KR20090069571A - Microorganisms of corynebacterium having an inactivated gene encoding oxidoreductase and processes for the preparation of 5'-inosinic acid using the same - Google Patents

Abstract

A Corynebacterium sp. microorganism which produces 5'-inosinic acid is provided to inactivate a gene coding an oxidoreductase and accumulate 5'-inosinic acid in medium with high yield and high concentration. A gene coding an oxidoreductase is inactivated in a Corynebacterium sp. microorganism which produces 5'-inosinic acid. The inactivation is performed by substituting with gene coding a protein which does not activation of the oxidoreductase. The gene coding a protein which does not activation of the oxidoreductase has a sequence of the sequence number 2 (SEQ ID NO:2). The Corynebacterium sp. microorganism is Corynebacterium ammoniagenes CN01-0209(KCCM 10908P). A method for manufacturing the Corynebacterium sp. microorganism comprises: a step of making a recombinant vector comprising the gene coding a protein which does not activation of the oxidoreductase; a step of substituting; a step of screening a transformed strain.

Description

MICROORGANISMS OF CORYNEBACTERIUM HAVING AN INACTIVATED GENE ENCODING OXIDOREDUCTASE AND PROCESSES FOR THE PREPARATION OF 5'-INOSINIC ACID USING THE SAME}

The present invention is a microorganism of the genus Corynebacterium producing 5'-inosinic acid, Corynebacterium microorganisms in which a gene encoding oxidoreductase is inactivated. It relates to a method for producing 5'-inosinic acid using the same. The present invention also relates to a gene encoding oxidoreductase of a microorganism of the genus Corynebacterium and a gene for inactivating oxidoreductase by replacing the gene.

5'-inosinic acid is an intermediate of the nucleic acid biosynthetic metabolic system. It plays a physiologically important role in the body of animals and plants, and is used in various fields such as food, medicine, and various medical uses. In particular, when used together with sodium glutamate It is one of nucleic acid-based seasonings that has been spotlighted as a seasoning seasoning because of its synergistic effect. Currently, 5'-inosinic acid is known to be produced by fermenting a strain of the genus Corynebacterium, for example Corynebacterium ammoniagenes (Korean Patent Publication No. 2003-42972, etc.).

Many attempts have been made to improve the 5'-inosinic acid production method using such Corynebacterium strains. Among them, there was a study to improve 5'-inosinic acid-producing Corynebacterium strain by destroying or attenuating specific genes using recombinant DNA technology. There was also a study to improve the 5'-inosinic acid production capacity by applying random mutations using NTG. However, even by the conventional method described above, there is still a need for a strain with improved production capacity of 5'-inosinic acid.

Random mutations using conventional NTG can cause unnecessary mutations, delay growth, and weaken stress tolerance. Moreover, there is a problem that it is difficult to grasp the exact genetic information without knowing the exact location of the mutation.

L-aspartate, one of the precursors of 5'-inosinic acid, is a central metabolite of nitrogen metabolism in cells, and acts as a unit or regulator of cell composition or protein synthesis. L-aspartate is used for the synthesis of nucleic acids, amino acids, or lipids of cells as cell constituent units, and is used as a protein structure or a main functional group as a unit for protein synthesis.

However, large amounts of this L-aspartate are used to construct proteins encoded by non-essential genes that are not essential for cell growth, maintenance and regulation in cells. Therefore, removing or inactivating a gene encoding a non-essential protein having a high content of L-aspartate can reduce or eliminate unnecessary consumption of a large amount of L-aspartate required for product synthesis of the gene. In other words, in terms of reducing the consumption of unnecessary L- aspartate, it is expected to work advantageously for 5'-inosinic acid production under the same conditions.

Accordingly, the present inventors inactivated a gene encoding oxidoreductase, a non-essential protein having a high content of L-aspartate, thereby developing a microorganism of the genus Corynebacterium having an increased yield of 5'-inosinic acid. .

Oxidoreductase genes of microorganisms of Corynebacterium have not been reported yet, and no variant strains inactivating genes encoding such oxidoreductases have been reported.

