KR20090041909A - The protein chip for screening inhibitors of tyrosinase phosphorylation and the screening method using it - Google Patents

Abstract

A protein chip for screening tyrosinase phosphorylation inhibitors containing an immobilization fusion protein is provided to massively screen whitening-related target molecule by inhibiting tyrosinase phosphorylation which is a pigmentation-related enzyme caused by PKC beta(Protein Kinase C beta). A protein chip for screening tyrosinase phosphorylation inhibitors containing an immobilization fusion protein is obtained by immobilizing a fusion protein, wherein Maltose Binding Protein(MBP) and polypeptide containing all or some part of amino acid sequence of a mixture of tyrosinase cytosolic domain and transmembrane domain are fused, on a solid substrate. A method for screening the tyrosinase phosphorylation inhibitors comprises the following steps of: adding PKC and candidate inhibitors of tyrosinase phosphorylation to the protein chip; treating anti-phosphorylation tyrosinase or anti-phosphorylserine specific antibody; confirming the amount of antibodies coupled with the protein chip; and selecting the candidate material to reduce degree of coupling antibodies in comparison with a control group.

Description

Protein chip for screening inhibitors of tyrosinase phosphorylation and the method for screening inhibitors of tyrosinase phosphorylation and the screening method using it

The present invention relates to a method for detecting a tyrosinase phosphorylation inhibitor protein chip and a method for screening a tyrosinase phosphorylation inhibitor using the same, and more particularly, to inhibit the phosphorylation of tyrosinase, a pigmentation-related enzyme by PKC β (Protein Kinase C beta). The present invention relates to a biological micro protein chip for searching for a tyrosinase phosphorylation inhibitor and a method for searching for a tyrosinase phosphorylation inhibitor using the same.

Protein Kinase C (PKC) is a cyclic nucleotide-independent enzyme that phosphorylates the serine and threonine residues of many target proteins. The PKC was first discovered in bovine cerebellum in 1977 by Nishizuka and its partners and is known as a protein that phosphorylates histones and protamines. Since then, PKC has been known to be involved in many biological processes such as development, memory, differentiation, proliferation and carcinogenesis, and these are known to be involved in structure, cofactor requirements and It is known that families with different functions exist. There are currently 10 isoforms identified and can be divided into three categories.

Typical (c) PKC subtypes (α, βI, βII, γ)

: Calcium and diacylglycerol (DAG) are required to be active.

Novel (n) PKC subtypes (δ, ε, η (PKC-L), θ, μ)

: Diacylglycerol (DAG) is required to be active.

-Atypical (a) PKC subtypes (ζ, ι, λ)

: Calcium and diacylglycerol (DAG) are not needed to be active.

All the PKCs have a phospholipid-binding domain for membrane interaction. The general structure of a PKC molecule consists of catalytic and regulatory domains, each of which is subtyped into a conserved region and a variable region.

Activity of cPKC includes translocation from cytosol to binding domain of cell membrane. At this time, there is an interaction between receptors for activated C-kinase (RACK) and activated PKC, which is structurally distinguished from inactive PKC. Diacylglycerol (DAG) promotes cPKC penetration, and the affinity of calcium and PKC after attachment increases the activity of the enzyme. Phosphatidylserine acts as a membrane lipid anchor. Β subtype of PKC is known to activate melanin by activating tyrosinase, a membrane protein of melanosomes.

Tyrosinase is widely distributed in mammals and plants, and plant tyrosinase is involved in the browning phenomenon in the processing of fruits and vegetables. Mammalian tyrosinase is contained in melanocytes (melanocytes) distributed in the skin, hair follicles, eyes, etc. and plays a role in protecting against UV damage. To date, numerous tyrosinase has been isolated and purified from various species of organisms, and research on the structure and function of these tyrosinase has been actively conducted. Mammalian tyrosinase has a molecular weight of 65-75 kDa depending on the state of glycosylation and is a copper-dependent glycoprotein present in the melanosomal membrane. Tyrosinase is an enzyme that converts tyrosine, a practical first step in melanin formation, and is a key enzyme in melanogenesis. The role of this enzyme occurs inside the melanosomes, which account for more than 90% of the 512 amino acid sequences of tyrosinase, while the remaining short sequences have approximately 30 amino acids and form the transmembrane and cytoplasmic domains (Hee). Young Park et.al., The Journal of Biological Chemistry , vol. 268, No. 16 Issue of june 5, pp. 11742-11749,1993). Tyrosinase activity is characterized by activated PKC β in which two serines of the cytosolic C-terminal sequence (505 and 509) are translocated to melanosomes by RACK-1. Phosphorylation by Hee-Young Park et.al., The Journal of Biological Chemistry , vol. 274, No. 23 Issue of june 4, pp. 16470-16478, 1999).

