KR20090035828A - Fam83h gene for dental enamel calcification - Google Patents

Abstract

A pharmaceutical composition containing FAM83H(family with sequence similarity 83, member H) or mammal homologs protein is provided to treat dominant hypocalcification type amelogenesis imperfecta by adjusting action of a selected gene related to the dominant hypocalcification type amelogenesis imperfecta. A pharmaceutical composition contains normal FAM83H(family with sequence similarity 83, member H) or mammal homologs protein. The mammal represents rat, rabbit, pig, cow, monkey, goat or cat. The normal FAM83H has amino acid sequence indicated as sequence number 62. The mammal homologs protein has greater than 70% of similarity with the amino acid sequence indicated as sequence number 62. The pharmaceutical composition is administered to patients in order to treat the dominant hypocalcification type amelogenesis imperfecta.

Description

FAM83H gene for dental enamel calcification

The present invention relates to a composition for treating dominant hypocalcified enamel dysplasia comprising a normal FAM83H (family with sequence similarity 83, member H) protein, and more particularly, the FAM83H protein described in SEQ ID NO: 62 or a mammal homologue thereof. The present invention relates to a method for treating dominant hypocalcified enamel dysplasia of a patient comprising administering a therapeutic composition comprising a protein to a patient suffering from dominant hypocalcified enamel dysplasia.

Dental enamel is the most highly mineralized tissue in the human body. Mature tooth enamel contains less than 1% of organic matter and does not contain cells and collagen. Dental enamel is formed in the extracellular space surrounded by the enamel cells, which are cells that regulate the ion and organic content of the extracellular matrix (Simmer JP & Fincham AG, Crit). Rev Oral Biol Med 6: 84, 1995). The mineral of tooth enamel is mainly composed of calcium hydroxyapatite, the size of the mineral crystallite is specific in enamel formation. In other words, the size of the final crystal is about 25 nm thick and 65 nm wide, but it is known that the length is about 2 mm from the enamel-dentin boundary to the tooth surface (Daculsi G & Kerebel B, J Ultrastruct). Res 65: 163, 1978). These crystals grow parallel to each other to form a bundle of crystals called rods, which consist approximately 10,000 crystals per soju (Warshawsky H et. al . , Anat Rec 218: 380, 1987). The crystals grow from a mineralization front located at the substrate secretion side of the centrifugal enamel cell and grow to a very long length. Proteins secreted from the substrate secretion side of the porcine enamel cell work harmoniously to grow crystals. These proteins are known as Amelogenin, Enamelin, Ameloblastin, and Emelysin (MMP-20), a protease (Salido). EC et al , Am J Hum Genet 50: 303, 1992; Hu CC et al , J Dent Res 79 : 912, 2000; Toyosawa S et al , Gene 256 : 1, 2000; Bartlett JD et al , Gene 183 : 123, 1996). No or thin enamel has been reported in amelogenin, enamelin and ameloblastin gene mice (Gibson). CW et al , J Biol Chem 276 : 31871, 2001; Seedorf H et al , J Dent Res 86 : 764, 2007; Fukumoto S et al , J Cell Biol 167 : 973, 2004), it has been reported that enamelisin-generated mice have about half the thickness of normal enamel (Caterina). JJ et al , J Biol Chem 277 : 49598, 2002). It has also been reported that amelogenin, enamelin and enamellysine in humans cause enamel dysplasia of semi hereditary, autosomal dominant and autosomal recessive (Kim JW et al , J Dent Res 83 : 378, 2004; Kim JW et al , J Dent Res 84 : 278, 2005; Kim JW et al , J Med Genet 42 : 271, 2005; Hu JC et al, Cells Tissues Organs 186 : 78, 2007). Kallikrein 4 is also a serine protease secreted late in enamel formation and has been reported to cause autosomal recessive enamel dysplasia (Simmer). JP et al , J Dent Res 77 : 377, 1998; Hart PS et al , J Med Genet 41 : 545, 2004). Therefore, the protein that forms the enamel matrix has been established to cause enamel dysplasia. It is also known that only about a quarter of the enamel dysplasias can be explained by these genes. JW et al , Eur J Oral Sci 114 Suppl 1 : 3, 2006).

Enamel dysplasia is a generic term for hereditary diseases that occur only in enamel without serious symptoms other than teeth. The prevalence of enamel dysplasia varies regionally due to genotype differences, which is about 1: 700 in Sweden and about 1: 14,000 in the United States. Dual low-calcification is the most common type in the United States (Witkop Jr. CJ & Sauk Jr. JJ, in Oral Facial Genetics Stewart RE & GH Prescott GH, Eds (CV Mosby Co., St Louis, 1976) pp. 151-226). Enamel dysplasia is a heterogeneous disease caused by mutations in many genes. Diseases can be divided into hypoplasia due to disorders of matrix formation, hypocalcification with a soft rough surface due to calcification failure, and low maturity with a soft, colored surface resulting from insufficient removal of the matrix protein. 14 types are known based on phenotype and genotype (Witkop Jr. CJ J Oral Pathol 17 : 547, 1988). Since the phenotype is limited to teeth, it has long been believed that genes that form enamel cause disease, and indeed all genes except ameloblastine have already been identified as the cause of the disease.

Many studies have been conducted on the proteins in the enamel matrix of developing teeth (Bartlett). JD et al , Curr Top Dev Biol 74: 57, 2006; Yamakoshi Y et al , Eur J Oral Sci 114 Suppl 1 : 266, 2006). Enamel protein bodies are mainly composed of amellogenin and in small amounts, but are composed of degradation products of enamelline and amellogenin (Fincham AG et. al , J Struct Biol 126 : 270, 1999; Hu JC et al , Cells Tissues Organs 181 : 219, 2005). Thus, the future is unlikely to find more genes that make up important substrate components. Recently, however, a new component called amelotin, which forms the basal lamina of maturity, has been discovered (Iwasaki). K et al , J Dent Res 84 : 1127, 2005). Amelotin is currently considered a low-mature candidate gene, but no mutation has been found that causes disease.

