KR20090097388A - Recombinant vector containing 4cl gene and sht gene, microorganism transformed thereof and method for producing phenylpropanoid amide-based compounds using the same - Google Patents
Recombinant vector containing 4cl gene and sht gene, microorganism transformed thereof and method for producing phenylpropanoid amide-based compounds using the same Download PDFInfo
- Publication number
- KR20090097388A KR20090097388A KR1020080022494A KR20080022494A KR20090097388A KR 20090097388 A KR20090097388 A KR 20090097388A KR 1020080022494 A KR1020080022494 A KR 1020080022494A KR 20080022494 A KR20080022494 A KR 20080022494A KR 20090097388 A KR20090097388 A KR 20090097388A
- Authority
- KR
- South Korea
- Prior art keywords
- serotonin
- gene
- phenylpropanoid
- recombinant vector
- acid
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/001—Amines; Imines
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y602/00—Ligases forming carbon-sulfur bonds (6.2)
- C12Y602/01—Acid-Thiol Ligases (6.2.1)
- C12Y602/01012—4-Coumarate-CoA ligase (6.2.1.12)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
본 발명은 4CL 유전자 및 SHT 유전자를 포함하는 재조합 벡터를 이용하여 세균을 형질전환하고, 상기 형질전환된 세균으로부터 페닐프로파노이드 아미드계 화합물을 생산하는 방법에 관한 것이다. 구체적으로 본 발명은 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase; SHT) 유전자 및 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase; 4CL) 유전자를 순차적으로 도입하여, 프로모터와 작동가능하게 연결되어 있는 것을 특징으로 하는 재조합 벡터 및 상기 재조합 벡터로 형질전환된 세균에 관한 것이며, 또한 상기 재조합된 세균에 페놀 기질 및 아민 기질을 투여하여 세균을 배양하고 배양된 세균으로부터 생산된 페닐프로파노이드 아미드계 화합물을 분리 및 정제하여 페닐프로파노이드 아미드계 화합물을 생산하는 방법에 관한 것이다.The present invention relates to a method of transforming bacteria by using a recombinant vector comprising a 4CL gene and an SHT gene, and producing a phenylpropanoid amide compound from the transformed bacterium. More specifically, the present invention is serotonin-hydroxy cinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase; SHT) gene and 4- Kumar rate-coenzyme A ligase (4-Coumarate-CoA ligase; 4CL) by introducing a gene sequence, a promoter and The present invention relates to a recombinant vector and a bacterium transformed with the recombinant vector, wherein the recombinant bacterium is operably linked to the recombinant vector. The present invention relates to a method for separating and purifying propaneoid amide compounds to produce phenylpropaneoid amide compounds.
페닐프로파노이드 아미드계 화합물은 다양한 약리적 효과를 가지고 있는 것으로 보고되어 있다. 구체적으로 홍화씨 깻묵에서 추출한 페닐프로파노이드 아미드계 화합물의 일종인 쿠마로일세로토닌 및 페루로일세로토닌은 항산화활성(Kawashima et al., J. Interferron & Cytokine Res. 18, 423-428, 1998), 항암활성(Zhang et al., Chemical & Pharma. Bull. 44, 874-876, 1996)이 있는 것으로 보고되고 있고, 뼈 형성 촉진(특허등록번호 제10-0354791호)에도 관련되어 있는 것으로 알려져 있으며 특히 최근에는 탁월한 미백효과가 있는 것으로도 보고되고 있다(Roh et al., Biol. Pharm. Bull. 27, 1976-1978, 2004). 한편 다른 페닐프로파노이드 아미드계 화합물의 일종인 페루로일티라민 및 카페오일티라민 화합물도 항암활성이 있는 것으로 알려져 있으며(Park et al., Cancer Let. 202, 161-171, 2003), 특히 상기 페루로일티라민의 경우는 미백활성이 있는 것으로도 보고되고 있다(Efdi et al., Biol. Pharm. Bull. 30, 1972-1974, 2007).Phenylpropaneoid amide compounds have been reported to have various pharmacological effects. Specifically, Kumaroyl serotonin and Peruroyl serotonin, which are a kind of phenylpropanoid amide compound extracted from safflower seed oil, have antioxidant activity (Kawashima et al., J. Interferron & Cytokine Res. 18, 423-428, 1998), It is reported to have anticancer activity (Zhang et al., Chemical & Pharma. Bull. 44, 874-876, 1996), and is known to be involved in promoting bone formation (Patent No. 10-0354791). It has recently been reported to have an excellent whitening effect (Roh et al., Biol. Pharm. Bull. 27, 1976-1978, 2004). On the other hand, Peruroyl tyramine and caffeoyl tyramine compounds, which are a kind of other phenylpropanoid amide compounds, are also known to have anticancer activity (Park et al., Cancer Let. 202, 161-171, 2003). Loyltyramine has also been reported to have whitening activity (Efdi et al., Biol. Pharm. Bull. 30, 1972-1974, 2007).
상기 페닐프로파노이드 아미드계 화합물은 페놀 화합물(phenolic compounds)과 아민류(amines) 화합물의 중합체로써, 대표적으로 페루로일세로토닌(feruloylserotonin), 쿠마로일세로토닌(coumaroylserotonin), 카페오일세로토닌(caffeoylserotonin), 시나포일세로토닌(sinapoylserotonin), 페루로일티라민(feruloyltyramine), 페루로일옥토파민(feruloyloctopamine), 쿠마로일티라민(coumaroyltyramine) 및 쿠마로일옥토파민(coumaroyloctopamine)등이 있다.The phenyl propaneoid amide compound is a polymer of phenolic compounds and amines compounds, typically peruyl serotonin, coumaroylserotonin, caffeoylserotonin, caffeoylserotonin, Sinapoylserotonin, peruloyltyramine, peruloyloctopamine, coumaroyltyramine and coumaroyloctopamine.
한편 상기 페닐프로파노이드 아미드계 화합물을 생합성하는데 사용되는 아민 류는 티라민(tyramine), 세로토닌(serotonin), 도파민(dopamine), 펜에틸아민(phenethylamine), 노르아드레날린(noradrenaline) 및 옥토파민(octopamine) 등이 있으며, 페놀 화합물로는 페루로일코에이(feruloyl-CoA), 신나모일코에이(cinnamoyl-CoA), 쿠마로일코에이(4-coumaroyl-CoA), 사나포일코에이(sinapoyl-CoA) 및 카페오일코에이(caffeoyl-CoA) 등이 있다.On the other hand, the amines used for biosynthesis of the phenylpropanoid amide compound are tyramine, serotonin, dopamine, phenethylamine, noradrenaline and octopamine. Phenolic compounds include feruloyl-CoA, cinnamoyl-CoA, 4-coumaroyl-CoA, sinapoyl-CoA and Caffeoyl-CoA.
상기와 같이 약리적 효과가 우수한 페닐프로파노이드 아미드계 화합물은 식물체에서 미량으로만 존재한다. 예를 들어 홍화씨에서는 그램 종자 당 20㎍ 정도의 페루로일세로토닌이 존재하며(Baek et al., J. Korean. Soc. Agric. Chem. Biotechnol. 42, 366-368, 1999), 병원균에 감염된 대나무 가지에서 그램 무게 당 3~10㎍의 페루로일세로토닌 및 쿠마로일세로토닌이 존재하는 것으로 알려져 있다(Tanaka et al., Phytochemistry, 64, 965-969, 2003). 또한 고추의 꽃에서 7㎍의 쿠마로일세로토닌, 95㎍의 쿠마로일티라민, 및 21㎍의 페루로일티라민이 존재하는 것으로 보고되고 있다(Kang et al., Sci. Hortic. 26, 2009-2015, 2007). 또한 감자 및 옥수수에서도 미량의 페닐프로파노이드 아미드계 화합물 등이 발견되었다(Schmidt et al., J. Biol. Chem. 274, 4273-4280, 1999; Ishihara et al., Biosci. Biotechnol. Biochem. 64, 1025-1031, 2000). 그러나 상기와 같이 페닐프로파노이드 아미드계 화합물은 식물체에서 미량으로만 존재하므로, 상기 페닐프로파노이드 아미드계 화합물을 식물체에서 추출하여 생산하는 방법은 경제적이지 못하므로, 이를 인공적으로 대량 생산하는 방법에 대한 개발이 절실한 상황이다. Phenylpropaneoid amide compounds having excellent pharmacological effects as described above are present only in trace amounts in plants. For example, safflower seeds contain about 20 μg of Peruroyl serotonin per gram seed (Baek et al., J. Korean. Soc. Agric. Chem. Biotechnol. 42, 366-368, 1999) and bamboo infected with pathogens It is known that eggplants contain 3-10 μg of peruroyl serotonin and coumaroyl serotonin per gram weight (Tanaka et al., Phytochemistry, 64, 965-969, 2003). It has also been reported that 7 μg of Kumaroyl serotonin, 95 μg of Kumaroyl tyramine, and 21 μg of Peruroyl tyramine are present in the pepper flower (Kang et al., Sci. Hortic . 26, 2009- 2015, 2007). Trace amounts of phenylpropanoid amide compounds have also been found in potatoes and corn (Schmidt et al., J. Biol. Chem . 274, 4273-4280, 1999; Ishihara et al., Biosci. Biotechnol. Biochem. 64 , 1025-1031, 2000). However, as described above, since the phenylpropaneoid amide compound is present only in a small amount in the plant, the method of extracting and producing the phenylpropaneoid amide compound from the plant is not economical, and thus, in a method of artificially mass producing it The situation is urgently needed.