Melanin (Melanin) is a high-molecular compound synthesized in melanin-producing cells in the basal layer of the epidermis and absorbs ultraviolet rays that have harmful effects on the skin and blocks the penetration into the skin. Melanin is a compound formed by the conversion of tyrosine (tyrosine) by the active tyrosinase of the melanosome (melanosome) present in the melanocyte (melanocyte). Tyrosinase acts on the synthesis of melanin in melanin-forming cells, and tyrosinase acts on tyrosine (hydroxy phenylalanine), an amino acid, in the early stages of melanogenesis, promoting the formation of dihydroxy phenylalanine (DOPA) and also dihydroxy Promotes oxidation of phenylalanine (DOPA) to form quinones (DOPA Quinone), and the formed dopaquinones undergo a series of steps to produce melanin. Therefore, it is believed that inhibitors that inhibit the activity of tyrosinase may be used as skin whitening agents for treating skin pigmentation lesions and in functional cosmetics.

So far, the search for such inhibitors has been performed by gel mobility-shift analysis (C. Jansen et al., Biochem . J. 246: 227-232, 1987; K. Ruscher et al., J. Biotechnol . 78: 163-170. , 2000), Southwestern blotting (B. Bowen et al., Nucleic Acids Res . 8: 120, 1980; WK Miskimins et al., Proc . Natl . Acad . Sci . USA 82: 6741-6744, 1985), ELISA (Y. Choo et al., Nucleic Acids Res . 21, 1993), but reporter constructs in yeast assay (SD Hanes et al., Science 251: 426-430, 1991) were performed, but these methods were performed using radioisotopes, well plates. Using linked immunosorbent assay (ELISA) or immunofluorescence, there was a problem of low-throughput screening (LTS), such as limited number of experiments and time, and complicated experimental methods.

Therefore, the present inventors selected the interactions of the cytosolic domains of PKC β and tyrosinase as screening targets and implemented them on protein chips to perform simultaneous multiple experiments by applying a high throughput screening (HTS) system, a low concentration and The present invention has been completed by confirming that a small molecular weight substance can be searched to search for a tyrosinase inhibitor, a target protein related to whitening.

An object of the present invention is to provide a protein chip for searching for tyrosinase phosphorylation inhibitor and a method for searching for tyrosinase phosphorylation inhibitor using the same.

In order to achieve the above object, the present invention provides a polypeptide comprising a whole or part of an amino acid sequence combining the cytosolic domain and the transmembrane domain of tyrosinase and maltose binding protein (MBP). Provided is a protein chip for searching for tyrosinase phosphorylation inhibitor fixed in a solid substrate is a fusion protein fused to).

The present invention also provides a kit for searching for a tyrosinase inhibitor comprising the protein chip.

In addition, the present invention

1) adding a tyrosinase phosphorylation inhibitor candidate with PKC (Protein Kinase C) to the protein chip;

2) treating anti-phosphorylated tyrosinase or anti-phosphoserine specific antibodies;

3) confirming the amount of antibody bound to the protein chip; And

4) provides a method for screening a tyrosinase phosphorylation inhibitor comprising the step of selecting a candidate substance having a reduced antibody binding degree compared to the control group not treated with the inhibitor candidate substance.

Protein chip for the detection of tyrosinase phosphorylation inhibitor of the present invention is economical, universal by using a glass chip other than the conventional radioisotope, well plate immunoassay (enzyme-linked immunosorbent assay, ELISA) or immunofluorescence method It is possible to supply and to simplify the process by introducing a column method without the difficult purification process of tyrosinase used as a substrate for PKC β. In addition, simultaneous experiments can be performed on a glass substrate, and a small concentration of inhibitors as well as small molecular weight inhibitors have the advantage of being sensitively screened by the fluorescence method. In addition, it is analyzed at the protein level rather than the gene level in relation to the screening of the existing whitening-related target material, and because of the use of the whitening-related substrate itself rather than the purpose of screening the inhibitor using a known substrate, the scope of application is wider. Therefore, the protein chip for searching for tyrosinase inhibitor of the present invention and the searching method using the same can be usefully used for developing whitening-related target molecules and effective new materials by discovering inhibitors that inhibit the phosphorylation of tyrosinase, a pigmentation-related enzyme.

Hereinafter, the present invention will be described in detail.

The present invention relates to a fusion protein in which a polypeptide comprising all or part of an amino acid sequence combining a cytosolic domain and a transmembrane domain of tyrosinase is fused to a maltose binding protein (MBP). Provided is a protein chip for searching tyrosinase phosphorylation inhibitor fixed on a solid substrate.

Phosphorylation of tyrosinase is that two serines (505 and 509) of the cytosolic C-terminal sequence of tyrosinase are phosphorylated by activated PKC β. Tyrosinase is an enzyme that converts tyrosine and plays an important role in the production of melanin. Thus, inhibitors that inhibit the phosphorylation of tyrosinase may be used as therapeutic agents for skin pigmentation lesions and as whitening agents in functional cosmetics.

The inventors of the present invention have fabricated a protein chip for the detection of tyrosinase phosphorylation inhibitors with the aim of constructing a search method for screening the phosphorylation inhibitors of tyrosinase. Protein chips were prepared in the following manner.