Mutagenesis in families with enamel dysplasia often does not detect causal mutations (Kim JW et al , Eur J Oral Sci 114 Suppl 1 : 3, 2006). Sometimes it is found that it is not associated with a known candidate gene (Hart PS et al , Eur J Oral Sci 111 : 326, 2003), on rare occasions it has been reported to be associated with specific chromosome sites. Recently, the 2.1 Mb region of the chromosome 8q24.3 region was found to be involved in a Brazilian family of diseases with autosomal dominant hypocalcification-type enamel dysplasia, but the association region did not have a distinct candidate gene, and the related gene was also unknown. (Mendoza G et al , Hum Genet 120 : 653, 2007).

The present inventors have made many efforts, the FAM83H gene present in the area is very closely related to the dominant low-calcification type enamel formation failure to discover the gene causing an autosomal dominant low calcification type enamel formation failure in the 8q24.3 region The present invention was completed by confirming the presence of the present invention.

An object of the present invention is to provide a method for the selection of dominant hypocalcified enamel dysplasia related genes and a method for treating dominant hypocalcified enamel dysplasia using the selected gene.

In order to achieve the above object, the present invention provides a composition for treating dominant hypocalcified enamel dysplasia comprising a normal FAM83H (family with sequence similarity 83, member H) protein or a mammal homologous protein thereof.

In another aspect, the present invention provides a method for treating dominant hypocalcified enamel dysplasia of a patient comprising administering the therapeutic composition to a patient suffering from dominant hypocalcified enamel dysplasia.

The present invention also provides a composition for the treatment of dominant hypocalcification-type enamel dysplasia gene containing normal FAM83H gene or a mammalian homolog thereof as an active ingredient.

In addition, the present invention provides a method for treating dominant hypocalcified enamel dysplasia of a patient comprising administering a gene carrier comprising the gene therapy composition to a patient with dominant hypocalcified enamel dysplasia.

Hereinafter, the term used by this invention is demonstrated.

"Proband" refers to an individual who has been found to have discovered the lineage in a family tree survey of genetically problematic traits.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for treating dominant hypocalcified enamel dysplasia comprising a normal FAM83H (family with sequence similarity 83, member H) protein or a mammal homologous protein thereof.

The normal FAM83H protein has the amino acid sequence set forth in SEQ ID NO: 62. The mammal may be any one selected from the group consisting of mice, rabbits, pigs, cows, monkeys, goats, and cats, and the homologous protein refers to a protein which performs the same function as a normal FAM83H protein. It may have at least 70% homology with the amino acid sequence of 62, more preferably at least 80% homology, most preferably at least 90% homology.

The dominant hypocalcification-type enamel dysplasia refers to a generic term of genetic diseases that appear only in enamel without serious symptoms other than teeth, and includes a clinical phenotype of low enamel, low calcification or low maturity of tooth enamel.

In the present invention, the pedigree of the tooth enamel having a clinical phenotype of dental enamel hypocalcification, which is normal in the thickness of the tooth enamel before the eruption or immediately after the eruption, is very soft and disappears immediately after the eruption (V: 11, see FIG. 2). (See FIG. 1). As a result of genotyping and association analysis using 13 polymorphic markers of 25 families from the family tree, dominant hypocalcification-type enamel dysplasia related genes are located at the end of chromosome 8 and chromosome 8. Expected (see Table 2). As a result of sequencing the 42 genes present in the site, FAM83H Mutations were found at the 325th (p.R325X) and 398th (p.Q398X) sequences of the gene (see FIGS. 3A-3B). In addition, the structure of the p.R325X and p.Q398X mutant proteins were analyzed, and it was confirmed that 883 and 855 amino acids were deficient than normal (see FIG. 3C). In addition, both mutations were not found in 200 healthy normal control chromosomes, but in 25 (3 non-patients not listed in FIG. 1) correlated in the family tree of FIG. . In other words, the results strongly supported that the FAM83H protein mutations found in autosomal dominant hypocalcification enamel dysplasia cause the disease and that the protein plays an essential function in the calcification of dental enamel.

In this regard, the present inventors have described the FAM83H. The gene was renamed the calcification amelogenesis imperfecta linked gene (CAILIN) gene, and the normal FAM83H protein, set forth in SEQ ID NO: 62 of the present invention, would be useful in the treatment of dominant hypocalcification enamel dysplasia.

The normal FAM83H protein can be administered parenterally during clinical administration and can be used in the form of a general pharmaceutical formulation.

That is, the normal FAM83H protein of the present invention can be administered in various parenteral formulations, and when formulated, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. that are commonly used. do. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As a suppository base, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

In addition, the normal FAM83H protein can be used in admixture with various carriers (pharmaceutically acceptable carrier) such as physiological saline or organic solvents, carbohydrates such as glucose, sucrose or dextran to increase stability or absorption Antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers can be used as medicaments.

The effective dose of the normal FAM83H protein is 1 to 2 mg / kg, preferably 0.5 to 1 mg / kg, and may be administered 1 to 3 times a day.

In the pharmaceutical composition of the present invention, the normal FAM83H protein set forth in SEQ ID NO: 62 may be administered to a patient in a single dose by the total effective amount in bolus form or by infusion for a relatively short period of time. And multiple doses may be administered by a fractionated treatment protocol with long term administration. Since the concentration of the normal FAM83H protein is determined in consideration of various factors such as the age and health of the patient as well as the route of administration and the number of treatments of the drug, the effective dose of the patient is determined in view of the above-described general knowledge. Growing up, one will be able to determine the appropriate effective dosage for the particular use of the normal FAM83H protein as a pharmaceutical composition.

The human sample of step 1) may be used as a secretion obtained from dental tissues and target patients, such as enamel cells and progenitor cells, and preferably, but not limited to dental tissues. All parts can be targeted. FAM83H of the present invention in mice Examination of genes in each tissue revealed that FAM83H was present in the eyes, liver and kidneys of mice. It was confirmed that both genes are expressed (see Fig. 4), in almost all tissues via the ESTs analysis FAM83H It was confirmed that the gene is expressed.

The present invention also provides a method for treating dominant hypocalcified enamel dysplasia comprising a normal FAM83H protein to a patient suffering from dominant hypocalcified enamel dysplasia. Provide treatment.

The administration method is not particularly limited thereto, but any parenteral administration method may be used, and systemic or local administration is possible, but systemic administration is more preferable, and intravenous administration is most preferred.

In addition, the present invention is a normal FAM83H Provided is a composition for treating dominant low calcification-type enamel dysplasia gene containing gene or mammalian homolog thereof as an active ingredient.

