KR20090083804A - Selection method of sirna sequence for selectively inhibiting expression of target subtype mrna - Google Patents

Abstract

A method for selecting a sequence of siRNA(small interfering RNA) which selectively suppresses the expression of specific subtype mRNA at the same time is provided to simplify the selection process through direct comparison without unnecessary analysis process and error. A method for selecting siRNA sequence to suppress selective expression of target subtype mRNA comprises: a step (S1) of selecting a target subtype mRNA and non-target subtype mRNA; a step of extracting common sequence domain(A) of target subtype mRNAs; and a step of determining target domain sequence by extracting a sequence domain(B) which specifically presents in the target mRNA by removing common sequence domain with each non-target subtype mRNA.

Description

{Selection method of siRNA sequence for selectively inhibiting expression of target subtype mRNA}

The present invention relates to a method for selecting siRNA sequences for selective expression suppression of target subtype mRNA, and more particularly, to selectively express the expression of a specific subtype target mRNA or two or more specific subtype target mRNAs in a gene having several subtypes. The present invention relates to a method for selecting consensus siRNA sequences that can be simultaneously inhibited.

RNA interference (RNA interference) is a double-stranded RNA (dsRNA) composed of a sense RNA having a sequence homologous to the mRNA of a target gene and an antisense RNA having a sequence complementary thereto, and the like to introduce a cell into a cell. It is a phenomenon that can selectively induce the degradation of mRNA of the target gene and inhibit the expression of the target gene. Since RNAi can selectively inhibit the expression of target genes, it has attracted considerable attention as a simple gene knock-down method or gene therapy method that replaces conventional methods of gene destruction by inefficient homologous recombination. Since it was first identified in C. elegans (nematodes) by Fire and Mello in 1998, it has also been reported in Drosophila, Drosophila, Trypanosoma, and vertebrates (Tabara H, Grishok A, Mello CC, Science, 282 (5388). ), 430-1, 1998).

In humans, when the dsRNA was introduced into cells, the antiviral interferon pathway was induced, making it difficult to observe RNAi.However, in 2001, Elbashir and Tuschl et al. When introduced, RNAi was found to occur without antiviral interferon mechanisms (Elbashir, SM, Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T., Nature, 411). , 494-498, 2001; Elbashir, SM, Lendeckel, W., Tuschl, T., Genes & Dev., 15, 188-200, 2001; Elbashir, SM, Martinez, J., Patkaniowska, A., Lendeckel, W., Tuschl, T., EMBO J., 20, 6877-6888, 2001). Since then, 21nt dsRNA, called small interfering RNA (siRNA), has been in the spotlight as an effective functional genomics tool.In 2002, it was selected as “Breakthrough of the year” by Science Journal (Jennifer Couzin, BREAKTHROUGH OF THE YEAR: Small RNAs Make Big Splash, Jennifer Couzin, Science 20 December 2002: 2296-2297), and in 2006, Andrew Z. Fire (Stanford, USA) and Craig C. Melo (Massachusetts, USA) discovered RNAi. The importance was recognized as being a co-winner of the medical award.

The use of siRNA has been studied to predict the efficiency compared to the existing antisense RNA (antisense RNA) technology, so that a small number of experiments can find a high efficiency siRNA, changing the expression level of the polypeptide product Compared to other polynucleotides used in the regulation of sequence-specific modifications or gene expression used in the art, the siRNA polynucleotide effective concentration used is low, has enhanced stability, and other polynucleotides such as antisense. , Ribosomes or triplex polynucleotides), and shorter lengths. It also has a number of advantages, including the ease of acceptance by the cell and the need for the use of chemically modified nucleotides.

The most important part of the research using siRNA is to select high efficiency target sequences and to deliver siRNA to a desired tissue. The physicochemical properties and efficiencies vary depending on the nucleotide sequence of the siRNA, and the high-efficiency siRNA clarifies the experimental results and can be used as a small amount of therapeutic agent. The development of an algorithm to find the target area is very important.