1) forming a well using an adhesive sticker on an epoxy slide;

2) arranging by injecting a substrate of PKC β into each well of step 1); And

3) washing and blocking the arrangement of step 2);

In the above method, it is preferable that the substrate of PKC of step 2) uses tyrosinase, but since tyrosinase is difficult to array to have a complete structure on the protein chip as a membrane protein, the substrate of PKC β is actually MBP which fused 11 amino acids of cytosolic domain, or 30 amino acid sequences combining cytosol and transmembrane domains to Maltose Binding Protein (MBP) It is more preferred to use -TYR fusion protein, but not always limited thereto.

The inventors prepared 6H-MBP-EK-TYR11aa and 6H-MBP-EK-TYR30aa using PCR, and then inserted into pET vectors, respectively, to express 6H-MBP-EK-TYR11aa and 6H-MBP-EK-TYR30aa expression vectors. Prepared. The recombinant vector pET21a-6H-MBP-EK- TYR11aa and pET21a-6H-MBP-EK- TYR30aa each Escherichia Recombinant strains transduced in coli BL21 (DE3) were cultured and chromatographed by overexpressing MBP-TYR fusion proteins (6H-MBP-EK-TYR11aa and 6H-MBP-EK-TYR30aa). Separated MBP-TYR fusion proteins (6H-MBP-EK-TYR11aa and 6H-MBP-EK-TYR30aa) were arrayed on chip (see FIG. 9).

The inventors of the present invention, MBP-TYR11aa, MBP-TYR30aa, the positive control histone (Histone) and the negative control MBP fusion (MBP) having a different sequence to determine the degree of tyrosinase phosphorylation according to the substrate on the protein chip Phosphorylation of tyrosinase was confirmed by fluorescence method using -c2X as each substrate. As a result, signals of histone and MBP-TYR30aa were strongly detected, but MBP-c2X without phosphorylation site had a weak signal, and MBP-11aa had a phosphorylation site but a weak signal. The MBP-11aa appears to have steric hindrance because the portion fused with MBP is too short to react with PKC β. Therefore, it can be seen that it is preferable to use MBP-TYR30aa as the substrate of the protein chip of the present invention.

In addition, the present inventors divided the presence or absence of treatment with PKC β or phosphoserine in order to confirm whether the search result is actually phosphorylation. As a result, no signal was seen when PKC β was not treated or the antibody searching for phosphoserine was not treated. Thus it can be seen that the signal is due to phosphorylation.

The present inventors measured the degree of phosphorylation by dividing the treatment of PKC β or ATP by protein concentration and time to determine whether the phosphorylation is caused by PKC β. As a result, it was found that the degree of phosphorylation increased as the concentration of PKC β or ATP increased. Therefore, it can be seen that the phosphorylation is a mechanism by PKC β and ATP.

The present invention also provides a kit for searching for a tyrosinase inhibitor comprising the protein chip.

By treating the kit with a tyrosinase phosphorylation inhibitor candidate, the degree of phosphorylation inhibition of tyrosinase can be measured. Thus, the kit of the present invention can be used to easily search for tyrosinase inhibitors.

In addition, the present invention

1) adding a tyrosinase phosphorylation inhibitor candidate with PKC (Protein Kinase C) to the protein chip;

2) treating anti-phosphorylated tyrosinase or anti-phosphoserine specific antibodies;

3) confirming the amount of antibody bound to the protein chip; And

4) The present invention provides a method for screening a tyrosinase phosphorylation inhibitor, the method comprising selecting a candidate substance having a reduced degree of antibody binding as compared to a control group not treated with the inhibitor candidate substance.

In the search method, the PKC of step 1) is preferably PKC βII, but is not limited thereto.

In the detection method, the antibody of step 2) preferably uses mouse anti-phosphoSer / Thr (Mouse anti-phosphoSer / Thr), but is not limited thereto, and detects phosphoserine (phsphoserine) Any antibody that can be used can be used.

In the above detection method, the amount of antibody bound to the protein chip of step 3) is preferably introduced by a high throughput screening (HTS) system, which includes a fluorescence method and a fluorescent material performed by detecting fluorescence by a fluorescent label. It is preferable to use a surface plasmon resonance (SPR) method for measuring the plasmon resonance change of the surface in real time without a label of or a surface plasmon resonance imaging (SPRI) method for imaging and confirming the SPR system.

The fluorescence method is a method of labeling an antibody that binds to an anti-phosphoserine specific antibody on a protein chip with a fluorescent material and spotting the signal using a fluorescence scanner program, and applying this method to treat tyrosinase phosphorylation inhibitors. It can be seen that the binding is inhibited. The fluorescent material is Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC) , Rhodamine (rhodamine) is preferably any one selected from the group consisting of, but not limited to.

Unlike the fluorescence method, the SPR system can analyze the degree of inhibition of tyrosinase phosphorylation in real time without labeling the sample with a fluorescent material, but has the disadvantage that simultaneous sample analysis is impossible. In the case of SPRI, it is possible to analyze multiple samples simultaneously using a microalignment method, but it has a disadvantage of low detection intensity.

In order to confirm the applicability of the protein chip as a screening device, the present inventors treated Birosindolylmaleimide I, which is known as tyrosinase mimetic peptide (TMP) or PKC β as a selective substrate, to confirm the applicability of the protein chip as a screening device. The degree of inhibition of tyrosinase phosphorylation was confirmed by fluorescence. As a result, it was confirmed that the degree of phosphorylation decreases as the treatment concentration of the inhibitor increases. Therefore, it can be seen that the protein chip of the present invention can search for tyrosinase phosphorylation inhibitor.