An object of the present invention is to provide a microorganism of the genus Corynebacterium producing 5'-inosinic acid, wherein the gene encoding the oxidoreductase is inactivated.

In addition, an object of the present invention is to provide a method for producing 5'-inosinic acid using the microorganism.

Still another object of the present invention is to provide a gene encoding oxidoreductase of a microorganism of the genus Corynebacterium.

Still another object of the present invention is to provide a gene which inactivates the gene encoding the oxidoreductase by being substituted with a gene encoding the oxidoreductase of the microorganism of the genus Corynebacterium.

The present invention is to solve the problems of the prior art, and provides a microorganism in which the gene encoding the oxidoreductase of the genus Corynebacterium is inactivated microorganism and 5'-inosinic acid using the same.

The present invention also provides a gene encoding the oxidoreductase and a gene substituted therewith to inactivate the gene encoding the oxidoreductase.

The microorganism of the genus Corynebacterium in which the gene encoding the oxidoreductase according to the present invention is inactivated is a microorganism that directly accumulates 5'-inosinic acid in a culture medium with high yield and high concentration. Allows production of 5'-inosinic acid in yield.

In order to achieve the object of the present invention, the present invention provides a gene encoding the oxidoreductase of the genus Corynebacterium.

The microorganism of the genus Corynebacterium in the present invention is a microorganism known to be able to produce 5'-inosinic acid, preferably Corynebacterium ammoniagenes.

In one embodiment of the present invention, the inventors perform chromosome sequencing of Corynebacterium ammoniagenes ATCC 6872 with a microorganism producing 5'-inosinic acid, and DNA of a gene encoding oxidoreductase. The sequence was analyzed. As a result, it was found that the gene encoding the oxidoreductase of the microorganism of the genus Corynebacterium has a nucleotide sequence of SEQ ID NO: 1 of 426 bp.

The gene encoding the oxidoreductase of the microorganism of the genus Corynebacterium of the present invention is at least 90%, preferably at least 90% to the gene of SEQ ID NO: 1 by the gene of SEQ ID NO: 1 or by ordinary substitution, deletion, and / or insertion Is a gene having at least 95% homology, more preferably at least 98%. Preferably, the present invention includes a gene having at least 90% homology to the gene of SEQ ID NO: 1 or the gene of SEQ ID NO: 1 according to another embodiment of the present invention.

A gene encoding a protein that does not have oxidoreductase activity of a microorganism of the genus Corynebacterium of the present invention is a gene having a nucleotide sequence of SEQ ID NO: 2 that inactivates the gene encoding the oxidoreductase, The front portion 113bp and the rear end 58bp of the gene encoding the oxidoreductase of the genus microorganism in theium are removed, meaning the truncated oxidoreductase, that is, 114bp to 368bp of SEQ ID NO: 1.

The gene encoding the protein having no oxidoreductase activity is at least about 80%, preferably 90%, relative to the gene of SEQ ID NO: 2 or to a gene of SEQ ID NO: 2 by conventional substitution, deletion, and / or insertion Or more, more preferably at least 95%, most preferably at least 98%. Preferably, the present invention provides a gene having at least 80% homology to the gene of SEQ ID NO: 2 or the gene of SEQ ID NO: 2 according to another embodiment of the present invention.

The present invention also provides a microorganism of the genus Corynebacterium in which a gene encoding oxidoreductase is inactivated.

The microorganism according to the present invention is a microorganism of the genus Corynebacterium in which the gene of SEQ ID NO: 1 encoding the oxidoreductase of the microorganism of the genus Corynebacterium is inactivated, and the normal substitution and deletion of the gene of SEQ ID NO: 1 And / or Corynebacterium spp. Microorganisms in which genes having at least 90%, preferably at least 95%, more preferably at least 98% homology with the sequence of SEQ ID NO: 1 by insertion are inactivated.

Preferably, the present invention is a microorganism belonging to the genus Corynebacterium producing 5'-inosinic acid, the gene of SEQ ID NO: 1 encoding the oxidoreductase or a gene having at least 90% homology to the sequence of SEQ ID NO: To provide microorganisms of the genus Corynebacterium.

