KR20090090944A - Screening method for tumor suppression or tumor therapeutic agent through the regulation of light expression by axl signaling - Google Patents

Abstract

A method for screening therapeutic agent or suppressing tumor by regulating Axl signal is provided to increase the sensitivity of natural killer cell by the expression of LIGHT gene and induce apoptosis of tumor cell. A composition for suppressing tumor comprises LIGHT (lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells) (TNFSF14) or its activator as an active ingredient. The activator is Axl receptor tyrosine kinase or its ligand. The Axl ligand is an antibody to Axl antibody, gamma-carboxylated Gas-6(growth-arrest specific gene 6) or protein S. The tumor is lymphatic tumor. A method for screening agent for suppressing or treating tumor comprises: a step of adding a test compound to a LIGHT (TNFSF14) or its activator; and a step of researching the influence of the test compound on the expression or activation of LIGHT or its activator.

Description

Screening method for tumor suppression or tumor therapeutic agent through the regulation of LIGHT expression by Axl signaling}

The present invention relates to a method for screening a tumor suppressor or therapeutic agent of lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells (TNFSF14), which is regulated by Axl signals. The present invention relates to a method for inhibiting tumors by increasing expression of LIGHT by ligands of Axl receptor tyrosine kinase that induce differentiation from progenitor killer cells to mature killer cells.

The smallest unit that makes up the human body is a cell. Normally, cells divide and grow and die due to intracellular regulation and maintain the balance of cell numbers. When a cell is damaged for some reason, it is treated and recovered to act as a normal cell or, if it is not recovered, to die on its own. However, for a variety of reasons, abnormal cells that do not control this proliferation and inhibition not only proliferate uncontrolled and proliferate, but also invade surrounding tissues and organs, leading to mass formation and destruction of normal tissues. It is called.

Cells continue to grow or cease to grow, die, and die, and these processes are tightly controlled. However, in the case of cancer cells, abnormality occurs in some of the genes of the cell, and the characteristics of the protein, which is a product of these genes, are changed, and as a result, abnormality in the regulation of cell growth occurs. The abnormality of cell growth regulation is accompanied by mutations in the gene, so cancer is a genetic disease caused by the abnormality of the gene.

Known for the ligand of the Axl receptor tyrosine kinase that induces differentiation from progenitor killer cells to mature killer cells by the present inventors (Korean Patent Registration No. 10-650384, which is hereby incorporated by reference in its entirety). There is a bar. The invention is a method for producing mature natural killer cells, characterized in that the progenitor natural killer cells are treated with gamma-carboxylated Gas6 protein and protein S as ligands to differentiate into mature natural killer cells to obtain mature natural killer cells. It is about. However, the ligand of the Axl receptor tyrosine kinase is responsible for the lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells (TNFSF14), a cytokine of the family of tumor necrosis factors. It is not known until now that it can be used for tumor suppression or treatment by modulating.

LIGHT plays a pivotal role in the regulation of the immune system. LIGHT is a type II transmembrane protein belonging to the TNF family. It is inherently involved in inducing cell necrosis and has been extensively studied for its role in inducing cell necrosis in T cell regulation.

Natural killer cells (NK cells) are a type of white blood cells in the blood that are produced by human bone marrow and are immune cells that directly destroy cancer cells. To date, it is possible to find a method to distinguish cancer cells from normal cells by major histocompatibility (MHC), a specific protein of natural killer cells, and to treat cancer without side effects by using natural killer cells. However, the specific action of natural killer cells to identify and attack cancer cells and harmful cells in the human body is not known.

The present inventors have attempted to identify a method for treating cancer by inhibiting the activity of tumors by studying overexpression or inhibition of ligands of Axl receptor tyrosine kinase. Accordingly, the present inventors have one or more selected from LY [lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells] (TNFSF14) or an activator thereof as an active ingredient. The present invention was completed by identifying the possibility of use as an inhibitor or therapeutic agent.

Accordingly, it is an object of the present invention for tumor suppression, comprising one or more selected from LY [lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells] (TNFSF14) or an activator thereof as an active ingredient. It is to provide a composition.

Another object of the present invention is to provide a method for screening a tumor suppressor or therapeutic agent using the composition.

The present invention relates to a composition for inhibiting tumor, comprising at least one selected from LY [lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells] (TNFSF14) or an activator thereof. The activator is Axl Receptor Tyrosine Kinase (Axl) or a ligand thereof. In this case, the ligand of Axl uses at least one selected from the group consisting of an antibody against Axl, gamma-carboxylated growth-arrest specific gene 6 (Gas-6), and protein S (protein S). It is not limited.