The protein chip of the present invention and a search method using the same are characterized in that the analysis at the protein level, not the gene level, which is a conventional target material screening method, and related to the purpose of screening PKC β inhibitor using a known substrate Since the substrate itself can be used, it is characterized by a wider range of applications.

Hereinafter, the present invention will be described in detail by Examples and Experimental Examples.

However, the following Examples and Experimental Examples are only illustrative of the present invention, and the content of the present invention is not limited to the following Examples and Experimental Examples.

< Example  1> Tyrosinase  Mimic protein ( Tyrosinase mimetic peptide Manufacturing

The present inventors fused 11 maltose of cytosolic domains and 30 amino acids including transmembrane and cytoplasmic domains to maltose binding protein (MBP) so that the portion of the substrate of PKCβ is easily Substrates were made to be exposed. The DDDDK, a cleavage site of enterokinase with a hydrophobic substrate, was inserted between the MBP and the peptide so that the substrate sequence was well exposed on the surface of the MBP. ), 30 amino acids longer than 11 sequences were produced. The preparation method initially made a template of 30aa length through DNA synthesis, and prepared primers of restriction enzyme site + DDDDK + 30aa and restriction enzyme site + DDDDK + 11aa based on the template, respectively, to perform PCR. Amplified through. The genomic DNA of E. coli DH5α was used as a template to amplify the MBP sequence and attach the previously created sequence. Two prepared sequences, MBP + DDDDK + 30aa and MBP + DDDDK + 11aa, were put into the pET21a vector, respectively, and the plasmids were purified, transformed into E. coli BL21, and cultured.

< Example  2> recombination TYR30aa  And TYR11aa Preparation of High Concentration Expression Vector

<2-1> Reagent

The present inventors have found that the E. coli (Escherichia used for the separation of plasmid DNA manipulation and coli ) strain is DH5α (F-φ80dlacZΔM15 Δ (lacZYA_argF) U169 end A1 recA1 hsdR17 (rK-mK +) deoR thi_1 supE44 λ-gyrA96 relA1) and Escherichia coli used to express genes in recombinant E. coli coli ) strain is BL21 (D3) (F-ompT hsdSB (rB-mB-) gal (λc I857 ind1 Sam7 nin5 lacUV5-T7gene1) dcm (DE3)). The vector used for recombinant E. coli expression is pET21a (Novagen). Restriction enzymes for DNA recombination, DNA polymerase, T4 DNA ligase, RNase, PCR reagents (pfu polymerase, dNTP mixture) were used by Boehringer Mannheim or Bioprogen, and media components were purchased from Difco. Reagents used for electrophoresis and protein quantification were purchased from Bio-rad.

<2-2> medium and culture conditions

As a medium for E. coli, LB (1% Tryptone, 0.5% Yeast extract, 1% NaCl) was used, and 50ug / ml ampicillin was used for the growth of E. coli transformed with the expression vector. Was used. To express the recombinant strain, in LB medium containing 50 ug / ml ampicillin, the temperature was incubated at 37 ° C. for 2 hours, and then 1 mM isopropyl 1-thio-beta-di- when the OD was about 0.6 at 600 nm. Galactopyranoside (Isopropyl 1-thio-β-D-galactopyranoside (IPTG)) was added to allow expression of the T7 lac promoter. And, after addition of IPTG was incubated for 4-6 hours. After incubation, the final oxygen demand (OD) of the culture was measured and the cells were recovered.

<2-3> Preparation of Recombinant Plasmid

Vector pET21a (see FIG. 1) was digested overnight at 37 ° C. with restriction enzymes NdeI and XhoI, followed by electrophoresis on a 10% agarose gel to size. It was confirmed and eluted using a Power gel extraction kit (Bioprogen). 6H-MBP-EK-TYR30aa to be inserted into the vector was prepared using PCR (Perkin Elmer 2400). Each primer was prepared based on the sequence of MBP and TYR. The MBP sequence was amplified by genomic DNA of E. coli DH5α as a template and TYR by human tyrosinase (Oculocutaneous albinism IA, Genebank No. NM_000372) as RT-PCR. In this case, as the fragment including the transmembrane domain and the cytoplasmic domain, the 1580 to 1669 site of the nucleotide sequence of the tyrosinase was used. The sequences of MBP and TYR, and primer sequences are as follows (see Table 1).