한편, 유전자조작 기술이 발전하면서 박테리아 및 여러 동식물들을 이용한 목적 단백질 및 화합물의 대량생산 연구도 많이 이뤄지고 있다. 현재까지 대장균은 여러 유용 단백질 및 화합물을 대량 생산하는데 가장 널리 이용되고 있는 숙주 세포이며, 이에 관한 연구도 가장 많이 이뤄지고 있다(Hodgson, Bio/Technology, 11:887, 1993; Lee, Trends Biotechnol., 14:98, 1996). 그러나 상기 대장균을 이용한 목적 단백질 및 화합물의 대량 생산 방법은, 목적 단백질 및 화합물의 종류에 따라 재조합 벡터를 구현하고 이를 이용하여 형질전환하는 구체적인 생산 방법을 설계하여야 하며, 무엇보다도 비록 상기와 같은 생산 방법을 설계하였다 하더라도 실제 목적 단백질 또는 화합물이 효율적으로 생산될 수 있는지는 당업자가 용이하게 예측할 수 없는 문제점이 있다. 특히 목적단백질이 형질전환된 세균으로부터 바로 생산되지 않거나, 형질전환된 세균으로부터 생산된 단백질이 별도로 추가된 기질과 반응하지 못하여 화합물을 생산할 수 없는 경우 등 다양한 원인으로 인하여 당업자가 실제로 목적단백질 또는 화합물을 수득할 수 있는지 여부를 용이하게 예측할 수는 없다. 상기 다양한 원인으로는 예를 들면, 세포질 내에 존재하는 여러 가지 프로티아제(protease)에 의하여 단백질이 분해되어 생산 수율이 현저히 낮을 수 있으며 또한 단백질이 완전한 접힘(folding)을 이루지 못하고 활성을 잃은 상태의 불용성 응집체(inclusion body)를 형성하는 경우를 들 수 있다. 또는 형질전환된 세균에 기질을 처리하여도 기질이 세균에 의해 분해되거나, 또는 처리한 기질이 세균내로 효과적으로 들어가지 못해 화합물과 단백질간의 효소반응이 불가능하 여 화합물의 생산이 불가능한 경우도 발생 할 수 있기 때문이다.On the other hand, with the development of genetic engineering technology, a lot of research on mass production of target proteins and compounds using bacteria and various plants and animals is being conducted. To date, Escherichia coli is the most widely used host cell for mass production of many useful proteins and compounds, and the research on this is the most widely conducted (Hodgson, Bio / Technology , 11: 887, 1993; Lee, Trends Biotechnol. , 14 : 98, 1996). However, the mass production method of the target protein and compound using the E. coli should design a specific production method of implementing a recombinant vector and transforming the same according to the type of target protein and compound, and above all, even if the production method as described above Even if it is designed, whether the actual target protein or compound can be efficiently produced, there is a problem that can be easily predicted by those skilled in the art. In particular, a person skilled in the art can actually produce a target protein or compound due to various causes, such as when the target protein is not produced directly from the transformed bacterium or the protein produced from the transformed bacterium fails to react with a separately added substrate. It cannot be easily predicted whether it can be obtained. The various causes may be, for example, the protein is degraded by various proteases present in the cytoplasm, so that the production yield may be significantly low, and the protein may not be fully folded and inactivated. The case where an insoluble aggregate body is formed is mentioned. Alternatively, even when the substrate is treated with the transformed bacterium, the substrate may be degraded by the bacterium, or the processed substrate may not enter the bacterium effectively, thus making it impossible to produce the compound due to the enzymatic reaction between the compound and the protein. Because there is.
본 발명자들은 약리적 효과가 우수한 페닐프로파노이드 아미드계 화합물을 식물체에서 생산하고자 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자를 벼에 형질전환하여, 페닐프로파노이드 아미드계 화합물을 생산하였다. 상기 형질전환 벼에서는 그램 생체중 당 77㎍의 쿠마로일세로토닌과 96㎍의 페루로일세로토닌을 생산하였다(Jang et al., Plant Physiol. 135, 346-356, 2004; 미국특허번호 7084322). 그러나 상기 형질전환 벼에서 페닐프로파노이드 아미드계 화합물을 정제하기 위해 식물체 파쇄, 컬럼정제 및 고속액체크로마토그라피(HPLC) 정제과정을 거쳐야 되고, 수율도 낮아 경제성이 용이 하지 않았다. 이 후 경제적이고 간단하게 생합성하는 방법에 대하여 연구하던 중, 많은 시행착오를 거쳐 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 유전자와 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자를 가장 효율적으로 발현시킬 수 있는 재조합 벡터를 설계하고, 이를 이용하여 세균을 형질전환한 후, 이에 아민 기질 및 페놀기질을 투여하여 다량의 페닐프로파노이드 아미드계 화합물을 생산함으로써 본 발명을 완성하였다.The inventors have produced a superior phenyl profile by cannabinoid amide compound serotonin-hydroxy-cinnamate to produce in a plant together transferase (Serotonin N -hydroxycinnamoyltransferase) transformed with the genes in rice, phenyl profile cannabinoid amide compound pharmacological effect . The transformed rice produced 77 μg of coumaroyl serotonin and 96 μg of Peruroyl serotonin per gram of live weight (Jang et al., Plant Physiol. 135, 346-356, 2004; US Pat. No. 7084322). However, in order to purify the phenylpropanoid amide compound in the transformed rice, plant crushing, column purification and high-performance liquid chromatography (HPLC) purification process have to be performed, and the yield is also low and the economic efficiency is not easy. Later, while investigating economic and simple biosynthesis methods, the 4-Coumarate-CoA ligase gene and serotonin hydroxycinnamoyl transferase (Serotonin N- ) went through a lot of trial and error. By designing a recombinant vector capable of expressing the hydroxycinnamoyltransferase gene most efficiently, transforming bacteria using the same, and then administering an amine substrate and a phenol substrate, a large amount of phenylpropanoid amide compound is produced. Was completed.
따라서 본 발명의 목적은 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 유전자와 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자가 삽입된 재조합 벡터 및 상기 벡터로 형질전환된 세균을 제공하는데 있다.Accordingly, an object of the present invention is a recombinant vector and a vector transformed with 4-Coumarate-CoA ligase and Serotonin N -hydroxycinnamoyltransferase gene. To provide bacteria.
본 발명의 또 다른 목적은 본 발명의 형질전환된 세균을 이용하여 페닐프로파노이드 아미드계 화합물을 생산하는 방법을 제공하는데 있다.Still another object of the present invention is to provide a method for producing a phenylpropanoid amide compound using the transformed bacterium of the present invention.
상기와 같은 과제를 해결하기 위하여, 본 발명은 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자 및 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 유전자가 순차적으로 연결되고, 프로모터와 작동가능하게 연결되어 있는 것을 특징으로 하는 재조합 벡터를 제공한다.In order to solve the above problems, the present invention is a serotonin hydroxycinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase) gene and 4-coumarate-Coenzyme A ligase (4-Coumarate-CoA ligase) gene is sequentially linked It provides a recombinant vector, which is operably linked to a promoter.
또한 본 발명은 상기 재조합 벡터로 형질전환된 세균을 제공한다.The present invention also provides a bacterium transformed with the recombinant vector.
또한 본 발명은 (a) 상기 형질전환된 세균에 페놀 기질 및 아민 기질을 투여하여 세균을 배양하는 단계 및 (b) 상기 (a) 단계의 배양된 세균으로부터 생산된 페닐프로파노이드 아미드계 화합물을 분리 및 정제하는 단계를 포함하는 것을 특징으로 하는 페닐프로파노이드 아미드계 화합물의 생산방법을 제공한다.In another aspect, the present invention (a) administering a phenol substrate and an amine substrate to the transformed bacteria to cultivate the bacteria and (b) a phenylpropanoid amide compound produced from the cultured bacteria of step (a) It provides a method for producing a phenylpropaneoid amide compound comprising the step of separating and purifying.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명에서 "재조합 벡터"란 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 벡터로써, 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절 요소를 포함하는 유전자 작제물을 말한다.As used herein, a "recombinant vector" refers to a gene construct that is capable of expressing a protein of interest in a suitable host cell, and includes a gene construct comprising essential regulatory elements operably linked to express the gene insert.
본 발명에서 용어 "작동 가능하게 연결된다(operably linked)"는 것은 본 발명의 폴리뉴클레오티드가 발현 조절 서열과 결합되어 그의 기능 또는 발현이 상기 발현 조절 서열에 의해 영향을 받는 것을 말한다. 즉, 발현 조절 서열의 조절 하에 폴리뉴클레오티드의 서열이 발현되어 원하는 폴리펩티드가 형성되도록 정확한 해독프레임을 유지시키는 것을 포함한다. 이와 같이 작동 가능하게 연결된 폴리뉴클레오티드와 발현 조절 서열은 프로모터, 전사 종결부위, 선택 마커 및 복제 개시점(replication origin)을 같이 포함하고 있는 하나의 벡터 내에 포함될 수 있다.As used herein, the term “operably linked” refers to the polynucleotide of the present invention that is associated with an expression control sequence such that its function or expression is affected by the expression control sequence. That is, maintaining the correct frame of translation such that the sequence of polynucleotides is expressed under the control of expression control sequences to form the desired polypeptide. Such operably linked polynucleotides and expression control sequences may be included in a vector containing a promoter, transcriptional termination, selection marker, and replication origin.
본 발명에서 용어 "프로모터"는 구조 유전자의 전사를 지시하는 뉴클레오티드 서열이다. 전형적으로, 프로모터는 구조 유전자의 전사 개시부위에 인접하는, 유전자의 5' 비-코딩 부위에 위치한다.As used herein, the term "promoter" is a nucleotide sequence that directs the transcription of a structural gene. Typically, the promoter is located at the 5 'non-coding site of the gene, adjacent to the transcriptional initiation site of the structural gene.