Axl antibodies have been shown to have an agonistic effect on natural killer cells, which means that Axl signaling can regulate the differentiation and activity of natural killer cells. In the present invention, the analysis of Axl knock / out (K / O) mice lacking the Axl gene showed that the number of natural killer cells in various organs was reduced, and the in vivo tumor model (in Tumor growth was relatively increased in the in vivo tumor model.

Hereinafter, the present invention will be described in more detail.

At this time, if there is no other definition in the technical terms and scientific terms used, it has a meaning commonly understood by those of ordinary skill in the art.

In addition, repeated description of the same technical configuration and operation as in the prior art will be omitted.

In order to investigate the effect of LIGHT expression by Axl signaling on tumor suppressor formation, Axl stable transfectant was expressed by overexpressing Axl in each mouse and human T lymphoma cells (ATCC TIB-152). ) And they found that the expression of LIGHT and Herpesvirus entry mediator (HVEM) genes increased compared to the control group. Analysis of Axl knock-out mice lacking the Axl gene also confirmed that the expression of HVEM genes, known as LIGHT and LIGHT receptors, decreased in many organs, indicating that these genes are regulated by Axl signaling. It was identified. In addition, treatment of Axl signaling and LIGHT signaling inhibitors, similar to LIGHT gene expression, reduced cell proliferation of Axl stable transfectants and induced induction of apoptosis, which was observed in terms of apoptosis or apoptosis. It was confirmed that there is an anti-tumorigenecity effect. Therefore, in the present invention, the tumor targets lymphoma, and the expression of LIGHT gene is regulated by Axl in T lymphoma, and the sensitivity of natural killer cells by Axl to T lymphoma death is elucidated by LIGHT gene expression. It was. However, the tumor is not limited to lymphoma.

The present invention also provides a test compound to lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells (TNFSF14) or an activator thereof, wherein the test compound expresses LIGHT or an activator thereof. In addition, the present invention provides a method for screening a tumor suppressor or therapeutic agent, comprising the step of examining the effect on the activity.

 Tumor-suppressing composition comprising at least one selected from LY [lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells] (TNFSF14) or an activator thereof according to the present invention. When using as an inhibitor or therapeutic agent, the dose of the active ingredient may be appropriately determined according to the age, sex, health condition, type and severity of the disease, for example, a dose of 20 to 100 mg per day for an adult. May be administered.

The composition may be administered via any route of administration known in the art, for example orally or parenterally, but preferably, orally. Thus, the active ingredient may be combined with a pharmaceutically acceptable conventional carrier to produce tablets, hard or soft capsules, granules, chewing tablets, pills, powders, elixirs, suspensions, emulsions, solutions, syrups and oral tablets, depending on the purpose of administration. It may be formulated in the form of a preparation for administration or parenteral administration such as an aerosol, a saser, a sterile injectable solution or a sterile powder or the like. When the active ingredient of the present invention is formulated into tablets, capsules, granules, chewing tablets, pills, powders, elixirs, suspensions, emulsions, solutions, syrups and the like for the purpose of oral administration, gum arabic, corn starch , Binders such as microcrystalline cellulose or gelatin, excipients such as dicalcium phosphate or lactose, disintegrants such as alginic acid, corn starch or potato starch, lubricants such as magnesium stearate, sweeteners such as sucrose or saccharin and peppermint, Flavoring agents may be included, such as methyl salicylate or fruit flavor. When the unit dosage form is a capsule, a liquid carrier such as polyethylene glycol or fatty oil may be included in addition to the above components. In addition, injections in the form of solutions or suspensions for parenteral administration can be administered parenterally, eg, subcutaneously, intravenously, intramuscularly or intraperitoneally. Generally, injectable solutions or suspensions are effective amounts in pharmaceutically acceptable liquid carriers, such as water, saline, aqueous dextrose and related sugar solutions, nonvolatile oils, glycols such as ethanol, glycerin, polyethylene glycol, propylene glycol, and the like. It can be prepared by mixing the active ingredient homogeneously. In addition, if necessary, auxiliary agents such as antibacterial agents, chelating agents, buffers, and preservatives may be included. As the pharmaceutically acceptable carrier, any adjuvant may be used that is pharmaceutically pure, substantially non-toxic, and which does not inhibit the action of the active ingredient.