MBP  And TYR The sequence of, and primer  order division Sequence (5 '-> 3') MBP (Maltose binding protein) SEQ ID NO: 1 ATGAAAATCGAAGAAGGTAAACTGGTAATCTGGATTAACGGCGATAAAGGCTATAACGGTCTCGCTGAAGTCGGTAAGAAATTCGAGAAAGATACCGGAATTAAAGTCACCGTTGAGCATCCGGATAAACTGGAAGAGAAATTCCCACAGGTTGCGGCAACTGGCGATGGCCCTGACATTATCTTCTGGGCACACGACCGCTTTGGTGGCTACGCTCAATCTGGCCTGTTGGCTGAAATCACCCCGGACAAAGCGTTCCAGGACAAGCTGTATCCGTTTACCTGGGATGCCGTACGTTACAACGGCAAGCTGATTGCTTACCCGATCGCTGTTGAAGCGTTATCGCTGATTTATAACAAAGATCTGCTGCCGAACCCGCCAAAAACCTGGGAAGAGATCCCGGCGCTGGATAAAGAACTGAAAGCGAAAGGTAAGAGCGCGCTGATGTTCAACCTGCAAGAACCGTACTTCACCTGGCCGCTGATTGCTGCTGACGGGGGTTATGCGTTCAAGTATGAAAACGGCAAGTACGACATTAAAGACGTGGGCGTGGATAACGCTGGCGCGAAAGCGGGTCTGACCTTCCTGGTTGACCTGATTAAAAACAAACACATGAATGCAGACACCGATTACTCCATCGCAGAAGCTGCCTTTAATAAAGGCGAAACAGCGATGACCATCAACGGCCCGTGGGCATGGTCCAACATCGACACCAGCAAAGTGAATTATGGTGTAACGGTACTGCCGACCTTCAAGGGTCAACCATCCAAACCGTTCGTTGGCGTGCTGAGCGCAGGTATTAACGCCGCCAGTCCGAACAAAGAGCTGGCGAAAGAGTTCCTCGAAAACTATCTGCTGACTGATGAAGGTCTGGAAGCGGTTAATAAAGACAAACCGCTGGGTGCCGTAGCGCTGAAGTCTTACGAGGAAGAGTTGGCGAAAGATCCACGTATTGCCGCCACCATGGAAAACGCCCAGAAAGGTGAAATCATGCCGAACA TCCCGCAGATGTCCGCTTTCTGGTATGCCGTGCGTACTGCGGTGATCAACGCCGCCAGCGGTCGTCAGACTGTCGATGAAGCCCTGAAAGACGCGCAGACT TYR SEQ ID NO: 2 TGT CGT CAC AAG AGA AAG CAG CTT CCT GAA GAA AAG CAG CCA CTC CTC ATG GAG AAA GAG GAT TAC CAC AGT TTG TAT CAG AGC CAT TTA 6H-MBP Forward SEQ ID NO: 3 GGC CAT ATG CAC CAC CAC CAC CAC CAC AAA ATC GAA GAA GGT AAA CTG GTA ATC Reverse SEQ ID NO: 4 CC AAG CCA TGG AGT CTG CGC GTC TTT CAG GGC TTC ATC GAC TYR mold Forward SEQ ID NO: 5 AAG AGA AAG CAG CTT CCT GAA GAA AAG CAG CCA CTC CTC ATG GAG AAA GAG GAT TAC CAC AGT TTG TAT Reverse SEQ ID NO: 6 CTG ATA CAA ACT GTG GTA ATC CTC TTT CTC CAT GAG GAG TGG CTG CTT TTC TTC AGG AAG CTG CTT TCT ek-TYR 30aa Forward SEQ ID NO: 7 GGC CCA TGG GAC GAC GAC GAC AAG TGT CGT CAC AAG AGA AAG CAG CTT Reverse SEQ ID NO: 8 GGC CTC GAG TTA TAA ATG GCT CTG ATA CAA ACT ek-TYR 11aa Forward SEQ ID NO: 9 GGC CCA TGG GAC GAC GAC GAC AAG GAG GAT TAC CAC AGT Reverse SEQ ID NO: 10 GGC CTC GAG TTA TAA ATG GCT CTG ATA

To prepare a tyrosinase template, each primer of the tyrosinase template is dissolved at 100 pM and 10 ul each of the forward and reverse are mixed. The mixture is subjected to one cycle of reaction at 95 ° C. for 5 minutes, 55 ° C. for 5 minutes, 37 ° C. for 10 minutes, and 20 ° C. for 20 minutes in PCR. PCR reaction was carried out using the reaction solution as a template, and the conditions were 30 cycles of denaturation at 95 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and extension at 72 ° C. for 45 seconds. The last elongation was carried out at 72 ° C. for 7 minutes, and 2.5 unit pfu polymerase, 5 μl 2.5 mM dNTP, 2 μl template, each 100 pM oligonucleotide primer, 10 μl 10 × pfu polymerase buffer solution. The final volume was adjusted to 100 μl with sterilized tertiary distilled water and reacted. At this time, after confirming the size of the reaction by agarose (agarose) electrophoresis, it was eluted using a PCR purification kit (Bioprogen). The 6H-MBP PCR product in this eluted PCR product was restriction enzymes Nde I and Nco I, and EK-TYR 30aa and EK-TYR 11aa were Nco I / Xho I 3 at 37 ° C. After digestion for a time, the size was confirmed by electrophoresis and gel elution was performed.