본 발명의 재조합 벡터는 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자 및 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 유전자가 순차적으로 연결되고, 프로모터와 작동가능하게 연결되어 있는 것을 특징으로 한다. 이에 한정되지 않으나 바람직하게는 상기 재조합 벡터는 도 2에 기재된 개열지도를 갖는 벡터일 수 있다.The recombinant vector of the present invention is serotonin-hydroxy cinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase) gene and 4- Kumar rate-and coenzyme A ligase (4-Coumarate CoA-ligase) gene are connected in sequence, enabling promoter and Operation It is characterized by being connected. Although not limited thereto, preferably, the recombinant vector may be a vector having a cleavage map described in FIG. 2.
상기 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 유전자는 서열번호 5의 염기서열을 갖는 것을 특징으로 하며, 바람직하게는 4-쿠마레이트-코엔자임A 리가아제1(4-Coumarate-CoA ligase1), 4-쿠마레이트-코엔자임A 리가아제2(4-Coumarate-CoA ligase2), 4-쿠마레이트-코엔자임A 리가아제3(4-Coumarate-CoA ligase3) 및 4-쿠마레이트-코엔자임A 리가아제4(4-Coumarate-CoA ligase4)로 이루어진 군에서 선택된 유전자인 것을 특징으로 하며, 가장 바람직하게는 애기장대에서 유래된 4-쿠마레이트-코엔자임A 리가아제2(4-Coumarate-CoA ligase2)인 것을 특징으로 한다. 상기 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase)는 다양한 페놀 기질에 코에이 그룹을 붙여 활성형태의 페놀 기질화합물을 합성할 수 있는 활성이 있다.The 4-coumarate-Coenzyme A ligase (4-Coumarate-CoA ligase) gene is characterized in that having a nucleotide sequence of SEQ ID NO: 5, preferably 4-coumarate-Coenzyme A ligase 1 (4-Coumarate -CoA ligase 1), 4-Coumarate-CoA
상기 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자는 서열번호 6의 염기서열을 갖는 것을 특징으로 하며, 이에 한정되지 않지만 바람직하게는 고추에서 유래된 것을 특징으로 한다. 상기 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N- hydroxycinnamoyltransferase)는 상기 페놀 기질에 코에이가 결합된 활성형태의 페놀 화합물과 아민 기질을 이용하여 페닐프로파노이드 아미드계 화합물을 생합성할 수 있는 활성이 있다.The serotonin hydroxycinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase) gene is characterized in that it has a nucleotide sequence of SEQ ID NO: 6, but is not limited thereto, preferably characterized in that derived from red pepper. The serotonin hydroxycinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase) has the activity of biosynthesizing a phenylpropanoid amide compound using an phenolic compound and an amine substrate in an active form in which a koei is bonded to the phenolic substrate. .
따라서 상기와 같이 본 발명의 재조합 벡터는 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자 및 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 유전자가 순차적으로 연결되고, 프로모터와 작동가능하게 연결되어 있어, 본 발명의 페닐프로파노이드 아미드계 화합물을 생합성하는데 이용될 수 있다.Therefore, as described above, the recombinant vector of the present invention is a serotonin hydroxycinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase) gene and 4-coumarate-Coenzyme A ligase (4-Coumarate-CoA ligase) gene is sequentially linked, promoter It is operatively linked with and can be used to biosynthesize the phenylpropanoid amide compounds of the present invention.
본 발명의 일실시예에서는 4-쿠마레이트-코엔자임A 리가아제2(4-Coumarate-CoA ligase2) 유전자를 서열번호 1 및 서열번호 2의 프라이머를 사용하여 RT-PCR을 수행한 후, 그 생성물을 제한효소 NdeI 및 XhoI으로 절단하고, pETDuet-1내의 동일한 제한효소 부위 내로 삽입시켜 pETDuet-4CL2 벡터를 제작하였다. 또한 고추 유래의 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 유전자를 서열번호 3 및 서열번호 4의 프라이머를 사용하여 PCR을 수행한 후, 그 생성물을 제한효소 NcoI 및 NotI으로 절단하고, 상기 제조된 pETDuet-4CL2 벡터에 삽입하여 pETDuet-SHT+4CL2 벡터를 제조하였다(<실시예 1-1> 참조).In one embodiment of the present invention, after performing the RT-PCR of the 4-Coumarate-
본 발명의 형질전환된 세균은 상기 재조합 벡터로 형질전환된 것을 특징으로 한다. 상기 세균은 이에 한정되지 않지만 대장균(Escherichia coli), 바실러스 서 브틸리스(Bacillus subtilis), 스트렙토마이세스(Streptomyces), 슈도모나스(Pseudomonas), 프로테우스 미라빌리스(Proteus mirabilis) 및 스타필로코쿠스(Staphylococcus)로 이루어진 군에서 선택된 세균일 수 있으며 가장 바람직하게는 대장균일 수 있다.The transformed bacteria of the present invention is characterized in that transformed with the recombinant vector. The bacteria, but not limited to Escherichia coli (Escherichia coli), Bacillus sub subtilis (Bacillus subtilis), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Proteus Mira Billy's (Proteus mirabilis) and Staphylococcus (Staphylococcus It may be a bacteria selected from the group consisting of and most preferably may be E. coli.
상기 본 발명의 재조합 벡터를 상기 세균에 도입하는 공지된 방법으로는, 이에 한정되지는 않으나, CaCl2 및 열 쇼크(heat shock) 방법, 입자 총 충격법(particle gun bombardment), 실리콘 탄화물 위스커(Silicon carbide whiskers), 초음파 처리(sonication), 전기천공법(electroporation) 및 PEG(Polyethylenglycol)에 의한 침전법 등을 사용할 수 있다. 본 발명의 일실시예에서는 열 쇼크 방법으로 재조합 벡터를 대장균에 도입하는 방법을 이용하였다(<실시예 1-2> 참조)Known methods for introducing the recombinant vector of the present invention into the bacteria include, but are not limited to, CaCl 2 and heat shock methods, particle gun bombardment, silicon carbide whiskers carbide whiskers), sonication, electroporation, and precipitation by polyethylene glycol (PEG). In an embodiment of the present invention, a method of introducing a recombinant vector into E. coli as a heat shock method was used (see <Example 1-2>).
상술한 방법에 의해 제조된 본 발명의 형질전환 세균은 통상적인 배양방법에 의해 대량으로 배양할 수 있다. 배양배지로는 탄소원, 질소원, 비타민 및 미네랄로 구성된 배지를 사용할 수 있으며, 예를 들어, 통상적인 암피실린(ampicillin)이 함유된 YEP 배지를 사용할 수 있다. 세균의 배양은 통상의 세균 배양 조건상에서 가능하며 예를 들어, 온도범위 15℃ 내지 45℃에서 1시간 내지 40시간 동안 배양할 수 있다. 배양액 중의 배양배지를 제거하고 농축된 균체만을 분리하기 위해 원심분리(centrifugation) 또는 여과(filtration)과정을 거칠 수 있으며 이러한 단계는 당업자가 필요에 따라 수행할 수 있다. 농축된 균체는 통상적인 방법에 따라 냉 동(frozen)하거나 또는 냉동건조(lyophilized)하여 그 활성을 잃지 않도록 보존할 수 있다.The transformed bacteria of the present invention prepared by the above-described method can be cultured in large quantities by conventional culture methods. As the culture medium, a medium consisting of a carbon source, nitrogen source, vitamins and minerals may be used. For example, a conventional YEP medium containing ampicillin may be used. Cultivation of bacteria is possible under conventional bacterial culture conditions and may be incubated for 1 hour to 40 hours, for example, in the temperature range of 15 ° C to 45 ° C. Centrifugation or filtration may be performed to remove the culture medium in the culture and to separate only the concentrated cells, which steps may be performed by those skilled in the art as needed. The concentrated cells can be frozen or lyophilized according to a conventional method so as not to lose their activity.
본 발명자들은 상기와 같이 제조된 재조합 대장균을 'pETDuet-SHT+4CL2(BL21(DE3))'라 명명하고, 2008년 2월 4일에 한국유전자은행(Korean Collection for Type culture)에 기탁하였다(기탁번호: KCTC 11272BP). 또한 본 발명자들은 본 발명의 재조합 대장균에서 SHT 단백질이 안정적으로 발현되고 있음을 확임함으로써, 상기 SHT 단백질의 활성을 고려하면, 상기 재조합 대장균으로부터 페닐프로파노이드 아미드계 화합물을 생산할 수 있음을 알 수 있었다(<실시예 2-1> 참조).The present inventors named the recombinant E. coli prepared above as 'pETDuet-SHT + 4CL2 (BL21 (DE3))', and deposited it on the Korean Collection for Type culture on February 4, 2008 (deposited). Number: KCTC 11272BP). In addition, the present inventors confirmed that the SHT protein is stably expressed in the recombinant E. coli of the present invention, and considering the activity of the SHT protein, it was found that the phenylpropanoid amide compound could be produced from the recombinant E. coli. (See <Example 2-1>).
본 발명의 페닐프로파노이드 아미드계 화합물의 생산방법은 (a) 상기 형질전환된 세균에 페놀 기질 및 아민 기질을 투여하여 세균을 배양하는 단계 및 (b) 상기 (a) 단계의 배양된 세균으로부터 생산된 페닐프로파노이드 아미드계 화합물을 분리 및 정제하는 단계를 포함하는 것을 특징으로 한다.Method for producing a phenylpropaneoid amide compound of the present invention comprises the steps of (a) administering a phenol substrate and an amine substrate to the transformed bacteria to culture the bacteria and (b) from the cultured bacteria of step (a) And separating and purifying the produced phenylpropaneoid amide compound.
