KR20090131309A - Svr1 gene controlling cell size of cyanobactria, and method for controlling cell size of cyanobactria using the svr1 gene - Google Patents

Abstract

PURPOSE: An svr1(synechocystis 4-vinyl reductase 1) is provided to control cell size of cyanobacteria and research cell size regulation of other bacteria. CONSTITUTION: An svr1(synechocystis 4-vinyl reductase 1) regulates cell size of Synechocystis sp. The svr1 gene comprises a sequence of sequence numbr 1. A host cells are transformed using a recombinant vector containing svr1 gene. The host cell is Synechocystis sp. PCC6803. The cell size of the Synechocystis sp. is regulated by expressing svr1 gene. When the svr1 gene is overexpressed, the cell size of Synechocystis sp. is reduced. When the expression of svr1 is suppressed, the cell size of Synechocystis sp. is increased.

Description

Svr1 gene controlling cell size of Cyanobactria, and method for controlling cell size of Cyanobactria using the svr1 gene}

The present invention relates to a bacterium, more specifically, a cell size regulation gene svr1 of Synechocystis sp.

Cell size is determined by growth and metabolic rate. The relationship between cell size growth and metabolic rate has been studied in animals, photosynthetic prokaryotic cells, and green algae. However, research on cell size regulators has recently begun, and some of the pathways that control cell size in nematodes ( C. elegans ), genes and yeasts, and the prokaryotic bacterium Bacillus subtilus are known. However, there is a report on the correlation of respiratory rate to the size of cells, such as bacteria and algae, the molecular genetic mechanism is not yet known.

The bacterium is the largest of the 11 true bacterial phyta. Among them, indigo green circular single cell Synechocystis sp. PCC 6803 is a representative species. Inside the Synechocystis cell, there is a member of a photosynthetic electron transport system that absorbs light and transmits electrons in a multi-layered thylakoid membrane, resulting in oxygen-producing photosynthesis, as in higher plants and algae. In contrast to light harvesting complexes consisting of chlorophyll a and b in higher plants, Synechocystis has a phycobilisome as an auxiliary pigment, capable of absorbing wavelengths of 500-650 nm. In addition, thylakoid membranes include NAD (P) H dehydrogenase (NDH), succinate dehydrogenase (SDH), cytochrome c553, and terminal oxidase, resulting in oxidative phosphorylation in thylakoid membranes. However, the regulation of activity between photosynthetic and respiratory electron transport systems in thylakoid membranes in the presence of light is not yet clear.

Synechocystis is able to grow under photosynthetic photoindependent nutrient growth conditions as well as light-dependent nutrient growth conditions in which glucose is added to the medium as a carbon source and cancer-based nutrient growth conditions in which glucose is added to cancer conditions. Do. Glucose from the outside is phosphorylated to produce pyruvate via glycolysis or the oxidative pentose phosphate pathway (OPPP), and pyruvate passes through the tricarboxylic acid (TCA) cycle. Nicotinamide adenine dinucleotide (NAD (P) H) and ATP to produce more steps. The NAD (P) H thus produced is used for oxygen-based respiratory electron transfer, which causes a proton gradient and paired with ATP synthase to produce ATP. .

In this way, they have photosynthetic mechanisms and can live depending on the carbon source from the outside, and have high transformation efficiency by homologous recombination to search for photosynthetic enzymes and mechanisms that are difficult to study in slow generation alternating plants. The advantage is that you can. In addition, the genome sequence analysis of Synechocystis was completed in 1996, making it easier to search for genes in the database ( http://www.kazusa.or.jp/cyanobase ). It is used in a variety of studies, including cell cycles and divisions, and certain biosynthetic materials such as poly hydroxybutyrate (PHB) and tocopherol (tocophenol).

Synechocystis can be grown using glucose given externally through glucose catabolism. After addition of 10 mM glucose to wild type cells cultured in photoindependent trophic growth conditions, chlorophyll a content was increased more than 5 times on day 2. Doubling time was also 22 hours in photoindependent nutrient growth, compared to 7 hours in photo-dependent nutrient growth. This is expected to be the result of the increased use of glucose, the energy source, to produce more energy and precursors. In addition, glucose produces NAD (P) H through OPPP, glycolysis, and TCA cycles, causing a difference in the content or ratio of intracellular NAD (P) H. Respiratory electron transfer initiated by NADPH can be measured in terms of oxygen consumption: when glucose is added, oxygen consumption increases more than three times, while photosynthesis decreases by about 10%. However, as with algae, no studies on the correlation between glucose-induced respiratory rate and cell growth rate have been reported.

The present invention has been made in accordance with the above-mentioned demands, and after identifying whether the respiratory rate increased by glucose treatment in the bacterium Synechocystis correlates with the cell size, it is intended to identify the cell size signaling pathway. First, 1,200 random Tn5 mutant strains were used to select mutant strains with cell size differences compared to wild species under photoindependent and photodependent nutrient growth conditions. Among them, the cell size increased by more than 30% compared to wild-type cells under photo-dependent nutrient growth conditions, but the slr0144 gene whose function was not known was selected to produce a mutant strain lacking this gene and a transgenic strain that overexpressed the cell size by glucose. In an attempt to shed light on its function.

At the same time, to investigate whether cAMP, which is involved in cell size regulation in yeast and nematodes, is also involved in Synechocystis cell size regulation, a double mutant strain lacking the enzyme cya1 gene and the cya2 gene involved in cGMP production was constructed. This study attempted to elucidate the role of cAMP or cGMP in cell size regulation.

In order to solve the above problems, the present invention provides a svr1 (Synechocystis 4-vinyl reductase 1) gene that regulates the cell size of the bacteria Synechocystis sp.

The present invention also provides a recombinant vector comprising the svr1 gene.

The present invention also provides a host cell transformed with the recombinant vector.

In another aspect, the present invention provides a method for controlling the cell size of S. aureus cynecossis by controlling the expression of svr1 (Synechocystis 4-vinyl reductase 1) gene in S. aureus cynecossis sp.

The present invention also provides a Synechocystis sp. PCC6803 mutant strain in which the svr1 gene is deleted.

By using the svr1 gene or cya1 and cya2 genes of the present invention, the cell size of the bacterium Synechocystis sp. In addition, the present invention may be useful for cell size control studies of other bacteria.

In order to achieve the object of the present invention, the present invention, Synechocystis sp., More specifically svr1 (Synechocystis 4-vinyl reductase 1) that regulates the cell size of Synechocystis sp. PCC6803 Provide the gene.

svr1 (Synechocystis 4-vinyl reductase 1) gene is a novel gene, it may be composed of the nucleotide sequence of SEQ ID NO: 1. In addition, variants of such genes are included within the scope of the present invention. A variant is a nucleotide sequence that changes in base sequence but has similar functional properties to that of SEQ ID NO: 1. Specifically, the gene comprises a nucleotide sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 1 can do.

The "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).

The present invention also provides a recombinant vector comprising the svr1 gene.

The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter (for example, a pLλ promoter, a trp promoter, a lac promoter, a T7 promoter, a tac promoter, etc.) capable of promoting transcription, It is common to include ribosomal binding sites and transcription / detox termination sequences for initiation of translation. When E. coli is used as the host cell, a promoter and an operator site of the E. coli tryptophan biosynthetic pathway, and a phage λ left promoter (pLλ promoter) can be used as regulatory sites.

On the other hand, vectors that can be used in the present invention are plasmids (eg, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19, etc.) which are often used in the art, phage (e.g. λgt4.λB , λ-Charon, λΔz1 and M13, etc.) or viruses (eg SV40, etc.).

On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is a host, a promoter derived from the mammalian cell genome (for example, metallothionine promoter) or a promoter derived from a mammalian virus (for example, adeno) Late viral promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

Vectors of the present invention may include antibiotic resistance genes commonly used in the art as optional markers, for example ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin And resistance genes for tetracycline.