Normal FAM83H above The gene has a nucleotide sequence set forth in SEQ ID NO: 55, and the gene carrier may be any one selected from the group consisting of liposomes, plasmids, adenoviruses, retroviruses and adeno accessory viruses.

The mammal may be any one selected from the group consisting of rats, rabbits, pigs, cows, monkeys, goats, and cats, and the homologous gene is normal FAM83H. Means a gene encoding a protein that performs the same function as the gene, may have a homology of 70% or more, and more preferably 80% or more homology with the nucleotide sequence of SEQ ID NO: 55, most preferably May have a homology of 90% or more.

Gene therapy compositions of the present invention can be administered parenterally during clinical administration, it can be used in the form of a general pharmaceutical formulation.

In other words, the gene therapy composition of the present invention may be administered in various parenteral formulations during actual clinical administration, and when formulated, diluents such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. that are commonly used, or Formulated using excipients. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, Tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used. In addition, calcium or vitamin D3 may be added to enhance the efficacy as a therapeutic agent.

Dosage units may contain, for example, one, two, three or four times, or 1/2, 1/3 or 1/4 times the individual dosage. Individual dosages preferably contain an amount in which the effective drug is administered at one time, which usually corresponds to all, 1/2, 1/3 or 1/4 times the daily dose.

The effective dose of the gene therapy composition is 0.05 to 12.5 mg / kg for the vector per kilogram of body weight, 10 ⁷ to 10 ¹¹ virus particles (10 ⁵ to 10 ⁹ IU) / kg for the recombinant virus, and for the cells. Is 10 ³ to 10 ⁶ cells / kg, preferably 0.1 to 10 mg / kg for a vector, 10 ⁸ to 10 ¹⁰ particles (10 ⁶ to 10 ⁸ IU) / kg for a recombinant virus, for cells There are 10 ² to 10 ⁵ cells / kg and may be administered 2-3 times a day. The composition as described above is not necessarily limited thereto, and may vary depending on the condition of the patient and the degree of the onset of neurological disease.

In addition, the present invention is a normal FAM83H Formation of dominant low calcification-type enamel of the patient, comprising administering to the patient suffering from dominant low-calcification-type enamel dysplasia comprising the gene carrier comprising the gene as an active ingredient Provides a method for treating dysfunction.

The administration method is not particularly limited thereto, but any parenteral administration method may be used, and systemic or local administration is possible, but systemic administration is more preferable, and intravenous administration is most preferred.

By controlling the mechanism of action of the dominant hypocalcified enamel dysplasia related genes selected by the method of the present invention, it may be usefully used to develop a therapeutic agent that can improve dominant hypocalcified enamel dysplasia.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

< Example  1> Genotyping Genotyping )

<1-1> Subject Registration

Experimental method and patient consent of the present invention was reviewed and approved by the Institutional Review Board (IRB, Institutional Review Board).

<1-2> Genotyping

Conventional salt precipitation (Miller SA et al . , Nucleic Acids Res 16: 1215, 1988) extracted DNA from peripheral blood or oral cells of 25 Korean families (14 patients, 11 non-patients). As shown in FIG. 1 (three non-diseases were not listed in FIG. 1), each was given an arbitrary name, the squares were males, the circles were females, and the sick were black. Of the 25, probands were identified as V: 11.

The purity of the extracted DNA was assayed at an OD ₂₆₀ / OD ₂₈₀ ratio, and the concentration was adjusted to 10 ng / μl. Genotyping was performed using fluorescently labeled primer pairs (Table 1, SEQ ID NOs: 1 to 26) of 13 polymorphic markers. Genotyping was commissioned by Seoul National University NICEM (National Instrumentation Center for Environmental Management, Seoul National University, Korea), and the association analysis was performed based on the genotyping results. Association analysis was performed using FastLink in the easyLINKAGE Plus v5.02 program (http://sourceforge.net/projects/easylinkage/) using a model with 100% permeability and disease allele frequency of 0.001 (Lindner). TH & Hoffmann K, Bioinformatics 21: 405, 2005).

Polymorphic marker primer pair number Marker Name SEQ ID NO: primer Sequence One D8S347 SEQ ID NO: 1 Sense primer GTAGCCTCCCTGCCATTTCCTAA SEQ ID NO: 2 Antisense primer TATTGTGGTCCAGAGCTCCTTGG 2 D8S378 SEQ ID NO: 3 Sense primer TGTTCTGCACATGTATCCCA SEQ ID NO: 4 Antisense primer CATTCATTAGCCACAGGCC 3 D8S1837 SEQ ID NO: 5 Sense primer AATGAAAGGCTGACCTCC SEQ ID NO: 6 Antisense primer ACCCAGATTGCTTATGCTC 4 D8S1050 SEQ ID NO: 7 Sense primer ATACCTCTTGCTGAGAAGC SEQ ID NO: 8 Antisense primer GTGACAGAGTGAGACTCAA 5 D8S1024 SEQ ID NO: 9 Sense primer CCTGTAGTCCCAGCTACTC SEQ ID NO: 10 Antisense primer TATATCATGCTGGATTCAGTG 6 D8S1704 SEQ ID NO: 11 Sense primer TCTGGGTGATAGAGCAAGAC SEQ ID NO: 12 Antisense primer AGCTAAAAATTGACACTTGTTTACA 7 D8S1744 SEQ ID NO: 13 Sense primer GGTGGTCCCAAAATGCTA SEQ ID NO: 14 Antisense primer GTTTCTTGAAGGGGCTCCGTTAGA 8 D8S161 SEQ ID NO: 15 Sense primer GATCAAGGAGCATCACATCT SEQ ID NO: 16 Antisense primer TAACATGTCCCCTCATTTGG 9 D8S1836 SEQ ID NO: 17 Sense primer CCTTCATATCCTCCATACCC SEQ ID NO: 18 Antisense primer GCTGACTCCGTCCTGTGT 10 D8S315 SEQ ID NO: 19 Sense primer CGGGAGGAAAACAAAATAGATATCG SEQ ID NO: 20 Antisense primer GACCCTCAAACAAACATTGGCCAA 11 D8S373 SEQ ID NO: 21 Sense primer TTGGTCTCCTCTGATGGGT SEQ ID NO: 22 Antisense primer GGCCTAAGGCGATTTAAGG 12 D8S2334 SEQ ID NO: 23 Sense primer GTTCTCTGAACCCTAATGCA SEQ ID NO: 24 Antisense primer GTTTCCAGCATAGCACATCT 13 D8S1926 SEQ ID NO: 25 Sense primer GGGCTTATTAACTTATGAGCAC SEQ ID NO: 26 Antisense primer GTTTCTTGAGTTTTACCTATCTCATTGC