In the case of using a gene as an active ingredient, conventional gene therapy such as ex vivo therapy and in vivo therapy may be used, and retroviruses may be used as gene transfer vectors. ), Adenoviruses (adenovirus), adeno-associated virus (adeno-associated virus), herpes virus (herpes virus) and the like can be used, but is not particularly limited thereto.

As described above, the present invention is to investigate the effect of the sensitivity of the natural killer cells by Axl increased by the expression of the LIGHT gene on the tumor suppressor formation, the increase in the expression of LIGHT by Axl signaling apoptosis (apoptosis) It is expected to be useful as a tumor suppressor or therapeutic agent by confirming its anti-carcinogenic effect in terms of cell proliferation or apoptosis.

Hereinafter, the present invention will be described in more detail with reference to specific examples. However, the present invention is not limited to the following examples, and it will be apparent to those skilled in the art that various changes or modifications can be made within the spirit and scope of the present invention.

[ Example  One] Axl  Overexpressing Cell Line Construction

To produce Axl overexpressing cell lines (EL-4 mAxl, Jurkat hAxl), respectively, because Axl is not expressed in mouse T lymphoma EL4 cell line (ATCC TIB-39) and human T lymphoma Jurkat cell line (ATCC TIB-152). Total RNA and Axl primers (forward; 5'- ggtgcccatcaacttcggaa, antisense-3 ', reverse; 5'-ggatgtcccaggtggaagatt-3') isolated from mouse RAW264.7 macrophage line (ATCC TIB-71) with high Axl expression Reverse Transcription Polymerase Chain Reaction (RT-PCR) was performed to amplify Axl at 2750 bp. The amplified Axl was treated with EcoR I and CIP enzymes in pcDNA 3.1, and then Axl isolated by treatment with EcoR I restriction enzyme was added to pCR4-Axl and ligated with T4 DNA ligation to obtain recombinant pcDNA 3.1-Axl. Prepared. The cloned pcDNA3.1-Axl was transfected into EL4 and Jurkat cell lines using an Amaxa Nucleofector machine, and then treated with G418 at a concentration of 750 ug / ml to select only transfected cells to overexpress Axl. Stable transfectants were made. As a result, as shown in Figure 1, Axl overexpressed cell lines (EL-4 mAxl, Jurkat hAxl) was confirmed that significantly increased the amount of Axl compared to the control.

Example 2 Discovery of LIGHT Gene whose Expression is Regulated by Axl

Compared to the stable transfectants (EL-4 mAxl, Jurkat hAxl) and the vector control (EL-4 vector, Jurkat vector) produced as in Example 1 to determine the genes that are controlled by the expression of Axl As a result of performing RT-PCR by isolating RNA from cells (EL-4 vector, EL-4 mAxl, Jurkat vector, Jurkat hAxl), as shown in FIG. Herpesvirus entry mediator (HVEM) gene expression, known as the receptor for LIGHT, increases with Axl expression.

Example 3 Effect of Gas6 on Proliferation of Axl Overexpressing Cell Line

Axl overexpressing cells obtained in Example 1 were aliquoted to 3 × 10 ⁴ cells per well. After 48 hours of treatment with each concentration of A6-Ig, which blocks the binding of A6 and Gas6 to Gas6, which is known as Axl's ligand, and blocks Axl signal into cells, MTS (3 -(4,5-dimethylthiazol-2-yl) -5 (3-carboxymethonyphenol) -2- (4-sulfophenyl) -2H-tetrazolium) was analyzed. MTS validation was performed with tetrazolium [3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxy-phenyl) -2- (4-sulfophenyl) -2H-tetrazolium, inner salt] and electrons. -Colorimetric analysis using phenazine methosulfate (PMS), an electro-coupling reagent, was added to each well for 0.025ml of MTS / PMS mixture on the last day of cell culture, followed by reaction for 30 minutes. Absorbance was measured and analyzed at a wavelength of 495 nm using an Eliser Reader (Molecular Devices Co. Sunnyvale, CA, USA).

As a result, as shown in FIG. 3, A6 overexpression cell proliferation was increased by Gas6, and it was confirmed that Axl overexpression cell proliferation was induced by the interaction of Axl and Gas6. As a result of PCR, expression of tumor necrosis factor-related gene LIGHT increased as Gas6 was treated. On the other hand, Axl-Ig decreased Axl overexpressing cell proliferation and RT-PCR was performed to isolate RNA from these cells. As a result, LIGHT, a gene related to tumor necrosis factor, decreased as AXL-Ig treated.