상기 (a) 단계의 페놀 기질은 이에 한정되지 않지만 바람직하게는 쿠마르산(coumaric acid), 카페익산(caffeic acid), 페루릭산(ferulic acid), 신남산(cinnamic acid) 및 시납산(sinapic acid)으로 이루어진 군에서 선택된 것임을 특징으로 하며, 상기 (a) 단계의 아민 기질은 티라민(tyramine), 트립타민(tryptamine), 세로토닌(serotonin), 도파민(dopamine), 노르아드레날린(noradrenaline) 및 옥토파민(octopamine)으로 이루어진 군에서 선택된 것임을 특징으로 한다.The phenolic substrate of step (a) is not limited to this, but preferably coumaric acid (coumaric acid), caffeic acid (caffeic acid), ferulic acid (ferulic acid), cinnamic acid (cinnamic acid) and cinamic acid (sinapic acid) The amine substrate of step (a) is tyramine, tryptamine, serotonin, dopamine, doradamine, noradrenaline and octopamine. ) Is selected from the group consisting of.
또한 상기 (a) 단계에서 형질전환된 세균에 페놀 기질 및 아민 기질뿐만 아니라, 필요한 경우 발현유도인자를 추가적으로 투여할 수 있다. 상기 발현유도인자는 유전자의 발현을 유도할 수 있는 물질로 이에 한정되지 않지만 바람직하게는 IPTG(isopropyl-β-thiogalactoside)를 사용할 수 있다.In addition, in addition to the phenol substrate and the amine substrate, the expression-inducing factor may be additionally administered to the bacteria transformed in step (a). The expression inducing factor is a substance capable of inducing the expression of the gene, but is not limited thereto. Preferably, IPTG (isopropyl-β-thiogalactoside) may be used.
또한 상기 (a) 단계에서 페놀 기질 및 아민 기질은 이에 한정되지 않지만 각각 0.5mM~5mM이 투여하는 것이 바람직하며, 가장 바람직하게는 각각 0.5mM로 투여할 수 있다. 또한 발현유도인자를 투여하는 경우 이에 한정되지 않지만 각각 0.01mM~1mM이 투여하는 것이 바람직하며, 가장 바람직하게는 각각 0.1mM로 투여할 수 있다. In addition, in the step (a), the phenol substrate and the amine substrate are not limited thereto, but preferably 0.5mM to 5mM, and most preferably, 0.5mM may be administered . In addition, in the case of administering the expression inducer, but not limited to each, preferably 0.01mM to 1mM, and most preferably, 0.1mM can be administered respectively .
또한 상기 (a) 단계에서 세균을 배양하기 위한 조건으로, 이에 한정되지 않지만 바람직하게는 28~40℃의 조건에서 2~4시간 배양하는 것이 바람직하다.In addition, the conditions for culturing the bacteria in the step (a), but is not limited to this, preferably incubated for 2 to 4 hours at the conditions of 28 ~ 40 ℃.
상기 (a) 단계에서 상기 형질전환된 세균에서 생산된 4-쿠마레이트-코엔자임A 리가아제(4-Coumarate-CoA ligase) 효소가 페놀 기질에 코에이 그룹을 붙여 활성형태의 페놀 화합물을 합성하고, 세로토닌 하이드록시신나모일 트랜스퍼라제(Serotonin N-hydroxycinnamoyltransferase) 효소는 상기 활성형태의 페놀 화합물과 아민 기질을 이용하여 페닐프로파노이드 아미드계 화합물을 생합성할 수 있다.In step (a), the 4-coumarate-CoA ligase enzyme produced by the transformed bacterium attaches a coay group to the phenol substrate to synthesize an active phenolic compound, Serotonin hydroxycinnamoyl transferase (Serotonin N -hydroxycinnamoyltransferase) enzyme can biosynthesize a phenylpropanoid amide compound using the phenolic compound and amine substrate of the active form.
본 발명의 일실시예에서는 상기 형질전환된 세균에 발현유도인자(IPTG) 0.1mM, 쿠마르산 1mM 및 세로토닌 1mM 농도로 처리하고, 28℃의 조건에서 36시간 배양하였다(<실시예 2-1> 참조). 또한 상기 형질전환된 세균에 발현유도인자(IPTG)를 0.1mM를 투여한 후, 쿠마르산(coumaric acid) 및 세로토닌(serotonin)을 각각 0.5, 1, 1.5, 2 또는 5mM로 처리 한 다음 28℃에서 3시간 동안 배양한 결과, 2mM 기질 농도에서 쿠마로일세로토닌의 생산이 포화상태에 도달함을 알 수 있었다(<실시예 2-2> 참조). 한편 상기 형질전환된 세균에 다양한 페놀 기질 및 아민 기질을 투여한 결과 다양한 페닐프로파노이드 아미드계 화합물이 대량 생산될 수 있음을 알 수 있었다(<실시예 3> 참조).In one embodiment of the present invention, the transformed bacteria were treated with an expression inducer (IPTG) of 0.1 mM, coumaric acid, 1 mM and
한편 상기 (b) 단계의 페닐프로파노이드 아미드계 화합물은 쿠마로일세로토닌, 페루로일세로토닌, 카페오일세로토닌, 시나포일세로토닌, 시나모일세로토닌, 쿠마로일옥토파민 및 쿠마로일티라민으로 이루어진 군에서 선택된 것임을 특징으로 한다.On the other hand, the phenyl propaneoid amide compound of step (b) is a group consisting of coumaroyl serotonin, peruroyl serotonin, caffeoyl serotonin, cinafoyl serotonin, cinamoyl serotonin, coumaroyl octopamine and coumaroyl tyramine. It is characterized in that selected from.
상기 (b) 단계에서 상기 배양된 세균으로부터 생산된 페닐프로파노이드 아미드계 화합물을 분리하는 것은 이에 한정되지 않지만 세균 배양액에 유기용매를 투여하여 쉽게 분리할 수 있다. 상기 유기용매로는 이에 한정되지 않지만 에테르, 클로로포름, 및 에틸아세테이트로 이루어진 그룹 중에서 선택하여 사용할 수 있으며 바람직하게는 에틸아세테이트(ethylacetate)를 사용할 수 있다. 또한 필요에 따라 크로마토그래피와 같은 통상적으로 사용되는 정제 방법을 이용하여 상기 용매에 의한 추출액으로부터 페닐프로파노이드 아미드계 화합물을 정제할 수 있다.Separating the phenylpropanoid amide compound produced from the cultured bacteria in step (b) is not limited thereto, and can be easily separated by administering an organic solvent to the bacterial culture. The organic solvent may be selected from the group consisting of ether, chloroform, and ethyl acetate, but is not limited thereto. Preferably, ethyl acetate may be used. In addition, if necessary, a phenyl propaneoid amide compound may be purified from the extract by the solvent using a commonly used purification method such as chromatography.
본 발명의 일실시예에서는 상기 배양된 세균을 원심 분리하여 수득한 균체침전물 또는 배양액에 에틸아세테이트로 투여하여 페닐프로파노이드 아미드계 화합물 을 분리한 후, 고속액체크로마토그라피(HPLC)를 수행하여 페닐프로파노이드 아미드계 화합물을 정량하였다(<실시예 2-2> 참조). 특히 상기 균체침전물 보다는 상기 배양액에서 더 많은 페닐프로파노이드 아미드계 화합물이 분리 및 생산되었다(도 4 참조).In one embodiment of the present invention, the cellulose propane obtained by centrifugation of the cultured bacteria or the culture solution was administered with ethyl acetate to separate the phenyl propanoid amide compound, and then subjected to high performance liquid chromatography (HPLC) to phenyl Propaneoid amide compounds were quantified (see <Example 2-2>). In particular, more phenylpropanoid amide compounds were isolated and produced in the culture medium than the cell precipitate (see FIG. 4).
상기 본 발명의 페닐프로파노이드 아미드계 화합물의 생산방법은 본 발명의 형질전환된 세균에 페놀 기질 및 아민 기질을 투여함으로써 아주 간단하게 페닐프로파노이드 아미드계 화합물을 대량 생산할 수 있는 방법이며, 특히 상기 본 발명의 형질전환된 세균은 페닐프로파노이드 아미드계 화합물을 배양액으로 분비하므로 형질전환체를 파쇄하지 않아도 되어 재활용 또는 연속배양이 가능하여 아주 경제적이다. 뿐만 아니라 상기 본 발명에 의하여 제조된 페닐프로파노이드 아미드계 화합물은 세균의 배양액 속에 다량 분포하여 용이하게 분리 및 정제될 수 있으므로, 본 발명의 생산방법은 비용 및 공정 면에서 매우 유리하다. The method for producing the phenylpropaneoid amide compound of the present invention is a method for mass production of phenylpropanoid amide compound very simply by administering a phenol substrate and an amine substrate to the transformed bacterium of the present invention. Since the transformed bacteria of the present invention secrete the phenylpropanoid amide-based compound into the culture medium, the transformant does not have to be crushed, so it can be recycled or continuously cultured, which is very economical. In addition, the phenylpropanoid amide compound prepared according to the present invention can be easily separated and purified by large distribution in the culture medium of bacteria, the production method of the present invention is very advantageous in terms of cost and process.
