KR20090068644A - A process of preparing adenosine deaminase having enhanced activity, a variant of adenosine deaminase having enhanced activity, and a process of preparing 2'-deoxyguanosine from dadpr using the same - Google Patents

Abstract

A method for increasing enzyme activity of adenosine deaminase(ADD) to 2,6-diaminopurine-2'-deoxyriboside(dDAPR) is provided to increase the enzyme activity using human derived ADD and produce deoxyguanosine with high yield. A nucleotide coding human adenosine deaminase is denoted by the sequence number 3. A transformed strain is produced by transforming the nucleotide of the sequence number 3 in E.coli BL21 strain. A method for producing dGR from the dDAPR comprises: a step of transforming the nucleotide in E.coli BL21 strain and culturing the transformed strain; and a step of converting dDAPR with dGR using adenosine deaminase from medium.

Description

A process of preparing adenosine deaminase having enhanced activity, a variant of adenosine deaminase having enhanced adenosine deaminase having enhanced activity, adenosine deaminase variant having increased activity, and a method for producing deoxyguanosine using the variant activity, and a process of preparing 2'-deoxyguanosine from dADPR using the same}

The present invention relates to adenosine deaminase (ADD) for 2,6-diaminopurine-2'-deoxy-riboside (dDAPR). A method of increasing enzyme activity, a variant having increased enzyme activity, and a method of producing deoxyguanosine (dGR) from dDAPR using the variant.

1.2'-deoxyribonucleosides (2'- deoxyribonucleoside Production method

The development of antisense drugs that block specific mRNA expression has allowed gene therapy in a wide range of fields, including cancer, and the demand for 2'-dioxyl ribonucleosides, a source of RNAi, is rapidly increasing. Production methods of 2'-deoxyribonucleoside include extraction and hydrolysis of DNA from natural products such as DNA-rich herring or salmon fish, chemical synthesis and enzymatic synthesis.

The method of obtaining 2'-deoxyribonucleoside from natural DNA through hydrolysis (VN Barai, Bio / techniques 10, 875 (1996)) has a method of using a chemical and a DNase depending on the method of decomposing DNA polymer. However, chemical methods require a high energy reaction environment and DNase methods are inefficient because they require expensive enzymes. To compensate for this, a method for mass production of relatively low-cost DNases (Bochlov, DV, et al . Biochemistry (Moscow) 71, 97 (2006)) and the development of microbial strains capable of secreting DNA / RNA extracellularly While this has been done, it has the limitation of requiring a very complex process to purify the degraded DNA.

Another strategy for producing 2'-deoxyribonucleosides is by synthetic methods, including chemical synthesis and enzymatic synthesis. Deoxythymidine and deoxyuridine can be easily produced by chemical synthesis, but other 2'-deoxyribonucleosides are difficult to synthesize and require complex processes. Thus, more economical and simple enzymatic synthesis methods have been proposed (Bochlov, DV, et al . Biochemistry (Moscow) 71, 97 (2006)). Synthetic pathways using various enzymes have been proposed, but the route for synthesizing ribose first is a starting point. First, sugars such as starch or glucose are used to make D-glyceraldehyde-3-phosphate, an intermediate product of glycolysis. Aldol with acetaldehyde. 2'-deoxyribose-1-phosphate is produced via condensation and isomerization (Horinouchi, N. Appl microbiol biotechnol 71, 615 (2006)). The final product is deoxyribonuine by binding a nucleo-base to the 2'-deoxyribose-1-phosphate synthesized using a phosphorylase. It will synthesize deoxyribonucleoside. Synthetic methods using such enzymes are also relatively complicated because they have to go through several stages of enzyme reactions, and have the problem of satisfying the optimum conditions of the enzymes in each reaction stage.

On the other enzyme synthesis method is Enterobacter difficulties jeneseu (Enterobacter aerogenes ) Nucleoside phosphorylase of AJ-1115 (Yokozeki, KJ Molecular Catalysis B: Enzymatic 10, 207 (2000)) Lactobacillus Helveticus has a base substitution method using a (Biotechnol. Biochem. 67, 989 (2003) Okuyama, K. Biosci.) Nucleoside deoxyribonucleotide transferase one of (Lactobacillus helveticus). Both are syntheses by substituting specific bases for 2'-deoxyribonucleosides using enzymes, and have the commonality that a desired 2'-deoxyribonucleoside can be obtained in high yield without the need for complicated synthesis steps up to ribose.