The present invention also provides a host cell transformed with the recombinant vector of the present invention. Host cells capable of stably and continuously cloning and expressing the vectors of the present invention may use any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. strains of the genus Bacillus, such as coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcensons, and various Pseudomonas species. Enterobacteria and strains. The host cell is preferably Synechocystis sp., More preferably Synechocystis sp. PCC6803.

In addition, when transforming the vector of the present invention into eukaryotic cells, yeast (Saccharomyce cerevisiae), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293) as host cells , HepG2, 3T3, RIN and MDCK cell lines) and plant cells and the like can be used.

The method of carrying the vector of the present invention into a host cell is performed by the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973), when the host cell is a prokaryotic cell). ), Hanahan method (Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)) and electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16: 6127-6145 (1988)) and the like. In addition, when the host cell is a eukaryotic cell, fine injection method (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52: 456 (1973)), Electroporation (Neumann, E. et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), and gene balm (Yang et al., Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)) Vector may be injected into the host cell.

The present invention also provides a method for regulating the cell size of Bacillus cynecossis comprising controlling the expression of svr1 (Synechocystis 4-vinyl reductase 1) gene in Synechocystis sp.

In the method of the present invention, the bacterium bacteriocineticis is preferably bacteriobacteriacene synthesis PCC6803. Synechocystis sp. May overexpress the svr1 gene to reduce the cell size of the bacterium cynecossis. As can be seen in the Example, the svr1 overexpressing strain Ox Svr1 strain can be seen that the cell size is reduced than the wild type.

In addition, by inhibiting the expression of the svr1 gene in Synechocystis sp. Can increase the cell size of the bacteria. As can be seen in the example, the svr1 mutant svr1 ^- strain can be seen that the cell size increased than the wild type.

In the method of the present invention, the cell size of Bacillus cynecossis can be regulated through respiration by glucose metabolism. L-glucose and 3-O-methylglucose glucose analogs were used as the carbon source, indicating no increase in cell size. In addition, as a result of investigating the association between respiration and cell size using 6-aminonicotinamide, KCN, and HgCl ₂ as electron transfer inhibitors, no increase in cell size was observed. This means that an increase in cell size is determined.

In the method of the present invention, the svr1 gene is characterized by inhibiting respiration of S. aureus cynecossis. The svr1 gene inhibits respiration by inhibiting electron inflow into the PQ pool.

The Svr1 protein encoded by the svr1 gene inhibits respiration by inhibiting the enzymatic activity of NADPH thioredoxin reductase (NTR) protein, and the N-terminal region not containing the 4VR (4-vinyl reductase) domain of the Svr1 protein has To combine. The cell size of Bacillus cynecossis is characterized by being regulated at post-translational levels.

The present invention also provides a Synechocystis sp. PCC6803 mutant strain in which the svr1 gene is deleted.

Hereinafter, the present invention will be described in more detail with reference to Examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

Example

Materials and methods

Strain Culture Conditions

Bacillus Synechocystis sp. (Pre-sale reception from SMCC) wild species, 3,500 species of a transposon (Tn5) mutants of PCC 6803 (Synechocystis), svr1 yujeonga deletion of svr1 (slr0144) mutants (svr1 ^-), svr gwabyeol current transformant (OxSvr), cya1 ^- / 2 ^was used for the double mutants in the experiment materials of the present invention. In order to analyze their cell size changes and their effects, each strain was treated with inorganic medium BG containing 5 mM pH buffer N-tris (hydroxymethyl) methyl-2-aminoethane-sulfonic acid (TES) -NaOH (pH 8.0). -11 (Rippka et al., 1979, J. Gen. Microbiol. 111: 1-61) contained 1.5% (w / v) bacto agar and 0.3% (w / v) sodium thiosulfate. Cultured in the added solid medium. svr1 -, OxSvr, cya1 - / 2- and Tn 5 mutation to maintain attention on the solid medium 20 ㎍ml ^-1 spectinomycin (svr1 -, cya1- / 2-) and 30 ㎍ml ^-1 chloramphenicol (cya1 ^- / 2 ^-), it was added to the antibiotic kanamycin 20 ㎍ml ^-1 (OxSvr, Tn5). Strains maintained in a solid medium were cultured in a low temperature incubator (Hanback, Korea) where light of 28 ° C., humidity 60%, and 10-30 μmol photons m ⁻² s ⁻¹ was maintained. Wild species and mutants in the exponential growth phase (A ₇₅₀ = ~ 0.6) were tested for cell sizing, photo-dependent growth conditions with 10 mM glucose, and 10-M glucose supplemented but light-blocked nutrients. State cells were used. 0.5 μM HgCl ₂ , which inhibits electron inflow from NDH to PQ as an electron transfer inhibitor, 1 mM 6-aminonicotinamide (6AN), a terminal oxidase that inhibits NADPH production by inhibiting glucose 6-p dehydrogenase, the first step in the catabolism of glucose 50 μM KCN was used to inhibit electron transfer to oxygen at. In addition, the concentration of glucose and glucose analogs (L-glucose, LGlc; 3-O-methylglucose, OMG) sugar was used as the final 10 mM.

DNA extraction

Cells were harvested by centrifugation (3,000 × g, 15 min, 4 ° C.). The harvested cells were suspended in 200 μl TEN buffer (10 mM Tris-Cl, 150 mM NaCl, 100 mM EDTA), and then 10 μl lysozyme (20 mg / ml) was added for 15 minutes at 37 ° C. to destroy the cells. After shaking, 5 μl of 10% SDS was added thereto. 5 μl protease K (20 mg / ml) was added to the reaction material and reacted at 60 ° C. for 1 hour. After the reaction, 400 μl phenol was added, followed by centrifugation (3,500 rpm, 3 minutes, room temperature) to transfer the supernatant to a new tube. Phenol: chloroform: isoamyl alcohol in the same amount as the supernatant was added and shaken at room temperature for 3-5 minutes. After centrifugation again (3,500 rpm, 3 minutes, room temperature), the obtained supernatant was mixed with 20 μl 3M sodium acetate (pH5.2) and 400 μl ethanol, followed by centrifugation (3,500 rpm, 3 minutes, room temperature). Only got.

Inverse PCR

In order to know the nucleotide sequence of the site where the transposon was inserted, a reverse polymerase reaction was performed by modifying the method performed in Escherichia coli (Ochman et al ., 1988, Genetics, 120, 621-623). Synechocystis DNA was cut completely using restriction enzyme Taq I (5 units / ug DNA). The cut DNA was self-bonded with T4 DNA ligase (Promega, USA) enzyme, and then used as a template primer (template primer 5'- GCACGATGAAGAGCAGAAGT-3 '(SEQ ID NO: 2), reverse template primer 5'-GGATAAATCCCGCGGATGG- The polymerase reaction was carried out using 3 ′ (SEQ ID NO: 3) (30 seconds at 95 ° C., 30 seconds at 58 ° C., 2 min condition cycles at 72 ° C., 36 times repeated). PCR reactions were isolated from 1.0% agarose gel using a QIA quick gel extraction kit (Qiagen, Germany) and then sequenced (PE Applied Biosystems). The obtained sequences were compared and analyzed using PSI-blast and ClustalW program.

Synechocystis Mutants and transformants

The chromosomal DNA used as a template for the production of mutant strains of Synechocystis was porter method (Porter R. (1988) Methods. Enzymol. 167, 703-712). A two-step fusion PCR method (Guo et al. (2000) Proc. Natl. Acad. Sci. USA 97, 12158-12163) was used to construct mutants lacking the svr1 gene. The upper and lower gene regions of the slr0144 gene were respectively identified as primers (UF, 5'-AGGGTTGTGACTGGTTGAGAGATT-3 '(SEQ ID NO: 4); UR + 271, 5'- GGCGAGCATCGTTTGTTCGCCCAGATCAGTTTGGCTTGGCAGGTAA-3' (SEQ ID NO: 5) and DF + 271, PCR was performed using 5'-TAATGTCTAACAATTCGTTCAAGCGCCACCAAACTCGTCAAAGG-3 '(SEQ ID NO: 6); DR, 5'-CAATCAATGCCCCGACAAAA-3' (SEQ ID NO: 7)). At this time, the UR +271 and DF + 271 primers contain the antibiotic spectinomycin (SP) base sequence of the pBSL271 vector. PCR was performed by putting together the PCR reaction product and the antibiotic reaction product obtained by using the pBSL271 vector as a template. At this time, the primers used were UF and DR. All PCR reactions used Pfx Taq polymerase (Invitrogen. CA. USA). The 3.2 kb mutant cassette thus obtained was cloned into pCR-blunt TOPO vector (Invitrogen, CA, USA).