이상 살펴본 바와 같이, 본 발명의 재조합 벡터에 의하여 제조된 본 발명의 형질전환된 세균에 페놀 기질 및 아민 기질을 투여하면 페닐프로파노이드 아미드계 화합물을 대량 생산할 수 있다. 따라서 상기 형질전환된 세균을 이용한 본 발명의 페닐프로파노이드 아미드계 화합물의 생산방법은 아주 간단하게 페닐프로파노이드 아미드계 화합물을 대량 생산할 수 있는 방법이며, 특히 상기 본 발명의 형질전환 된 세균은 페닐프로파노이드 아미드계 화합물을 배양액으로 분비하므로 형질전환체를 파쇄하지 않아도 되어 재활용 또는 연속배양이 가능하여 아주 경제적이다. 뿐만 아니라 상기 본 발명에 의하여 제조된 페닐프로파노이드 아미드계 화합물은 세균의 배양액 속에 다량 분포하여 용이하게 분리 및 정제될 수 있으므로, 본 발명의 생산방법은 비용 및 공정 면에서 매우 유리하다.As described above, when the phenol substrate and the amine substrate are administered to the transformed bacteria of the present invention prepared by the recombinant vector of the present invention, it is possible to mass-produce the phenylpropanoid amide compound. Therefore, the method for producing the phenylpropanoid amide compound of the present invention using the transformed bacterium is a very simple method for mass production of the phenylpropanoid amide compound, and in particular, the transformed bacterium of the present invention Since the phenyl propanoid amide compound is secreted into the culture medium, the transformant does not have to be crushed, so it can be recycled or continuously cultured, which is very economical. In addition, the phenylpropanoid amide compound prepared according to the present invention can be easily separated and purified by large distribution in the culture medium of bacteria, the production method of the present invention is very advantageous in terms of cost and process.
이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.
<실시예 1> <Example 1>
4CL2 및 SHT 유전자 발현용 재조합 대장균의 제조Preparation of Recombinant E. Coli for Expression of 4CL2 and SHT Genes
<1-1> <1-1> 4CL2 및 SHT 유전자의 클로닝 및 형질전환용 발현 벡터의 제조Preparation of Expression Vectors for Cloning and Transforming 4CL2 and SHT Genes
4CL(4-Coumarate-CoA ligase) 유전자는 공지된 애기장대에서 유래된 4CL2 (유전자은행번호 AF106086)((Ehlting et al., Plant J. 19, 9-20, 1999) 유전자의 염기서열을 이용하여, 역전사 중합효소 연쇄반응(reverse transcription-polymerase chain reaction; RT-PCR)을 통해 클로닝하였다.The 4CL (4-Coumarate-CoA ligase) gene is obtained by using the nucleotide sequence of the 4CL2 (Gene Bank No. AF106086) ((Ehlting et al., Plant J. 19, 9-20, 1999) gene derived from a known Arabidopsis. It was cloned through reverse transcription-polymerase chain reaction (RT-PCR).
구체적으로 상처가 생긴지 12시간이 지난 애기장대 잎으로부터 TRI 시약을 이용(Molecular Research Center, Inc., 미국)하여 전체 RNA를 추출하였고, 이 전체 RNA를 주형으로 하여 역전사 중합효소 연쇄반응을 수행하였다. 먼저 cDNA를 합성하기 위해 역전사효소(reverse transcriptase) SuperScript II(Invitrogen Inc., 미국)를 이용하였고, 프라이머는 올리고 dT를 사용하였다. 상기 역전사효소 반응 산물을 주형으로 하고, NdeI 제한효소부위(밑줄그음)를 갖는 전방향 프라이머 5'-(atacatatgacgacacaagat)-3'(서열번호 1) 및 XhoI 제한효소부위(밑줄그음)를 갖는 역방향 프라이머 5'-(agactcgagctagttcattaatcc)-3'(서열번호 2)을 사용하여 PCR 반응을 수행하였다. 상기 PCR 반응에 의한 4CL2 유전자 생성물(서열번호 5)을 제한효소 NdeI 및 XhoI으로 절단하고, 겔 정제한 후, 벡터 pETDuet-1(Novagen사, 미국)내의 동일한 제한효소 부위 내로 삽입시켜 pETDuet-4CL2 벡터를 제작하였다.Specifically, total RNA was extracted from the Arabidopsis foliar leaves 12 hours after the wounding using TRI reagent (Molecular Research Center, Inc., USA), and reverse transcription polymerase chain reaction was performed using the entire RNA as a template. First, reverse transcriptase SuperScript II (Invitrogen Inc., USA) was used to synthesize cDNA, and oligo dT was used as a primer. The reverse transcriptase reaction product was used as a template, and the forward primer 5 '-(ata catatg acgacacaagat) -3' (SEQ ID NO: 1) and the Xho I restriction enzyme site (underlined) having an Nde I restriction enzyme site (underlined) PCR reactions were performed using
또한 고추 SHT(Serotonin N-hydroxycinnamoyltransferase) 유전자의 전장 cDNA(유전자은행번호 AF329463)(Back et al., Plant Cell Physiol. 42, 475-481, 2001, 서열번호 6)를 주형으로, NcoI 제한효소부위(밑줄그음)를 갖는 전방향 프라이머 5'-(cataccatggcttctgctcct)-3'(서열번호 3) 및 NotI 제한효소부위(밑줄그음)를 갖는 역방향 프라이머 5'-(tatgcggccgcctaacagcttcctgcacc)-3'(서열번호 4)을 사용하여 PCR 반응을 수행였다. 상기 PCR 반응에 의한 생성물을 제한효소 NcoI 및 NotI으로 절단하고, 겔 정제한 후, 상기 제조된 pETDuet-4CL2 벡터내의 동일한 제한효소 부위 내로 삽입시켜 pETDuet-SHT+4CL2 벡터를 제조하였다(도 1 및 2 참조)Also pepper SHT (Serotonin -hydroxycinnamoyltransferase N) full-length cDNA of the gene (gene bank number AF329463) to (Back et al., Plant Cell Physiol. 42, 475-481, 2001, SEQ ID NO: 6) of the mold, Nco I restriction
<1-2> <1-2> 4CL2 및 SHT 유전자 발현용 재조합 대장균의 제조Preparation of Recombinant E. Coli for Expression of 4CL2 and SHT Genes
상기 <실시예 1-1>에서 제조된 pETDuet-SHT+4CL2 벡터 1㎍ DNA를 상업적으로 구입 가능한 E.coli BL21(DE3)(Novagen사, 미국) 균주 15㎕와 혼합하여, 얼음에 30분간 두었다가, 42℃에 40초간 열 쇼크를 가하고, 다시 얼음에 1분간 냉각 시킨 후, 60㎕의 SOC 배지(Bacto-trypton 20g, Bacto-yeast extracts 5g, NaCl 0.5 g, 1M KCl 2.5 ml/L)를 첨가한 후 1시간동안 37℃에 배양하였다. 배양 후 상기 균주를 암피실린이 함유된 YEP 고체 배지에서 배양하여 4CL2 및 SHT 유전자 발현용 재조합 대장균을 제조하였다. 상기 제조된 재조합 대장균을 'pETDuet-SHT+4CL2(BL21(DE3))'라 명명하고, 2008년 2월 4일에 한국유전자은행(Korean Collection for Type culture, 대전 유성구 어은동 52번지 한국생명공학연구원내 소재)에 기탁하였다(기탁번호: KCTC 11272BP).1 μg DNA of the pETDuet-SHT + 4CL2 vector prepared in Example 1-1 was mixed with 15 μl of a commercially available strain of E. coli BL21 (DE3) (Novagen, USA) and left on ice for 30 minutes. Heat shock was applied at 42 ° C. for 40 seconds, and after cooling on ice for 1 minute, 60 μl of SOC medium (20 g of Bacto-trypton, 5 g of Bacto-yeast extracts, 0.5 g of NaCl, and 2.5 ml / L of 1M KCl) was added. After incubation for 1 hour at 37 ℃. After culturing, the strain was cultured in YEP solid medium containing ampicillin to prepare recombinant E. coli for 4CL2 and SHT gene expression. The recombinant E. coli prepared above was named 'pETDuet-SHT + 4CL2 (BL21 (DE3))', and on February 4, 2008, the Korean Gene Bank (Korean Collection for Type culture, 52, Eeun-dong, Yuseong-gu, Daejeon) (Accession number: KCTC 11272BP).
<실시예 2><Example 2>
재조합 대장균을 이용한 쿠마로일세로토닌(coumaroylserotonin)의 생산Production of coumaroylserotonin using recombinant E. coli
<2-1> <2-1> 재조합 대장균에서 SHT 단백질의 발현 여부 확인Expression of SHT Protein in Recombinant Escherichia Coli
상기 <실시예 1-2>에서 제조된 4CL2 및 SHT 유전자 발현용 재조합 대장균을 통상적인 암피실린(ampicillin) 함유 YEP 배지에서 배양물의 흡광도(O.D.600)가 1.5에 도달 할 때까지 37℃에서 배양한 후, 발현유도인자(IPTG)를 0.1mM, 쿠마르산 1mM 및 세로토닌을 1mM 농도로 처리하고, 28℃의 조건에서 36시간 배양하면서, 시간 별로 상기 대장균 배양액을 원심 분리하여 균체침전물과 배양액으로 구분하였 다.After incubating the recombinant Escherichia coli 4CL2 and SHT gene expression prepared in <Example 1-2> at 37 ℃ until the absorbance (OD600) of the culture reached 1.5 in conventional ampicillin (ampicillin) containing YEP medium Treatment of the expression inducer (IPTG) with 0.1mM, 1mM of kumaric acid and serotonin at 1mM concentration, and 36 hours of incubation at 28 ° C, the E. coli culture was centrifuged to separate the cell precipitate and the culture medium. .
