KR20090043791A - Marker for the diagnosis of susceptibility to chronic obstructive pulmonary disease using col4a3 gene and method for predicting and analyzing susceptibility to chronic obstructive pulmonary disease using the same - Google Patents

Abstract

The present invention relates to a marker for diagnosing chronic pulmonary dysfunction susceptibility using COL4A3 gene and a method for predicting and determining susceptibility to chronic pulmonary dysfunction using the same. More specifically, a marker for diagnosing chronic pulmonary dysfunction susceptibility based on polymorphism of COL4A3 gene, Pulmonary dysfunction susceptibility diagnostic kit, microarray and methods for predicting and determining the susceptibility of chronic pulmonary dysfunction. Chronic pulmonary dysfunction susceptibility diagnostic marker of the present invention has the effect of diagnosing the degree of sensitivity to chronic pulmonary dysfunction. Therefore, the marker of the present invention and its application method can be used for the purpose of predicting and determining the susceptibility to chronic pulmonary dysfunction.

Chronic pulmonary dysfunction, COPD, COL4A3, marker

Description

Marker for the diagnosis of susceptibility to chronic obstructive pulmonary disease using COL4A3 gene and method for predicting and analyzing susceptibility to chronic obstructive pulmonary disease using the same}

The present invention relates to a marker for diagnosing chronic pulmonary dysfunction susceptibility using COL4A3 gene and a method for predicting and determining susceptibility to chronic pulmonary dysfunction using the same. More specifically, a marker for diagnosing chronic pulmonary dysfunction susceptibility based on polymorphism of COL4A3 gene, Pulmonary dysfunction susceptibility diagnostic kit, microarray and methods for predicting and determining the susceptibility of chronic pulmonary dysfunction.

Genetic differences between individuals are caused by differences in DNA sequences between individuals, and these differences are divided into mutations and polymorphisms. Polymorphisms lead to subtle phenotypic changes. If the frequency is more than 1% of the population, it is defined as a polymorphic genotype.

Among them, single nucleotide polymorphism (SNP) refers to the change in one nucleotide sequence consisting of A, T, C, and G in the genome. Two-thirds of these SNPs are known to be mutations between C and T in the nucleotide sequence, and SNP mutations are known to occur once every 1000 in the nucleotide sequence. In addition, SNPs account for about 90% of the mutations occurring in the human genome, and people with similar traits or the same family tree show the same or similar SNP patterns, so clinically susceptible to individual disease. It can be used as an index for predicting, and can be used as an index for predicting the effects and side effects on drugs. Furthermore, if it can be used in personalized medicine that uses diagnosis and treatment strategies appropriate to the genetic characteristics of an individual, and if the SNP pattern and disease record can be well integrated, medical statistics for the treatment of various diseases can be established. It is believed to be possible.

Chronic obstructive pulmonary disease (COPD), on the other hand, is a disease in which radical and irreversible pulmonary pore disorders occur, such as inflammation narrowing the line or destroying elastin fibers and soft tissues in the lung (Pauwel RA et al. ., Am J Respir Crit Care Med . , 2001, 163: 1256-1276). Smoking is a very important environmental factor in the development of COPD, but only 10-15% of chronic smokers have symptoms of COPD. This fact and the fact that there is a family of COPD suggest that genetic factors play a role in the development of COPD. Genes related to the protease-antiprotease hypothesis, oxidation-reduction hypothesis, inflammatory response, apoptosis and foreign body metabolism that have been known or suspected to be associated with the pathogenesis of COPD have been mainly studied, but the results differed from study to study.

Currently, genetic association analysis of susceptible genes in chronic pulmonary dysfunction has been conducted mostly in 2q33.3-2q37.2 sites. In a study on early onset of COPD in Boston, the site showed an LOD score of greater than 2.0 for the ratio of forced expiratory volume (FEV ₁ ) to forced vital capacity (FVC). (Silverman EK et al., Am J Human Genet, 2002, 70: 1229-1239). Similar to the portion of the chromosome 2q In this FEV ₁ / FVC ratio associated with said Utah Genetic Reference Project (Malhotra A et al., Am J Respir Crit Care Med , 2003, 168: 556-561. In addition, this particular genetic region contains genes related to COPD susceptibility, which are known to affect the development of COPD due to the effects of smoking. This site is expected to have a large number of genes associated with COPD, including interleukin 8 receptor alpha and beta (IL8RA and IL8RB), CYP27A1, type 4 collagen alpha3 (COL4A3), and soluble carrier family 11 Have.

The present inventors have studied the potential role of COL4A3 on COPD susceptibility among candidate genes for COPD, and found that one polymorphic region of the COL4A3 gene is closely related to COPD susceptibility. The present invention was completed by developing a marker for diagnosing chronic pulmonary dysfunction susceptibility using the same.