For genes cya1 and cya2 encoding adenylate cyclase and guanylyl cyclase, Synechocystis chromosomal DNA was used as a template, and R1991S, 5'-GGGGTACCCCGGGATTTGTTGGGGTTT-3 '(SEQ ID NO: 8) and R1991AS, 5'-GGGGTACCCCTTTATCGGCAATGA sequence number 9); PCR was performed using L0646S, 5'-GGGGTACCCGGGGTATTTGGATTGCGAA-3 '(SEQ ID NO: 10) and L0646AS, 5'-GGGGTACCCCCCTTTAGCGGAGATTTGC-3' (SEQ ID NO: 11) primers. PCR reactions of 1.6 kb and 1.9 kb were cloned into pGEM-T easy vector (Promega, USA), and the cloned vector was cut with a restriction enzyme present only inside the gene to remove a portion of the gene and then screened for antibiotic resistance genes. (Spectinomycin and chloramphenicol) were inserted.

In order to overexpress the svr1 gene, it was made to be expressed by the promoter of the gene sigE overexpressed by glucose. At this time, the primers used were sigEF- AACTGCAGGATTTCAGCAGGAAACTAGGGTTA (SEQ ID NO: 12), sigER-GGGGTACCAGCCTGCCATTGGTCAACGGCAC (SEQ ID NO: 13). The vector used was pIGA (Kunert, 2000, J. Micorobiol. Methods., 41, 185-194) that could be inserted into the chromosome to which the kanamycin resistance gene was added.

The resulting vector was transformed into Synechocystis wild species based on the method of Porter (1988). Harvest 2 ml (3-5 μgChl a) of Synechocystis wild species in exponential growth period and resuspend with 200 μl of liquid BG-11 medium and mix the plasmid DNA with the antibiotic cassette inserted into the final 1 μgml ^−1. It was transformed by standing for 4-6 hours in -30 ℃ cow. Suspensions containing the transformed cells were mixed with BG-11 with 3 ml of 0.5% bacto agar cooled to 40 ° C. or lower (-Glc) BG-11 solids with or without 10 mM glucose (+ Glc). It was placed on the medium and incubated in a cold incubator for strain maintenance. After 36 hours (+ Glc) or 48 hours (-Glc) incubation, the antibiotics are plated to give an antibiotic concentration gradient below the solid medium to a final concentration of 5 μg ml ⁻¹ until antibiotic resistant colonies emerge. Incubated weekly. Each transformant undergoes a segregation process that results in at least eight single colonies in the antibiotic-added medium, followed by PCR and reverse transcriptase-PCR (RT-PCR) at the gene and transcript levels. It was confirmed that there was no wild species trait gene on the genome (FIG. 1).

RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)

RNA extraction of Synechocystis was performed by modifying the method using Mohamed and Jasson's hot phenol (Mohamed and Jasson, 1989, Plant Mol. Biol. 13, 693-700). For RNA extraction, 20-40 ml of culture containing Synechocystis cells at A ₇₅₀ = approximately 0.4-0.6 Cells were harvested by centrifugation (3,000 × g, 15 min, 4 ° C.). Harvested cells were fully re-dissolved in chilled (4 ° C.) 400 μl of STE buffer (1 M Tris-Cl, pH 8.0, 0.5 M NaCl, 20% SDS) and 500 μl of acid phenol preheated at 65 ° C. (pH4.3) was added and mixed, followed by incubation at 65 ° C for 15 minutes. Shake vigorously every 3 minutes and mix thoroughly with phenol and supernatant again. The treated sample was centrifuged (12,000 × g, 15 min, 4 ° C.), the supernatant was mixed with 500 μl of trizol, and allowed to stand at room temperature for 10 minutes. Then, 200 μl of chloroform was added, mixed thoroughly with vortex, and centrifuged again. 10,000 × g, 15 minutes, 4 ° C.). The aqueous supernatant was transferred to a new tube, and 0.4 volume of isopropanol and high salt (0.8 M Sodium citrate, 1.2 M NaCl) were added to the supernatant and allowed to stand at room temperature for 10 minutes to precipitate nucleic acid. Centrifuge the tube with precipitated nucleic acid (12,000 × g, 15 min, 4 ° C.) to obtain a precipitate, wash with 0.8 ml of 75% (v / v) aqueous ethanol and centrifuge again to dry the precipitate at room temperature. I was. 0.1% (v / v) diethyl pyrocarbonate (DEPC) treated sterile distilled water was dissolved in the dried precipitate. DNase I (TaKaRa, Japan) and 0.5 μg ribonuclase inhibitor (TaKaRa, Japan) were treated for 30 minutes at 37 ° C to remove DNA that could remain in the extracted RNA samples. For purification, the same volume of phenol: chloroform (1: 1) was added and thoroughly mixed for at least 15 seconds and centrifuged (12,000 × g, 5 minutes, room temperature) to give a supernatant, and the same volume of chloroform as the supernatant was mixed and centrifuged. Isolate to remove residual phenol. The supernatant obtained by centrifugation was again mixed with ethanol, 3 M sodium acetate, pH5.3 solution at 2.5: 0.1 (v: v), and left at -70 ° C. for at least 30 minutes to precipitate RNA. After centrifugation (12,000 × g, 15 min, 4 ° C.) to obtain a purified precipitate, which was washed with 70% (v / v) ethanol, dried and 20-50 μl of 0.1% DEPC treated. It was dissolved in sterile distilled water to obtain RNA.

RT-PCR for the analysis of expressed mRNA levels used cDNA and specific primers. cDNA synthesis was performed using a Reverse Transcription system (Promega, USA). 1 μg of the extracted total RNA was reverse transcribed at 42 ° C. for 1 hour with reverse transcriptase along with a random primer synthesized with 6 dNTPs as a template. A total of 20 μl of the reaction solution was treated with boiling water for 5 minutes to inactivate the enzyme, and then diluted with 100 μl of neclease-free water. 5 μl was taken as a template and PCR was performed by adding a 15 pmole gene primer to Taq-polymerase Mixture (Bioneer, Korea). PCR reaction was performed using MJ Research Minicycler (German). PCR reactions were isolated from 1.4% agarose gel and identified by GELDOC2000 densitometer and computer-aided image analysis system (Bio-Rad Lab., Hercules, California. USA).

DNA content

Incubated for 30 minutes with lysozyme (3 ㎍ / ml) in the cell suspension, and washed twice with phosphate-buffered saline (0.85% NaCl, 10mM Na ₂ HPO ₄ , pH 7.2). After fixing for 1 hour at 4 ° C using 4% paraformaldehyde, washed twice with phosphate-buffered saline again. DAPI (4'-6-diamnidino-2- phenylindole, 2 ㎍ml ^-1 ) was added for 10 minutes, and then the amount of DNA was measured using FLAC channel (BD Biosciences) of FACSCalibur. Analysis was performed using Win MDI version 2.8 program (Scripps Research Institute, La Jolla, Calif.).

Microstructure Analysis Using Transmission Electron Microscopy

For negative staining, Synechocystis wild species and various mutants were stained with 0.1% phosphotungstic acid for 1 minute and then washed with 0.02% phosphotungstic acid. The stained cells were observed using a Carl Zeiss EM912-omega microscope (Carl Zeiss, Thornwood, NY, USA). To prepare ultra-density sections, cells were fixed in neutral 0.1M phosphate buffer with 2.5% paraformaldehyde and 2.5% glutaraldehyde for 2 hours. The tissues were fixed in 1% (w / v) osmic acid dissolved in phosphate-buffered saline for 1 hour. After dehydration with ethanol, it was placed in a low viscosity spurr (Pelco International, CA, USA). Ultra-density sections were made, placed on a nickel grid and stained twice with uranyl acetate. Thus prepared sections were observed with Zeiss LIBRA120 TEM (Carl Zeiss, Germany).