상기 배양기간 동안 상기 실시예 <1-2>에서 제조된 재조합 대장균에서 SHT 단백질이 발현되는지를 알아보기 위하여, 상기 재조합 대장균의 전체 배양액 5㎕를 전기영동으로 분리한 후(SDS-PAGE), 니트로셀루로즈(nitrocellulose) 막에 블롯팅시키고, SHT 항체로 면역 반응시켰다(Back et al., Plant Cell Physiol. 42, 475-481, 2001). 상기 반응에 의한 밴드를 검출하기 위하여 웨스턴 블롯팅 키트(Boehringer Manheim 사, 독일)를 이용하였으며 상기 실험 결과를 도 3에 기재하였다.In order to determine whether SHT protein is expressed in the recombinant Escherichia coli prepared in Example <1-2> during the incubation period, 5 µl of the total culture solution of the recombinant Escherichia coli was separated by electrophoresis (SDS-PAGE), and nitro Blot on nitrocellulose membrane and immunoreact with SHT antibody (Back et al., Plant Cell Physiol . 42, 475-481, 2001). Western blotting kit (Boehringer Manheim, Germany) was used to detect the band due to the reaction and the experimental results are shown in FIG. 3.
상기 도 3에 기재된 바와 같이, 상기 배양기간 동안 재조합 대장균에서 SHT 단백질이 안정적으로 발현되고 있음을 알 수 있었으며, 상기 SHT 단백질이 아민 기질과 페놀 화합물을 이용하여 페닐프로파노이드 아미드계 화합물을 생합성하는 효소인 점을 고려하면, 상기 재조합 대장균으로부터 대표적인 페닐프로파노이드 아미드계 화합물이 생산될 수 있음을 알 수 있었다.As shown in FIG. 3, it was found that SHT protein was stably expressed in recombinant E. coli during the culture period, and the SHT protein biosynthesized a phenylpropanoid amide compound using an amine substrate and a phenolic compound. Considering the enzyme, it can be seen that a representative phenylpropanoid amide compound can be produced from the recombinant E. coli.
<2-2> <2-2> 재조합 대장균을 이용한 쿠마로일세로토닌의 생산Production of Coumaroyl Serotonin Using Recombinant Escherichia Coli
상기 <실시예 2-1>에서 제조된 균체침전물 또는 배양액에 함유된 쿠마로일세로토닌(comaroylserotonin)을 정량하기 위하여, 상기 균체침전물을 그램 무게 당 1㎖의 0.1M Tris-HCl 버퍼에 녹이거나 또는 1㎖ 배양액을 각각 등량의 에틸아세테이트로 분획한 후, 에틸아세테이트 분획물을 40℃의 감압농축기에 넣어 용매를 완전히 제거하고, 100㎕의 메탄올에 녹여 고속액체크로마토그라피(HPLC)로 정량하였 다. 상기 고속액체크로마토그라피에서 사용된 컬럼은 Wakosil II 3C18HG(4.6× 150mm)이며, 전개용매로 0.5% TFA가 함유된 35% 메탄올을 사용하였으며 분리된 물질은 320nm에서 측정하여(Jang et al., Plant Physiol. 135, 346-356, 2004), 그 결과를 도 4에 기재하였다.In order to quantify the comoylserotonin contained in the cell precipitate or culture medium prepared in <Example 2-1>, the cell precipitate was dissolved in 1 ml of 0.1 M Tris-HCl buffer per gram weight or After diluting 1 mL of the culture solution with an equivalent amount of ethyl acetate, the ethyl acetate fraction was placed in a vacuum concentrator at 40 ° C. to completely remove the solvent, dissolved in 100 μl of methanol, and quantified by high performance liquid chromatography (HPLC). The column used in the high performance liquid chromatography was Wakosil II 3C18HG (4.6 × 150 mm), 35% methanol containing 0.5% TFA as the developing solvent, and the separated material was measured at 320 nm (Jang et al., Plant Physiol. 135, 346-356, 2004), and the results are described in FIG.
상기 도 4에 기재된 바와 같이, 상기 배양액에서는 약 200㎎/ℓ, 상기 균체침전물에서는 약 30㎎/ℓ의 쿠마로일세로토닌이 생산되었으며 총 230㎎/ℓ의 쿠마로일세로토닌이 기질 처리 후 3시간 내에 생산되었고, 배양시간 36 시간동안 안정적으로 생산되고 있음을 확인 할 수 있었다. 특히 기질 처리 후 배양시간을 좀 더 세분화해 본 결과, 30분 내에 150㎎/ℓ 정도의 쿠마로일세로토닌이 생산되었고, 2시간 내에 최대치인 230~240㎎/ℓ 에 도달됨을 볼 수 있었다.As shown in FIG. 4, about 200 mg / l of the culture medium and about 30 mg / l of coumaroyl serotonin were produced in the cell precipitate and a total of 230 mg / L of coumaroyl serotonin was treated for 3 hours after substrate treatment. It was produced in, it was confirmed that the production is stable for 36 hours. In particular, as a result of further subdividing the incubation time after the substrate treatment, it was found that about 30 mg / L of coumaroyl serotonin was produced within 30 minutes, and reached a maximum value of 230-240 mg / L in 2 hours.
따라서 상기 재조합된 대장균은 페닐프로파노이드 아미드계 화합물을 2시간 정도의 짧은 시간 내에 대부분 배양액으로 분비하므로, 배양액으로부터 상기 화합물을 추출한 후, 배양액을 다시 대장균 균체와 혼합하여 재활용 또는 연속배양을 함으로써, 상기화합물을 24시간 내에 12회 정도 연속적으로 추출할 수 있어 매우 용이하게 대량으로 상기 화합물을 수득할 수 있음을 알 수 있다.Therefore, the recombinant Escherichia coli secretes most of the phenylpropanoid amide compound into the culture medium within a short time of about 2 hours. After extracting the compound from the culture medium, the culture medium is mixed with the E. coli cells and recycled or continuously cultured. It can be seen that the compound can be continuously extracted about 12 times within 24 hours, so that the compound can be obtained in large quantities easily.
<2-3> <2-3> 재조합 대장균을 이용한 쿠마로일세로토닌의 기질 농도별 생산량 비교Comparison of Production of Kumaroyl Serotonin by Substrate Concentration Using Recombinant Escherichia Coli
상기 <실시예 2-1>에서 배양된 재조합 대장균(O.D. 600= 1.5)에 발현유도인자(IPTG)를 0.1mM를 투여한 후, 쿠마르산(coumaric acid) 및 세로토닌(serotonin)을 각각 0.5, 1, 1.5, 2 또는 5mM로 처리 한 다음 28℃에서 3시간 동안 배양하고 원심 분리하였다. 상기 원심 분리한 후 배양액에 함유된 쿠마로일세로토닌의 함량을 상기 <실시예 2-2>와 동일한 방법으로 정량하고 그 결과를 도 5에 기재하였다.After administering 0.1 mM of the expression inducer (IPTG) to the recombinant E. coli (OD 600 = 1.5) cultured in Example 2-1, coumaric acid and serotonin 0.5 and 1, respectively. , 1.5, 2 or 5mM and then incubated for 3 hours at 28 ℃ and centrifuged. After centrifugation, the amount of coumaroyl serotonin contained in the culture was quantified in the same manner as in <Example 2-2>, and the results are shown in FIG. 5.
상기 도 5에 기재된 바와 같이, 쿠마르산 및 세로토닌을 0.5 또는 1mM을 처리한 경우 200mg/ℓ의 쿠마로일세로토닌이 생산되었고, 2 또는 5mM 을 처리한 경우 250mg/ℓ의 쿠마로일세로토닌이 생산됨을 확인하였다. 상기 결과로부터, 쿠마르산 및 세로토닌의 농도를 높일수록 쿠마로일세로토닌 생산량이 증대되지만, 기질 농도에 비례해서 지속적으로 쿠마로일세로토닌이 생산량이 증대되는 것은 아니며, 2mM 기질 농도에서 쿠마로일세로토닌의 생산이 포화상태에 도달함을 알 수 있었다. 특히, 0.5mM 및 1mM의 쿠마르산(coumaric acid) 및 세로토닌(serotonin)을 처리 할 경우, 모든 기질이 쿠마로일세로토닌 생산에 이용되기 때문에, 잔존하는 기질이 배양액에 더 이상 존재하지 않는다. 따라서 컬럼정제나 고속액체크로마토그라피(HPLC)정제과정을 거치지 않아도 배양액의 에틸아세테이트 추출만으로도 98-100% 순도의 정제된 쿠마로일세로토닌을 손쉽게 수득 할 수 있다.As shown in FIG. 5, when 0.5 or 1 mM of cumaric acid and serotonin were treated, 200 mg / L of coumaroyl serotonin was produced, and when 2 or 5 mM was treated, 250 mg / L of coumaroyl serotonin was produced. Confirmed. From the above results, the higher the concentrations of cumaric acid and serotonin, the higher the yield of coumaroyl serotonin, but the yield of coumaroyl serotonin does not continuously increase in proportion to the substrate concentration. It can be seen that the production reaches saturation. In particular, when treating 0.5 mM and 1 mM coumaric acid and serotonin, all the substrates are used for the production of coumaroyl serotonin, so that the remaining substrate is no longer present in the culture. Therefore, even without the column purification or high-performance liquid chromatography (HPLC) purification process can be obtained easily purified Kumaroyl serotonin of 98-100% purity only by extracting the ethyl acetate of the culture.
<< 실시예Example 3> 3>
재조합 대장균을 이용한 다양한 페닐프로파노이드 아미드계 화합물의 생산Production of Various Phenylpropanoid Amide Compounds Using Recombinant Escherichia Coli
상기 <실시예 2-1>에서 배양된 재조합 대장균에 발현유도인자(IPTG)를 0.1mM를 투여한 후, 하기와 같은 다양한 페놀 기질 및 아민 기질을 1mM 농도로 처리하여 생성된 페닐프로파노이드 아미드계 화합물을 상기 <실시예 2-2>와 동일한 방법으로 정량하고 그 결과를 도 6에 기재하였다.After administering 0.1 mM of expression inducer (IPTG) to the recombinant Escherichia coli cultured in <Example 2-1>, and then treated with various phenol substrates and amine substrates at a concentration of 1 mM, phenylpropanoid amide The compound was quantified in the same manner as in <Example 2-2>, and the results are shown in FIG. 6.