Association analysis LOD score Marker Physical location θ (recombination rate) 0.0 0.05 0.10 0.15 0.20 0.30 0.40 D8S347 129,409,639 ∞ -1.62 -0.44 0.10 0.37 0.51 0.34 D8S378 134,105,713 ∞ -0.50 -0.22 -0.08 0.00 0.07 0.07 D8S1837 139,301,331 ∞ 1.48 1.53 1.45 1.31 0.93 0.46 D8S1050 139,724,990 2.46 2.23 1.99 1.75 1.50 0.99 0.45 D8S1024 141,497,876 2.67 2.36 2.12 1.90 1.68 1.14 0.52 D8S1704 141,720,546 4.64 4.29 3.90 3.47 3.01 2.00 0.91 D8S1744 143,101,154 3.78 3.45 3.11 2.76 2.39 1.62 0.80 D8S161 143,444,797 5.55 5.04 4.52 3.98 3.41 2.21 0.97 D8S1836 143,747,505 5.86 5.36 4.84 4.29 3.73 2.52 1.21 D8S315 144,218,310 5.83 5.33 4.81 4.27 3.71 2.50 1.21 D8S373 144,296,507 3.41 3.11 2.80 2.48 2.14 1.45 0.70 D8S2334 146,101,309 3.40 3.11 2.81 2.49 2.16 1.47 0.73 D8S1926 146,114,938 5.70 5.21 4.70 4.18 3.62 2.45 1.17

As a result, the chromosome 8q24.3 site was identified as the site associated with the disease (D8S1837 and chromosome 8 terminal end region (marked in black)) (Fig. 1 and Table 2). Although the LOD value of the D8S1837 marker in Table 2 is small, the black bars shown in FIG. 1 mean a site associated with the disease. This is because the LOD value is also associated with the polymorphism of the marker, so the maximum value may be less than or equal to 3 depending on the type of marker.

In Table 1, θ means the degree of recombination of the chromosome as a recombination ratio, and when the logarithm of the odds (LOD) value according to the θ value of a specific marker exceeds 3.0 (1000: 1 ratio), the disease is It is associated with the site where the marker is located. Sites with an LOD value of 5.0 or higher indicate a strong association with the disease.

< Example  2> mutation detection

Mutations were tested in patients with V: 11 (pronger; FIG. 2) and other disease families for 42 genes located at chromosome 8q24.3 and chromosome terminal 8 identified by Example 1 Was performed.

The sequence of primer pairs comprising exon and x / intron boundaries of the genes for sequencing of 42 genes is described by ExonPrimer (http://ihg.gsf.de/ihg/ExonPrimer.html) and Primer3 on the web (http http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). PCR reaction was 94 ℃, initial denaturation for 5 minutes, 30 amplification cycles repeated (95 ℃ 30 seconds, 30 seconds, 68 ℃ 30 seconds at a temperature suitable for each amplification reaction (68-63 ℃) and 68 ℃, 5 minutes While the final reaction was carried out using HiPi DNA polymerase premix (ElpisBio, Korea), the PCR product was purified by PCR purification kit (ElpisBio, Korea). The sequencing of the purified product was performed by requesting a DNA sequencing center (Macrogen, Korea).

Mutation Test Primer Pair number SEQ ID NO: primer Sequence One SEQ ID NO: 27 Sense primer CAGGAGGCAGGAGCGAC SEQ ID NO: 28 Antisense primer GGTAGCCCAAGTGGGACC 2 SEQ ID NO: 29 Sense primer TCCACAGTGTGTCCATGCTC SEQ ID NO: 30 Antisense primer GCTCATGCATCTCCTCCAC 3 SEQ ID NO: 31 Sense primer GTGATCCAGACACCTCCCG SEQ ID NO: 32 Antisense primer CCTGGTGTGGAAAGGGG 4 SEQ ID NO: 33 Sense primer AGACCTCACATCCCTGCG SEQ ID NO: 34 Antisense primer CTTGAAGGCGTCCATCTCC 5 SEQ ID NO: 35 Sense primer ACTTCCTGTCGGCCTTCC SEQ ID NO: 36 Antisense primer GTAGGAGGCCAAACGCC 6 SEQ ID NO: 37 Sense primer GGACTACGTGCCGTCCAG SEQ ID NO: 38 Antisense primer AGCAGCTGCACCTTCTCAG 7 SEQ ID NO: 39 Sense primer AGCAGGACTCATTCCGCTC SEQ ID NO: 40 Antisense primer GACTCATTATGGAGCACCTGG 8 SEQ ID NO: 41 Sense primer AGCTGCTCGACACACTGG SEQ ID NO: 42 Antisense primer GCCCAGTGACAGACGCC 9 SEQ ID NO: 43 Sense primer AAGGCTCCTTGCGTCTTAGG SEQ ID NO: 44 Antisense primer CTGCTGGCCTCCTCTTTC 10 SEQ ID NO: 45 Sense primer TCCGCTCGGACAGCTTG SEQ ID NO: 46 Antisense primer AGCCCAGACCGCTCAAC 11 SEQ ID NO: 47 Sense primer AGCACCTTCATCTCTGCACC SEQ ID NO: 48 Antisense primer AGCGAGCAGGAGAATCCAAG 12 SEQ ID NO: 49 Sense primer CTCAGGGCCTCCTGTTCTC SEQ ID NO: 50 Antisense primer CCCATACCTGTCAAGGATAAGC 13 SEQ ID NO: 51 Sense primer ATGGTCCAGACAACCTGTGG SEQ ID NO: 52 Antisense primer GGAACTGCTGCCTTTGTTTG 14 SEQ ID NO: 53 Sense primer TGTAGAAAGCCCCCACTGTT SEQ ID NO: 54 Antisense primer GTCCACAGGGGAAATCTGG

As a result, FAM83H (family with sequence similarity 83, member H) gene (SEQ ID NO: 55; Gene bank amplified from V: 11 (promoter) using the primer pairs set forth in SEQ ID NO: 27 to SEQ ID NO: 54 in Table 3). A nonsense mutation (c.973C> T) was found at exon 5 of NM_198488.2) (FIG. 3A). The mutations were determined according to the GenBank standard sequences NC_000008.9 (Homo sapiens chromosome 8) and NM_198488.2 (Homo sapiens family with sequence similarity 83, member H (FAM83H), mRNA), respectively. T, or p.R325X, based on amino acid sequence. The position of the mutated nucleotide sequence is indicated by an arrow (nucleotide sequence located at 325rd C-> T). The nonsense mutation resulted in the termination codon (X) of arginine (denoted Arg or R).