Cell size measurement using scanning microscope (SEM)

After culturing wild species cells, svr deletion mutants, overexpressing mutants, and cya1 and cya2 double mutants, which were cultured in photo-trophic growth, were suspended in sterile water, and the appropriate amount of cells were dried at room temperature for 12 hours. 7 minutes was placed on the IB-3 machine for gold particle coating (IB-3, Japan) and observed under a scanning microscope (HITACHI S-800, Japan).

Protein quantification using antigen antibody reaction (Immunoblot analysis)

To confirm the expression of a particular protein,Synechocystis Wild species and proteins of various mutant strains were isolated. After moving the isolated protein to PVDF membrane, various antibodies PilA1 (Kim) were added to TBS buffer containing 5% (w / v) nonfat dried milk.et al, 2004, Biochem. Biophys. Res. Comm. 315, 179-186), FtsZ (Jeonget al, 2002), psaA / B (Agrisera, Sweden), D1 (Agrisera, Sweden), D2 (Agrisera, Sweden) were attached for 1 hour. In this case, the concentrations of the antibodies were 1: 1000, 1: 5000, 1: 10000, and 1: 500, respectively. After washing three times with TBST buffer, goat anti-rabbit secondary antibody conjugated with horseradish peroxidase (Sigma, Mo, USA) was bound at a ratio of 1: 10,000 for 1 hour. After washing three times with TBST buffer again, bound antibody was detected using ECL (Amersham Biosciences, NJ, USA).

Measurement of chlorophyll content and fluorescence, NADPH fluorescence, P700 absorbance, cytoplasmic pH, reduction of plasmaquinone and rate of oxygen exchange

Cell density and chlorophyll a content in Synechocystis were measured using a UV-VIS spectrometer (Shimadzu UV mini 1240, Japan). Chlorophyll a content was calculated according to the following calculation method (Myers et al ., 1980, Plant Physiol. 66, 1144-1149).

Chl a (μg ml ^-1 ) = [1.0162 (A ₇₅₀ -A ₆₇₈ ) -0.063 (A ₇₅₀ -A ₆₂₅ )] × 893/68

The chlorophyll a fluorescence induced by photosystem 2 and the redox levels of intracellular NADPH fluorescence, acridine yellow fluorescence, and platoquinone in Synechocystis were measured by emitter-detector-cuvette assembly unit ED-101US / D, PAM Data Acquisition System (PDA). 2 ml of live cells were measured in quartz cuvettes using a pulse amplitude modulated fluorescence measuring system (Xe-PAM, Heinz Walz, GmbH, Effeltrich, Germany) equipped with a thermostat (-100) and a temperature controller (unit US-T). .

Chlorophyll a fluorescence was measured using BG39 and 10% filters on the emitter, R65, RG9 and 25% filters on the detector, and NADPH fluorescence using the UV pass UG11 filter and cyan specific wavelength KV418 + BG18 filter, respectively. Measured. For chlorophyll a fluorescence and NADPH fluorescence measurements, actinic light was a halogen lamp with a wavelength removed above 695 nm, and gave 400 or 40 μmol photons m ^-2 s ^-1 , respectively. The total chlorophyll fluorescence measurement used for a content was respectively 1.5 ㎍ml ^-1 and 20 ㎍ml ^-1.

Absorbance changes of Pyne-system 1 reaction center P700 of Synechocystis were measured using a PAM-101 modulated fluorometer with dual-wavelength emitter-detector uint EDP700DW. The oxidized ratio of P700 in the dark state (P700 +) was calculated as the increase in absorbance at the 810-830 nm wavelength caused by near infrared light (> 715 nm).

Oxygen exchange rates in Synechocystis were measured using an electrode control unit (Oxygraph system, Hansatech) using a liquid phase O ₂ electrode unit (DW3) and a white light source (LS2, 100W halogen photo optic lamp, Osram xenophot HLX) as a light source. It was measured at room temperature using. 12 ml of exponential growth cells with a chlorophyll a content of 1-2 μg ml ⁻¹ were used. Oxygen consumption corresponding to respiration was calculated by the incidence of oxygen evolution measured for 5 minutes in the dark and for 4 minutes at 50 μmol photon m ^-2 s ^-1 luminosity. 50 mM sodium bicarbonate (Na ₂ HCO ₃ -Na ₂ CO ₃ , pH8.0) was added before measurement for sufficient CO ₂ supply.

Acridine yellow (AY) is best known as a cytoplasmic pH sensor energized by Synechocystis . AY fluorescence uses an ultraviolet wavelength filter UG11 with a BG18 filter that removes ultraviolet A in order to reduce the background signal to the emitter, and Xe-PAM (Balz, Effeltrich, Germany) equipped with a BG18 + KV418 filter that transmits blue-green wavelengths to the detector. ) Was measured. The fluorescence of AY was harvested for cells corresponding to a chlorophyll content of 60 μg, resuspended in 2 ml of BG-11 medium without pH buffer, and adapted at 30 ° C. for 30 minutes with AY at a final concentration of 5 μM, It was measured by inducing an increase in the pH of the cytoplasm with 10 mM glucose or a luminosity of 40 μmol photon m ^-2 s ^-1 .

The reducing power of Plastoquinone (PQ) was modified by Cooley et al. (Cooley, JW, and Vermaas. WJF (2000) J. Bacteriology 183, 4251-4258) using cancer-adapted cells using Xe-PAM. It was. In order to measure the fluorescence induced by low light, 1 mM KCN, 60 μM DBMIB, 5 mM sodium ascorbate was added 3 minutes after low light irradiation to prevent electrons from escaping the PQ. Low light was given a pulse of 10 seconds intervals for 10 minutes. The obtained data was divided by the initial value F0 to measure the degree of accumulation of electrons in PQ.

77K Chlorophyll Fluorescence Emission Spectrum

To examine 77K chlorophyll fluorescence emission spectra, Synechocystis wild species and various mutants grown in solid medium were harvested and then adapted for 15 minutes in cancer. Cancer-adapted cells were measured using a Jobin Yvon FluoroMax-2-spectrofluorometer (ISA Jobin Yvon Instruments SA).

Enzyme Activity Measurement

Enzyme activity was measured using a quantity of cells containing a chlorophyll content of about 100 μg ml ⁻¹ of exponential growth. 0.9 ml of buffer (50 mM Tris-HCl, pH 7.8, 10% (v / v) glycerol) pre-chilled at 4 ° C for cells harvested by centrifugation (3,200 x g, 4 ° C, 5 minutes) The solution was again transferred to a tube containing zirconia / silica beads (100 μm in diameter) soaked with the same buffer. The tube was shaken six times for 30 seconds with a bead beater to destroy the cells. At this time, it was placed on ice for 1 minute between repetitions to remove heat generated by friction. Completely broken cells were separated from the beads by centrifugation (12,000g, 10 minutes, 4 ℃). The supernatant was transferred to a new tube and quantified and 50 ng of protein was used for the reaction. The following compositions were used for the determination of the respective enzyme activities in reaction buffer (50 mM HEPES-KOH, pH 8.0, 1 mM DTT, 10 mM MgCl ₂ ). glucose-s-phosphate dehydrogenase (6PGD); 0.4 mM NADP ⁺ , 5 mM 6-P-gluconate, phosphoglucose isomerase (PGI); 1.7 mM NAD ⁺ , 2 mM F6P, 5 units ml ^-1 G6PD, phosphoenol pyruvate carboxylase (PEPC); 0.15 mM NADH, 10 mM KHCO ₃ , 4 mM PEP, 10 units ml ⁻¹ malate dehydrogenase, and pyruvate dehydrogenase complex (PDC); 2.6 mM cysteine, 2.5 mM NAD ⁺ , 2 mM thiamine pyrophosphate, 1 mM MgCl ₂ , 0.13 mM CoASH, 2 mM sodium pyruvate, 50 mM KH ₂ PO ₄ (pH 7.4). The supernatant separated from these reaction mixtures was mixed and reacted in the dark at 37 ° C. for 30 minutes. Enzyme activity was calculated using the molar extinction coefficiency of NADPH at 340 nm.