In addition, the microorganism of the present invention is replaced by a gene having at least 90% homology to the gene of SEQ ID NO: 1 or the sequence of SEQ ID NO: 1 encoding the oxidoreductase of a microorganism of the genus Corynebacterium. Inactivated microorganisms are most preferred.

Preferably, the substitution is made by a gene of SEQ ID NO: 2 encoding a protein that does not have the oxidoreductase activity of Corynebacterium ammonia genes, and also a conventional substitution, deletion, and And / or by insertion comprises a gene having at least about 80%, preferably at least 90%, more preferably at least 95% and most preferably at least 98% homology to the gene of SEQ ID NO: 2. .

Preferably, the microorganism of the present invention is a gene having at least 80% homology to the gene of SEQ ID NO: 2 or the sequence of SEQ ID NO: 2 encoding a protein that does not have the oxidoreductase activity of the microorganism of the genus Corynebacterium It is a microorganism obtained by transforming a microorganism belonging to the genus Corynebacterium producing 5'-inosinic acid with a recombinant vector comprising, and selecting strains in which oxidoreductase is inactivated.

The recombinant vector is a polymerase chain reaction of a gene having at least 80% homology with the gene of SEQ ID NO: 2 or the sequence of SEQ ID NO: 2 encoding a protein having no oxidoreductase activity of a microorganism of Corynebacterium. It can be prepared by amplification through Polymerase Chaine Reaction (PCR) and inserting the DNA fragment into pCR2.1 vector (TOPO TA Cloning Kit Invitrogen, USA) which is a known expression vector.

The vector which can be used is not specifically limited, A well-known expression vector can be used. The recombinant vector thus prepared may be delivered to Escherichia coli using a conventional electroporation method, and the recombinant vector may be collected according to a known method (Quiagen plasmid preparation KIT). Therefore, the recombinant vector is preferably pTOPO KO- oxidoreductase prepared by inserting the gene of SEQ ID NO: 2 in the pCR2.1 vector.

The recombinant vector is a microorganism strain (for example, Corynebacterium ammoniagenes CJHB100 (KCCM-10330), using a conventional electroporation method, Korean Patent Publication No. 2003-42972 To pass). The microbial strain is transformed into a microbial strain by homologous recombination at a site on a microbial chromosome that is homologous to a homologous site with a microbial chromosome located in a recombinant vector, for example, the pTOPO KO-oxidoreductase vector. The gene encoding the oxidoreductase may be inactivated by substitution inside the oxidoreductase gene of the chromosome, followed by culturing in a medium containing the antibiotic kanamycin (selective marker). The insertion of pTOPO KO-oxidoreductase into the genome by homologous recombination in the selected strains can be confirmed by PCR. The cloning process of the gene is briefly shown in FIG.

More preferably, the microorganism of the present invention is Corynebacterium ammoniagenes CN01-0209 (KCCM-10908P).

The present invention also provides a method of preparing a recombinant vector comprising a gene encoding a protein that does not have oxidoreductase activity of a microorganism of the genus Corynebacterium; Inactivating a gene encoding oxidoreductase by transforming a microorganism of Corynebacterium producing 5'-inosinic acid with the recombinant vector; Selecting and culturing the transformed strain; And it provides a method for producing 5'-inosinic acid comprising the step of separating the 5'-inosinic acid from the culture.

The microorganism of the present invention can be cultured while controlling the temperature, pH and the like under aerobic conditions in a conventional medium containing a suitable carbon source, nitrogen source, amino acids, vitamins and the like.

As the carbon source, carbohydrates such as glucose, fructose, sterilized pretreated molasses (i.e., molasses converted to reducing sugars) and the like can be used. As nitrogen sources, various inorganic nitrogen sources such as ammonia, ammonium chloride, and ammonium sulfate and peptone, NZ-amine, Organic nitrogen sources such as meat extracts, yeast extracts, corn steep liquors, casein hydrolysates, fish or their degradation products, skim soy cakes, or their degradation products can be used. As the inorganic compound, potassium monohydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate and the like may be used. In addition, vitamins and nutrient-containing bases may be added as necessary.