In addition, another nonsense mutation (c.1192C> T) idiopathic from another disease family member was found in the same gene (exon 5 of the FAM83H gene) (FIG. 3B). The mutations were designated p.Q398X based on g.2314C> T, c.1192C> T, or amino acid sequence, respectively, according to GenBank standard sequences NC_000008.9 and NM_198488.2. The position of the mutated nucleotide sequence is indicated by an arrow (nucleotide sequence located at 398th C-> T). By the nonsense mutation, glutamine (denoted Gln or Q) became stop codon (X).

The gene structure of FAM83H is shown in Figure 3C. The molecular weight expected by the calculation of normal FAM83H protein was 127 kDa and the pi value was 6.6. p.R325X and p.Q398X mutant proteins lacked 883 and 855 amino acids than normal, respectively (SEQ ID NO: 56 and SEQ ID NO: 57).

< Example  3> FAM83H  Protein Mutation Aspects

The p.R325X and p.Q398X mutations were compared in normal and diseased patients.

Specifically, DNA was extracted from 200 normal Koreans having no tooth enamel hypocalcification symptoms and 25 family members of the family tree of FIG. 1 by using a primer pair having the nucleotide sequences of SEQ ID NO: 27 and SEQ ID NO: 54 at 94 ° C, 5 PCR under conditions of initial denaturation for 30 minutes, 30 amplification cycles (95 ° C. 30 sec, 30 sec, 68 ° C. 30 sec. At appropriate temperature (56-63 ° C.) for each amplification reaction, and 68 ° C., final reaction for 5 min) Sequence analysis while performing FAM83H The gene (SEQ ID NO: 55) and the nucleotide sequence were compared.

As a result, both p.R325X and p.Q398X mutations were not found in 200 healthy normal control chromosomes, but in 25 patients correlated in the family tree of FIG.

The results strongly supported that the FAM83H mutation found in autosomal dominant hypocalcified enamel dysplasia caused the disease. The present inventors on the basis of the results was renamed as the FAM83H CAILIN (calcification amelogenesis imperfecta linked gene) .

< Example  4> FAM83H Gene expression detection

FAM83H in tooth tissue To detect the expression level of the gene in situ Hybridization was performed.

<4-1> Labeled FAM83H Gene probe of  making

FAM83H GeneBank Accession no. AA409316 was detected as a homologous gene in mice. Based on the mRNA sequence of the gene (Entrez accssion no. NM_134087.1), a primer pair for amplification of the gene was prepared (amplified product size: 539 bp; SEQ ID NO: 58: tgcgctcatcactcatcttt, forward primer; SEQ ID NO: 59: ataaggcagctggtgtgtcc , Reverse primer). Template DNA was extracted from rat dental tissue using RNeasy mini kit (QIAGEN, USA), and then 1 μg of total RNA and 1 μl of oligo-d (T) (Invitrogen, USA, 0.5 μg / μl) were extracted. After filling up to 50 μl, it was placed in AccuPower RT-premix (Bioneer, Korea) and reacted with RT-PCR (reverse transcription polymerasechain reaction). The reaction was performed at 70 ° C. for 5 minutes, 4 ° C. for 5 minutes, at 42 ° C. for 60 minutes, and at 94 ° C. It was obtained by reacting 5 minutes at 4 degreeC for 5 minutes, and synthesize | combining cDNA. Using the cDNA template DNA as the primer pair (SEQ ID NOs: 34 and 35), 94 ° C., initial denaturation for 5 minutes, 30 amplification cycles repeated [95 ° C. 30 sec, suitable temperature for each amplification reaction (56-63 ° C.) 30 seconds, 68 ℃ 30 seconds] and 68 ℃, for 5 minutes under the conditions of the final reaction, after the PCR product 4.5 μl and 1 μl salt solution (Invitrogen, USA), pCR2.1-TOPO vector 0.5 μl (Invitrogen, USA) was mixed and reacted at room temperature for 5 minutes, and then cloned into a pCR2.1-TOPO vector (Invitrogen, USA). 3 μl of the reaction product was transformed into Top 10 transformant cells, and the vector was amplified by culturing the cells. After the vector was treated with EcoR I restriction enzyme, the cleavage product was recovered and cloned back into pBluescript II SK (+) vector (Invitrogen, USA). The vector was transformed into E. coli DH5α to amplify the vector by culturing E. coli, and then the vector was purified from E. coli, digested with BamH I and labeled using DIG RNA labeling kit (Roche, Germany) to FAM83H. A DIG labeled probe of the gene was constructed.

<4-2> Hybridization  reaction

FAM83H in Dental Tissues of 3-week-old Mice Expression of the gene was confirmed by performing a hybridization reaction using the probe prepared by the method of Example 3-1. Sections were counterstained with methyl blue green (Park JC et al . , Biochem Biophys Res Commun 282: 1145, 2001).

1. Organizational sample production

After 7, 10, 14 and 21 days of age, the mice (Sam Dako, Korea) were perfused with 4% paraformaldehyde solution, and the jaw containing the mandibular condyle was extracted. Dental tissues of mice were obtained by re-establishing 16% in% paraformaldehyde solution. The tissues were washed for one day with pH 7.4 PBS buffer and demineralized in 10% EDTA-2Na (pH 7.4) solution for 4-6 weeks. For dehydration, 70%, 80%, 90%, 100% I, 100% II and 100% III ethanol treatments were treated for 12 hours, respectively, and after incubation with xylene, they were embedded with paraffin. . After making the 5 μm-thick sections from the tissues subjected to the above procedure, some of them were morphologically observed by staining with Hematoxylin-Eosin, and the rest were stored at 4 ° C. to hybridize mRNA i n - situ. It was used for (hybridization).