Z (mol / s, kat) = c × v / Δt

C (mmol / l) = ΔA / ε × d, (ε = 0.63 ℓ (mmol) ^-1 (mm) ^-1 )

v = volume of the assay in ℓ

t = time (sec)

A = absorbance

d = length of cuvette

NTR activity was determined by thioredoxin reductase assay kit (Cyaman, USA) using NADPH to reduce 5,5-dithiobis- (2-nitrobenzoic acid) (DTNB) to 5-thio-2-dinitrobenzoic acid (TNB). It measured using.

To overexpress the svr1 gene in Escherichia coli, it was cloned into pGEX4T-1 vector to which glutathione S-transferase (GST) gene induced by isoprophyl-β-D-thiogalactopyranoside (IPTG) was added. Synechocystis chromosomal DNA primers BamH I and Xho I enzymes attached to svr1 gene in (svrFB; 5 'CGCGGATCCATGGGTTACCTGCCAAGCCAAAC-3 ' ( SEQ ID NO: 14) and svrRX; 5 'CCGCTCGAGTCATTTCAGGTATTCCCCTTTGAC-3' ( SEQ ID NO: 15)) cloned by PCR using It was. E. coli transformed the overexpression vector into which the svr1 gene was inserted and overexpressed the gene for 3 hours by adding 0.2 mM IPTG. Overexpressed cells were harvested by centrifugation (3,500 rpm, 10 minutes, 4 ° C.) and then in 800 ul lysis buffer (50 mM Tris-HCl, pH 7.8, 20 mM dithiothreitol, 10% glycerol, and protease inhibitors cocktail). Suspended. The suspension was lysed at 4 ° C. using ultrasound to obtain overexpressed Svr1 protein.

Protein Selection and Protein Interaction Using Yeast Two Hybrid

To select a protein that interacts with the Svr1 protein, the svr1 gene was cloned into the pGBKT7 vector, followed by Sacharomyces cerevisiae AH109 ( MATa, trp1-901, leu2-3, gal4Δ, gal80Δ, LYS2 :: GAL1 _UAS -GAL1 ^TATA -HIS3). , plasma was switched on _{GAL2 UAS -GAL2 TATA -ADE2, ura3 ::} MEL1 UAS -MEL1 TATA -lacZ). Transformants with Svr1 inserted were maintained in medium lacking tryptophan (Clontech, USA). To screen for interacting proteins, chromosomal DNA pools of Synechocystis wild species were cloned into pGAD424 to make a library. The library production method is as follows. Synechocystis chromosome DNA was fragmented using restriction enzyme Sau3A I, and then DNA fragments of 400 to 1,100 bp and 1,000 to 3,000 bp were separated from 0.8% agarose gel and pGAD424, pGAD424 (+1) and pGAD424, respectively. (+2) cloned into vector and then transformed into E. coli respectively. The restriction enzyme Tsp509I was also treated in the same manner to obtain 400-800 bp and 800-2,000 bp sequence fragments, which were cloned into pGAD424, pGAD424 (+1) and pGAD424 (+2) vectors, and transformed into E. coli, respectively. . The library thus obtained was grown in Escherichia coli and plasmid DNA was obtained using a Qiagen maxi-prep kit. 500 ug of the obtained library plasmid DNA was transformed into AH109 yeast transformed with svr1. Transformation method was performed according to the Clonthech instructions by Lithium acetate (LiAc) method. Transformed cells were incubated for 6 days at 30 ° C. in minimal selection medium. The expression of the lacZ reporter gene was confirmed to select proteins that bind to each other. In a medium made by adding the X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) substrate to a minimal selection medium, a gene whose protein was cloned interacting with svr1 was identified. It was selected because it has a strain. To quantify β-Galactosidase activity, see Schneider et al ., (1996) method and Clonthech manual. In order to confirm the degree of interaction of the interacting protein, the growth of the strain was confirmed in the medium prepared by adding various concentrations of 3AT (3-amino-1,2,4-triazole) that compete with histidine.

The plasmid DNA of the selected yeast strains was extracted to confirm the gene inserted into the library.

Each gene was cloned into pGADT7 and pBAKT7 vectors to confirm the mutual binding of the proteins produced by the svr gene, the ntr gene, and the ferredoxin thioreductase (ftr) gene. At this time, the svr gene divides the front part (N term) and the back part (C term) from the 4VR domain, and the ftr gene is a gene encoding the catalytic domain (sll0554) and a gene encoding the variable domain (ssr0330) . Each was cloned. Synechocystis wild species cells contain three types of m-type TrxA ( slr0642 ), x-type TrxB ( slr1139 ), and γ-type TrxQ ( slr0233 ) thioredoxin. Each of these genes was also cloned. Through various combinations, the degree of protein mutual binding of each gene was confirmed.

Example 1: Cell size and respiration in Svr1 and cya1 / cya2 mutants, Svr1 overexpression

1.1 Selection of svr1 Gene Related to Cell Size Regulation from Random Mutant Population

Synechocystis can be grown on glucose from external sources through catabolism. To identify genes that regulate cell size through glucose use, 1,200 random Tn5 mutants were observed for cell size using an optical microscope, and the cell size was quantified using the BMI plus program. 37 random Tn mutant strains with increased or decreased cell size of more than 30% compared to wild-type nutrient growth conditions with 10 mM glucose supplementation and 23 species under light independent nutrient growth conditions with growth without glucose Of Tn mutants were selected. In the selected strains, the nucleotide sequence of the gene into which Tn 5 was inserted was confirmed by inverse PCR. A total of 60 genes were classified based on the categories provided by CyanoBase (http://bacterai.kazusa.or.jp/cyano/Synechocystis/cgibin/category_cyano.cgi). Strains selected under photoindependent nutrient growth conditions were classified into five categories, and strains selected under photo-dependent nutrient growth conditions were classified into genes corresponding to six categories. The selection of the mutS gene, which encodes a DNA mismatch repair protein that is expected to be involved in cell size regulation, and a gene encoding a protein that inhibits glucose under photo-dependent nutrient growth conditions, is reliable. These results suggest that the genes involved in Synechocystis cell size regulation in photoindependent or photodependent nutrient growth conditions.

Among the selected Tn mutant strains, the slr0144 gene encodes a protein containing a 4-vinyl reductase (VR) domain (see IPR004096), which is a type of small molecule binding domain (SMBD). Since SMBD is involved in metabolism, membrane transport and signaling pathways, it is assumed that SMBD may be closely related to cell size. Synechocystis has been named Svr1 (Synechocystis 4-VR 1) to separate these to present additional Slr0147 with VR domain in addition Slr0144, the function of the svr gene using a fusion PCR method to find deletion of mutants and Overexpressing transformants were made using the sigE promoter overexpressed by glucose (FIG. 1).

1.2 svr1 ^- ,  cya1 ^- /2 ^-  Cell size of mutant and overexpressed transformants

Based on the increase in cell size when Tn was inserted into Svr1, we investigated the function of this gene in cell size control based on svr1 deletion mutants. In addition, cA (G) MP is known to be involved in the control of the cell size of yeast and nematodes. In addition, the bacterium Anabaena sp. In strain PCC 7120, mutation of the adenyly cyclase gene, a cAMP-producing enzyme, causes cell size changes. Synechocystis also has a cya1 gene encoding adenylyl cylase and a cya2 gene encoding guanylyl cylase. Thus, a mutant strain in which both genes were deleted was used to determine whether these two genes are involved in the cell size (FIG. 1).