On the other hand, it is well known that selective splicing plays a large role in the diversity of proteins, the end products of genes (Graveley, B.R., Trends Genet., 100-107, 2001). 74% of human genes are known to have selective splicing mRNA (Johnson, JM, et al., Science (302), 2141-2144, 2003), and in the case of Drosophila they contain a wide variety of selective splicing mRNAs. (Schmucker, D., et al., Cell (101), 671-684, 2000). In addition, selective splicing is known to show different expression patterns of isoforms depending on disease, tissue specificity, stage of development, etc. (Sigalas I, Calvert AH, Anderson JJ, Neal DE, Lunec J, Nat Med. 1996 Aug; 2 (8): 912-7; Weng MW, Lai JC, Hsu CP, Yu KY, Chen CY, Lin TS, Lai WW, Lee H, Ko JL, Environ Mol Mutagen. 2005 Jul; 46 (1) Ando S, Sarlis NJ, Krishnan J, Feng X, Refetoff S, Zhang MQ, Oldfield EH, Yen PM, Mol Endocrinol. 2001 Sep; 15 (9): 1529-38; Nakahata S, Kawamoto S, Nucleic Acids Res. 2005 Apr 11; 33 (7): 2078-89; Lees-Murdock DJ, Shovlin TC, Gardiner T, De Felici M, Walsh CP, Dev Dyn. 2005 Apr; 232 (4): 992-1002) .

Therefore, in order to effectively perform the function research and regulation of the protein, which is the subject of life phenomena using RNAi, consideration of selective splicing mechanism is essential in the design of siRNA sequences. In other words, in order to control production for individual specific proteins, expression of a specific subtype or combination of two or more subtypes among a plurality of selective spliced-variants expressed in any gene is selectively suppressed. SiRNA should be designed. However, subtypes produced by selective splicing are constituted by various combinations of exons, and because they share some common exons or contain specific exons among subtypes, Designing consensus siRNAs to inhibit expression of combinations is not straightforward. In addition, since the combination of subtype mRNAs to suppress expression may vary depending on the purpose and needs of the study, it is practically impossible to design common siRNA libraries for the combination of numerous subtype mRNAs in consideration of the genes of the whole genome. . Therefore, if the subtype mRNA or combination to be suppressed is determined according to the purpose of the study and the necessity, siRNA should be designed by determining the common target region of siRNA in real time accordingly, and for that, to obtain the target region of the common siRNA for the subtype mRNA combination. An effective way is needed.

Prior patents related to a method of inhibiting target mRNA expression using siRNA sequences include Korean Patent Application Publication No. 2007-0094601 and Korean Patent Application Publication No. 2004-0022449, but these prepare siRNAs for respective mRNAs. In addition, as a method of suppressing the expression of a target mRNA, there is a limit that it is difficult to apply to a plurality of target mRNA.

Prior patents related to a method for preparing siRNA capable of inhibiting the expression of a plurality of target mRNAs include Korean Patent Publication No. 0,93,505, which forms a sequence motif for each nucleotide sequence and generates a keyword tri from it. Since it must be performed repeatedly, it has a cumbersome disadvantage. In addition, although there is a prior patent related to a method for obtaining a target region of a common siRNA for subtype mRNA combination, there is a Korean Patent Publication No. 0794705, which is a method for determining genomic life of the University of California Santa Cruz (UCSC) to determine a target region. Since the location information on the DNA of exons provided by the genome bioinformatics database (http://www.genome.ucsc.edu) is used, there is a difference from the present invention that directly uses the mRNA sequence, DNA sequence information Even if is changed, there is a problem to wait until it is provided reflected in the location information of the exon. In addition, it is expected that errors in the analysis process are likely to occur because a complicated multi-step analysis process that requires calculations by translating DNA coordinates and DNA coordinates is required to obtain a target region for designing a common siRNA. can do.

Accordingly, the present inventors have compared the sequence of each subtype mRNAs expressed in an arbitrary gene to logarithmically combine the common sequence of the target subtype mRNAs with the sequence of the non-target mRNAs, and thus the common sequence having only specific target subtype mRNAs. It was conceived that a region could be derived, and a method for selecting siRNA sequences for suppressing selective expression of target subtype mRNAs was developed to complete the present invention.

By devising and applying a method of directly comparing nucleotide sequences of subtype mRNAs, the above-mentioned problems do not occur with the conventional method of selecting a target region using the coordinates of the exon genome. There is an advantage that it is possible to more easily obtain a target region for siRNA design that can suppress expression control or expression of various combinations of target mRNAs according to experimental targets. In addition, since the method of the present invention directly uses mRNA sequences, it does not require location information on the genomes of exons, and does not require complicated analysis processes such as coordinate calculation. The concept is simple, so there is little possibility of error, it is easy to check the error in the analysis process, and it is easy to implement and automate it as a program. In addition, unlike the case where exon position information is used, even if the mRNA base sequence information, which is the primary data in the database, is updated, there is no time delay in reflecting the information.