All of the above-mentioned synthesis methods using enzymes have one fatal disadvantage, both from the synthesis from ribose and from the base substitution method, which is very difficult to synthesize deoxyguanosine (dGR). The reason why the yield of dGR among the four deoxyribonucleosides is very low is because guanine is insoluble in water. In order to increase the water solubility of guanine, various compounds in which the functional groups at position 6 were substituted with other substituents were used for the synthesis reaction (Krenitsky, TA et al . Biochemistry 20, 3615 (1981)) (Shirasaka, T., et al . Proc. Natl. Acad. Sci. USA, 87, 9426 (1990)), a method of making dGR by hydrolyzing a halogen element or amino group at position 6 by adenosine deaminase (ADD) (Nair, V., et al . Syn lett, 10, 753 (1991)) (Marquez, VE et al . J. Med. Chem., 33, 978 (1990)). Among the many strategies presented, 2,6-diaminopurine-2'-dioxy-riboside (2,6) was used with 2,6-diaminopurine in which 6 oxo groups were substituted with amines instead of guanine. 6-diaminopurine-2'-deoxy-riboside (dDAPR) is produced, and the method of synthesizing dGR by removing 6-amine groups using ADD is the best among all known methods and is also used in actual processes (JP2002017393).

2. Adenosine Diamines (Adenosine deaminase )

Adenosine deaminase (ADD) is an enzyme present in the cytoplasm and responsible for part of purine metabolism. ADD first became known as severe combined immunodeficiency disease (SCID), a congenital disease that develops during deficiency (Dolezal, T. Insect Biochem Mol Biol. 35, 381 (2005)). Two types of cytosolic / ecto-ADD are known in the human body, and they regulate adenosine concentrations in and out of cells, and ecto-ADD has been found to be related to cellular signal transduction mechanisms (Martin, M. , et al . J. Immunol. 155, 4630 (1995) (Ciruela, F., et al . FEBS Lett. 380, 219 (1996)).

ADD is an enzyme that is distributed evenly in all living things, including prokaryotic and eukaryotic cells. ADD has been isolated, purified and characterized from various microorganisms. First, Escherichia Collie ( Escherichia ADD derived from coli ) is a monomer and has a molecular weight of 29 kDa and is known to be stable under conditions of ₂ mM CaCl _{2 ,} 50 μM EDTA, and 20% ethylene glycol (Nygaard, P. Methods Enzymol 51, 508 (1978)). Bacillus cereus (Bacillus cereus) derived from ADD, while a molecular weight of 53.7kDa, and stable at -20 ℃, it is unstable and requires the least 20mM KCl is stabilized in 4 ℃ (Gabellieri, E., et al. Biochim Biophys Acta. 10, 490 (1986)). Klebsilan Sp. (Klebsiella sp.) In the case of LF1202 is without the need to take any action as a monomer having a molecular weight of 26kDa have been reported to be stable at 4 ℃ to 3 weeks. Pseudomonas EO dinum (Pseudomonas iodinum) IFO 3558-derived enzyme is required for 15% ethanol and a molecular weight of 240kDa, and 50mM Tris (Sakai, T., et al. FEBS lett. 86, 174 (1978)), micro Lactococcus Sodonensis ( Micrococcus sodonensis ) ATCC11880 (aqueous and membrane-bound forms) is particularly unstable when frozen at dilute concentrations up to 100 μg / ml and requires Mg ions for enzyme activity and stability (Pickard, MA, et al . Can. J.). Biochem. 53, 344 (1975). Streptomyces S. Streptomyces sp . ) J-845S-derived enzyme is an in vitro enzyme whose dimer structure has a molecular weight of 90 kDa and is enhanced by Fe 3+ (Jun, H., J. Ferm. Bioeng. 71, 6 (1991)). Aspergillus duck material (Aspergillus oryzae ) -derived ADD is also an in vitro enzyme, has a low substrate specificity, a dimer structure, has a molecular weight of 103 kDa, and does not require the addition of a Zn-enzyme or a separate Zn (Minato, S., et al . J. Biochem. 58, 519 (1965).

Saccharomyces, eukaryotic cell organisms Celebi jiae (Saccharomyces cerevisiae ) Unlike vertebral ADD, ADD does not require Zn, and its specificity to substrate and inhibitors is higher than that of vertebrate ADD (Lupidi, GF et al . Biochim., Biophys. Acta 1122, 311 (1992)). . Roneun non-vertebrates ADD draw a small pillar melanocyte master (Drosophila An enzyme derived from melanogaster ) is known, and a new protein is known to exhibit ADD activity called adenosine deaminase-related growth factor (ADGF), which is known to be secreted out of cells (Zurovec, M., et al . Proc. Natl. Acad. Sci. 99, 4403 (2002)). Human-derived ADD is 41 kDa in size and has an amino acid sequence with high similarity to that of other species (Daddona, PE et al . Adv. Exp. Med. Biol. 76A, 223 (1977)). Escherichia coli coli ) and the tertiary structure of human (Homo sapiens) -derived ADD are known (Farber, GK, et al . Trends Biochem. Sci. 15, 228-234. (1990)), and the structure of amino acids that catalyze the deamination process. And functions are all revealed. Both enzymes were found to be directly involved in the deamino reaction of Zn ions contained in the active site (Wilson, DK, et al . Biochemistry 32, 1689 (1993)), (Mohamedali, KA, et al . Biochemistry 35, 1672 (1996)), Sideraki, V., et al . Biochemistry 35, 7862 (1996).