Accordingly, it is an object of the present invention to provide a marker for diagnosing chronic pulmonary dysfunction susceptible including a polymorphic site of the COL4A3 gene.

Another object of the present invention is to provide a kit for diagnosing chronic pulmonary dysfunction and microarray for diagnosing chronic pulmonary dysfunction, which can hybridize or amplify with a polymorphic site of the COL4A3 gene.

On the other hand, another object of the present invention is to provide a method for predicting and determining chronic pulmonary dysfunction susceptibility using the marker for diagnosing chronic pulmonary dysfunction susceptibility.

In order to achieve the above object, the present invention provides a marker for diagnosing chronic pulmonary dysfunction susceptibility comprising a polymorphic site of the COL4A3 gene.

To achieve another object of the present invention, the present invention provides a kit for diagnosing chronic pulmonary dysfunction and microarray for diagnosing chronic pulmonary dysfunction, which can hybridize or amplify with a polymorphic site of the COL4A3 gene.

In order to achieve another object of the present invention, the present invention provides a method for predicting and determining chronic pulmonary dysfunction susceptibility using the marker for diagnosing chronic pulmonary dysfunction.

Hereinafter, the content of the present invention will be described in more detail.

The marker for diagnosing chronic obstructive pulmonary disease (COPD) susceptibility of the present invention is characterized by including a polymorphic site of the COL4A3 gene. More specifically, the polymorphic site of the COL4A3 gene in the marker of the present invention is 20 to 100 in the polynucleotide consisting of SEQ ID NO: 1, where 253th base A of SEQ ID NO: 1 is substituted with G and includes the 253th base. It is characterized by consisting of a polynucleotide consisting of a continuous DNA sequence.

COL4A3 used in the present invention is one of the genetically unique analogue alpha chains (COL4 A1 to A6), and is highly expressed in the alveolar basement membrane (Boutaud A. et al., J Biol). Chem , 2000, 275: 30716-30724). COL4A5 is thought to form triple-stranded collagen molecules and to act as a regulatory center of cell differentiation, fixation, division and migration. In addition, COL4A3 may inhibit the activity of neutrophils. COL4A3 increases cytoplasmic cAMP of neutrophils, resulting in inhibition of peroxide and protease secretion of neutrophils (Monboisse JC et al., J Biol) Chem , 1994, 269: 25475-25482; Shahan TA et al., Cancer Res , 1999, 59: 4584-4590). In addition, it has been known that COL4A3 may inhibit endothelial cell differentiation and cell death or differentiation (Maeshima Y et al., J Biol). Chem , 2001, 276: 31959-31968; Marneros AG et al., Matrix Biol , 2001, 20: 337-345). In conclusion, these findings demonstrate that COL4A3 may be involved in exacerbation of COPD by modulating immune responses or cell death (Groneberg DA et al., Respir) . Res , 2004, 5:18).

In the present invention, the polymorphic site of the COL4A3 gene is substituted with G in the 253th base A of SEQ ID NO: 1, and the base corresponds to the 78340385 base of the sequence known in GenBank (accession No. NT_005403). SEQ ID NO: 1 of the present invention corresponds to the 78340333 to 78340633 bases of the sequence known from GenBank (accession No. NT_005403).

In one embodiment of the present invention, all potential functional polymorphic markers present in the COL4A3 gene in the universal database resulting in changes in amino acids, 3'-UTRs, splicing sites, promoters, etc., are searched for their polymorphism and their frequency. Investigate. As a result, based on each polymorphic frequency, haplotype, and associative imbalance (LD), six polymorphic markers were identified, namely -1162T> C (transcription start point is +1, rs12613226), IVS2 + 12C> A (rs1882435 ), G162E (exon 7, rs6436669), H451R (exon 22, rs11677877), P574L (exon 25, rs28381984), ^* 315C> A (translational end codons are indicated by ^* 1, rs2070735) and selected It was used to confirm the association with COPD (see Example 1).

In another embodiment of the present invention, a case-control study was performed on patients diagnosed with COPD and normal subjects in relation to COPD risk for each polymorphic marker candidate. Allele frequencies were examined and correlated. As a result, it was confirmed that H451R (rs11677877) of the polymorphic marker candidates present in the COL4A3 gene was significantly different between the COPD patient group and the control group (see Examples 2 and 3).

Therefore, by combining these results, the potential association between the COL4A3 gene polymorphism and the risk of developing COPD revealed that the H451R polymorphism was clearly associated with an increased risk of developing COPD. These results indicate that the COL4A3 gene may be involved in the development of COPD and that H451R polymorphism may be used as an effective marker for COPD sensitivity.