It is an object of the present invention to 1) select a target subtype mRNA and a non-target subtype mRNA, each of which is desired to inhibit expression among subtype mRNAs of any gene; 2) extracting a common sequence region (A) of all of the target subtype mRNAs; And 3) extracting a sequence region (B) specifically present only in target mRNAs except for a sequence region common to each non-target subtype mRNA in the region (A) to determine a target region sequence. It is to provide a method for selecting siRNA sequences for the selective suppression of subtype mRNA.

In one aspect, the present invention provides a method for producing a subtype mRNA, comprising the steps of: 1) selecting a target subtype mRNA and a non-target subtype mRNA, each of which is desired to inhibit expression among subtype mRNAs of any gene; 2) extracting a common sequence region (A) of all of the target subtype mRNAs; And 3) extracting a sequence region (B) specifically present only in target mRNAs except for a sequence region common to each non-target subtype mRNA in the region (A) to determine a target region sequence. It relates to a method of selecting siRNA sequences for the selective inhibition of subtype mRNA.

The term "subtype mRNA" as used herein refers to mRNAs having different forms of exon combinations produced by selective splicing. In eukaryotes, including humans, selective splicing is performed from premature mRNA (premature mRNA or pre-mRNA) produced immediately after transcription from any gene. Splicing is a type of editing process that removes introns from genes transcribed from genes and connects exons to make mature mRNAs.Alternative splicing is the exon of pre-mRNA By linking them together in different patterns, several subtype mRNAs can be made from a single pre-mRNA.

 In the present invention, "exon" refers to one or more partial regions that actually encode amino acid information of a protein among regions corresponding to any gene on the genome, and constitutes mRNA through selective splicing. In eukaryotes there is more than one exon in any one gene. In addition, in the present invention, "intron" means a nucleotide sequence existing between exons among regions corresponding to any gene on the genome, and is included in the transcribed immature mRNA and is removed and degraded during selective splicing. . Thus, it is not included in the mRNA sequence and does not contribute to the translation of the protein.

As used herein, the term "target subtype mRNA" refers to one or more mRNAs that are subject to inhibition of expression among subtype mRNAs of any gene, and "non-target subtype mRNA" refers to the remaining subtype mRNAs except for the target subtype mRNA. do.

Hereinafter, the present invention will be described in detail step by step.

First, '1) selecting each target subtype mRNA and a non-target subtype mRNA to suppress expression among subtype mRNAs of any gene of the present invention is to target subtype mRNAs to be suppressed among subtype mRNAs of a specific gene. It means the stage of selection.

The target subtype mRNA and the non-target subtype mRNA of the present invention may be one or more than one, and the information of each subtype mRNA for selecting the target subtype mRNA is located in the US National Center for Biological Information (http: //www.ncbi.nlm.nih) .gov /), etc.

'2) extracting a common sequence region (A) of all the target subtype mRNAs of the present invention is a step of obtaining a common sequence of all of them using only base sequence information of the target subtype mRNAs selected in step 1); In mathematical expression of the consensus sequence region (A), A = T ₁ ∩T ₂ ∩T ₃ ∩ ... ∩T _n , where n is a natural number and a target desired to inhibit expression in subtype mRNA of any gene. The number of subtype mRNA (T), T _n means the base sequence of the n-th target mRNA.

In the method of extracting a common sequence, preferably, when there are a plurality of target subtype mRNAs, a common sequence may be extracted by first selecting one target subtype mRNA and sequentially comparing the remaining target subtype mRNAs one by one. That is, after selecting one target subtype mRNA, one of the remaining target subtype mRNAs is compared with the previously selected target subtype mRNA, and the primary common sequence is extracted, and the target subtype RNAs are not compared with the extracted common sequences. By comparison, the common sequence is extracted by a sequential method such as extracting a second common sequence.