In photo-trophic growth conditions with 10 mM glucose added to BG11 solid medium, the size of svr1 ^- cells was significantly increased compared to wild-type cells as in Tn mutants (FIG. 2A), which was also reconfirmed via scanning microscopy (SEM). (FIG. 2B). Wild type cells and svr1 ^- with the exception of the cell division that is 5,000 out of cells and measure the diameter size of the wild type cells is 3.41 ± 0.01 μm, whereas, svr1 ^- Cell size was 4.31 ± 0.01 μm, an increase of 43%. On the other hand, the cell size of the transgenic strain OxSvr1 overexpressed Svr1 was 1.67 ± 0.01 μm, which was 30% smaller than that of wild-type cells. The generation of cA (G) MP inhibition cya1 ^- / 2 ^- the double mutants, despite the presence of glucose compared to the wild type, and does not increase the cell size. This significant difference in cell size was not seen in photoindependent nutrient growth conditions, but only in photodependent nutrient growth conditions. This means that the cell size increases when Synechocystis changes from photoindependent nutrient growth to photo-dependent nutrient growth, indicating that svr1 , cya1 or cya2 are involved in this process.

1.3 Increasing Glucose Specific Cell Size

L-glucose (L-Glu) and 3- O- methylglucose (OMG) glucose analogs were used to investigate whether the increase in Synechocystis cell size by glucose was an effect of glucose osmotic pressure or metabolic activity. L-Glu, an isomer of glucose, is not transported into cells, and OMG is transported into cells but is not phosphorylated by hexokinase and thus is not used in cells. As shown in Table 1, cell size increase was observed only by glucose. In addition, gtr ^- mutants lacking a transporter that transports glucose into cells and glucose can be transported, but glk ^- mutants that cannot use glucose due to the deletion of glucokinase are photoindependent and photo-dependent. It was measured (Table 1). Glucose increase in cell size was not seen in both mutants, suggesting that the increase in cell size requires the process of glucose metabolism by respiration.

Table 1.Effect of glucose and its analogs on cell size

In the svr1 ^- mutant and OxSvr1 strains, the cell size increase and decrease by glucose were not reproduced by LGlu or 3-OMG. These results indicate that cell size increase by Svr1 is specific for glucose. On the other hand, cA (G) cya1 MP is generated does not happen ^- / 2 ^- double mutant strain could not see the cells increase in size by the addition of glucose. At this time, the cells were grown in glucose-added medium in the cow to investigate whether light is involved in the increase of the cell size caused by glucose. As a result, the effects of Svr1 and cA (G) MP were independent of the presence or absence of light.

The above results indicate that cA (G) MP is involved in the increase of Synechocystis cell size caused by glucose, and Svr1 plays a role in determining the cell size limit.

1.4 Glucose-induced Cell Size Increase and Respiration Rate

Since glucose is phosphorylated by glucokinase Sll0593 and then metabolized by the oxidative pentose phosphate pathway, respiration, and the citric acid cycle, glucose-specific cell size increases that do not depend on light result in glucose metabolism. It is closely related to the increase in cell size. Respiratory metabolism of the algae in the jyeoteumeuro known to be proportional to the cell size wild type and svr1 ^- to measure the respiratory rate using a Clark type O2 electrode in strains ^-, OxSvr and cya1 ^- / 2. There was no significant difference in respiratory rate between wild and other strains under photoindependent nutrient growth conditions. However, the light heterotrophic growth conditions in the light autotrophic respiration rate is 329% in the wild type, svr1 compared to the growth conditions ^were a 674.5% increase in ^strain at 472% strain, 195.1% at OxSvr strain, and cya1 ^- / 2. This means that the increase in respiration caused by glucose is closely related to the increase in cell size. The respiratory rate between wild-cell cells and other strains was also significantly increased in comparison with the photo-dependent nutritional status in the cancer-dependent nutritional state (10 days culture), but the increase pattern between the strains was similar (FIG. 3).

Glucose enters the cell, phosphorylates glucose 6-p, and then enters the oxidative pentose phosphorylation pathway and is oxidized by glucose 6-P dehydrogenase. 6-aminonicotiamide (AN) inhibits this process. Electron transfer from respiratory end oxidase to oxygen and from NDH to PQ can be inhibited using KCN and HgCl ₂ . In order to support the above results, the association between respiration rate and cell size was investigated using the electron transfer inhibitors 6AN, KCN and HgCl ₂ . Thereof by an electron transfer inhibitors and wild svr1 as expected ^- strain, OxSvr transformed cell, cya1 ^- / 2 ^- could not see the cells increase in size caused by glucose in the strains (Table 2).

Table 2. Effects of Glucose-induced Cell Size Respiratory Electron Transfer Inhibitors

This result means that the increase in cell size is determined through intracellular respiration by glucose metabolism.

1.5 Reduction of Plastoquinone Pool

Increased respiration by glucose metabolism can be measured by changes in chlorophyll a fluorescence in the thylakoid membrane of Synechocystis . Therefore, when svr1 genes are determined by regulating respiration, the room temperature chlorophyll a fluorescence induction pattern of the svr1 gene is deleted or overexpressed. After a chlorophyll fluorescence induced in the Synechocystis cultured in the light autotrophic growth conditions give off the actinic light to the chlorophyll a fluorescence dropped to the initial fluorescence (Fo) level decreased after then increased again. Chlorophyll a fluorescence peak induced after the light irradiation is due to the NADPH generated by photosynthesis is oxidized by NDH and electrons are transferred to PQ, resulting in the inhibition of photochemical reaction in photosystem 2 by the PQ pool. . On the other hand, chlorophyll a fluorescence in the peak is not decreased but continuously maintained by the addition of glucose (FIG. 4). This means that NAD (P) H produced during glucose metabolism continuously supplies electrons to PQ pool. Chlorophyll fluorescence a of svr1 ^- strains and OxSvr cells cultured in photoindependent nutrient growth conditions were the same as those of wild type cells, but the maximum value of chlorophyll a fluorescence in svr1 ^- strains was higher due to glucose addition. OxSvr, on the other hand, shows a similar pattern to wild-type non-glucose-treated chlorophyll- a fluorescence, which does not remain high despite the addition of glucose. Differences in chlorophyll a fluorescence induction in these mutant strains and overexpressing strains indicate that Svr1 inhibits electron transfer to the PQ pool.

Reduction of PQ pool in thylakoid membranes by respiratory electron transfer can be measured by monitoring chlorophyll a fluorescence changes induced by intermittent irradiation of weak light beams where photosynthetic electron transfer does not occur. . Independent optical and optical heterotrophic a wild type cell and svr1 cultured in growth ^conditions after the harvest, OxSvr strains presented the chlorophyll a is 2 ㎍ was arm adaptation for 5 minutes. After the initial chlorophyll fluorescence value F0 was measured, the Fo fluorescence value was measured by turning on / off the light source at 10 second intervals after adding the electron transfer inhibitor DBMIB, KCN, ascorbate using a Hamilton syringe. The electron transfer to the electron transfer from the oxygen and terminal oxidase to cytb ₆ f in PQ pool inhibited the DBMIB with KCN. In wild species, the PQ pool was saturated after about 5 minutes, but in the svr1 ^- mutant strain, PQ pool reduction was initially similar to that of the wild species, but gradually increased slowly without being saturated. On the other hand, OxSvr1 showed a low PQ pool reduction as well as an initial reduction rate as well as a saturation value of 50% compared to wild species (FIG. 4). In cells grown under photoindependent nutrient conditions, PQ pool reduction was less than those grown under photodependent nutrient conditions. Significantly increased or decreased PQ pool reduction compared to wild species in mutant strains and overexpressed strains suggests that Svr1 regulates respiration by inhibiting electron influx into the PQ pool.