Accordingly, the present invention provides a marker for diagnosing chronic pulmonary dysfunction susceptibility including a polymorphic site of the COL4A3 gene.

The term "diagnosis" as used herein includes all types of analyzes used to predict or derive a disease outbreak and to predict disease outbreaks. In addition, the term "sensitivity" in the present invention refers to the increase and decrease in the sensitivity to chronic pulmonary dysfunction, that is, the risk of developing chronic pulmonary dysfunction (COPD). In the present invention, the term "polymorphism" refers to the occurrence of two or more alternative sequences or alternative alleles within a genetically determined population. Preferred polymorphic markers have two alleles which exhibit an incidence of at least 1%, more preferably at least 10% or 20% in the selected population.

Chronic obstructive pulmonary disease that can be diagnosed using the diagnostic marker of the present invention includes emphysema, chronic bronchitis, and bronchiolitis.

On the other hand, the present invention provides a kit for diagnosing chronic pulmonary dysfunction susceptibility comprising a primer capable of amplifying a polynucleotide comprising the 253rd base of SEQ ID NO: 1.

The diagnostic kit may include not only the polynucleotide of the present invention but also reagents required for the polymerization reaction, such as dNTP, polymerases of various kinds, and colorants.

The term “amplifiable primer” means template-directed DNA synthesis under appropriate conditions (eg, four different nucleoside triphosphates and polymerizers such as DNA, RNA polymerase or reverse transcriptase) in appropriate buffers and at appropriate temperatures. Refers to a single-stranded oligonucleotide that can act as a starting point. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template. The primer hybridizes to the target DNA comprising the polymorphic site and initiates amplification of an allelic form in which the primer shows complete homology. This primer is used in pairs with a second primer that hybridizes to the other side. By amplification the product is amplified from two primers, which means that certain allelic forms are present. Primers of the invention include polynucleotide fragments used in ligase chainreaction (LCR). In the present invention, the primer may be a primer of SEQ ID NO: 8 and SEQ ID NO: 9.

The invention also includes a microarray for diagnosing chronic pulmonary dysfunction comprising the polynucleotide of the invention or its complementary polynucleotide. More specifically, the present invention includes a polynucleotide consisting of 20 to 100 consecutive DNA sequences including the 253rd base A, wherein the 253rd base A of SEQ ID NO: 1 is substituted with G in the polynucleotide consisting of SEQ ID NO: 1. To provide a microarray for diagnosing chronic pulmonary dysfunction.

The microarray may include DNA or RNA polynucleotides. The microarray consists of conventional microarrays except that the polynucleotide of the present invention is included in the probe polynucleotide.

Methods for preparing microarrays by immobilizing probe polynucleotides on substrates are well known in the art. The term “probe polynucleotide” refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid. Such probes include peptide nucleic acids described in Nielsen et al., Science, 254, 1497-1500 (1991). The probe of the present invention is an allele-specific probe, in which polymorphic sites exist in nucleic acid fragments derived from two members of the same species, and hybridize to DNA fragments derived from one member, but not to fragments derived from other members. . In this case, hybridization conditions show significant differences in hybridization strength between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used for diagnostic methods for detecting alleles. The diagnostic method includes detection methods based on hybridization of nucleic acids such as Southern blot and the like, and may be provided in a form that is pre-bound to the substrate of the DNA chip in a method using a DNA chip. The hybridization can usually be carried out under stringent conditions such as salt concentrations of 1 M or less and temperatures of 25 ° C. or higher. For example, conditions of 5 × SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 ° C. may be suitable for allele specific probe hybridization.

The immobilization of probe polynucleotides on substrates associated with chronic pulmonary dysfunction of the present invention can also be readily prepared using this prior art. In addition, the hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. The detection is accomplished by labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal comprising, for example, a fluorescent substance such as Cy3 and Cy5, and then hybridizing onto a microarray and generating from the labeling substance. The hybridization result can be detected by detecting the signal.

Furthermore, the present invention provides a method for predicting and determining chronic pulmonary dysfunction. More specifically,

a) obtaining a nucleic acid sample from a sample;

b) amplifying the polymorphic site of the 253th base of SEQ ID NO: 1 in the nucleic acid sample obtained in step a); And

c) determining the base of the amplified polymorphic site of step b) and analyzing the risk of developing chronic pulmonary dysfunction.

Obtaining a nucleic acid from the sample of step a) of the method may be performed by a conventional DNA separation method. For example, the target nucleic acid can be amplified by PCR and purified. Ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al . , Proc . Natl . Acad . Sci . USA 86, 1173 (1989)) and self-sustaining sequence replication (Guatelli et al., Proc . Natl . Acad . Sci . USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA).