'3) Determining a target region sequence by extracting the sequence region (B) specifically present only in the target mRNAs except for the sequence region common to the respective non-target subtype mRNAs in the region (A) Excluding all sequence regions (B) present in non-target mRNAs from the consensus sequence (A) of target subtype mRNAs extracted in step 2), where the sequence region (B) is mathematically represented, B = A − (Q ₁ ∪Q ₂ ∪Q ₃ ∪ ... ∪Q _m ), m is a natural number, which means the number of non-target subtype mRNAs (Q) among subtype mRNAs of any gene, and Q _m is the mth non-target Means the nucleotide sequence of mRNA.

The method of excluding the sequence of non-target subtype mRNAs from the common sequence (A) of the target subtype mRNAs is preferably a target subtype mRNA extracted from the target subtype mRNAs sequentially in step 2) one by one when there are a plurality of non-target subtype mRNAs. By comparing with the common sequence of these, the common sequence can be excluded. That is, after selecting one non-target subtype mRNA, a new sequence is established by excluding the common part from the common sequence (A) compared to the common sequence (A) extracted in step 1), and the new non-target subtype mRNAs are established. Compared to one, the sequential method is performed to exclude common parts from the new sequence.

Common sequence analysis of each target and non-target subtype mRNAs can be performed by comparing the sequence information of each mRNA. Such sequence information can be found in the US National Institute of Biological Information (http: //www.ncbi.nlm.nih. gov /) and UCSC's public databases such as the homepage of the genome bioinformatics (http://genome.ucsc.edu/). In addition, the common sequence analysis for finding the common region between each target and non-target subtype mRNA sequences can use a general-purpose program that provides a sequence alignment algorithm, which is provided by the US National Center for Biological Information. FASTA program offered by the BLAST program (ftp://ftp.ncbi.nlm.nih.gov/blast/) or the European Bioinformatics Institute (http: // www.ebi.ac.uk/fasta33/). This is a representative example.

In a specific embodiment of the present invention, by databaseting all the mRNA information including the sequence of the target subtype mRNA and the non-target subtype mRNA of step 1), by programming a series of instructions for performing steps 2) and 3) In addition, the process of determining the final target region for selecting siRNA sequences for selective expression suppression of target subtype mRNA may be applied to an automated system to develop software for efficient siRNA sequence selection.

Hereinafter, the present invention will be described in more detail with reference to the drawings.

In order to design a common siRNA that inhibits the expression of a particular subtype mRNA or two or more subtype mRNAs of any gene, as presently provided, only specific target mRNAs exist as target region sequences for the design of the common siRNA. The sequence of the region should be determined. For example, the case of a gene with three different subtype mRNAs is described with reference to FIG. 1 as follows:

The target gene is composed of four exon regions and intron regions therebetween, as shown in A of FIG. 1, and three subtypes of isoform1, isoform2 and isoform3. It is expressed by mRNA. Among them, subtype 2 and subtype 3 were determined as target mRNAs to be suppressed. As shown in B of FIG. 1, subtype 2, which is a target mRNA, consists of three exons of exon 1, exon 2, and exon 4, and subtype 3 is exon 1, exon 2, and exon 3. (exon3), which consists of four exons of exon 4. Subtype 1, a non-target mRNA, consists of two exons, exon 1 and exon 3. To illustrate the more generalized gene structure, it is assumed that exon 1 of subtype 1, exon 3 and exon 4 of subtype 3 have extra exon regions separated by dotted lines compared to the corresponding exons of the other subtypes. The mature mRNA (matured mRNA), which migrated from the nucleus of the cell to the cytoplasm after selective splicing occurs, has a form in which introns are removed and exons are sequentially connected as shown in FIG. Target regions for the design of common siRNAs targeting subtype 2 and subtype 3 are regions of the first, exon 1 and exon 2, which are the common regions of target subtype mRNAs, as shown in D of FIG. Two target candidate regions of the region can be obtained and obtained by excluding the exon 1 region, which is a common region between them and the non-target subtype mRNA, so that the final target region is two regions of exon 2 region and some regions of exon 4 region.

Meanwhile, a method of selecting siRNA sequences for selective expression inhibition of target subtype mRNA of the present invention will be described in more detail with reference to a flowchart shown in FIG. 2.

The process for finding the A region, which is a common region of all target subtype mRNAs, is preferably performed as shown in the flow chart of FIG.

(Iii) A sequence of one of the selected target subtype mRNAs is selected to be a target region candidate for siRNA design (S2 in FIG. 2). If there is only one target subtype mRNA, the common region of all target subtype mRNAs becomes the target region candidate sequence, and each of the non-target subtype mRNA sequences without the need to perform steps (ii), (iii) and (iv) below. Proceed to step (v) to exclude the common part of (S3 of FIG. 2).