Example 4 LIGHT Gene Expression by Axl Signaling-Specific Blocker Treatment

Mouse recombination of Axl overexpressing cells with inhibitors that specifically inhibit Axl signaling such as Wortmanin (Akt-inhibitor), PD98059 (MAP Kinase-inhibitor), and LY294002 (PI3K-inhibitor) Gas 6 was treated every 4 hours, 6 hours and 12 hours. As a result, as shown in FIG. 4, the expression of LIGHT was suppressed after 6 hours after the treatment of LY294002, which can suppress downstream signaling of Axl, that is, PI3K, by treatment with mouse recombinant Gas6. There was no change by treatment of Wortmanin and PD98059. The results indicate that the signaling pathway of Axl is made by intracellular PI3K and can specifically regulate the expression of LIGHT.

Example 5 Effect of LIGHT Signal on Proliferation of Axl Overexpressing Cell Line

Axl overexpressing cells obtained in Example 1 were aliquoted to 3 × 10 ⁴ cells per well. After treatment with LIGHT antibody (anti-LIGHT) and HVEM-Ig that can block LIGHT signaling pathway at 500ng / ml and 250ng / ml, respectively, the proliferation of Axl overexpressing cells was analyzed by MTS verification 96 hours later. . As a result, as shown in FIG. 5, the cells transfected with the vector alone were not significantly different from the Axl overexpressing cell proliferation compared to the control group, and the proliferation of all Axl overexpressing cells by LIGHT antibody and HVEM-Ig As a result, it was confirmed that Axl overexpressing cell proliferation was induced by the interaction of Axl and LIGHT signals. In addition, MTS test was performed to analyze the proliferation of Axl overexpressing cells 96 hours after treatment with 500ng / ml and 250ng / ml of LIGHT antibody and HVEM-Ig, respectively, with mouse Gas6 (16ug / ml). As a result, the proliferation of Axl overexpressing cells was reduced by LIGHT antibody and HVEM-Ig as in the case of not containing mouse Gas6 (16ug / ml).

Example 6 Cell Necrosis Gene Expression Regulated by Axl Expression in Axl Knock-Out Mice

To identify the gene expressed according to the presence or absence of Axl and to establish the basic technology that can be used to develop cancer diagnostic indicators using the gene regulated by Axl, RNA was isolated from the thymus tissue of Axl knock-out mice. As a result of performing RT-PCR, as shown in FIG. 6, the expression of genes such as Bax, caspase, p53 and p21 was not significantly different in Axl knock / out compared to the control group. Peforin and granzyme, which are important indicators of activity, have been reduced, suggesting that Axl plays an important role in the activity of natural killer cells.

Example 7 Induction of Apoptosis by LIGHT Signal Inhibitor in Axl Overexpressing Cells

After treatment with HVEM-Ig (1ug / ml) and anti-LIGHT (1ug / ml), which can inhibit LIGHT signal transduction in Axl overexpressing cell lines, the mice were treated with Gas6 (16ug / ml) for 12 hours. Immunostaining with Annexin V-FITC (fluoresceinated isothiocyanate, fluorescein-attached isothiocyanate) and Propidium Iodide (PI) was performed by flow cytometry analysis. As a result, apoptosis was increased by treatment with HVEM-Ig (1ug / ml) or anti-LIGHT (1ug / ml).

[ Example  8] in animal cancer models Axl Effect by

To establish an animal cancer model, mouse T lymphoma EL4 cells, which are tumor cells derived from C57BL / 6, were overexpressed by Axl knock / out mice and Axl genes that lacked the Axl gene at 7 to 8 weeks of age. After intravenous injection of 5 × 10 ⁴ mice into Axl control mice, tumor mass was measured at 8, 12, and 16 day intervals. As shown in FIG. 8, Axl gene lacking Axl gene was shown. Tumor size of the out / out mice increased significantly.