ADD used for enzymatic reaction in the production process of 2'-deoxyguanosin mainly uses ADD derived from E. coli , but ADD derived from E. coli has no activity against dDAPR. It is known to be significantly inferior to the activity against adenosine (Okuyama, K., Biosci. Biotechnol. Biochem. 67, 989 (2003)). This is because ADD is an enzyme that exhibits very high substrate specificity for adenosine. Therefore, for the dDAPRdp which is similar in structure to adenosine but has an amino group at the 2 'position of purine, the ADD derived from the calf pancreas is different from that of ADD derived from the E. coli-derived ADD used in the biosynthetic process. It is found to be 6 times higher.

Accordingly, the present inventors have determined the activity of adenosine dianases (ADD) on 2,6-diaminopurine-2'-deoxy-riboside (dDAPR). While studying how to increase, assuming that the low activity of human-derived ADD transformed into E. coli is because the ADD has a rare codon with low expression rate in E. coli, and the CDS (Coding sequence) of the ADD The present invention was completed by confirming that codon-optimized human ADD gene synthesized with Escherichia coli preferred codon was transformed into Escherichia coli, which showed a high expression rate and increased activity on dDAPR. Furthermore, the present inventors completed the present invention by selecting and preparing ADD variants derived from human and Escherichia coli, whose inactivation is significantly increased through random mutagenesis according to molecular evolution in order to further increase the activity of the enzyme. It was.

In order to achieve the above object, the present invention is to provide a genetic variant of human-derived ADD codon optimized with E. coli-preferred codons to increase the activity of human-derived adenosine diamine (ADD).

The present invention also aims to select and provide human or E. coli-derived ADD variants with increased activity according to molecular evolution.

It is an object of the present invention to provide a method for preparing dGR from dDAPR using the ADD variant with increased activity.

The adenosine diamines (ADD) used for the production of 2'-deoxyguanosine (dGR) are mainly Escherichia coli-derived ADD, and no studies have been conducted to convert dDPAR to dGRfh using human-derived ADD. This study was based on the assumption that human-derived ADD may have high inactivation to dDAPR according to the degree of evolution between species. That is, the present inventors transformed the gene of human-derived ADD into E. coli to induce expression and measure its activity, but showed very low activity. Thus, as a result of cDNA sequence analysis of E. coli and human-derived ADD, it was confirmed that a number of rare codons exist in human-derived ADD (Table 1), BL21 codon plus strain for expression of genes with rare codon ( It was confirmed that the activity was increased as a result of transformation using the Stratagene company (Fig. 4). Accordingly, a codon optimized HoptADD (SEQ ID NO: 3) was synthesized by synthesizing a human-derived ADD CDS (coding sequence) into an E. coli preferred codon, and the activity was measured by transforming the codon optimized HoptADD gene into several E. coli strains. As a result, it was confirmed that human-derived ADD showed higher activity than before codon optimization (FIG. 5).

Accordingly, the present invention provides a human-derived ADD gene variant with increased activity by codon-optimizing a human-derived ADD gene into E. coli-preferred codons, and a codon-optimized human-derived ADD gene prepared according to the method. Provide variants.

Preferably, the codon optimized human-derived ADD gene variant has a nucleotide sequence represented by SEQ ID NO: 3. When the gene having the nucleotide sequence of SEQ ID NO: 3 was transformed into several E. coli, and the expression was measured, it was confirmed that E. coli BL21 strain was particularly high activity (Fig. 5).

By using the codon-optimized human-derived ADD as described above, in part, we can expect high enzyme activity, but the present inventors further use human and E. coli-derived ADD variants with increased activity using molecular evolution methods to obtain higher inactivity. To prepare.

Thus, in a specific embodiment of the present invention, using an E. coli ADD (EADD) and the codon-optimized human ADD (HoptADD) as a template using a random mutagenesis kit (Stratagene) to perform error-prone PCR, and purified the PCR product obtained Transformed to E. coli DH5a strain to obtain approximately 10,000 to 12,000 variant clones from each of EDAA and HoptADD, of which 6,000 clones were selected using the ADD enzyme quantification method for 96 well plates, compared to wild type 2 for dDAPR. Variants showing ˜3 fold increased activity were obtained for EADD and HoptADD, respectively (FIG. 6). As a result of sequencing analysis, it was confirmed that the variants had mutations on one or two amino acid sequences, respectively, compared to the amino acid sequences of wild type EADD and HADD (Table 2).

Accordingly, a second aspect of the present invention provides Escherichia coli and human derived adenosine amines (ADD) variants with increased inactivity to dDAPR, and these variants are specifically,

Iii) valine (V), amino acid residue 112 of the E. coli adenosine diazine represented by the amino acid sequence of SEQ ID NO: 1 is replaced with isoleucine, or amino acid residue K, 135, is substituted with E, amino acid 279 The residue D is a variant substituted with N, or

ii) a variant in which K, amino acid residue 164 of the human adenosine diazine represented by amino acid sequence of SEQ ID NO: 2 is substituted with E, and G, amino acid residue 360, is substituted with D, or

iii) A variant in which Y, the amino acid residue of amino acid 201 of the human adenosine diamine represented by the amino acid sequence of SEQ ID NO: 2, is substituted with F.