(ii) If there are two or more target subtype mRNAs, one of the target subtype mRNA sequences not yet considered is selected and aligned using the target region candidate sequence and the sequence alignment program (S4 in FIG. 2).

(iii) If there is a consensus sequence region in which the target region candidate sequence and the target subtype mRNA sequence under consideration are correctly aligned, the consensus sequence is extracted and selected as a new target region candidate sequence (S5 and S6 in Fig. 2). There may be more than one consensus sequence region, in which case all consensus sequence regions are selected as separate new target region candidates. If there is no consensus sequence region, there is no consensus sequence region among all subtype mRNAs, and if so, there is no target region to design a common siRNA capable of simultaneously suppressing all target subtype mRNAs. It means. In such cases, two or more siRNAs must be applied to suppress the expression of all target subtype mRNAs, which is not considered in the present invention.

(iv) Repeat steps (ii) and (iii) until all target subtype mRNAs are considered.

In addition, the target region sequence for the common siRNA design of the target subtype mRNAs is a common region of all target subtype mRNAs obtained through the above process and simultaneously with each non-target subtype mRNA in the A sequence or sequence set that is the target region candidate. The sequence or sequence set (B) which exists only in target mRNAs except for the sequence of the common region is obtained, and it is determined by selecting it as the final target region sequence. The process is also shown in the flow chart of FIG. 2 and preferably consists of:

(v) One of the non-target subtype mRNAs is selected and aligned with the target region candidate sequence or sequence set A, which is the consensus sequence of all the target subtype mRNAs (S8 in FIG. 2). If there is no non-target subtype mRNA, the target region candidate sequence A is the final target region sequence as it is (S7 in FIG. 2).

(vi) if there is a consensus sequence region precisely aligned between the target region candidate sequence A and the nontarget subtype mRNA sequence under consideration, the sequence obtained by removing the sequence of the consensus region from the target region candidate sequence A is selected as a new target region candidate sequence (S9 and S10 in Fig. 2). If there is no consensus sequence region, it proceeds to the next step without removing the consensus region sequence (S9 of FIG. 2).

(vii) Steps (v) and (vi) are repeated until all nontarget subtype mRNAs are considered. After all non-target subtype mRNAs are considered, the remaining target region candidate sequence or sequence set (B) becomes the final target region sequence.

Meanwhile, efficient siRNA sequences for selective expression inhibition of target subtype mRNAs can be selected from the final target region sequences obtained through steps 1), 2) and 3) of the present invention. This is possible through known methods, for example, by methods such as Tuschl rule (SM Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, Klaus Weber, T. Tuschl, Nature, 411, 494-498, 2001a). SM Elbashir, W. Lendeckel, T. Tuschl, Genes & Dev., 15, 188-200, 2001b; SM Elbashir, J. Martinez, A. Patkaniowska, W. Lendeckel, T. Tuschl, EMBO J., 20, 6877-6888, 2001c), wherein 3'overhang morphology, GC content, repetition of specific bases, single nucleotide polymorphism (SNP) in sequence, RNA secondary structure, and non-target mRNA The homology with the base sequence can be considered. In addition, considering the binding energy state of the double helix portion of the siRNA may be reflected in the siRNA design (Khvorova, A., Reynolds, A., Jayasena, SD, Cell, 115 (4), 505). , 2003; Reynolds, A., Leake, D., Boese, Q., Scaringe, S., Marshall, WS, Khvorova, A., Nat. Biotechnol., 22 (3), 326-330, 2004). The most representative example of reflecting the state of the binding energy in the siRNA design is that the RISC (RNAi-induced silencing complex) binds to either of the two strands of the siRNA, the dsRNA, which affects the siRNA efficiency. The energy difference between the 5 'and 3' ends was introduced to predict siRNA efficiency (Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD., Cell, 115 (2), 199-). 208, 2003), and an 'optimizing method of siRNA design using relative binding energy type discrimination' (Korean Patent Application No. 2004-0103283 and PCT Patent Application No. PCT / KR2005 / 004207) can also be used.