Each of the PCR products were prepared by ligation of three pieces at 16 ° C. for 4 hours using pET 21a and T4 DNA ligase, followed by ligation mixture. The mixture was transformed into DH5α to obtain colonies. The colonies thus obtained were inoculated in 3 ml of LB / amp and incubated overnight, and Nde I and Xho I used for cloning after preparing plasmids using the Plasmid purification kit (Bioprogen). By digestion, the genes of the sizes of 6H-MBP-ek-TYR30aa and 6H-MBP-ek-TYR11aa were found by electrophoresis on agarose gel, and MBP Recombinant genes correctly identified through sequencing using internal sequence primers were obtained (see FIGS. 2 to 7).

<2-4> Preparation of Recombinant Strain

1 ug of the prepared pET21a-6HMBP-ek-TYR30aa and pET21a-6HMBP-ek-TYR11aa vectors were inserted into 100ul of the protein-expressing strain BL21 (DE3), incubated for 30 minutes on ice, and then heated at 42 ° C. for 90 seconds. Heat shock is added, and 100ul of LB medium is added and reacted at 37 ° C for 30 minutes. And then plated on an LB agar plate containing ampicillin (ampicillin) (agar plate), and cultured at 37 ℃ to obtain a recombinant strain transformed with pET21a-6HMBP-ek-TYR30aa and pET21a-6HMBP-ek-TYR11aa.

< Example  3> MBP - TYR  Recombinant Fusion Protein Expression and Isolation

<3-1> Expression of Protein

3 ml of LB / amp culture was inoculated with the recombinant strain 1 colony transformed with pET21a-6HMBP-ek-TYR30aa or pET21a-6HMBP-ek-TYR11aa to confirm the expression by induction or induction. . Each tube was inoculated with colonies, and then incubated at 37 ° C until O.D. became 0.6 at 600 nm. When O.D. reached 0.6, 1 mM isopropyl-1-thio-beta-di-galactopyranoside (Isopropyl 1-thio-β-D-galactopyranoside, IPTG) was added to induce protein expression.

<3-2> Isolation of Protein

When the final O.D. is> 3, 1 ml of each culture is taken and centrifuged at 12,000 rpm for 1 minute to obtain pellets. 1 ml of DW was added to the pellet so that it was suspended well, and the ultrasonication was broken for 30 seconds. The total fraction in 1 ml of crushed liquid was obtained, and centrifuged at 12,000 rpm for 1 minute to separate the soluble fraction and the insoluble fraction. 20ul of 5X Lysis Buffer (lysis buffer) was added to 80ul of the fraction, heated at 100 ° C for 5 minutes, cooled with ice, and then loaded onto a 1% thick 5% stacking gel. Separation was carried out at 12% separating gels. The loaded PAGE gel was electrophoresed at 150 V, 25 mA, and after electrophoresis, the gels were stained with a coomasyl brilliant blue-R solution to produce 6H-MBP-ek-TYR30aa and 6H-MBP-ek-. The expression level of TYR11aa could be confirmed (see FIG. 8).

< Example  4> Protein Chips ( Protein chip ) Production

The chip was made of epoxy slide (VEPO-25C, CEL associate), and was made to form a well by attaching a hole of 1.5 mm in diameter to the adhesive sticker. The substrate was spotted in each well with a concentration of 0.5 mg / ml containing 20% of glycerol and placed at 30 ° C. overnight to be arrayed on the chip. Shaking for 20 minutes with a washing solution (PBS (pH7.4) containing 0.5% Tween-20) and briefly wash with distilled water until no foaming occurs. Blocking was done for 1 hour 30 minutes with 3% BSA. As described above, after washing with a washing solution (PBS (pH 7.4) containing 0.5% Tween-20) for 20 minutes, washing it briefly until no bubbles occur with distilled water, and drying with nitrogen gas. In each well, 100 uL PKC solution (20 mM HEPES (pH 7.4), 0.1 mM CaCl ₂ , 10 μM Mg / ATP cocktail (Upstate), 10% lipid mixture (100 ug / ml phosphatidyl-serine (Sigma), 20 ug / ml Diacylglycerol (Sigma), 1 mM HEPES (pH 7.4), 0.03% Triton X-100, 1.2 ug / ml PKC βII (Calbiochem) were spotted and reacted at 30 ° C. 10 ug / mouse anti-phosphoSer / Thr after drying with antibody diluting solution (10% BSA in PBS containing pH 30% glycerol (pH7.4). After diluting to the ml concentration and spotting, the reaction was carried out for 1 hour After washing and drying for 20 minutes, Cy5-labeled goat anti-mouse antibody (G) oat anti-mouse Ab) was diluted to 20 ug / ml and spotted after reacting for 30 minutes, and washed with a fluorescent scanner (Axon) for 20 minutes (see Fig. 9).

< Experimental Example  1> Determination of phosphorylation by substrate

MBP-11aa and MBP-30aa prepared above were fused with histone (Sigma) as a positive control and MBP as a negative control to determine whether it can be used as a substrate for PKC β. (NEB) and BSA, a blocking agent, were used. The reaction conditions were ATP 10 uM, and reacted for 2 hours. Each well was divided into the presence or absence of PKC β treatment and the presence of antibody treatment to confirm whether the result of phosphorylation was actually detected.