[Example 9] Role of Axl through NK Cell Surface Molecular Expression Analysis in Axl Knock-Out Mice Lacking Axl Gene

Analysis of the expression of NK cell surface molecules in Axl knock / out mice demonstrated the in vivo experimental results of Axl and the function and role of NK cells in vitro. Therefore, the phenotype of Axl knock / out mice was compared and analyzed with control mice. Bone marrow cells, spleen cells, and Liver cells were isolated from control and knock / out mice under sterile conditions according to animal care instructions and erythrocytes with cytolysis buffer (0.2% NaCl, 1.6% NaCl). Cells were reacted with 2.4G2 supernatant for 10 min on ice and washed in phosphate buffer (buffer A) containing 2 mM EDTA. In order to immunostain, the cells were adjusted to 1 × 10 ⁶ cells and washed once with staining buffer (20 mM HEPES, 3% fetal bovine serum, pH 7.4). These are natural killer cell-specific receptors that combine fluoresceinated isothiocyanate (FITC) or isothiocyanate with fluorescein or PE (phycoerythrin), namely NK1.1 (Pharmingen) and CD94 (Pharmingen). The antibody was added to the cell sample, reacted for 30 minutes at 0 ° C., washed twice with staining buffer solution, and analyzed by FACS (BD Bioscience). As shown in FIG. 8, natural killer cells were detected in Axl knock / out mice. The expression of specific receptors was significantly reduced.

[ Example  10] Axl Regulated by LIGHT Cancer cells of natural killer cells To killing power  Impact

To compare cancer cell killing ability by natural killer cells, cells were isolated from mouse spleen, stimulated with mouse interleukin-2 (10 ng / ml) for 48 hours and overexpressed Axl for 2 hours at ⁵¹ Cr (100uci). (EL4 Axl) was labeled. The labeled cells were again inhibited by the treatment of HVEM-Ig (1ug / ml) or anti-LIGHT (1ug / ml) and mixed with natural killer cells at a ratio of 10: 1, 2: 1 and 0.4: 1. After 4 hours, the amount of ⁵¹ Cr secreted into the culture supernatant was measured. As shown in FIG. 10, HVEM, a receptor for the LIGHT gene, was expressed in natural killer cells, and in cells overexpressing Axl (EL4 Axl). When Axl signal was activated by Gas6, LIGHT gene expression was also activated. However, the inhibition of LIGHT signal expression in Axl overexpressing cells (EL4 Axl) prevented interaction with HVEM receptors expressed in natural killer cells, resulting in significantly lower killing ability of natural killer cells. Indicated.

1 is the electrophoresis result after RT-PCR showing the present invention Axl overexpressing cell line production.

Figure 2 is the result of electrophoresis after RT-PCR showing the expression of LIGHT genes regulated by Axl in Axl overexpressing cell lines and Axl knock / out mice lacking the Axl gene.

Figure 3 is the result of analyzing the effect of Gas6 and Axl-Ig on Axl overexpressing cell line proliferation according to the present invention.

4 confirms LIGHT gene expression regulated by Axl after treatment with inhibitors specific for Axl signal.

5 is a result of analyzing the effect of anti-LIGHT and HVEM-Ig on Axl overexpressing cell line proliferation with or without Gas6 treatment according to the present invention.

Figure 6 confirms the expression of cell necrosis genes regulated by the expression of Axl in Axl knock-out mice lacking the Axl gene.

Figure 7 shows the flow cytometry analysis results.

FIG. 8 is a result of measuring tumor mass at 8, 12, and 16 day intervals after intravenous injection of Axl knock / out mice and Axl control mice overexpressing Axl genes at 5 × 10 ⁴ numbers.

9 is a flow cytometry analysis of the effects of Axl in animal cancer model and the expression of natural killer cell surface molecules in Axl knock-out mice lacking the Axl gene.

Figure 10 confirms the effect of LIGHT controlled by Axl on the killing ability of natural killer cells.

Claims (5)

A composition for tumor suppression, comprising one or more selected from LY [lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells] (TNFSF14) or an activator thereof. The method of claim 1, The activator Axl receptor tyrosine kinase (Axl Receptor Tyrosine Kinase, Axl) or a tumor suppressor composition for its ligand. The method of claim 2, The ligand of Axl is at least one selected from the group consisting of an antibody against Axl, gamma-carboxylated Gas-6 (growth-arrest specific gene 6) and protein S (protein S). The method of claim 1, The tumor is a tumor suppressor composition for lymphoma. The test compound is added to LY [lymphotoxin-like inducible protein that competes with glycoprotein D for binding herpesvirus entry mediator on T cells] (TNFSF14) or an activator thereof, and the effect of the test compound on the expression or activity of LIGHT or its activator. A method for screening a tumor suppressor or therapeutic agent, comprising the step of irradiating.

Images