According to the method of the present invention, siRNA sequences for selective expression inhibition of target subtype mRNAs can be selected by a simple method of directly comparing common sequences using mRNA sequences, and do not require location information on the genome of exons, and coordinate calculations are performed. No complicated analysis process is required, and the concept is simple, so that there is little possibility of error.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are only for illustrating the present invention, and the content of the present invention is not limited by the following examples.

Example : MDM2  Target region selection for specific subtype combinations of genes

The human transformed 3T3 cell double minute 2, p53 binding protein (MDM2) gene contains subtype mRNAs by six selective splicing, and the expression of these subtype mRNAs may lead to the development of some cancers (ovarian cancer, bladder cancer, etc.). It is known to have a significant effect (Sigalas I, Calvert AH, Anderson JJ, Neal DE, Lunec J, Nat Med. 1996 Aug; 2 (8): 912-7; Weng MW, Lai JC, Hsu CP, Yu KY, Chen CY, Lin TS, Lai WW, Lee H, Ko JL, Environ Mol Mutagen. 2005 Jul; 46 (1): 1-11; Ando S, Sarlis NJ, Krishnan J, Feng X, Refetoff S, Zhang MQ, Oldfield EH, Yen PM, Mol Endocrinol. 2001 Sep; 15 (9): 1529-38). FIG. 3 shows information on subtypes in which the gene of MDM2 can be expressed and expressed by selective splicing and a domain constituting the same.

In order to examine how the domain of the MDM2 gene is related to the development of cancer, a target region for designing siRNAs that can selectively inhibit its expression was selected through the following procedure.

Among the six subtypes shown in FIG. 3, acidic domains include three of mdm2-FL (NM_002392), mdm2-a (NM_006878), and mdm2-d (NM_006881). A good way to determine the association of these acidic domains with cancer is to inhibit their expression with siRNA that selectively inhibits the expression of these three subtypes, and then observe cell changes.

To this end, first, target mRNA was set to NM_006881, and NM_006881 was used as a search term in the US National Institute of Biological Information (http://www.ncbi.nlm.nih.gov/). Relevant information including base sequences was found for NM_006879, NM_006880, NM_006882. Among them, NM_006880 is reported to suppress self-expression by the nonsense-mediated mRNA decay (NMD) mechanism due to the mutational characteristics in the sequence.

Some of the base sequences of the five subtype mRNAs except NM_006880 are shown in Table 1 below, and how the exons constituting the five subtype mRNAs are distributed on the chromosome, and the Ensembl genome browser of the European Bioinformatics Institute The results obtained by searching (Ensembl Genome Browser, http://www.ensembl.org/) are shown in FIG. 4 in the form of a genome map. The actual nucleotide sequence of the five subtype mRNAs is as shown in Figures 5a, 5b, 5c, 5d and 5e.

mRNA access number Sequence length Base sequence (part of first part) NM_002392 2357 bp CGAGCTTGGCTGCTTCTGGGGCCTGTGTGGCCCTGTGTGTCGGAAAGATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGACCGAG .... NM_006878 1613 bp CGAGCTTGGCTGCTTCTGGGGCCTGTGTGGCCCTGTGTGTCGGAAAGATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGACCGAG .... NM_006879 1143 bp CGAGCTTGGCTGCTTCTGGGGCCTGTGTGGCCCTGTGTGTCGGAAAGATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGACCGAG .... NM_006881 1540 bp CGAGCTTGGCTGCTTCTGGGGCCTGTGTGGCCCTGTGTGTCGGAAAGATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGACCGAG .... NM_006882 1403 bp CGAGCTTGGCTGCTTCTGGGGCCTGTGTGGCCCTGTGTGTCGGAAAGATGGAGCAAGAAGCCGAGCCCGAGGGGCGGCCGCGACCCCTCTGACCGAG ....

Of the five subtype mRNAs, NM_002392, NM_006878, and NM_006881 having acidic domains are selected as target subtype mRNAs, and the other three are selected as non-target subtype mRNAs, thereby simultaneously suppressing expression of target subtype mRNAs around the world. The target region for designing common siRNAs was intended. According to the method of the present invention, a method of selecting a target region for designing the common siRNA for inhibiting the three target mRNA expressions is as follows.

Step 1: As shown in FIG. 6, NM_002392, which is any one of target subtype mRNAs, is selected to select the entire sequence as a target region candidate (step 1 target region candidate).