상기 도 6에 기재된 바와 같이, 쿠마르산 및 세로토닌을 처리한 경우 200㎎/ℓ의 쿠마로일세로토닌이 생산되었고 페루릭산(ferulic acid) 및 세로토닌을 처리한 경우 페루로일세로토닌이 약 90㎎/ℓ 생산됨을 확인하였다. 또한 쿠마르산과 옥토파민(octopamine)을 처리한 경우 쿠마로일옥토파민이 약 200㎎/ℓ 생산되었고, 쿠마르산과 티라민(tyramine)을 처리한 경우 쿠마로일티라민이 180㎎/ℓ 생산됨을 확인하였다.As shown in FIG. 6, 200 mg / l of coumaroyl serotonin was produced when treated with coumaric acid and serotonin and about 90 mg / l when treated with ferulic acid and serotonin. Confirmed to be produced. In addition, it was confirmed that when Kumaric acid and octopamine were treated, Kumaroyl Octopamine was produced about 200 mg / l, and when Kumaric Acid and tyramine were treated, Kumaroyl Tyramine was produced 180 mg / l.
상기의 결과로부터 SHT 유전자 및 4CL2 유전자를 대장균에 발현함으로써 다양한 종류의 페닐프로파노이드 아미드계 화합물을 생산할 수 있음을 알 수 있었다.From the above results, it was found that by expressing the SHT gene and 4CL2 gene in Escherichia coli, various kinds of phenylpropanoid amide compounds can be produced.
도 1은 4CL 및 SHT 유전자 발현용 재조합 대장균 발현 벡터의 모식도이다(SHT: 세로토닌 하이드록시신나모일 트랜스퍼라제, 4CL: 4-쿠마레이트 코엔자임A 리가아제).1 is a schematic diagram of recombinant E. coli expression vectors for 4CL and SHT gene expression (SHT: serotonin hydroxycinnamoyl transferase, 4CL: 4-coumarate coenzyme A ligase).
도 2는 4CL2 및 SHT 유전자 발현용 재조합 대장균 발현 벡터의 개열지도이다(SHT: 세로토닌 하이드록시신나모일 트랜스퍼라제, 4CL2: 4-쿠마레이트 코엔자임A 리가아제, T7/lac: T7/lac 프로모터, rbs:리보좀 결합부위, T7 ter: T7 종결부위, f1 origin: 복제 개시점, AmpR: 암피실린 저항성 유전자).2 is a cleavage map of recombinant E. coli expression vectors for 4CL2 and SHT gene expression (SHT: serotonin hydroxycinnamoyl transferase, 4CL2: 4-coumarate coenzyme A ligase, T7 / lac: T7 / lac promoter, rbs: Ribosomal binding site, T7 ter: T7 termination site, f1 origin: origin of replication, Amp R : ampicillin resistance gene).
도 3은 재조합 대장균에서 SHT 단백질의 발현 여부를 시간별로 확인한 결과를 나타낸 사진이다(SHT: 세로토닌 하이드록시신나모일 트랜스퍼라제).3 is a photograph showing the results of confirming the expression of SHT protein in recombinant E. coli over time (SHT: serotonin hydroxycinnamoyl transferase).
도 4는 재조합 대장균을 이용한 쿠마로일세로토닌의 생산정도를 시간별로 확인한 결과를 나타낸 그래프이다(CS: 쿠마로일세로토닌).Figure 4 is a graph showing the results of confirming the production of cumuloyl serotonin over time using recombinant E. coli (CS: cumaroyl serotonin).
도 5는 재조합 대장균을 이용한 쿠마로일세로토닌의 기질 농도별 생산량을 비교한 그래프이다.Figure 5 is a graph comparing the production of the substrate concentration of Kumaroyl serotonin using recombinant E. coli.
도 6은 재조합 대장균을 이용한 다양한 페닐프로파노이드 아미드계 화합물의 생산량을 나타낸 그래프이다.6 is a graph showing the yield of various phenylpropanoid amide compounds using recombinant E. coli.
<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Recombinant vector containing 4CL gene and SHT gene, microorganism transformed thereof and method for preparation phenylpropanoid amide-based compounds using the same <130> NP08-0013 <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4CL-F <400> 1 atacatatga cgacacaaga t 21 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4CL-R <400> 2 agactcgagc tagttcatta atcc 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SHT-F <400> 3 cataccatgg cttctgctcc t 21 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SHT-R <400> 4 tatgcggccg cctaacagct tcctgcacc 29 <210> 5 <211> 1671 <212> DNA <213> Arabidopsis thaliana <400> 5 atgacgacac aagatgtgat agtcaatgat cagaatgatc agaaacagtg tagtaatgac 60 gtcattttcc gatcgagatt gcctgatata tacatcccta accacctccc actccacgac 120 tacatcttcg aaaatatctc agagttcgcc gctaagccat gcttgatcaa cggtcccacc 180 ggcgaagtat acacctacgc cgatgtccac gtaacatctc ggaaactcgc cgccggtctt 240 cataacctcg gcgtgaagca acacgacgtt gtaatgatcc tcctcccgaa ctctcctgaa 300 gtagtcctca ctttccttgc cgcctccttc atcggcgcaa tcaccacctc cgcgaacccg 360 ttcttcactc cggcggagat ttctaaacaa gccaaagcct ccgcggcgaa actcatcgtc 420 actcaatccc gttacgtcga taaaatcaag aacctccaaa acgacggcgt tttgatcgtc 480 accaccgact ccgacgccat ccccgaaaac tgcctccgtt tctccgagtt aactcagtcc 540 gaagaaccac gagtggactc aataccggag aagatttcgc cagaagacgt cgtggcgctt 600 cctttctcat ccggcacgac gggtctcccc aaaggagtga tgctaacaca caaaggtcta 660 gtcacgagcg tggcgcagca agtcgacggc gagaatccga atctttactt caacagagac 720 gacgtgatcc tctgtgtctg gcctatgttc catatatacg ctctcaactc catcatgctc 780 tgtagtctca gaattggtgc cacgatcttg ataatgccta agttcgaaat cactctcttg 840 ttagagcaga tacaaaggtg taaagtcacg gtggctatgg tcgtgccacc gatcgtttta 900 gctatcgcga agtcgccgga gacggagaag tatgatctga gctcggttag gatggttaag 960 tctggagcag ctcctcttgg taaggagctt gaagatgcta ttagtgctaa gtttcctaac 1020 gccaagcttg gtcagggcta tgggatgaca gaagcaggtc cggtgctagc aatgtcgtta 1080 gggtttgcta aagagccgtt tccagtgaag tcaggagcat gtggtacggt ggtgaggaac 1140 gccgagatga agatacttga tccagacaca ggagattctt tgcctaggaa caaacccggc 1200 gaaatatgca tccgtggcaa ccaaatcatg aaaggctatc tcaatgaccc cttggccacg 1260 gcatcgacga tcgataaaga tggttggctt cacactggag acgtcggatt tatcgatgat 1320 gacgacgagc ttttcattgt ggatagattg aaagaactca tcaagtacaa aggatttcaa 1380 gtggctccag ctgagctaga gtctctcctc ataggtcatc cagaaatcaa tgatgttgct 1440 gtcgtcgcca tgaaggaaga agatgctggt gaggttcctg ttgcgtttgt ggtgagatcg 1500 aaagattcaa atatatccga agatgaaatc aagcaattcg tgtcaaaaca ggttgtgttt 1560 tataagagaa tcaacaaagt gttcttcact gactctattc ctaaagctcc atcagggaag 1620 atattgagga aggatctaag agcaagacta gcaaatggat taatgaacta g 1671 <210> 6 <211> 753 <212> DNA <213> Capsicum annuum <400> 6 atggcttctg ctcctcaacc accaactcta tctgaaaaaa ccactaatct ctcaccggaa 60 aacgacaatg ttacgatcac cggaaagata tatacaagag tccgccttgc tacaaaatct 120 gatctgcacc atgcatacca gttgttttac caaatccacg cataccataa ccaatttcat 180 ttattcaaag caacagagtc ctccttatcg gacttgttct ttaaagaaaa tcctcttccc 240 cttttctacg gaccaaccct acttctactc gaagtctccc cgaccgcttt tactgaaccc 300 aaaaataaca aggacgaagg gttcaaaccc gtctttacag cgctcgacct taaatttcct 360 gtcgtggaag gacaagttga ggagtttcgg tccaaatatg atgatggaac cgataaacgt 420 gatgtgttca tcgcgggata tgcttacttt tttgctagtt attcactctt cgggaacgac 480 aaaccgggga tccatttcga cagtctttac ttcagggaaa gctatagaaa attgggaatg 540 ggaaaattgt tgtttggaac tgttgcgtct attgctgcga acaatgggtt tgctgcggtg 600 gagggaattg tagcagtttg gaataaaaag tcatatgatt tttatgtgag tatgggtgtt 660 gaaatgcatg atgactttag gtttggcaaa ttggacggtg aaaatcttca aaagtacgct 720 gataaggaga aaaatggtgc aggaagctgt tag 753 <110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Recombinant vector containing 4CL gene and SHT gene, microorganism transformed lili and method for preparation phenylpropanoid amide-based compounds using the same <130> NP08-0013 <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4CL-F <400> 1 atacatatga cgacacaaga t 21 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4CL-R <400> 2 agactcgagc tagttcatta atcc 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SHT-F <400> 3 cataccatgg cttctgctcc t 21 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SHT-R <400> 4 tatgcggccg cctaacagct tcctgcacc 29 <210> 5 <211> 1671 <212> DNA <213> Arabidopsis thaliana <400> 5 atgacgacac aagatgtgat agtcaatgat cagaatgatc agaaacagtg tagtaatgac 60 gtcattttcc gatcgagatt gcctgatata tacatcccta accacctccc actccacgac 120 tacatcttcg aaaatatctc agagttcgcc gctaagccat gcttgatcaa cggtcccacc 180 ggcgaagtat acacctacgc cgatgtccac gtaacatctc ggaaactcgc cgccggtctt 240 cataacctcg gcgtgaagca acacgacgtt gtaatgatcc tcctcccgaa ctctcctgaa 300 gtagtcctca ctttccttgc cgcctccttc atcggcgcaa tcaccacctc cgcgaacccg 360 ttcttcactc cggcggagat ttctaaacaa gccaaagcct ccgcggcgaa actcatcgtc 420 actcaatccc gttacgtcga taaaatcaag aacctccaaa acgacggcgt tttgatcgtc 480 accaccgact ccgacgccat ccccgaaaac tgcctccgtt tctccgagtt aactcagtcc 540 gaagaaccac gagtggactc aataccggag aagatttcgc cagaagacgt cgtggcgctt 600 cctttctcat ccggcacgac gggtctcccc aaaggagtga tgctaacaca caaaggtcta 660 gtcacgagcg tggcgcagca agtcgacggc gagaatccga atctttactt