As a result, only a strong control group, histone (Histone) and the produced MBP-30aa showed a strong signal (signal). MBP-11aa also has a phosphorylation site, but the fused portion of MBP was too short to react with PKC β, indicating steric hindrance. In addition, when no PKC β was treated or no antibody was searched for phosphoserine, no signal was seen, indicating that the antibody only detected serine phosphorylated by PKC β (see FIG. 10). ).

< Experimental Example  2> PKC  β and ATP  Measure the degree of phosphorylation according to the change of concentration

In order to confirm that the phosphorylation of <Experimental Example 1> is caused by PKC β, the protein chip of <Example 4> was treated differently according to the concentration and reaction time of PKC β and ATP.

As a result, as the concentration of PKC β or ATP increased, phosphorylation increased, thereby confirming that phosphorylation is a mechanism by PKC β and ATP (see FIGS. 11 and 12).

< Experimental Example  3> Measure the degree of phosphorylation according to the change of inhibitor concentration

<3-1> Tyrosinase  Mimic protein ( Tyrosinase mimetic peptide ) process

The degree of inhibition of phosphorylation was confirmed by treating tyrosinase mimetic protein synthesized with 11 peptides having a phosphorylation sequence on the protein chip of <Example 4>.

As a result, it was confirmed that the degree of phosphorylation was lowered as the treatment concentration of the tyrosinase mimic protein increased (see FIG. 13).

<3-2> Bisindoleylmaleimide ( Bisindolylmaleimide ) I treatment

The degree of inhibition of phosphorylation was confirmed by treating bisindolylmaleimide I, which is known as a selective substrate of PKC β, to the protein chip of <Example 4>.

As a result, it was confirmed that the degree of phosphorylation was lowered as the treatment concentration of bis indolyl maleimide I increased (see FIG. 14).

1 is a diagram showing a pET 21a (+) vector map used for genetic recombination,

2 is a diagram showing a vector map of pET 21a-6H-MBP-EK-TYR30aa,

Figure 3 is a diagram showing the results of electrophoresis confirming that 6H-MBP-EK-TYR30aa is inserted in the recombinant vector,

4 is a diagram showing the results of sequencing of 6H-MBP-EK-TYR30aa,

5 is a diagram showing a vector map of pET 21a-6H-MBP-EK-TYR11aa,

6 is a diagram showing the results of electrophoresis confirming that 6H-MBP-EK-TYR11aa is inserted into the recombinant vector.

7 is a diagram showing the results of sequencing of 6H-MBP-EK-TYR11aa,

8 is a diagram showing the results of electrophoresis showing the expression level of 6H-MBP-EK-TYR30aa and 6H-MBP-EK-TYR11aa in recombinant E. coli,

9 is a schematic diagram showing a manufacturing process of a protein chip,

10 is a graph showing the degree of phosphorylation according to substrate in the protein chip,

11 is a graph showing the degree of phosphorylation according to PKC β concentration in the protein chip,

12 is a graph showing the degree of phosphorylation according to ATP concentration in the protein chip,

13 is a graph showing the degree of phosphorylation according to the TMP treatment concentration in the protein chip,

14 is a graph showing the degree of phosphorylation according to the treatment concentration of bis indolyl maleimide I in the protein chip.