Example 2: Respiratory Inhibitory Pathway of Svr1

2.1 Expression of genes involved in respiration during glucose response

Investigated in strains ^- Svr1 the wild type expression of the gene and svr1 concerning the cell size increases in cellular respiration and oxidative phosphorylation in accordance with the above results discovered by would affect the subsequent growing season by glucose ^-, OxSvr, cya1 ^- / 2 It was. Pgi gene encoding phosphoglucose isomerase, ppc gene encoding PEP carboxylase, pyruvate dehydrogenase encryption pdh gene, tkt gene coding for trans Kane Tortola dehydratase (transketolase) of the oxidative pentose phosphate metabolism, tricarboxylic acid (TCA) iso-citrate dehydrogenase (isocitrate dehydrogenase) the coding gene icd, respiratory electron transfer circuit The ndb gene encoding NAD (P) H dehydrogenase, the cyd gene encoding cytochrome c oxidase, and the ATP-producing enzyme involved in chemical osmosis (ATP). The expression level of the atp gene encoding synhthase) was investigated. Glucose increased breathing svr1 or without ^- svr-overexpressing transgenic mutations weeks down the main switch, cya1 ^- / 2 ^- both double mutants showed the same gene expression levels and wild type cells (Fig. 5). These results are consistent with reports that respiration is regulated by post-translational control outside of the metastatic stage where nutritional status changes (Yang et al. (2002) Appl. Microbiol. Biotechnol. 58, 813-822). This suggests that regulation will also be regulated at the post-translational level.

2.2 Protein Selection to Interact with Svr Protein Using Yeast Two Hybrid

Because respiration is mainly regulated at post-translational level, yeast two hybrid (YTH) method was used to select target protein of Svr1 protein. In the yeast transformed with the svr1 gene cloned into the pGBKT7 vector, a plasmid cloned with the Synechocystis library was inserted into the pGADT7 vector. In the presence of a strain encoding a protein that interacts with the Svr1 protein, cells grown in minimal medium lacking His and Ade were selected using the reporter gene histidine and adenosine expression. Among them, lacZ gene expression was confirmed to confirm the degree of interaction with Svr1 protein. After culturing in a medium to which 80 mM X-gal was added, a strain was selected that interacts with Svr1 through color change to blue. In order to identify the genes in the selected strains, plasmids of yeast were isolated, transformed into E. coli, and cultured in ampicillin medium, which is an antibiotic selection gene of pGADT7 vector. A gene cloned into the pGADT7 vector was identified by sequencing the colony resistant to ampicillin and found that 10 proteins interacted with the Svr protein. Among these, NADPH thioredoxin reductase (NTR) binds to glucose metabolism-related enzymes to reduce thioredoxin (Trx), which regulates glucose metabolism. Therefore, the slr0600 gene encoding NTR was cloned into pGADT7 and pGBKT7 vectors to reconfirm the presence of Svr1 interaction. In addition, β-galactosidase analysis was performed to quantify the degree of cross-linking. As a result, it was confirmed that the two proteins Svr and Ntr bind.

The Svr protein was divided into N-terminus and C-terminus including 4VR domain based on 4VR domain to investigate which domain binds to homologous Ntr protein. As a result, the N-terminal region not containing 4VR domain was bound to the Ntr protein. The 4VR domain of Svr1 is not involved in chlorophyll a biosynthesis nor in the binding of Str target protein Ntr.

2.3 NADPH thioredoxin reductase (NTR) and ferredoxin thioredoxin reductase (FTR)

Thioredoxin from Synechocystis binds to a variety of membrane proteins as well as cytoplasmic proteins to regulate the cellular environment. Synechocystis regulates intracellular oxidation / reduction of Trx by the NADPH / Trx and Ferredoxin / Trx pathways. Svr1, which binds to Ntr, is expected to cross-link with Ftr, and the binding of the Svr1 protein to the variable and catalytic subunits of the FTR protein was investigated. As a result, Svr1 protein interacted with Ftr reversible monomer. Dimeric FTR enzymes composed of variable subunits (Ftrv) and catalytic subunits (Ftrc) are present only in photosynthetic bacteria. First, ferredoxin (Fdx) binds to the catalytic unit site of the FTR to transfer electrons, and then Trx binds through the heterodisulphid separation of the reversible unit site of the FTR to form a complete Fdx-FTR-Trx complex for oxidation / reduction. Adjust the signal path. The interaction between Svr1 and Ftrv means that Svr1 protein is activated when the reduced state of intracellular NAD (P) H is activated by respiration, and it is able to bind to the FTR reversible monomer site and regulate the function of Fdx-FTR-Trx complex. (FIG. 6).

2.4 Inhibition of Ntr Activity by Svr

YTH revealed that the Svr protein interacts with the Ntr protein, suggesting that Svr inhibits the enzyme activity of NTR. Thus, wild type cells and svr1 ^- Ntr the activity was measured in, OxSvr strain. Ntr activity can be determined by measuring the amount of NADPH changed by 5,5'-dithiobis (2-dinitrobenzoic acid) (DNTB). In the photoindependent nutrient growth conditions, all three strains showed no difference in NTR activity. However, in the light of heterotrophic growth conditions wild type and svr1 ^- were increased three times Ntr activity of the strain, 4.5 times (FIG. 7A). This means that the activity of NTR is increased by glucose, and Svr1 inhibits the increase of NTR activity. These results can also be seen in the result of significantly inhibiting the increase of Ntr activity by glucose in the transforming strain OxSvr overexpressed svr gene.

To further refine the results, the svr gene was over-expressed in E. coli using a pGEX4T vector with a glutathione S-transferase (GST) gene inserted and overexpressed by isopropyl β-D-thiogalactopyraniside (IPTG). After 3 hours of svr gene expression induction (FIG. 7B), the water-soluble protein was extracted from E. coli and added to the protein extracted from the svr1 ^- mutant strain to investigate the change in Ntr activity. As shown in FIG. 7C, when the concentration of the protein containing the overexpressed Svr1 protein was 42 μg, Ntr activity was 100% inhibited. This result is another evidence that the Svr protein inhibits the Ntr protein activity.

Example 3: cA (G) MP Affects Cell Size and Respiration

Intracellular cA (G) MP is a signaling agent as a secondary messenger well known in prokaryotic and eukaryotic cells. The cA (G) MP signaling pathway plays an important role in a variety of biological activities such as enzyme activity or gene expression regulation. In eukaryotic cells, cAMP-dependent protein kinase capable of binding cAMP is present, and in prokaryotic cells, cAMP recognition protein is present. These proteins play an important role in cell growth, stress resistance, metabolic regulation, and differentiation. Enteric bacteria cAMP is associated with enzymes involved in de novo production in sugar metabolism. Photosynthetic bacteria cA (G) MP are associated with changes in external environmental factors such as light, pH, oxygen and nitrogen deficiency. To get involved. The adenylate cyclase ( cya1 ) gene, which synthesizes cAMP, is present in both flagella and prokaryotic bacteria. However, little is known about the functional function of cAMP involved in the signaling pathway of P. aeruginosa. Bacterium Anabaena sp. PCC7120 has several genes that encode the adenylate cyclase gene. Among cyaB1 ^-, cyaB2 ^- While the wild type cells, similar in size to deletion mutants, cyaD ^- strains grew in size as compared to wild type cells. In flagella bacteria Spirulina platensis , cAMP correlates with respiratory rate.

cya1 ^- / 2 ^- according to the cell size and the respiration rate results in the double mutant cA (G) in the Synechocystis MP is the function and cell to inhibit the respiration rate increases due to the glucose is expected that the activator function of reaching a critical mass (Table 3 and Figure 3).

Table 3. svr1 interaction partners screened by YTH

Example 4: Gene Expression Related to Cell Size and Respiration

So far, various genes have been mentioned in relation to cell size and respiration. Svr1 , cya1 or cya2 involved in respiratory inhibition of cells, trxA, trxB, trxQ , which regulate cell oxidation / reduction, and ntr, ftrv, and ftrc genes that regulate them in photoindependent growth and photo-dependent growth conditions I examined the differences. The expression of these genes was not different in photoindependent and photodependent nutrient growth conditions of wild cells. This means that these genes do not directly respond to the glucose influx, and svr1 ^- mutants, OxSvr gwabal current transgenic strains and cya1 ^- / 2 ^- cells by when you are viewing in the double mutant gene expression, there is no difference in glucose size The gene that regulates respiration suggests that it is regulated by post-translational modifications.