The culturing may be carried out under aerobic conditions, for example by shaking culture or aeration stirring, preferably at a temperature of 20-40 ° C. The pH of the medium is preferably maintained near the neutral during the culturing, the culturing can be carried out for 5 to 6 days and the 5'-inosinic acid accumulated by the direct fermentation method can be recovered by a conventional method.

When the 5'-inosinic acid is prepared according to the production method of the present invention, the oxidoreductase gene is inactivated, thereby producing 5'-inosine acid with high yield. Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrating the present invention, and the present invention is not limited by these examples.

Example  One. Oxyridoductase  Gene of SEQ ID NO: 2 to inactivate Cloning

The pTOPO KO-oxidoreductase vector was constructed as briefly shown in FIG. The pCR2.1 vector contains the KmR gene. The gene of SEQ ID NO: 2 was obtained by removing part of the gene of SEQ ID NO: 1 encoding the oxidoreductase, that is, 113 bp in the front part and 58 bp in the back part. The gene fragment of SEQ ID NO: 2 obtained through polymerase chain reaction was conjugated to the pCR2.1 vector using TOPO KIT.

Conjugated DNA was transformed to E. coli GM2525 (Escherichia coli genetic stock center, Yale University, New Haven, Connecticut) by electroporation, and LB containing antibiotics to give 25 mg of kanamycin per liter. The cells were incubated in a solid medium (10 g / L of yeast extract, 10 g / L of bactotriptone, 10 g / L of sodium chloride, 1.7% of bactoa, pH 7.0). The grown single colonies were recovered and the plasmids were isolated from the cells in which the recovered colonies were cultured in LB medium to which the same antibiotic was added. Recombinant plasmid pTOPO containing a gene fragment encoding oxidoreductase by first checking the size of the included plasmid, and secondly by double cutting with Xba I and BamHI to confirm that a 487 bp DNA fragment was produced. KO-oxidoreductase (4.5 kb) was produced.

The primers used herein are as follows.

Primer oxidoreductase-F (SEQ ID NO: 3): 5'-tgtatgcgggctcttgctgg-3 '

Primer oxidoreductase-B (SEQ ID NO: 4): 5'- aggcttccccagtcaagcgc-3 '

Example  2. By insertion of recombinant plasmid Chromosome Oxydoriductase  Selection of strains in which the coding gene is inactivated

Recombinant plasmid pTOPO KO-oxidoreductase isolated from Escherichia coli GM2525 was used to transform Corynebacterium ammoniagenes CJHB100 (KCCM-10330), a 5'-inosinate production strain. CM solid medium to which 0.05 mg / L gentamicin was added (yeast extract 10 g / L, bactotriptone 10g / L, sodium chloride 2.5 g / L, bactoa 1.7%, adenine 100mg / L, guanine 100mg / L, pH 7.0) and incubated for 96 hours at 32 ℃. Single colonies were selected through recombinant polymerase chain reaction to insert a recombinant strain at a specific position of the chromosome of Corynebacterium ammoniagenes CJHB100 (KCCM-10330). The primers used herein are as follows, and the process of inactivating the gene encoding the oxidoreductase by inserting pTOPO KO-oxidoreductase into the chromosomal DNA is shown in FIG. 2.

Primer oxidoreductase-FC (SEQ ID NO: 5): 5'- AGATAGGTCTCAATCAACTGC -3 '

Primer oxidoreductase-FB (SEQ ID NO: 6): 5'- cgatggtgttggcaaacacaccc -3 '

The microorganisms in which the gene encoding the oxidoreductase on the chromosome selected through the above procedure were named Corynebacterium ammoniagenes CN01-0209, and the Korea Microorganism Conservation Center on December 20, 2007. Was deposited (Accession Number: KCCM 10908P).