The base determination of step c) of the method includes sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele-specific hybridization (DASH), and PCR extension. It can be performed by analysis or TaqMan technique.

Based on the genotype determined through such base determination, the risk of chronic lung dysfunction can be determined. The polymorphic allele frequency of H451R at the H451R polymorphic site of the present invention was significantly higher in patients than in controls (0.17 vs 0.13, P = 0.02), and individuals with one or more 451R alleles compared to those with 451H / H genotypes. Was significantly higher (adjusted OR = 1.48, 95% CI = 1.03-2.14, P = 0.03) (see Example 3 and Table 2).

Therefore, when determining the base of the polymorphic site amplified in step c) to predict and determine the chronic impaired disorder susceptibility, when the genotype of the 253th base of SEQ ID NO: 1 determined in step c) is AG or GG The risk of developing chronic pulmonary dysfunction can be judged to increase.

Accordingly, the present invention provides markers, kits, microarrays and methods for predicting and determining chronic pulmonary dysfunction susceptibility. Chronic pulmonary dysfunction susceptibility markers, kits, microarrays and methods of predicting and determining susceptibility to chronic pulmonary dysfunction can be used as an efficient tool to analyze the risk of developing chronic pulmonary dysfunction.

Below. The present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

COL4A3  Genetic Polymorphism Identification and Selection

To find all potential functional polymorphic markers in the COL4A3 gene, a general database (http://www.ncbi.nlm.nih.gov/SNP) was used to identify promoter regions, exons and genes covering all intron-exon ranges. Polymorphic markers were found at 3'-UTR of. As a result, seven polymorphic markers were selected, which were -1162T> C (rs12613226), IVS2 + 12C> A (rs1882435), G162E (G> A) (rs6436669), H451R (A> G) (rs11677877), P574L (C> T) (rs28381984), ^* 315C> A ^† (rs2070735) and P141L (exon 7, rs10178458).

The polymorphism markers were analyzed for polymorphism and polymorphism frequency of 27 healthy Koreans by sequencing. Samples were collected from individuals with informed consent, and genomic DNA was collected from peripheral blood lymphocytes of healthy Koreans, which were obtained by phenol / chloroform extraction and protease K treatment. The sample contained 54 chromosomes and alleles with a frequency of more than 5% were analyzed with at least 95% confidence. The primers used for sequencing were designed based on Genbank standard base sequence (accession no. NT_005403), and the sequence of the designed primers is as follows: SEQ ID NO: 2 (ACAGAGCACAGTAGTATTGG) and sequence for -1162T> C (rs12613226). SEQ ID NO: 4 (ATATTTCTATTGATATATTGCTACAAGGTC) for SEQ ID NO: 3 (ATAGTAACTAACACAGGCGC), IVS2 + 12C> A (rs1882435) and SEQ ID NO: 5 (GGATCTTTCTGCTACCGATGA), SEQ ID NO: 6 (CTGGGGGACAG) for CTGGGATTAG 7 (CTTCTCTGAAGTGCTGTACC), SEQ ID NO: 8 (AGCTTTCAAAGATCAACTACCTTA) for H451R (A> G) (rs11677877) and SEQ ID NO: 9 (CCATCAACTCCTGGGATTC), SEQ ID NO: 10 (GGGTGACCCAGGACTTA), and SEQ ID NO: 9 for P574L (C> T) (rs28381984) 11 (GGTTGAAATCACTGAATGCTAC), SEQ ID NO: 12 (GGGTTACTTTGTCTAGATTTACCATT) and SEQ ID NO: 13 (GGCATGCAAACCTACCG) for P141L (exon 7, rs10178458), and SEQ ID NO: 14 (GTTTCAAAGTTCTCTGT) for ^* 315C> A ^† (rs2070735) GGC) and SEQ ID NO: 15 (CACAATGCTCCAGGATACCA).

At this time, the analysis was confirmed by two experimenters who performed the experiment independently. All SNPs, SNP IDs and allelic information were obtained from the NCBI homepage.

As a result, among the studies on seven polymorphic markers, since P141L (exon 7, rs10178458) and G162E showed the perfect LD (| D '| = 1.00 and γ2 = 1.00), a total of six polymorphic markers were studied. Applied to.

< Example  2>

Selection of Research Subjects

The disease group consisted of 311 seizure male patients at Kyungpook National University Hospital diagnosed as COPD according to the GOLD established by the NHLBI / WHO Global Initiative.

The criteria for COPD are as follows: chronic cough and dyspnea; FEV ₁ (forced expiratory volume) below 80% after tracheal dilator, FEV ₁ / FVC (forced vital capacity) below 70% and salbutamol of 200μg before bronchodilator ) FEV ₁ recovery is less than 12% after taking. The weight of COPD was divided by the expected FEV ₁ ratio, according to GOLD criteria: mild (> 80%), moderate (50-80%), severe (30-50%), very severe (<30% ).