<110> Inha Univ. <120> The protein chip for screening inhibitors of tyrosinase          phosphorylation and the screening method using it <130> 7p-10-15 <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 1101 <212> DNA <213> Nucleotide sequence of MBP (Maltose binding protein) <400> 1 atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60 ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120 ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180 atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240 accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300 aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360 gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420 aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480 ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540 gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600 aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660 ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720 gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780 ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc gaaagagttc 840 ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900 ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960 accatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020 tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080 gccctgaaag acgcgcagac t 1101 <210> 2 <211> 90 <212> PRT <213> amino acid sequence of Tyrosinase (TYR) <400> 2 Thr Gly Thr Cys Gly Thr Cys Ala Cys Ala Ala Gly Ala Gly Ala Ala   1 5 10 15 Ala Gly Cys Ala Gly Cys Thr Thr Cys Cys Thr Gly Ala Ala Gly Ala              20 25 30 Ala Ala Ala Gly Cys Ala Gly Cys Cys Ala Cys Thr Cys Cys Thr Cys          35 40 45 Ala Thr Gly Gly Ala Gly Ala Ala Ala Gly Ala Gly Gly Ala Thr Thr      50 55 60 Ala Cys Cys Ala Cys Ala Gly Thr Thr Thr Gly Thr Ala Thr Cys Ala  65 70 75 80 Gly Ala Gly Cys Cys Ala Thr Thr Thr Ala                  85 90 <210> 3 <211> 54 <212> PRT <213> 6H-MBP forward primer <400> 3 Gly Gly Cys Cys Ala Thr Ala Thr Gly Cys Ala Cys Cys Ala Cys Cys   1 5 10 15 Ala Cys Cys Ala Cys Cys Ala Cys Cys Ala Cys Ala Ala Ala Ala Thr              20 25 30 Cys Gly Ala Ala Gly Ala Ala Gly Gly Thr Ala Ala Ala Cys Thr Gly          35 40 45 Gly Thr Ala Ala Thr Cys      50 <210> 4 <211> 41 <212> PRT <213> 6H-MBP reverse primer <400> 4 Cys Cys Ala Ala Gly Cys Cys Ala Thr Gly Gly Ala Gly Thr Cys Thr   1 5 10 15 Gly Cys Gly Cys Gly Thr Cys Thr Thr Thr Cys Ala Gly Gly Gly Cys              20 25 30 Thr Thr Cys Ala Thr Cys Gly Ala Cys          35 40 <210> 5 <211> 69 <212> PRT <213> TYR template forward primer <400> 5 Ala Ala Gly Ala Gly Ala Ala Ala Gly Cys Ala Gly Cys Thr Thr Cys   1 5 10 15 Cys Thr Gly Ala Ala Gly Ala Ala Ala Ala Gly Cys Ala Gly Cys Cys              20 25 30 Ala Cys Thr Cys Cys Thr Cys Ala Thr Gly Gly Ala Gly Ala Ala Ala          35 40 45 Gly Ala Gly Gly Ala Thr Thr Ala Cys Cys Ala Cys Ala Gly Thr Thr      50 55 60 Thr Gly Thr Ala Thr  65 <210> 6 <211> 69 <212> PRT <213> TYR template reverse primer <400> 6 Cys Thr Gly Ala Thr Ala Cys Ala Ala Ala Cys Thr Gly Thr Gly Gly   1 5 10 15 Thr Ala Ala Thr Cys Cys Thr Cys Thr Thr Thr Cys Thr Cys Cys Ala              20 25 30 Thr Gly Ala Gly Gly Ala Gly Thr Gly Gly Cys Thr Gly Cys Thr Thr          35 40 45 Thr Thr Cys Thr Thr Cys Ala Gly Gly Ala Ala Gly Cys Thr Gly Cys      50 55 60 Thr Thr Thr Cys Thr  65 <210> 7 <211> 48 <212> PRT <213> ek-TYR 30aa forward primer <400> 7 Gly Gly Cys Cys Cys Ala Thr Gly Gly Gly Ala Cys Gly Ala Cys Gly   1 5 10 15 Ala Cys Gly Ala Cys Ala Ala Gly Thr Gly Thr Cys Gly Thr Cys Ala              20 25 30 Cys Ala Ala Gly Ala Gly Ala Ala Ala Gly Cys Ala Gly Cys Thr Thr          35 40 45 <210> 8 <211> 33 <212> PRT <213> ek-TYR 30aa reverse primer <400> 8 Gly Gly Cys Cys Thr Cys Gly Ala Gly Thr Thr Ala Thr Ala Ala Ala   1 5 10 15 Thr Gly Gly Cys Thr Cys Thr Gly Ala Thr Ala Cys Ala Ala Ala Cys              20 25 30 Thr     <210> 9 <211> 39 <212> PRT <213> ek-TYR 11aa forward primer <400> 9 Gly Gly Cys Cys Cys Ala Thr Gly Gly Gly Ala Cys Gly Ala Cys Gly   1 5 10 15 Ala Cys Gly Ala Cys Ala Ala Gly Gly Ala Gly Gly Ala Thr Thr Ala              20 25 30 Cys Cys Ala Cys Ala Gly Thr          35 <210> 10 <211> 27 <212> PRT <213> ek-TYR 11aa reverse primer <400> 10 Gly Gly Cys Cys Thr Cys Gly Ala Gly Thr Thr Ala Thr Ala Ala Ala   1 5 10 15 Thr Gly Gly Cys Thr Cys Thr Gly Ala Thr Ala              20 25  

Claims (8)

A fusion protein in which a polypeptide comprising all or part of an amino acid sequence combining the cytosolic domain and the transmembrane domain of Tyrosinase is fused to a Maltose Binding Protein (MBP). Protein chip for screening tyrosinase phosphorylation inhibitor fixed on a solid substrate. The protein chip according to claim 1, wherein the amino acid sequence is represented by SEQ ID NO: 2. Kit for screening tyrosinase phosphorylation inhibitor comprising the protein chip of claim 1. 1) adding a tyrosinase phosphorylation inhibitor candidate with PKC (Protein Kinase C) to the protein chip of claim 1; 2) treating anti-phosphorylated tyrosinase or anti-phosphoserine specific antibodies; 3) confirming the amount of antibody bound to the protein chip; And 4) A method for screening a tyrosinase phosphorylation inhibitor comprising the step of selecting a candidate substance having a reduced degree of antibody binding as compared to a control group not treated with the inhibitor candidate substance. 5. The search method according to claim 4, wherein the PKC of step 1) is PKC βII. The method of claim 4, wherein the antibody of step 2) is mouse anti-phosphoSer / Thr. The method according to claim 4, wherein the amount of antibody bound to the protein chip of step 3) is performed by i) surface plasmon resonance (SPR) or surface plasmon resonance imaging (SPRI) or ii) fluorescence by fluorescent label attached to the antibody. The search method is performed by detecting. 8. The fluorescent label according to claim 7, wherein the fluorescent label is Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (rhodamine-B -isothiocyanate, RITC), rhodamine (rhodamine) is a screening method characterized in that any one selected from the group consisting of.

Images