In a third aspect of the invention, dGR through conversion of dDAPR using codon-optimized human-derived ADD gene variants with E. coli-preferred codons according to the first aspect, or an increased activity E. coli or human-derived ADD variants according to the second aspect. To provide a production method.

Specifically, the method transforms a codon-optimized human-derived ADD gene variant or a gene encoding an E. coli or human-derived amino acid substituted ADD variant into an appropriate transformed strain, and cultures the transformed strain. And converting dDAPR into dGR using ADD isolated from the culture medium. Preferably, the method is a method comprising culturing including Zn ^{2 +} ions in the culture medium of the transformed strain.

The present inventor has ADD is a Zn ^{2 +} when de-Amino reactions including ion Zn ^{2 +} ion in view of the point that it uses as the electron transfer process medium, when culturing of the transformed strain Zn ^{2 +} ions in the active site Changes in enzyme activity were tested by addition into the culture medium. As a result, the addition of Zn ^{2 +} ions appeared to be 2 to 3 times higher activity than the case without addition (Fig. 7), which is the enzyme by the addition of Zn ^{2 +} ions in the culture of the ADD production strain It provides a new culture method that can further increase the activity.

As described above, when using codon-optimized human-derived ADD or E. coli or human-derived amino acid-substituted ADD variants as the E. coli preferred codon according to the present invention, the enzyme activity is significantly increased compared to the conventional dDAPR, resulting in a high yield. can produce dGR. In addition, the present invention can further increase the activity of the ADD enzyme produced by adding Zn ^{2 +} ions to the culture medium in the culture of the strain transformed with the variant ADD, the present invention is a particularly low yield of the raw material of RNAi 2 It can be very useful for producing antisense drugs using RNAi by increasing production of '-deoxyguanosine.

Hereinafter, the present invention will be described in detail with reference to Examples. The following examples are only for illustrating the present invention, but the scope of the present invention is not limited thereto.

Example  1.E. coli ADD gene Cloning

E. coli-derived ADD (EADD) gene from Escherichia found GeneBank coli Forward primer EADDf (GAATTCAAAAatgattgataccaccctg: SEQ ID NO: 4) and backward primer to have Eco R I and Sal I restriction enzyme cleavage sites at the 5 'and 3' ends, respectively, based on the CDS of the adenosine deaminase of the genome sequence of W3110 EADDr (GTCGACttacttcgcggcgactttttc: SEQ ID NO: 5) was prepared and cloned using PCR. E. coli-derived ADD ORF sequence is shown in SEQ ID NO: 1.

The Gal10 promoter (Brunelli JP, et al . Yeast 12, 1299 (1993); Choi ES., Et al . Appl Micorbiol Biotechnol) was prepared by cutting the obtained ADD gene into Eco R I and Sal I to form an adhesive end and continuously expressing in E. coli. 42, 587 (1994)) was inserted downstream to construct the pBIISK-pGal-EADD vector, an ADD constant expression vector (FIG. 1).

In addition, an expression vector was prepared by replacing ampicillin, a selection marker, with kanamycin. To obtain the kanamycin resistance gene, pUC4K plasmid (Amersham) was treated with Sca I, and 1.2 kb of kanamycin ^r , which was blunt-ended with Klenow, was inserted into Sca I of the ampicillin ^r portion of the pBIISK-pGal-ADD vector. pBIISK-pGal-ADD-Km was prepared.

The ADD gene was also introduced into pTrc99A with an IPTG inducible promoter for inducible expression. First, the ampicillin ^r of pTrc99A was inactivated by Sca I, and the kanamycin ^r treated with smooth ends at both ends was inserted, and the ADD obtained by cloning was inserted at MCS (multi cloning site) to prepare pTrc99km-EADD vector. (FIG. 2).

Example  2. ADD gene derived from human body Cloning

Human-derived ADD (HADD) was searched for the mRNA sequence of H. sapiens adenosine deaminase from the NCBI nucleotide database, and a cDNA clone of accession number BC007678 was purchased from Open Biosystems (USA). The ORF portion of the cDNA base sequence was cloned by PCR using a forward primer having restriction enzyme sites of Eco RI and Sal I, HADDf (GAATTCAAAAATGGCCCAGACGCCCGCC: SEQ ID NO: 6), and HADDr (GTCGACTCAGAGGTTCTGCCCTGC: SEQ ID NO: 7). The expression vectors pBIISK-pGal-HADD and pTrc99km-HADD, respectively, were prepared by inserting them into the Eco RI / Sal I position of the pBIISK plasmid and pTrc99km plasmid.

Example  3. E. coli transformation and culture, recovery of enzyme

Produced expression vector Escherichia coli DH5α, BL21, HB101, BL21 (DE3) RIPL-codon plus, and BL21RIL-codon plus strains were transformed, and each cell was cultured using LB medium. In the case of cells transformed with the pTrc99km-ADD vector, expression was induced using IPTG (TAKARA). The cultured strain was recovered by centrifugation at 13,000 rpm, and 150 μl of B-PER Bacterial protein extration reagent (Pierce) was added per 1 ml of culture medium for cell wall permeation and enzyme separation of the recovered cells. The reaction mixture was centrifuged for 10 minutes at room temperature in a nication bath 2510 (Branson, Inc.), and the supernatant was used for measuring enzyme activity.