The control group (n = 386) was selected as a healthy group without any other disease or disease records among the healthy groups who visited the health examination center. All experimental and control groups were Koreans living in or near Daegu, and a trained professional interviewer completed detailed questions about the relative. The questionnaire included the average number of cigarettes smoked per day and year, and smokers were defined as those who smoked at least one day per year during their lifetime. A former smoker is defined as a person who has quit smoking for at least one year before the diagnosis (patient) or before the date of consent after sufficient notice. Cumulative cigarette volume (pack-years) was calculated using the following formula: Smoking amount = (number of cigarette packs smoked per day) x (smoking period).

The study was approved by the institutional committee of Kyungpook National University Hospital and informed consent was obtained from each patient.

Basic information of the experimental group and the control group is shown in Table 1 below. The mean age and gender distribution did not differ significantly between the patient and control groups, and it was possible to compare the differences using two groups having the same distribution. On the other hand, the patient group had a higher percentage of smokers than the control group, and the amount of smoking (pack-years) in the smoker group was significantly higher than that of the control group (P <0.001). This difference was later controlled by multivariate analyses. The FEV ₁ and FEV ₁ / FVC ratios were significantly lower in the COPD group than in the control group (P <0.001).

COPD (n = 311) Control (n = 386) P age 65.5 ± 8.1 60.4 ± 8.0 <0.001 ^* Smoking status <0.001 ^# Now 171 (55.0) ^¶ 205 (53.1) Previous 129 (41.5) 128 (33.2) No experience 11 (3.5)  53 (13.7) Smoking amount (pack-year) ^† 42.6 ± 20.0  30.8 ± 16.9 <0.001 ^# FEV ₁ (estimated) 63.4 ± 26.3 104.9 ± 16.8 <0.001 ^# FEV ₁ / FVC (%) 49.7 ± 13.1 80.7 ± 7.4 <0.001 ^#

^* T-test; ^# χ ² test; ¶ The number in parentheses is a percentage; † Current and previous smokers

<Example 3>

Genotyping Using Light Cyclers

<3-1> Genotyping

Genotypes for the six polymorphic markers of the experimental and control samples were analyzed by fluorescent resonance energy transfer (FRET) analysis using PCR and fluorescent hybridization markers (Parks, SB et al., Am. J. Clin. Pathol. , 115, 439-447, 2001). To this end, peripheral blood lymphocytes were collected from the control group and the experimental group, which were then used to obtain genomic DNA through phenol / chloroform extraction and protease K treatment. PCR amplification and melting curve analysis in the genotyping analysis by the FRET assay was performed using LightCycler 480 (Roche Diagnostic, Germany), all PCR reactions 0.5 μl of each primer (5 pmol), hybridization probe 0.5 μl donor probe (2 pmol), 1 μl anchor probe (2 pmol), 1 μl genomic DNA (5 ng / μl), 1 μl LightCycler 480 Genotyping Master Mix (Roche Diagnostics, Germany) and 1 μl distilled water PCR was performed according to the manufacturer's instructions. Each hybridization probe pair is an anchor probe and donor flourphore labeled with 2 oligonucleotides, namely the acceptor flourphore LightCycler LC Red 640 at the 5 'end. Fluorescein is composed of a sensor probe labeled at the 3 'end.

Each primer base sequence used for the PCR amplification is as described above.

Genotyping of more than 98% was successful by the FRET method, and the samples not analyzed by the FRET method were genotyped by directly analyzing the sequencing using a PRISM 3700 genetic analyzer (Applied Biosystems, USA). All genotyping assays were conducted privately in the experimental and control groups to maintain reliability, with approximately 10% of subjects randomly re-analyzed by other experimenters and the results were 100% consistent (not shown).

<3-2> Statistical Analysis

The genotyping results were used to compare the control and patient groups through statistical analysis. The experimental group and the control group were compared using the Student's t-test for the continuous variables and the χ ² test for the variable by category. The frequency of the observed genotypes and the expected genotypes in the individual were determined by the Hardy-Weinberg equilibrium with one degree of freedom using a goodness-of-fit χ ² test. Investigate whether it meets the requirements.

Linkage disequilibrium (LD) coefficients during gene polymorphism were calculated using SAS genetics software (SAS, USA). Haplotypes and their frequencies were measured based on the Bayesian algorithm using a Phase program (Stephens, M., et al ., Am . J. Hum . Genet ., 68, 978-989, 2001). In order to once again confirm the haplotype predicted by the phase program, the Haplo. Stats program developed by Schaid et al. Was used (Daniel J. et al., Am. J. Hum. Genet. 70: 425-434, 2002) The risk of developing COPD associated with genotypes and haplotypes was determined using the non-conditional logistic regression analysis, using the odds ratio (OR) and 95% confidence interval ( CI). Further relevant analyzes were performed in stages according to age and severity of COPD to determine the relationship between the COL4A3 genotype and the risk of COPD.