2. in - situ hybridization

Rat FAM83H obtained by the method of Example 4-1 The cDNA of the gene was digested with restriction enzymes and linearized on a 1.5% agarose gel. Sense and antisense cRNA probes were prepared using DIG RNA labeling kit (Roche Molecular Biochemicals, Germany) and T3 and T7 RNA polymerases (Roche Molecular Biochemicals, Germany).

The obtained sections were deparaffinized with xylene, hydrated in the order of 100%, 90%, 80%, 70% ethanol, and then fixed in 4% PFA for 10 minutes. Washed twice with PBS, treated with 0.2N HCl for 20 minutes, and then washed with PBS. The solution was treated for 10 minutes in an acetylation solution (0.25% acetic anhydrate in 0.1M triethanolamine-HCl, pH8.0). After washing with PBS, it was dehydrated and dried in air. The cRNA probe prepared in the hybridization solution was diluted to 1:50 concentration and hybridized at 55 ° C. for 16 hours. After hybridization, each washed with 2 × SSC, 0.2 × SSCⅠ, 0.2 × SSCII, and then again with Dig buffer I (100 mM Tris-HCl, 150 mM NaCl) containing 1.5% blocking solution (Roche Molecular Biochemicals, Germany). -Dig antibody was diluted in Dig buffer I at a concentration of 1: 500 and treated at room temperature for 1 hour. Wash with Dig buffer II (100 mM Tris-HCl, 100 mM NaCl, 500 mM MgCl ₂ ), color with NBT / BCIP (nitroblue tetrazolium salt / 5-bromo-4-chloro-3-indolyphosphate) and dig buffer III (10 mM Tris). -HCl, 1 mM EDTA) for 3 minutes, and then contrast staining with methyl blue green for 15 seconds and observed under an optical microscope.

<4-3> RT - PCR  reaction

FAM83H in Human Tobacco and Tissues of Neonatal Mice Gene expression was examined via RT-PCR reaction.

Specifically, total RNA was extracted from tooth follicles and pulp tissues of normal persons and tissues of the newborn mice (eye, liver, kidney). In the case of RNA extracted from the control and dimensions of normal subjects, using a primer pair having nucleic acid sequences of SEQ ID NOs: 27 and 54, 94 ° C., initial denaturation for 5 minutes, and 30 amplification steps (95 ° C. 30 sec. PCR was performed at the appropriate temperature (56-63 ° C.) for 30 seconds, 68 ° C. 30 seconds) and 68 ° C., for 5 minutes under the conditions of the final reaction. For RNA extracted from the eyes, liver and kidney of newborn mice, primers with nucleic acid sequences of SEQ ID NOs: 58 and 59 were used for 94 ° C, initial denaturation for 5 minutes, and 30 amplification cycles (95 ° C 30 seconds, each). PCR was carried out at a temperature suitable for the amplification reaction (56-63 ℃) for 30 seconds, 68 ℃ 30 seconds) and 68 ℃, the conditions of the final reaction for 5 minutes. GAPDH was used as internal standard. For glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initial denaturation for 5 minutes at 94 ° C. for 5 minutes using primer pairs having nucleic acid sequences of SEQ ID NOs: 60 (forward primer: CCAAGGTCATCCATGACAAC) and 61 (forward primer: GCTTCACCACCTTCTTGATG) PCR was performed under repeated amplification process (95 ° C., 30 sec, 30 sec, 68 ° C., 30 sec, at a temperature suitable for each amplification reaction (56-63 ° C.), and 68 ° C., for 5 minutes, under the conditions of the final reaction. The PCR products were confirmed by electrophoresis.

<4-4> ESTs  analysis

FAM83H EST analysis was performed in BLAST using the mRNA sequence of the gene (SEQ ID NO: 55).

As a result, in FAM83H through situ hybridization It was confirmed that the gene is expressed in the enamel cells (arrow head) and progenitor cells (arrows) (FIG. 4A). In addition, FAM83H via RT-PCR reaction It was confirmed that the gene is expressed not only in human teeth and pulp but also in the tissues of mice (eye, liver, kidney) (FIG. 4B). In addition, in almost all tissues by analyzing ESTs FAM83H It was confirmed that the gene is expressed.

< Example  5> FAM83H  Protein structure prediction

The primary structure and motif of the FAM83H protein (SEQ ID NO: 62; NP_940890) is SignalP , an amino acid sequence prediction algorithm. 3.0 (http://www.cbs.dtu.dk/services/SignalP/) and 9aa Nine Amino Acids Transactivation Domain; https://emb1.bcc.univie.ac.at/toolbox/9aatad/webtool.htm R).

As a result, SignalP 3.0 predicted that the FAM83H protein was not a secretory protein. In addition, the common motif of DLLSEVLEA (SEQ ID NO: 63; amino acid sequences 162-170 of SEQ ID NO: 3) at the transactivation site of many transcription factors present in the FAM83H protein by 9aa TAD. ) Was confirmed.

1 is a diagram showing the pedigree and haplotype of autosomal dominant hypocalcification-type enamel dysplasia family 1.

Black bars indicate haplotypes associated with the disease. Polymorphic markers were displayed in the order on the chromosome.

Figure 2 is a diagram showing the clinical picture (top) and panoramic radiograph (bottom) of the disease of the autosomal dominant hypocalcification enamel dysplasia family 2.

Figure 3 shows the mutation of the FAM83H gene:

Figure 3A: Sequence analysis of the p.R325X mutation site found through gene sequencing (mutation site is indicated by a black arrow).

3B: Sequence analysis of the p.Q398X mutation site found through gene sequencing (mutation sites are indicated by black arrows).

Figure 3C: FAM83H gene structure (top) and structures of normal and mutant proteins (bottom)

4 is in Figure shows the results of detection of the expression level of FAM83H by the situ hybridization reaction and RT-PCR reaction:

4A: in Expression level detection of FAM83H by situ hybridization

Figure 4B: Detection result of the expression level of FAM83H by RT-PCR reaction

(+, Reaction with RT-PCR;-, reaction without RT-PCR).