Step 2: Select another target subtype mRNA, NM_006878, to align with the target region candidate sequence and extract a consensus sequence portion to select a new target region candidate. Since both sequences to be sequenced are expressed in one gene, and most share the same exon, as shown in FIG. 7, there is a single sequence polymorphism (SNP) or an error in sequencing process. Unless they have the same base sequence. In this example, the BLAST program provided by the US National Center for Biological Information was used as the sequence alignment program. As shown in FIG. 7, the consensus sequence portion identified by sequencing is extracted and selected as a new target region candidate. As shown in capital letters in the first-stage target region candidate sequence of FIG. 8, the first one-third portion (the 807th base region from the beginning of the NM_002392 sequence) and the first one-third portion (the 1545th sequence of the NM_002392 sequence) after There is a consensus sequence portion across the two regions (base to base 2357). Therefore, the two common sequence regions are extracted and selected as new target region candidates (two-stage target region candidate 1 and two-stage target region candidate 2) as shown in FIG.

Step 3: Align the two two-stage target region candidates with the sequence of the remaining target subtype mRNA NM_006881 as described above, extract the consensus sequence portion, and display two new target region candidates (three-stage target) as shown in FIG. Region candidate 1, 3 step target region candidate 2) are selected. Stage 3 target region candidate 2 has no change compared to stage 2, but candidate 1 has a shorter base sequence of 71 bases compared to stage 2.

Step 4: After obtaining the consensus sequence of all three target subtype mRNAs, the common part with each non-target subtype mRNA sequence should be excluded. The three-stage target region candidates 1 and 2 sequences are aligned with NM_006879, which is one of the non-target subtype mRNAs, and the common region is obtained from the target region candidate sequence as shown in lowercase in the nucleotide sequence of FIG. 11. Thus, as shown in Fig. 12, two new target region candidate (four-step target region candidate 1, candidate 2) sequences are obtained.

Step 5: As described above, the final non-target subtype mRNA NM_006882 sequence and the two 4-step target region candidate sequences obtained above are aligned to obtain a final target region as shown in FIG. 13 except for the common region. Stage 4 target region candidate 2 was completely aligned with the sequence of NM_006882, a nontarget subtype mRNA, and was excluded from the final target region. Candidate 1 also excluded 45 bases from the beginning and finally 736th from base 582 of NM_002392 sequence One target region sequence of 155 bases in length was selected.

Table 2 summarizes the types of target subtype mRNAs and non-target subtype mRNAs considered in each step in selecting the target region, the common region identified by sequence alignment, and the range of the target region candidate sequences to be calculated. In Fig. 14, the target region selection process is represented by the position on the genome map.

Treatment contents step Step-by-step further consideration mRNA Cumulative Considerations for Stages Staged Target Region Change (Reference mRNA: NM_002392) NM_006878 Non-target mRNA Target candidate area (start..end) Common Area (Start..End) New Target Candidate Area (Start..End) Calculation of the common domain of the target mRNA One NM_002392 NM_002392 - - - 1..2357 2 NM_006878 NM_002392NM_006878 - 1..2357 1..807 1..807 1545..2357 1545..2357 3 NM_006881 NM_002392NM_006878NM_006881  - 1..807 1..736 1..736 1545..2357 1545..2357 1545..2357 Exclude nontarget mRNA 4 NM_006879 NM_002392NM_006878NM_006881 NM_006879 1..736 1..536 537..736 1545..2357 1741..2357 1545..1740 5 NM_006882 NM_002392NM_006878NM_006881 NM_006879NM_006882 537..736 537..581 582..736 1545..1740 1545..1740 Remainder none Final result  - NM_002392NM_006878NM_006881 NM_006879NM_006882 582..736 region of the reference mRNA NM_002392

In this way, among the various subtypes of MDM2, it is possible to select a target region for designing an siRNA capable of selectively inhibiting the expression of subtypes having an acidic domain, and an effective siRNA known in the sequence range of the selected target region. SiRNA can be designed by applying criteria for selecting. The siRNA selected by this method can be applied to studies to find out how the acidic domain of the MDM2 gene correlates with cancer.

The method of the present invention is a simple method of comparatively analyzing common sequences using direct mRNA sequencing. In a gene in which several subtypes are expressed by selective splicing, only specific subtype target mRNA or expression of two or more specific subtype target mRNAs is expressed. The siRNA capable of selectively inhibiting can be easily designed, and the selective translation inhibition of a specific protein or two or more proteins can be effectively used for functional genomics research.