In addition, analysis of associations between smoking and genes can be performed using: i) classification according to cumulative levels of smoking exposure, ii) genotype / haplotype-coupling with smoking, and iii) logistic regression analysis. For this analysis, subjects were classified into three categories according to smoking exposure level. : Non-smokers, light smokers (less than 33 packs a year), severe smokers (more than 33 packs a year).

All analyzes were performed using statistical analysis program version 8.12 for Windows (SAS institute, USA).

The results of allele frequencies and genotypes of 6 COL4A3 polymorphisms in the patient and control groups through the above analysis are shown in Table 2 below. The distribution of six polymorphic genes in the control group was suitable for Hardy-Wineberg equilibrium. The polymorphic allele frequency of H451R was significantly higher in patients than in controls (0.17 vs 0.13, P = 0.02). Individuals with one or more 451R alleles had a significantly higher risk of COPD than those with the 451H / H genotype (adjusted OR = 1.48, 95% CI = 1.03-2.14, P = 0.03). The genotype distributions of the other five polymorphic markers did not show significant differences between the patient and control groups.

Association of COL4A3 Genotype with COPD Risk in Patients with COPD Polymorphism (rs no.) Genotype Experimental group Control Low frequency of traits Defined OR ^¶ n (%) n (%) P ^# Experimental group Control P ^# (95% CI) P ^¶ -1162T> C (rs12613226) TT 154 (49.5) 191 (49.5) 0.91 0.30 0.30 0.85 1.00 TC 130 (41.8) 158 (40.9) 0.98 (0.69-1.38) 0.90 CC 27 (8.7) 37 (9.6) 0.99 (0.55-1.80) 0.98 IVS2 + 12C> A (rs1882435) CC 101 (32.5) 135 (35.0) 0.79 0.42 0.41 0.54 1.00 CA 157 (50.5) 188 (48.7) 1.20 (0.83-1.73) 0.33 AA  53 (17.0)  63 (16.3) 1.18 (0.72-1.93) 0.51 G162E (G> A) (rs6436669) GG 241 (77.5) 307 (79.5) 0.35 0.12 0.11 0.74 1.00 GE  68 (21.9)  73 (18.9) 1.11 (0.74-1.67) 0.62 EE  2 (0.6)  6 (1.6) 0.34 (0.06-1.91) 0.22 H451R (A> G) (rs11677877) HH 213 (68.5) 294 (76.2) 0.07 0.17 0.13 0.02 1.00 HR  88 (28.3)  84 (21.8) 1.44 (1.00-2.11) 0.05 RR 10 (3.2)  8 (2.1) 1.99 (0.69-5.76) 0.20 HH 213 (68.5) 294 (76.2) 0.02 1.00 HR + RR  98 (31.5)  92 (23.8) 1.48 (1.03-2.14) 0.03 P574L (C> T) (rs28381984) PP  86 (27.7) 123 (31.9) 0.32 0.46 0.44 0.60 1.00 PL 165 (53.1) 183 (47.4) 1.39 (0.95-2.04) 0.09 LL  60 (19.3)  80 (20.7) 1.25 (0.78-2.01) 0.98 ^* 315C> A ^† (rs2070735) CC 187 (60.1) 220 (57.0) 0.63 0.22 0.24 0.35 1.00 CA 112 (36.0) 147 (38.1) 0.88 (0.62-1.24) 0.46 AA 12 (3.9) 19 (4.9) 0.55 (0.24-1.26) 0.16

( ^# Two-sided χ ² test for genotype distribution and allele frequency between experimental and control groups.

^¶ ORs (95% CIs) and P- values are calculated using logistic analysis not taken into account, age and year-old smoking volume.

^† Marked with ^* 1 from 3 'part of transcription termination codon.)

<Example 4>

Correlation Analysis of HPDR Genotype with Risk of COPD

<4-1> Association analysis according to age, smoking status and severity of COPD

Based on the results of Example 3, the experimental group and the control group were reclassified according to age, smoking status, and COPD severity, respectively, and the association between the risk of COPD and H451R genotype was analyzed again in the same manner as in Example 3.