Example  4. Measurement of enzyme activity using spectrophotometer

Enzyme activity of ADD was measured using adenosine as a substrate. Since adenosine is dissolved at elevated temperature or neutral pH, 15 mM adenosine is added to an appropriate amount of Tris-Cl buffer, titrated with a small amount of 10M NaOH, and Tris-Cl buffer (50 mM, pH 7.5) is added (Murphy, J., et al . Anal. Biochem. 122 , 328 (1982)). It has been known that ADD activity is inhibited by substrates and shows an abnormal activity depending on the amount of enzyme. Therefore, substrate adenosine was added to the cuvette to a concentration of 90 μM, and the absorbance at 265 nm was about 1.2. ADD enzymatic activity was measured by adding 5 μl of cell extract to 1 ml of 25 mM Tris-Cl buffer, 90 μM adenosine solution and immediately measuring the absorbance reduction at 265 nm. I made it.

Substrate solutions were prepared under the same conditions as adenosine when measuring the activity of ADD on dDAPR. At this time, the absorbance was about 2.2 at 217 nm wavelength and the rate of absorbance decrease after enzyme addition was based on the activity.

Example  5. Expression of ADD

E. coli DH5α strains were investigated to investigate the expression levels of four E. coli-derived and human-derived ADD expression vectors, pBIISK-pGal-EADD, pBII SK-pGal-HADD, pTrc99km-EADD, and pTrc99km-HADD. After transformation and incubation, enzyme activity was measured using adenosine as a substrate (FIG. 3).

In the case of pGal-EADD that does not require induction, activity was measured after 36 hours of incubation in a basic LB / km medium, and pTrc99-km requiring induction was 1% of the culture medium after overnight pre-culture. After inoculation using the amount as a seed was induced by adding IPTG to 1mM when OD = 1, and enzyme activity was measured after 3 hours.

In the case of E. coli ADD, the pTrc promoter showed higher activity than the pGal promoter. In the case of pTrc-EADD, IPTG was induced after a certain OD (≒ 1) growth, so it was possible to rapidly grow freely from the cytotoxicity of ADD in early cell growth, and OD itself was also very high. PBIISk-pGal-EADD showed a higher activity than the case was shown.

In the case of human-derived ADD, both pGal and pTrc showed very low enzymatic activity. The reason for such low enzymatic activity was due to the very low expression level in Escherichia coli HADD is a bacterial host. Rare codons, which are frequently found in the enzyme of, are assumed to be poorly translated in bacterial hosts. Thus E. coli and Examination of the cDNA sequence of human-derived ADD confirmed that a large number of rare codons existed (Table 1). Table 1 shows the frequency of use of the coli standard rare codon (%) of each ADD gene.

EADD HADD aga Arg (R) 0.0 5.9 agg Arg (R) 0.0 35.3 cgg Arg (R) 9.5 41.2 aua Ile (I) 0.0 5.9 cua Leu (L) 0.0 5.6 ccc Pro (P) 33.3 28.6

In order to confirm whether the low activity of HADD was due to the rare codon, the HADD expression vector was transformed into the BL21 Codon plus strain (Stratagene) developed for the expression of the gene with the rare codon, and the enzyme activity was measured after culturing. It was confirmed that the activity is increased in the Codon plus strain (Fig. 4).

Example  6. Codon Optimization of Human-derived ADD Genes

The new ADD gene synthesized by replacing all of the CDS sequences of the human-derived ADD gene with the E. coli preferred codon was customized to GeneScript Inc. (USA), and the codon replacement gene was designated as HoptADD (SEQ ID NO: 3). During this process, 98% of the codons in the HADD gene were replaced with codons with translation rates ranging from 91% to 100%, and the remaining 2% codons were replaced with codons with translation frequencies ranging from 80% to 90%. PBIISK-pGal-Hopt_ADD and pBIISK-pGal-Hopt_ADD overexpression vectors were prepared by cleaving and inserting the HoptADD gene with Eco RI / Sal I restriction enzyme in the same manner as in Example 2. These two types of expression vectors and EADD and HADD expression vectors were transformed into E. coli DH5α strain and the activity was measured (Fig. 5). E. coli ADD or human ADD showed very low dDAPR activity, and newly produced HoptADD showed the highest enzyme activity in the BL21 strain.

Example  7. Molecular Evolution of ADD

ADD is an enzyme with a very high substrate specificity for adenosine and therefore shows very low substrate specificity for dDAPR, an intermediate in the dGR production process. Although high enzyme activity can be expected in part using human-derived ADD, an attempt was made to produce an ADD improver using molecular evolution in order to obtain higher specific activity.