1 is a diagram illustrating a method for selecting a target region for designing a common siRNA for target mRNAs when one or more subtype mRNAs of target genes are designated as target mRNAs and simultaneously suppressed expression.

2 is a flow chart for selecting a target region for designing a common siRNA for target mRNAs.

FIG. 3 is a schematic diagram of information on subtypes that can be expressed by alternative splicing of the MDM2 gene and protein domains constituting the same.

Figure 4 shows the structure of subtype mRNAs that can be expressed by alternative splicing of the MDM2 gene in the examples by the distribution of exons and introns on the genome map.

FIG. 5 (FIGS. 5A, 5B, 5C, 5D and 5E) shows subtype mRNAs NM_002392, NM_006878, NM_006879, NM_006881 and subtype mRNAs that may be expressed by alternative splicing of the MDM2 gene in the Examples. The base sequence of NM_006882.

FIG. 6 illustrates a first target selected as a target region candidate in step 1 of a process for selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene The subtype mRNA is NM_002392.

7 is a step 2 of selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in Examples, a step 1 target region candidate and a second step It is a part of the result obtained by aligning the common region of NM_006878 which is a target subtype mRNA by BLAST which is a sequencing program.

8 is a step 2 of selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in Examples, a step 1 target region candidate and a second step The sequence of capitalization of the common region of NM_006878, which is a target subtype mRNA.

FIG. 9 shows a target region for selecting a target region for designing a common siRNA capable of simultaneously suppressing NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in Examples. The sequence shows two new candidate target regions (stage 2 target region candidate 1 and candidate 2) obtained from the common region of the first target subtype mRNA, NM_006878.

FIG. 10 is a third step of a process for selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in an embodiment, from a common region of all target subtype mRNAs. This sequence shows the two candidate target regions (stage 3 target region candidate 1 and candidate 2) obtained.

11 is a fourth step of a process for selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in Examples, a step 3 target region candidate 1 and a candidate 2 and the first non-target subtype mRNA NM_006879 are shown in lowercase.

12 is a fourth step of a process for selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in Examples, a step 3 target region candidate 1 and a candidate Sequences showing two new target regions (stage 4 target region candidate 1 and candidate 2) obtained by excluding the common region of NM_006879, the first non-target subtype mRNA in 2.

FIG. 13 is a sequence showing a target region obtained in a final step during a process for selecting a target region for designing a common siRNA capable of simultaneously inhibiting expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene.

FIG. 14 is a diagram showing the result of selecting a target region for designing a common siRNA capable of simultaneously suppressing expression of NM_002392, NM_006878, and NM_006881 among subtype mRNAs of the MDM2 gene in a position indicated on a genomic map. FIG.

Claims (5)

1) selecting a target subtype mRNA and a non-target subtype mRNA, each of which is desired to inhibit expression, among subtype mRNAs of any gene; 2) extracting a common sequence region (A) of all of the target subtype mRNAs; And 3) determining a target region sequence by extracting a sequence region (B) that is specifically present only in target mRNAs except for a sequence region common to each non-target subtype mRNA in the region (A). A method of selecting siRNA sequences for suppressing selective expression of subtype mRNAs. The method of claim 1, wherein the area A and the area B are A = T ₁ ∩T ₂ ∩T ₃ ∩ ... ∩T _n , B = A-(Q ₁ ∪Q ₂ ∪Q ₃ ∪ ... ∪Q _m ), N is a natural number, the number of target subtype mRNAs (T) desired to suppress expression in subtype mRNAs of any genes, m is the number of non-target subtype mRNAs (Q) in subtype mRNAs of any genes as natural numbers, T _n is the nucleotide sequence of the n-th target mRNA, Q _m is a nucleotide sequence of the m-th non-target mRNA. The method of claim 1, wherein step 2) comprises extracting a common sequence by first selecting one target subtype mRNA and sequentially comparing the remaining target subtype mRNAs one by one when there are a plurality of target subtype mRNAs. . The method of claim 1, wherein step 3) excludes the common sequence by comparing the non-target subtype mRNAs with the common sequences of the target subtype mRNAs extracted in step 2) one by one, when there are a plurality of non-target subtype mRNAs. How to feature. The method of claim 1, wherein the common sequence analysis of steps 2) and 3) is performed by a sequence alignment algorithm.

Images