As a result, when classified according to the average age as shown in Table 3, the risk of COPD increased significantly with younger people with H / R or R / R genotype (correction OR = 1.93, 95%) CI = 1.10-3.39, P = 0.02). However, at high age, there was no correlation between genotype and risk of onset. In the classification according to smoking status, the effect of H / R or R / R genotype on the increased risk of COPD is prominent in smokers but not in nonsmokers (corrected OR = 1.57, 95% CI = 1.08-2.27, P = 0.02). When people who have experienced smoking were classified according to annual smoking, the effect of H / R or R / R genotype on increased risk of developing COPD was significantly higher at higher smoking levels (correction OR = 1.84, 95% CI = 1.10-3.08). , P <0.02), and there was no significant correlation with the low smoking rate. When classifying patients by COPD severity, one or more 451R alleles were associated with increased risk of developing COPD (GOLD III-IV, adjusted OR = 1.62, 95% CI = 1.00-2.61, .P = 0.04) . However, the H451R genotype was not associated with the risk of mild COPD. Considering age and the severity of COPD, the effect of the H / R or R / R genotype was only apparent in young patients with severe COPD symptoms (GOLD III-IV, adjusted OR = 3.02, 95% CI = 1.37-6.67) , P = 0.006; P = 0.001, test for homogeneity).

COL4A3 Association between H451R (rs11677877A> G) genotype and COPD Experimental group Control R (95% CI) for HR + RR vs HH P P _H ^* HH HR + RR HH HR + RR age ≤ 60  51 (61.4) 32 (38.6) 155 (76.4) 48 (23.6) 1.93 (1.10-3.39) ^# 0.02 0.10 > 60 162 (71.1) 66 (28.9) 139 (76.0) 44 (24.0) 1.25 (0.78-2.01) ^# 0.35 Smoking status Non-smoking   8 (72.7)  3 (27.3)  40 (75.5) 13 (24.5) 1.16 (0.27-5.01) ^¶ 0.85 ^† sometimes 205 (68.3) 95 (31.7) 254 (76.3) 79 (23.7) 1.57 (1.08-2.27) ^¶ 0.02 0.29 Annual Smoking Amount ^† ≤33  69 (74.2) 24 (25.8) 151 (76.3) 47 (23.7) 1.15 (0.65-2.06) ^¶ 0.63 > 33 136 (65.7) 71 (34.3) 103 (76.3) 32 (23.7) 1.84 (1.10-3.08) ^¶ 0.02 0.09 COPD Severity GOLD I + II 138 (69.7) 60 (30.3) 294 (76.2) 92 (23.8) 1.33 (0.88-2.01) ^‡ 0.18 GOLD III + IV  75 (66.4) 38 (33.6) 294 (76.2) 92 (23.8) 1.62 (1.00-2.61) ^‡ 0.04 0.38 Age & COPD Severe Age≤60, GOLD I + II  35 (67.3) 17 (32.7) 155 (76.4) 48 (23.6) 1.44 (0.73-2.84) ^# 0.30 GOLD III + IV  16 (51.6) 15 (48.4) 155 (76.4) 48 (23.6) 3.02 (1.37-6.67) ^# 0.006 0.001 ^§ Age> 60, GOLD I + II 103 (70.5) 43 (29.5) 139 (76.0) 44 (24.0) 1.25 (0.75-2.10) ^# 0.39 GOLD III + IV  59 (72.0) 23 (28.0) 139 (76.0) 44 (24.0) 1.31 (0.69-2.49) ^# 0.40

( ^* Homogeneous test

^# Annual smoking adjustment value ^¶ Age value ^† Current and previous smokers ^‡ Corrected with age and annual smoking.

^§ Compared to all other groups.)

<4-2> Correlation analysis of combined effects of smoking status

In addition to the classification analysis, the effect of the combination of H451R genotype and smoking status on the risk of developing COPD was investigated in the same manner as in Example 3.

As a result, as shown in Table 4, when compared with the non-smoker group having the H / H genotype, it was found that the risk of developing COPD is increased if the H / R or R / R genotype and a large amount of smoking is high (correction OR = 9.51, 95% CI = 3.93-23.01, P <0.001). However, the association between H451R genotype and smoking status was analyzed by multivariate logistic regression. However, no statistically significant results were obtained.

Relationship between COL4A3 H451R Genotype and Smoking Rate for Risk of COPD Smoking status genotype H / H Definition OR (95% CI) ^* H / R + R / R Definition OR (95% CI) ^* Non-smoker 8/40 ^# 1.00 (reference) 3/13 1.23 (0.27-5.47) smoker ≤ 33 annual smoking 69/151 2.40 (1.05-5.49) ^¶ 24/47 2.79 (1.11-7.05) ^† > 33 annual smoking 136/103 5.36 (2.37-12.13) ^‡ 71/32 9.51 (3.93-23.01) ^‡

( ^* Analyzed by logistic regression with age correction based on non-smokers of H / H genotype.