Error-prone PCR was performed using a random mutagenesis kit (Stratagene) using PCR primers (see Examples 1 and 2) containing EADD and HoptADD as restriction enzyme sites of Eco R I and Sal I. PCR conditions were performed at 95 ° C: 30 minutes, 95 ° C: 30 seconds, 52 ° C: 30 seconds, and 30 cycles at 72 ° C: 1 minute 10 seconds. PCR fragments were electrophoresed with 0.9% agarose gel and purified using a gel extraction kit (Qiagen). The purified DNA fragments were cloned T.A into pGEM-T easy Vector (Promega), transformed into E. coli DH5a strains, smeared in LB medium containing ampicillin to confirm the number of ADD variants, and then colonies were collected and plasmid prepared by variants. The grass was produced. The mutant pool was cut with restriction enzymes Eco R I and Sal I, cloned into pBIISK-pGal plasmid and transformed into E. coli to obtain colonies.

Colonies were inoculated into 96 deep-well plates (Bioneer Inc.), incubated at 37 ° C. for 30 hours, and centrifuged to remove supernatants from the variant pools. B-PER bacterial protein extration reagent (Pierce) was added and vortexed for 20 minutes at room temperature to dissociate the cells, followed by centrifugation and 5 μl of the supernatant, two 96 well plates per plate. 30 μl of 21 mM adenosine solution and 21 mM dDAPR solution were added to each plate, and the enzyme reaction time was given for 1 hour. 90 μl of 106 mM phenol then; Add 0.17 mM sodium nitroprusside solution and immediately add 90 μl of 11 mM NaOCl; After 125mM NaOH was developed, the absorbance was measured at 650nM to determine the activity of adenosine and dDAPR of the variant ADD (Hans Ulrich Bergmeyer, Methods of enzymatic analysis, 2nd edition (1974)).

Of the 10,000 to 12,000 variant ADD clones, each of which were obtained with EADD and HoptADD as templates, 6,000 clones were screened using the ADD enzyme quantification method for 96-well plates described above, showing a 2-3-fold increase in activity against dDAPR. Two variants, ADD and EADD, were obtained. Through the sequencing analysis, it was confirmed that mutations on 1-2 amino acid sequences occurred, and dGR generated after enzymatic reaction using dDAPR as a substrate was analyzed by HPLC to confirm enzymatic activity of variant ADD. That is, HPLC was used to more accurately quantitatively measure the activity of the primary selected colonies. E. coli transformed with the expression vector After culturing the strain in LB / km medium for 24 hours to remove the medium by centrifugation, 10 mM dDAPR is added and reacted for 30 minutes at 37 ℃. 90 μl of 0.1 N NaOH at 4 ° C. was added to 10 μl of the reaction solution to stop the enzymatic reaction, and 900 μl of distilled water was further added to analyze the degree of dGR generation by HPLC. 30 μM dGR solution was taken as standard in HPLC analysis.

The four mutant clones obtained above were named as EmADD # 13, EmADD # 15, HmADD # 02, and HmADD # 07, respectively, and the mutant positions were identified by analyzing the nucleotide sequences (Table 2). All showed that the activity increased more than two times than wild-type ADD (Fig. 6).

Amino Acid Sequence Changes of Mutant ADD Clones Clone name Substitution position EmADD # 13 135 K → E 279 D → N EmADD # 15 112 V → I 279 D → N HmADD # 02 201 Y → F HmADD # 07 164 K → E 360 G → D

Example  8. Zn  ADD activity increased by ion addition

Most ADD is at the active site (activie site) including Zn ^{2 +} with an enzyme known to use a Zn ^{+ 2} at the time of de-Amino-reaction with the electron transfer mediator. However, the basic microbiological culture medium LB has been Zn ^{2 +} deficiency. Therefore, artificially added to the Zn ^{2 +} when incubated tried a change in the enzyme activity (Fig. 7). In experiments using pTrc99km-ADD, both EADD and HADD showed 2 to 3 times higher activity than when ZnCl ₂ was not added. This showed a similar pattern in the case of pBⅡSK-pGal-ADD which is considered as a new culture method to increase more the enzyme activity when added to Zn ^{2 +} ADD during culture of the production strain.

1 is a structure of a constant expression vector of E. coli ADD gene according to an embodiment of the present invention.

2 is a structure of an induction expression vector of E. coli ADD gene according to an embodiment of the present invention.

Figure 3 is a graph comparing the activity of the enzyme expressed by transforming the E. coli DH5α strain expression vectors of E. coli and human-derived ADD.

4 is a graph showing HADD expression in E. coli DH5a and Codon Plus strains transformed by the HADD expression vector.

Figure 5 is a graph measuring the expression by transforming the codon-optimized HADD vector and wild type EADD and HADD expression vector to E. coli DH5α, BL21 and BL21 codon plus strains, respectively.

Figure 6 is a graph comparing the dGR production activity of ADD variant clones by HPLC analysis.

7 is during culture of the production strain ADD Zn ^{2 +} ions is added during a graph showing a change of the ADD exhibition of the activity of the Zn ^{2 +} ion concentration.