<110> Seoul National University Industry Foundation <120> FAM83H gene for dental enamel calcification <130> 7P-07-71 <160> 63 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> D8S347 Marker Sense primer <400> 1 gtagcctccc tgccatttcc taa 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> D8S347 Marker Antiense primer <400> 2 tattgtggtc cagagctcct tgg 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S378 Marker Sense primer <400> 3 tgttctgcac atgtatccca 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S378 Marker Antiense primer <400> 4 cattcattag ccacaggcc 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> D8S1837 Marker Sense primer <400> 5 aatgaaaggc tgacctcc 18 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S1837 Marker Antiense primer <400> 6 acccagattg cttatgctc 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S1050 Marker Sense primer <400> 7 atacctcttg ctgagaagc 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S1050 Marker Antiense primer <400> 8 gtgacagagt gagactcaa 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S1024 Marker Sense primer <400> 9 cctgtagtcc cagctactc 19 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> D8S1024 Marker Antiense primer <400> 10 tatatcatgc tggattcagt g 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S1704 Marker Sense primer <400> 11 tctgggtgat agagcaagac 20 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> D8S1704 Marker Antiense primer <400> 12 agctaaaaat tgacacttgt ttaca 25 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> D8S1744 Marker Sense primer <400> 13 ggtggtccca aaatgcta 18 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> D8S1744 Marker Antiense primer <400> 14 gtttcttgaa ggggctccgt taga 24 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S161 Marker Sense primer <400> 15 gatcaaggag catcacatct 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S161 Marker Antiense primer <400> 16 taacatgtcc cctcatttgg 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S1836 Marker Sense primer <400> 17 ccttcatatc ctccataccc 20 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> D8S1836 Marker Antiense primer <400> 18 gctgactccg tcctgtgt 18 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> D8S315 Marker Sense primer <400> 19 cgggaggaaa acaaaataga tatcg 25 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> D8S315 Marker Antiense primer <400> 20 gaccctcaaa caaacattgg ccaa 24 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S373 Marker Sense primer <400> 21 ttggtctcct ctgatgggt 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D8S373 Marker Antiense primer <400> 22 ggcctaaggc gatttaagg 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S2334 Marker Sense primer <400> 23 gttctctgaa ccctaatgca 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D8S2334 Marker Antiense primer <400> 24 gtttccagca tagcacatct 20 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> D8S1926 Marker Sense primer <400> 25 gggcttatta acttatgagc ac 22 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> D8S1926 Marker Antiense primer <400> 26 gtttcttgag ttttacctat ctcattgc 28 <210> 27 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> 1 Sense primer <400> 27 caggaggcag gagcgac 17 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 1 Antiense primer <400> 28 ggtagcccaa gtgggacc 18 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2 Sense primer <400> 29 tccacagtgt gtccatgctc 20 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 2 Antiense primer <400> 30 gctcatgcat ctcctccac 19 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> 3 Sense primer <400> 31 gtgatccaga cacctcccg 19 <210> 32 <211> 17 <212> DNA <213> Artificial Sequence <220> 3 Antiense primer <400> 32 cctggtgtgg aaagggg 17 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 4 Sense primer <400> 33 agacctcaca tccctgcg 18 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> 4 Antiense primer <400> 34 cttgaaggcg tccatctcc 19 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> 5 Sense primer <400> 35 acttcctgtc ggccttcc 18 <210> 36 <211> 17 <212> DNA <213> Artificial Sequence <220> 5 Antiense primer <400> 36 gtaggaggcc aaacgcc 17 <210> 37 <211> 18 <212> DNA <213> Artificial Sequence <220> 6 Sense primer <400> 37 ggactacgtg ccgtccag 18 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> 6 Antiense primer <400> 38 agcagctgca ccttctcag 19 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> 7 Sense primer <400> 39 agcaggactc attccgctc 19 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> 7 Antiense primer <400> 40 gactcattat ggagcacctg g 21 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> 8 Sense primer <400> 41 agctgctcga cacactgg 18 <210> 42 <211> 17 <212> DNA <213> Artificial Sequence <220> 8 Antiense primer <400> 42 gcccagtgac agacgcc 17 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> 9 Sense primer <400> 43 aaggctcctt gcgtcttagg 20 <210> 44 <211> 18 <212> DNA <213> Artificial Sequence <220> 9 Antiense primer <400> 44 ctgctggcct cctctttc 18 <210> 45 <211> 17 <212> DNA <213> Artificial Sequence <220> 10 Sense primer <400> 45 tccgctcgga cagcttg 17 <210> 46 <211> 17 <212> DNA <213> Artificial Sequence <220> 10 Antiense primer <400> 46 agcccagacc gctcaac 17 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11 Sense primer <400> 47 agcaccttca tctctgcacc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> 