^# Patient / control.

^¶ P = 0.04; ^† P = 0.03; ^‡ P <0.001.

P = 0.32 variance between genotype and smoking.)

Taken together, our analysis of the potential association between the COL4A3 gene polymorphism and the risk of COPD revealed that the H451R polymorphism was clearly associated with an increased risk of developing COPD. In addition, the association between H451R polymorphism and COPD was more apparent with younger age and with higher COPD. These results indicate that the COL4A3 gene may be involved in the development of COPD and that H451R polymorphism may be used as an effective marker for COPD sensitivity.

As described above, the marker for diagnosing chronic pulmonary dysfunction susceptibility of the present invention has an effect of diagnosing the degree of susceptibility to chronic pulmonary dysfunction. Therefore, the marker of the present invention and its application method can be used for the purpose of predicting and determining the susceptibility to chronic pulmonary dysfunction.

<110> kyungpook national university industry-academic cooperation foundation <120> Marker for the diagnosis of susceptibility to chronic obstructive          pulmonary disease using COL4A3 gene and method for predicting and          analyzing susceptibility to chronic obstructive pulmonary disease          using the same <130> NP07-0132 <160> 15 <170> KopatentIn 1.71 <210> 1 <211> 301 <212> DNA <213> Homo sapiens <400> 1 agctttcaaa gatcaactac cttaaaaata ccacatctat gtaatatgaa gggaagagct 60 ggtcaccatg ctttctcagt tgcagataaa cttctaaaga ctaggcttcc aatacaaaga 120 tgagagagat gcattttaaa taatacatat attacaatac ttgctaattg aaaaaaacac 180 aaataaaaaa ttgtctttgg tgctgtattt ttataggtga catcgttttt cgcaagggtc 240 cacctggaga tcacggactg ccaggctatc tagggtctcc aggaatccca ggagttgatg 300 g 301 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> -1162T> C_1 <400> 2 acagagcaca gtagtattgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> -1162T> C_2 <400> 3 atagtaacta acacaggcgc 20 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> IVS2 + 12C> A_1 <400> 4 atatttctat tgatatattg ctacaaggtc 30 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IVS2 + 12C> A_2 <400> 5 ggatctttct gctaccgatg a 21 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> G162E_1 <400> 6 ctgggattac aggcatgtg 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G162E_2 <400> 7 cttctctgaa gtgctgtacc 20 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> H451R_1 <400> 8 agctttcaaa gatcaactac ctta 24 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> H451R_2 <400> 9 ccatcaactc ctgggattc 19 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> P574L_1 <400> 10 gggtgaccca ggactta 17 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> P574L_2 <400> 11 ggttgaaatc actgaatgct ac 22 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P141L_1 <400> 12 gggttacttt gtctagattt accatt 26 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> P141L_2 <400> 13 ggcatgcaaa cctaccg 17 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 315C> A_1 <400> 14 gtttcaaagt tctctgtggc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 315C> A_2 <400> 15 cacaatgctc caggatacca 20  

Claims (9)

In a polynucleotide consisting of SEQ ID NO: 1, chronic pulmonary dysfunction consisting of a polynucleotide consisting of 20 to 100 consecutive DNA sequences containing the 253rd base A of SEQ ID NO. COPD, chronic obstructive pulmonary disease. The marker of claim 1, wherein the chronic pulmonary dysfunction is selected from the group consisting of emphysema, chronic bronchitis, and bronchiolitis. Kit for diagnosing chronic pulmonary dysfunction comprising a primer capable of amplifying a polynucleotide comprising the 253rd base of SEQ ID NO: 1. The kit according to claim 3, wherein the primer is a primer having a nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9. A microarray for diagnosing chronic pulmonary dysfunction comprising the polynucleotide of claim 1. a) obtaining a nucleic acid sample from a sample; b) amplifying the polymorphic site of the 253th base of SEQ ID NO: 1 in the nucleic acid sample obtained in step a); c) determining the base of the amplified polymorphic site of step b) and analyzing the risk of developing chronic pulmonary dysfunction. 7. The method of claim 6, wherein the risk of developing chronic pulmonary dysfunction is increased when the genotype of the 253th base of SEQ ID NO: 1 determined in step c) is AG or GG. 7. The method of claim 6, wherein the chronic pulmonary dysfunction is selected from the group consisting of emphysema, chronic bronchitis, and bronchiolitis. The method of claim 6, wherein the base of the step c) is sequencing (sequencing), Single Strand Conformation Polymorphism (SSCP), Denaturing Gradient Gel Electrophoresis (DGGE), DNA microarray, Restriction Fragment Length Polymorphism ), TDGS (Two-dimensional Gene Scanning), Taq-Man and TOGATM.