<110> Korea Research Institute of Bioscience and Biotechnology <120> A process of preparing adenosine deaminase having enhanced          activity, a variant of adenosine deaminase having enhanced          activity, and a process of preparing 2'-deoxyguanosine from dADPR          using the same <130> PA070773 / KR <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 333 <212> PRT <213> Escherichia coli <400> 1 Met Ile Asp Thr Thr Leu Pro Leu Thr Asp Ile His Arg His Leu Asp   1 5 10 15 Gly Asn Ile Arg Pro Gln Thr Ile Leu Glu Leu Gly Arg Gln Tyr Asn              20 25 30 Ile Ser Leu Pro Ala Gln Ser Leu Glu Thr Leu Ile Pro His Val Gln          35 40 45 Val Ile Ala Asn Glu Pro Asp Leu Val Ser Phe Leu Thr Lys Leu Asp      50 55 60 Trp Gly Val Lys Val Leu Ala Ser Leu Asp Ala Cys Arg Arg Val Ala  65 70 75 80 Phe Glu Asn Ile Glu Asp Ala Ala Arg His Gly Leu His Tyr Val Glu                  85 90 95 Leu Arg Phe Ser Pro Gly Tyr Met Ala Met Ala His Gln Leu Pro Val             100 105 110 Ala Gly Val Val Glu Ala Val Ile Asp Gly Val Arg Glu Gly Cys Arg         115 120 125 Thr Phe Gly Val Gln Ala Lys Leu Ile Gly Ile Met Ser Arg Thr Phe     130 135 140 Gly Glu Ala Ala Cys Gln Gln Glu Leu Glu Ala Phe Leu Ala His Arg 145 150 155 160 Asp Gln Ile Thr Ala Leu Asp Leu Ala Gly Asp Glu Leu Gly Phe Pro                 165 170 175 Gly Ser Leu Phe Leu Ser His Phe Asn Arg Ala Arg Asp Ala Gly Trp             180 185 190 His Ile Thr Val His Ala Gly Glu Ala Ala Gly Pro Glu Ser Ile Trp         195 200 205 Gln Ala Ile Arg Glu Leu Gly Ala Glu Arg Ile Gly His Gly Val Lys     210 215 220 Ala Ile Glu Asp Arg Ala Leu Met Asp Phe Leu Ala Glu Gln Gln Ile 225 230 235 240 Gly Ile Glu Ser Cys Leu Thr Ser Asn Ile Gln Thr Ser Thr Val Ala                 245 250 255 Glu Leu Ala Ala His Pro Leu Lys Thr Phe Leu Glu His Gly Ile Arg             260 265 270 Ala Ser Ile Asn Thr Asp Asp Pro Gly Val Gln Gly Val Asp Ile Ile         275 280 285 His Glu Tyr Thr Val Ala Ala Pro Ala Ala Gly Leu Ser Arg Glu Gln     290 295 300 Ile Arg Gln Ala Gln Ile Asn Gly Leu Glu Met Ala Phe Leu Ser Ala 305 310 315 320 Glu Glu Lys Arg Ala Leu Arg Glu Lys Val Ala Ala Lys                 325 330 <210> 2 <211> 363 <212> PRT <213> Homo sapiens <400> 2 Met Ala Gln Thr Pro Ala Phe Asp Lys Pro Lys Val Glu Leu His Val   1 5 10 15 His Leu Asp Gly Ser Ile Lys Pro Glu Thr Ile Leu Tyr Tyr Gly Arg              20 25 30 Arg Arg Gly Ile Ala Leu Pro Ala Asn Thr Ala Glu Gly Leu Leu Asn          35 40 45 Val Ile Gly Met Asp Lys Pro Leu Thr Leu Pro Asp Phe Leu Ala Lys      50 55 60 Phe Asp Tyr Tyr Met Pro Ala Ile Ala Gly Cys Arg Glu Ala Ile Lys  65 70 75 80 Arg Ile Ala Tyr Glu Phe Val Glu Met Lys Ala Lys Glu Gly Val Val                  85 90 95 Tyr Val Glu Val Arg Tyr Ser Pro His Leu Leu Ala Asn Ser Lys Val             100 105 110 Glu Pro Ile Pro Trp Asn Gln Ala Glu Gly Asp Leu Thr Pro Asp Glu         115 120 125 Val Val Ala Leu Val Gly Gln Gly Leu Gln Glu Gly Glu Arg Asp Phe     130 135 140 Gly Val Lys Ala Arg Ser Ile Leu Cys Cys Met Arg His Gln Pro Asn 145 150 155 160 Trp Ser Pro Lys Val Val Glu Leu Cys Lys Lys Tyr Gln Gln Gln Thr                 165 170 175 Val Val Ala Ile Asp Leu Ala Gly Asp Glu Thr Ile Pro Gly Ser Ser             180 185 190 Leu Leu Pro Gly His Val Gln Ala Tyr Gln Glu Ala Val Lys Ser Gly         195 200 205 Ile His Arg Thr Val His Ala Gly Glu Val Gly Ser Ala Glu Val Val     210 215 220 Lys Glu Ala Val Asp Ile Leu Lys Thr Glu Arg Leu Gly His Gly Tyr 225 230 235 240 His Thr Leu Glu Asp Gln Ala Leu Tyr Asn Arg Leu Arg Gln Glu Asn                 245 250 255 Met His Phe Glu Ile Cys Pro Trp Ser Ser Tyr Leu Thr Gly Ala Trp             260 265 270 Lys Pro Asp Thr Glu His Ala Val Ile Arg Leu Lys Asn Asp Gln Ala         275 280 285 Asn Tyr Ser Leu Asn Thr Asp Asp Pro Leu Ile Phe Lys Ser Thr Leu     290 295 300 Asp Thr Asp Tyr Gln Met Thr Lys Arg Asp Met Gly Phe Thr Glu Glu 305 310 315 320 Glu Phe Lys Arg Leu Asn Ile Asn Ala Ala Lys Ser Ser Phe Leu Pro                 325 330 335 Glu Asp Glu Lys Arg Glu Leu Leu Asp Leu Leu Tyr Lys Ala Tyr Gly             340 345 350 Met Pro Pro Ser Ala Ser Ala Gly Gln Asn Leu         355 360 <210> 3 <211> 1092 <212> DNA <213> Artificial Sequence <220> <223> Synthetic nucleotide sequence that encodes Human Adenosine          Deaminase for enhanced expression in E.coli <400> 3 atggcgcaga ccccggcgtt tgataaaccg aaagtggaac tgcatgttca tctggatggc 60 agcattaaac cggaaaccat tctgtattat ggccgtcgtc gtggcattgc gctgccggcg 120 aacaccgcgg aaggcctgct gaatgtgatt ggcatggata aaccgctgac cctgccggat 180 tttctggcga aatttgatta ttatatgccg gcgattgcgg gctgccgtga agcgattaaa 240 cgtattgcgt atgaatttgt ggaaatgaaa gcgaaagaag gcgtggtgta tgtggaagtt 300 cgttatagcc cgcatctgct ggcgaatagc aaagtggaac cgattccgtg gaaccaggcg 360 gaaggcgatc tgaccccgga tgaagttgtg gcgctggttg gccagggcct gcaggaaggc 420 gaacgtgatt ttggcgtgaa agcgcgtagc attctgtgct gcatgcgcca tcagccgaat 480 tggagcccga aagttgtgga actgtgcaaa aaatatcagc agcagaccgt ggttgcgatt 540 gatctggcgg gtgatgaaac cattccgggc agcagcctgc tgccgggcca tgtgcaggcg 600 tatcaggaag cggtgaaaag cggtattcat cgtaccgtgc atgcgggcga agtgggtagc 660 gcggaagtgg tgaaagaagc ggtggatatt ctgaaaaccg aacgcctggg ccatggctat 720 cataccctgg aagatcaggc gctgtataac cgtctgcgtc aggaaaacat gcattttgaa 780 atttgcccgt ggagcagcta tctgaccggt gcgtggaaac cggataccga acatgcggtg 840 attcgtctga aaaatgatca ggcgaattat agcctgaaca ccgatgatcc gctgattttt 900 aaaagcaccc tggataccga ttatcagatg accaaacgcg atatgggctt taccgaagaa 960 gaatttaaac gtctgaacat taacgcggcg aaaagcagct ttctgccgga agatgaaaaa 1020 cgcgaactgc tggatctgct gtataaagcg tatggtatgc cgccgagcgc gagcgcgggt 1080 cagaacctgt aa 1092  