Example  3. Erlenmeyer flask Fermentation potency  exam

After dispensing 3 ml of seed medium into an 18 mm diameter test tube and autoclaving, it was inoculated with Corynebacterium ammonia genes CN01-0209 (KCCM 10908P) and shaken at 30 ° C. for 24 hours to use as a seed culture solution. 27 ml of the fermentation broth was dispensed into a 500 ml shake flask, and autoclaved at 120 ° C. for 10 minutes to inoculate 3 ml of the seed culture solution and incubated for 5 to 6 days. The rotation speed was adjusted to 200 times per minute at a temperature of 32 ° C. and pH 7.2. Accumulation of 5'-inosinic acid in the medium was about 5% higher than the parent strain CJHB100 (KCCM-10330).

The composition of the seed medium and fermentation medium is as follows.

Species medium: glucose 5%, peptone 0.5%, broth 0.5%, yeast extract 1%, sodium chloride 0.25%, adenine 100mg / l, guanine 100mg / l, pH7.2

Flask fermentation medium: 0.1% sodium glutamate, 1% ammonium chloride, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20mg / l, manganese sulfate 20mg / l, zinc sulfate 20mg / l, copper sulfate 5mg / l, L- Cysteine 23mg / l, Alanine 24mg / l, Nicotinic Acid 8mg / l, Biotin 45µg / l, Thiamine Hydrochloride 5mg / l, Adenine 30mg / l, Phosphoric Acid (85%) 1.9%, Fructose, Glucose and Molasses as reducing sugars Use to add 8%

Example  4. In 5-L fermenters Fermentation potency  Experiment

50 ml of the seed medium of Example 3 was dispensed into a 500 ml shaking Erlenmeyer flask and autoclaved, and then inoculated with Corynebacterium ammonia genes CN01-0209 (KCCM 10908P), followed by incubation at 30 ° C. for 24 hours for seed culture solution. Used as. 1000 ml of the fermenter seed medium were placed in a 2.5 L-fermentation tank, autoclaved at 120 ° C. for 15 minutes, inoculated with 50 ml of the seed culture solution, and then cultured for 1-2 days.

The rotation speed was adjusted to 900 times per minute, temperature 28 ~ 34 ℃, pH 7.2. In addition, 1250 ml of the fermenter main medium is placed in a 5 L-fermentation tank and autoclaved at 120 ° C. for 15 minutes to inoculate 250 ml of the fermenter seed broth. After that, when the reducing sugar became 2% in the culture medium while culturing, the primary, secondary, tertiary and quaternary additional sugars were mixed with fructose, glucose, and molasses, and added to the final reducing sugars, respectively, for 5 to 6 days. Incubated. Rotation speed was adjusted to 900 times per minute, temperature 32 ℃, pH 7.2. At this time, the accumulation amount of 5'-inosinic acid in the medium was improved by 3% over the parent strain CJHB100 (KCCM-10330).

The composition of the fermenter seed broth and the fermenter main broth are as follows.

Fermenter broth: 5.4% glucose, 1% peptone, 2% yeast extract, 0.1% potassium phosphate dibasic, 0.1% potassium diphosphate, 0.1% magnesium sulfate, 0.5% ammonium sulfate, 80 mg / l iron sulfate, 40 mg zinc sulfate / l, manganese sulfate 40mg / l, L-cysteine 80mg / l, calcium pantothenate 60mg / l, thiamine hydrochloride 20mg / l, biotin 240µg / l, adenine 1200mg / l, guanine 1200mg / l (pH7.2)

Fermenter Main Medium: Calcium Chloride 120mg / l, Copper Sulfate 8mg / l, Magnesium Sulfate 1.5%, Iron Sulfate 24mg / l, Zinc Sulfate 24mg / l, Manganese Sulfate mg / l, L-Cysteine 26.4mg / l, Sodium Glutamate 0.12%, Thiamine Hydrochloride 6mg / l, Biotin 40µg / l, Nicotinic Acid 50mg / l, Alanine 145mg / l, Adenine 200mg / l, Phosphoric Acid (85%) 4.3%, Fructose, Glucose and Molasses were added to 32% as reducing sugar Usage (pH 7.2)

1 shows the cloning process of genes that inactivate oxidoreductase.