Figure 1 shows the characteristics of svr , Svr overexpressing transgenics and adenylate cyclase ( cya1 ) and guanylyl cyclase ( cya2 ) genes. (A) Domain structures of Svr1, Svr2, Cya1 and Cya2. (B) Fusion PCR mutagenesis of svr1 and ntr mutants, Svr1 overexpression and construction of cya1 / cya2.

2 is grown Synechocystis wild type (WT) cells, Svr1- deficient mutant (svr1 ^-) under photomixotrophic conditions, Svr1 overexpressed state (Ox Svr1), cya1 cya2 and double mutants (cya1 ^- / 2 ^-) a light microscope (A of ) And SEM (B) images.

Of Figure 3 is photoautotrophic, photomixotrophic and heterotrophic growth Synechocystis wild type (WT) grown under conditions, Svr1- deficient mutant (svr1 ^-), Svr1 overexpression mutants (OxSvr1) and cya1, cya2 double mutant (cya1 ^{- -} / 2) Show respiratory rate.

4 is wild-type, svr1 under photoautotrophic and photomixotrophic ^conditions the PQ pool shows the dynamics of the induction and OxSvr.

FIG. 5 shows Synechocysits wild type (WT), Svr1-deficient mutants ( svr1 ⁻ ), Svr1 overexpressing mutants (OxSvr) and cya1 grown in the growth medium (40 μmol photon m ⁻² s ⁻¹ ) with or without 10 mM glucose , cya2 double mutant (cya1 ^- / 2 ^-) shows the transcript levels of genes in the breath.

Figure 6 is a schematic diagram showing the regulation of cell size through Svr1-mediated respiratory activity.

Figure 7. (A) wild-type, svr1 ^- And Synechocytis NTR activity in Ox Svr mutants. Enzyme activity was measured on crude extracts of isolated cells grown in autotrophic and photomixotrophic conditions (40 μmol photon m ⁻² s ⁻¹ ). (B) Conditions for inducing Svr overexpression in E. coli (top panel). Lane 1: size marker, lane 2; Control, svr induction condition lane 3; 0.2 mM IPTG (3 hr, 37 ° C.), lane 4; 1 mM IPTG (3 hr, 37 ° C.), lane 5; 0.2 mM IPTG (3 hr, 30 ° C.), lane 6; 1 mM IPTG (3 hr, 30 ° C.), lane 7; 0.2 mM IPTG (6 hr, 30 ° C.), lane 8; 1 mM IPTG (6hr, 30 ° C). Immunoblotting for each condition in E. coli with anti-GST antibody (bottom panel). (C) Inhibition of Synechocysits NTR activity of Svr1-deficient mutants by soluble crude enzyme extracts isolated from E. coli OxSvr1 mutant cells (mean + SE, n = 3-4).

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Svr1 gene controlling cell size of Cyanobactria, and method for          controlling cell size of Cyanobactria using the svr1 gene <130> PN08097 <160> 15 <170> KopatentIn 1.71 <210> 1 <211> 789 <212> DNA <213> Synechocystis sp. PCC6803 <220> <221> gene (222) (1) .. (789) <223> svr1 gene <400> 1 atgggttacc tgccaagcca aactgatttt ttcaccatac ctaaggggat gtcgtccatg 60 gttttaactt ccattagtac atcaaatatt ccggctaagg tcaaaggatc taacttgttg 120 gaacatagtt taagaaaggt tcatcccagc aaacatcacc actatcaagt agaagacttc 180 ttttgttttc aaatgaattc cggttccatt gtggactgga ataactgccg caatgttctt 240 accagcgaag attttatcgt cggtttaatt gacggcttgc aggaagaagt gggcaacgcc 300 tccagtgtgg tgatgtacaa catcggcaag gagtggggcc attacgatgc cgaatttttt 360 aaccagtggt tcccgacgga atttggctat accagttctt tgagcgagct caatcttaac 420 tatgtgctag aaggttggtg gtggcccttc accgcccagg gctggggtaa ctgggccatt 480 gacctcagtg aacagaaaaa cggctttttg tttgtggata ttttcgactc cgctgtggcc 540 cggacgttgg gggatgtggg taagcctgtt tgccatattt acgctggcct gttggcaggt 600 ttctttagcc gcctggtgaa taagtccctc aactgcattg aaattcagtg ctacgccatg 660 ggggaaacct attgcaagtt tctgattggt aagcaagacc gcattgatgc cgccactttc 720 tggcaaaacg aaggggccaa tgccaacgat attgccacca aactcgtcaa aggggaatac 780 ctgaaatga 789 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 gcacgatgaa gagcagaagt 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 ggataaatcc cgcggatgg 19 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> 223 UF primer <400> 4 agggttgtga ctggttgaga gatt 24 <210> 5 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> UR + 271 primer <400> 5 ggcgagcatc gtttgttcgc ccagatcagt ttggcttggc aggtaa 46 <210> 6 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> DF + 271 primer <400> 6 taatgtctaa caattcgttc aagcgccacc aaactcgtca aagg 44 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DR primer <400> 7 caatcaatgc cccgacaaaa 20 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> R1991S primer <400> 8 ggggtacccc gggatttgtt ggggttt 27 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> R1991AS primer <400> 9 ggggtacccc tttatcggca atgacctcc 29 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> L0646S primer <400> 10 ggggtacccg gggtatttgg attgcgaa 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> L0646AS primer <400> 11 ggggtacccc cctttagcgg agatttgc 28 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> sigEF primer <400> 12 aactgcagga tttcagcagg aaactagggt ta 32 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> sigER primer <400> 13 ggggtaccag cctgccattg gtcaacggca c 31 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> svrFB primer <400> 14 cgcggatcca tgggttacct gccaagccaa ac 32 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> svrRX primer <400> 15 ccgctcgagt catttcaggt attccccttt gac 33  

Claims (17)

Svr1 (Synechocystis 4-vinyl reductase 1) gene that regulates the cell size of Synechocystis sp. The gene according to claim 1, wherein the gene consists of the nucleotide sequence of SEQ ID NO: 1. Recombinant vector comprising the svr1 gene of claim 1. A host cell transformed with the recombinant vector of claim 3. The host cell of claim 4, wherein the host cell is Synechocystis sp. The host cell of claim 5, wherein the host cell is Synechocystis sp. PCC6803. A method for regulating the cell size of Bacillus cynecossis comprising controlling the expression of the Synechocystis 4-vinyl reductase 1 (svr1) gene in Synechocystis sp. 8. The method according to claim 7, wherein the cell size of the bacterium cynecosistis is reduced by overexpressing the svr1 gene in Synechocystis sp. 8. The method according to claim 7, wherein the cell size of the bacterium cynecossis is increased by inhibiting the expression of the svr1 gene in Synechocystis sp. 8. The method of claim 7, wherein the cell size of the bacterium cynecossis is controlled through respiration by glucose metabolism. 8. The method of claim 7, wherein the svr1 gene inhibits respiration of S. aureus cynecossis. 12. The method of claim 11, wherein the svr1 gene inhibits respiration by inhibiting electron influx into the platoquinone pool (PQ pool). 12. The method of claim 11, wherein the Svr1 protein encoded by the svr1 gene inhibits respiration by inhibiting the enzymatic activity of a NADPH thioredoxin reductase (NTR) protein. The method of claim 13, wherein the N-terminal region that does not contain the 4VR (4-vinyl reductase) domain of the Svr1 protein binds to the NTR protein. 8. The method of claim 7, wherein the cell size of Bacillus cynecosis is controlled at post-translational levels. 8. The method of claim 7, wherein the bacterium Cynecosistis is Synechocystis sp. PCC6803. Synechocystis sp. PCC6803 mutant strain lacking the svr1 gene.

Images