Claims (7)

A nucleotide encoding a human adenosine diamine represented by SEQ ID NO: 3. Variants of adenosine deaminase derived from human or Escherichia coli with increased inactivity, selected from the group consisting of i) to iii): Iii) valine (V), the amino acid residue of amino acid sequence of E. coli adenosine diamine represented by the amino acid sequence of SEQ ID NO: 1, is replaced with isoleucine, or amino acid residue K, 135, is substituted with E, amino acid 279 A variant in which the residue D is substituted with N, ii) a variant in which K, amino acid residue 164 of human adenosine diazine represented by amino acid sequence of SEQ ID NO: 2 is substituted with E, and amino acid residue 360, G is substituted with D, and iii) A variant in which Y, the amino acid residue of amino acid 201 of the human adenosine diamine represented by the amino acid sequence of SEQ ID NO: 2, is substituted with F. A nucleotide encoding the variant of claim 2. A strain transformed with the nucleotide of claim 1. The transformed strain according to claim 4, wherein the nucleotide represented by SEQ ID NO: 3 is produced by transforming the E. coli BL21 strain. i) culturing the transformed strain of claim 4 or 5, ii) converting dDAPR to dGR using a culture or adenosine diamine isolated from the culture, the method of producing dGR from dDAPR. The method of claim 6, wherein the method of producing dGR from dDAPR, characterized in that Zn ^{2 +} is added to the culture medium in the culture of the transformed strain.

Images