Figure 2 shows the process of inactivating oxidoreductase by inserting pTOPO KO-oxidoreductase into chromosomal DNA.

<110> CJ cheiljedang <120> Microorganisms of Corynebacterium having an inactivated gene          encoding oxidoreductase and process for the preparation of          5'-inosinic acid using the same <130> PA07-0341 <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 426 <212> DNA <213> Corynebacterium ammoniagenes <400> 1 ttaatcgtca tcgtcgtcat tgtcgtcatc gtcccaatcg tcatcgtccc agtcatcatc 60 ccagtcgtca tcgtcgtccc agtcttgata ggtcaacggc acttgcgggg tgatgtatgc 120 gggctcttgc tggatgtcat cagatacatc gtcgctatca tcatcgcgtt ccgagctagg 180 agtaactggc gtggacgggc tctggtgatc ggagtgctct ttgcttatcg atggctcaac 240 cgtcaccgcg gaaggatcaa tctccggcgc agtgcgcgta ttagcaatgg cagagcccgc 300 aacaacaagg gtgcccatca aagcaacgat gccggccagg ggagcaaagc gcttgactgg 360 ggaagccttg gactctttct caggctcgaa agcggaagtg ttcggggtgt gtggtgcctc 420 ggacat 426 <210> 2 <211> 255 <212> DNA <213> Corynebacterium ammoniagenes <400> 2 tgtatgcggg ctcttgctgg atgtcatcag atacatcgtc gctatcatca tcgcgttccg 60 agctaggagt aactggcgtg gacgggctct ggtgatcgga gtgctctttg cttatcgatg 120 gctcaaccgt caccgcggaa ggatcaatct ccggcgcagt gcgcgtatta gcaatggcag 180 agcccgcaac aacaagggtg cccatcaaag caacgatgcc ggccagggga gcaaagcgct 240 tgactgggga agcct 255 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer oxidoreductase-F <400> 3 tgtatgcggg ctcttgctgg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer oxidoreductase-B <400> 4 aggcttcccc agtcaagcgc 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer oxidoreductase-FC <400> 5 agataggtct caatcaactg c 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer oxidoreductase-FB <400> 6 cgatggtgtt ggcaaacaca ccc 23  

Claims (9)

A microorganism of the genus Corynebacterium producing 5'-inosinic acid, the microorganism of the genus Corynebacterium, in which a gene encoding oxidoreductase of the microorganism of the genus Corynebacterium is inactivated. The method of claim 1, The inactivation is a microorganism of the genus Corynebacterium, characterized in that by substitution by a gene encoding a protein that does not have oxidoreductase activity. The method of claim 2, The substitution is a microorganism of the genus Corynebacterium, characterized in that the substitution of the gene having a nucleotide sequence of SEQ ID NO: 2 coding for a protein that does not have the oxidoreductase activity of the microorganism of the genus Corynebacterium. The method of claim 1, The microorganism is Corynebacterium ammonia genes (Corynebacterium ammoniagenes) CN01-0209 (KCCM 10908P) characterized in that the genus Corynebacterium. Preparing a recombinant vector comprising a gene encoding a protein that does not have oxidoreductase activity of a microorganism of the genus Corynebacterium; Transforming and inactivating the gene encoding the oxidoreductase of the Corynebacterium microorganism by transforming the microorganism of the Corynebacterium with the recombinant vector; And Selecting the transformed strain; Corynebacterium genus microorganisms manufacturing method comprising a. The method of claim 5, The recombinant vector is a vector pTOPO KO- oxidoreductase prepared by conjugating the gene fragment of SEQ ID NO: 2 to the pCR2.1 vector Corynebacterium sp. A method for producing 5'-inosuccinic acid comprising culturing the microorganism according to any one of claims 1 to 4, and separating 5'-inosinic acid from the culture solution. The gene of SEQ ID NO: 1. The gene of SEQ ID NO: 2.

Images