caacagagac 720 gacgtgatcc tctgtgtctg gcctatgttc catatatacg ctctcaactc catcatgctc 780 tgtagtctca gaattggtgc cacgatcttg ataatgccta agttcgaaat cactctcttg 840 ttagagcaga tacaaaggtg taaagtcacg gtggctatgg tcgtgccacc gatcgtttta 900 gctatcgcga agtcgccgga gacggagaag tatgatctga gctcggttag gatggttaag 960 tctggagcag ctcctcttgg taaggagctt gaagatgcta ttagtgctaa gtttcctaac 1020 gccaagcttg gtcagggcta tgggatgaca gaagcaggtc cggtgctagc aatgtcgtta 1080 gggtttgcta aagagccgtt tccagtgaag tcaggagcat gtggtacggt ggtgaggaac 1140 gccgagatga agatacttga tccagacaca ggagattctt tgcctaggaa caaacccggc 1200 gaaatatgca tccgtggcaa ccaaatcatg aaaggctatc tcaatgaccc cttggccacg 1260 gcatcgacga tcgataaaga tggttggctt cacactggag acgtcggatt tatcgatgat 1320 gacgacgagc ttttcattgt ggatagattg aaagaactca tcaagtacaa aggatttcaa 1380 gtggctccag ctgagctaga gtctctcctc ataggtcatc cagaaatcaa tgatgttgct 1440 gtcgtcgcca tgaaggaaga agatgctggt gaggttcctg ttgcgtttgt ggtgagatcg 1500 aaagattcaa atatatccga agatgaaatc aagcaattcg tgtcaaaaca ggttgtgttt 1560 tataagagaa tcaacaaagt gttcttcact gactctattc ctaaagctcc atcagggaag 1620 atattgagga aggatctaag agcaagacta gcaaatggat taatgaacta g 1671 <210> 6 <211> 753 <212> DNA <213> Capsicum annuum <400> 6 atggcttctg ctcctcaacc accaactcta tctgaaaaaa ccactaatct ctcaccggaa 60 aacgacaatg ttacgatcac cggaaagata tatacaagag tccgccttgc tacaaaatct 120 gatctgcacc atgcatacca gttgttttac caaatccacg cataccataa ccaatttcat 180 ttattcaaag caacagagtc ctccttatcg gacttgttct ttaaagaaaa tcctcttccc 240 cttttctacg gaccaaccct acttctactc gaagtctccc cgaccgcttt tactgaaccc 300 Aaaaaataaca aggacgaagg gttcaaaccc gtctttacag cgctcgacct taaatttcct 360 gtcgtggaag gacaagttga ggagtttcgg tccaaatatg atgatggaac cgataaacgt 420 gatgtgttca tcgcgggata tgcttacttt tttgctagtt attcactctt cgggaacgac 480 aaaccgggga tccatttcga cagtctttac ttcagggaaa gctatagaaa attgggaatg 540 ggaaaattgt tgtttggaac tgttgcgtct attgctgcga acaatgggtt tgctgcggtg 600 gagggaattg tagcagtttg gaataaaaag tcatatgatt tttatgtgag tatgggtgtt 660 gaaatgcatg atgactttag gtttggcaaa ttggacggtg aaaatcttca aaagtacgct 720 gataaggaga aaaatggtgc aggaagctgt tag 753
Claims (12)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020080022494A KR100965984B1 (en) | 2008-03-11 | 2008-03-11 | Recombinant vector containing 4CL gene and SHT gene, microorganism transformed thereof and method for producing phenylpropanoid amide-based compounds using the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020080022494A KR100965984B1 (en) | 2008-03-11 | 2008-03-11 | Recombinant vector containing 4CL gene and SHT gene, microorganism transformed thereof and method for producing phenylpropanoid amide-based compounds using the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20090097388A true KR20090097388A (en) | 2009-09-16 |
KR100965984B1 KR100965984B1 (en) | 2010-06-24 |
Family
ID=41356758
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020080022494A KR100965984B1 (en) | 2008-03-11 | 2008-03-11 | Recombinant vector containing 4CL gene and SHT gene, microorganism transformed thereof and method for producing phenylpropanoid amide-based compounds using the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100965984B1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2018029097A1 (en) | 2016-08-08 | 2018-02-15 | Glaxosmithkline Intellectual Property Development Limited | Method for synthesising amides |
CN111139252A (en) * | 2019-12-31 | 2020-05-12 | 烟台金蕊女性用品有限公司 | Si4CL gene and its coding product and application |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100583207B1 (en) * | 2003-06-24 | 2006-05-25 | 전남대학교산학협력단 | Method for biosynthesizing the serotonin derivatives in plants |
-
2008
- 2008-03-11 KR KR1020080022494A patent/KR100965984B1/en active IP Right Grant
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2018029097A1 (en) | 2016-08-08 | 2018-02-15 | Glaxosmithkline Intellectual Property Development Limited | Method for synthesising amides |
CN111139252A (en) * | 2019-12-31 | 2020-05-12 | 烟台金蕊女性用品有限公司 | Si4CL gene and its coding product and application |
CN111139252B (en) * | 2019-12-31 | 2022-04-29 | 烟台金蕊女性用品有限公司 | Si4CL gene and its coding product and application |
Also Published As
Publication number | Publication date |
---|---|
KR100965984B1 (en) | 2010-06-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Cheng et al. | Molecular cloning and function assay of a chalcone isomerase gene (GbCHI) from Ginkgo biloba | |
Laudert et al. | Cloning, molecular and functional characterization of Arabidopsis thaliana allene oxide synthase (CYP 74), the first enzyme of the octadecanoid pathway to jasmonates | |
CN104769121B (en) | Vanillin synthase | |
CN106456588B (en) | Methods for the microbial production of capsaicinoids using capsaicin synthase | |
EP4095145A1 (en) | New carbon glycoside glycosyltransferase and use thereof | |
EP4108777A1 (en) | Bifunctional c-glycoside glycosyltransferases and application thereof | |
Ren et al. | Heterologous expression of BoPAP1 in tomato induces stamen specific anthocyanin accumulation and enhances tolerance to a long-term low temperature stress | |
CN110885846A (en) | Microorganism for synthesizing baicalein and scutellarein, preparation method and application thereof | |
KR100965984B1 (en) | Recombinant vector containing 4CL gene and SHT gene, microorganism transformed thereof and method for producing phenylpropanoid amide-based compounds using the same | |
Cho et al. | Characterization of regiospecific flavonoid 3′/5′-O-methyltransferase from tomato and its application in flavonoid biotransformation | |
CN114555798B (en) | Biosynthesis of eriodictyol | |
KR101533352B1 (en) | Recombinant microorganism with kaurene production ability and method for preparing kaurene using the same | |
JP2023514687A (en) | Glycosyltransferases, polynucleotides encoding them and methods of use | |
CN111440734B (en) | Genetic engineering yeast for producing baicalein compounds, and construction method and application thereof | |
Hu et al. | Molecular cloning and biochemical characterization of a new flavonoid glycosyltransferase from the aquatic plant lotus | |
CN110616205B (en) | Flavone synthase for synthesis and preparation of flavone glycoside | |
Zhu et al. | Molecular cloning and functional characterization of the anthocyanidin reductase gene from Vitis bellula | |
US6818755B2 (en) | Nucleic acid molecules encoding 10-deacetylbaccatin III-O-acetyl transferase and related products | |
CN112626047B (en) | Spermidine derivative glycosyltransferase and coding gene and application thereof | |
US20220154197A1 (en) | Cannabinoid precursor production | |
JP2023532382A (en) | Enzyme for conversion of chlorogenic acid to isochlorogenic acid | |
JP4258805B2 (en) | Biosynthetic enzymes for rose fragrance components and methods for producing rose fragrance components using the same | |
CN109762837B (en) | Method for regulating coenzyme Q synthesis by using salvia miltiorrhiza long-chain isopentenyl transferase gene SmPPS2 | |
CN113667655B (en) | Curculigo orchioides glycosyltransferase Co84A-471 gene and application thereof in preparation of orcinol glucoside | |
CN111819284B (en) | Method for producing 3-hydroxyisobutyrate and methacrylate |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20130520 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20140415 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20150602 Year of fee payment: 6 |
|
FPAY | Annual fee payment |
Payment date: 20160708 Year of fee payment: 7 |
|
FPAY | Annual fee payment |
Payment date: 20180516 Year of fee payment: 9 |
|
FPAY | Annual fee payment |
Payment date: 20190626 Year of fee payment: 10 |