11 Antiense primer <400> 48 agcgagcagg agaatccaag 20 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> 12 Sense primer <400> 49 ctcagggcct cctgttctc 19 <210> 50 <211> 22 <212> DNA <213> Artificial Sequence <220> 12 Antiense primer <400> 50 cccatacctg tcaaggataa gc 22 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> 13 Sense primer <400> 51 atggtccaga caacctgtgg 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> 13 Antiense primer <400> 52 ggaactgctg cctttgtttg 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> 14 Sense primer <400> 53 tgtagaaagc ccccactgtt 20 <210> 54 <211> 19 <212> DNA <213> Artificial Sequence <220> 14 Antiense primer <400> 54 gtccacaggg gaaatctgg 19 <210> 55 <211> 5604 <212> DNA <213> Human FAM83H <400> 55 gggcggcggt cggctcctgc tgcccctgtg ccgagacccc gcgcacctgg ccaggcccct 60 ggccccaaca tggcccgtcg ctctcagagc tcctcgcagg gggacaaccc actggcaccc 120 gggtacctgc cgcctcacta caaagagtac taccgcctgg cggtggatgc actggccgag 180 ggtggctcgg aggcctacag ccgcttcctc gctaccgagg gggcaccaga cttcctgtgc 240 cctgaagagc tggaacatgt gagccgacac cttcggcctc cgcagtatgt tacccgagag 300 ccacctgaag gcagccttct cgacgtggac atggatggct cctcgggtac atactggcca 360 gtgaactcag accaggccgt gcctgagctt gatttgggct ggcctctgac cttcggcttc 420 cagggcaccg aggtgaccac cttggtgcag ccaccgcccc ccgacagccc cagtatcaag 480 gatgaggccc gcaggatgat ccgttccgcc cagcaggtgg tggccgtggt gatggacatg 540 ttcactgatg tggacctgct cagcgaagtg ctggaggccg cggcccgtcg ggtcccagtc 600 tacatcctgc tggatgagat gaacgcgcag cacttcctgg acatggccga caagtgccgt 660 gtcaacctgc accacgtgga tttcctgcgc gtacggactg tggcgggccc cacctactac 720 tgccgcactg ggaagtcctt caagggccac gtcaaggaga agttcctgct ggtggactgt 780 gccgtggtga tgagtgggag ctacagcttc atgtggtcct ttgagaagat ccaccgcagc 840 ctggcgcacg tgttccaagg agagctggtc tccagcttcg acgaggagtt ccgcatcctc 900 ttcgcgcagt ccgagccgct tgtgccctcg gccgcggccc tggcccgcat ggacgcctat 960 gccctggctc cgtatgccgg ggccgggcct ctcgtgggcg tccctggggt cggggcgcca 1020 acccccttct ccttccctaa acgagcgcac ctcctgttcc cgccaccccg ggaagagggc 1080 ctgggcttcc cctccttcct cgacccggac cgccacttcc tgtcggcctt ccgccgggag 1140 gagccgccgc ggatgccggg gggcgcgctg gaaccgcacg cggggctgcg gccgctctcg 1200 cggcgcctgg aggccgaggc cgggccggct ggggagctcg cgggcgcgcg gggcttcttc 1260 caggcgcggc acctggagat ggacgccttc aagcggcaca gcttcgcgac cgagggcgcg 1320 ggcgccgtgg agaacttcgc ggccgcgcgg caggtgtcgc ggcagacgtt cctcagccac 1380 ggcgacgact tccgcttcca gaccagccac ttccaccgtg accagctcta ccagcagcag 1440 taccagtggg acccgcagct cacgccggcg cgcccgcaag gcctgttcga gaagcttcgc 1500 gggggccgcg cgggtttcgc ggacccggat gacttcaccc tgggcgccgg gccccgcttc 1560 ccggagctcg gacccgacgg gcaccagcgg ctggactacg tgccgtccag cgcgtcccgc 1620 gaggtgcgcc acggctcgga ccccgccttc gcgcccggac cccgcggcct ggagcccagc 1680 ggagccccgc gccccaacct gacccagcgc ttcccatgcc aggccgcggc gaggccgggc 1740 ccagaccccg ctcccgaggc ggagccggag cgcaggggcg ggcccgaggg gcgggcaggg 1800 ctgcggcgct ggcgtttggc ctcctacttg agcggctgcc acggcgagga tgggggcgac 1860 gacggcctac cggcgcccat ggtagcggag gcttacgaag acgacgtgct ggctcccggg 1920 ggccgggcac ctgccggcga cctgctcccc tcggccttcc gcgtcccagc agccttcccc 1980 accaaggtcc cggtgccagg cccgggcagc ggcggcaacg gcccagagcg cgagggcccg 2040 gaggagcctg gcctggccaa gcaggactca ttccgctcgc gcctgaaccc cctggtccag 2100 cgcagctcca ggctgcgctc ctcgctcatc ttcagcacgt cacaggccga gggcgcggcc 2160 ggggctgcgg cggccactga gaaggtgcag ctgctgcaca aggagcagac ggtcagcgag 2220 acgctggggc ccggcggaga ggccgtgcgc tccgcggctt ccaccaaggt ggcggagctg 2280 ctggagaagt acaagggccc agcccgtgat cccggcggcg gcgcgggcgc catcaccgtt 2340 gccagccaca gcaaggccgt cgtgtcccag gcgtggcggg aagaggtggc ggccccaggt 2400 gccgtggggg gcgagcgccg cagcctcgag agctgcctgc tggacctgcg cgactccttt 2460 gcacagcagc tgcaccagga ggcggagcgg cagccgggag ccgcgtcgct caccgcggcg 2520 cagctgctcg acacactggg ccggagcggc tccgaccgcc tgccttcccg cttcctctct 2580 gcccagagcc actcaacgtc cccgcaaggg ctggacagcc ctctgccgct ggaagggtcc 2640 ggagcgcacc aggtgctcca taatgagtca aaagggagcc ccacctcggc ttaccctgag 2700 cggaagggga gccccacgcc tgggttttcc actcgaagag gaagtccaac tacaggattt 2760 atcgagcaga aggggagccc cacctcagcc taccccgagc gcaggggtag tccggtgccc 2820 cccgtgccgg agcgcaggag cagtccggtg ccccccgtgc cggagcgcag gggcagcctc 2880 acccttacca tctccgggga gtccccgaag gccgggcccg cggaggaggg gccgagcggc 2940 cccatggaag tcttgcgcaa aggctccttg cgtcttaggc agctgctgag ccccaagggc 3000 gagcggcgca tggaggatga gggtggcttc ccagtgccgc aggagaacgg ccaacccgag 3060 agcccgcggc gtctgtcact gggccagggt gacagcacgg aggctgccac agaagagcgg 3120 ggtccgcggg cgcgcctgtc ctcagccacg gccaacgcct tgtacagcag caaccttcgg 3180 gatgacacga aggccattct ggagcagatc agtgcccacg gccagaagca ccgtgcggtc 3240 cctgccccga gccccggccc gacccacaac agccccgagc taggccgtcc accggctgct 3300 ggcgtcctgg ccccagatat gtccgacaag gacaagtgtt cagccatctt ccgctcggac 3360 agcttgggga cccagggccg gctgagccgc acgctgccag ccagcgcgga ggagcgcgat 3420 cggctgctgc gccgcatgga gagcatgcgc aaggagaagc gcgtgtacag ccgcttcgag 3480 gtcttctgca agaaagagga ggccagcagc cctggggcag gggaaggccc cgcggaggag 3540 ggcaccaggg acagcaaggt gggcaagttc gtgcccaaga tcctgggcac gttcaaaagc 3600 aagaagtgag tcttctggcc tggcaaccca ggccagggtg cccgcatcgc tgccccggtc 3660 atccagaagc cccgcggaac agagagccct gctcatgtgc ttgagcagcg gctgtcaggc 3720 cacggccgct tggggcttgg ctgagtgcgc cagacctcgg ctccactgga ggctcacctg 3780 gcagctgccg tctctgcccc ctggcctccc caacgctggg gctgcacccc tcgccaccag 3840 tgcctttctc ccctcagcac cttcatctct gcaccgtcag ccttgcgtgg cgcagcgtct 3900 ggctccgcca tctctttgtg cctcagtccc ccccgccccc tttatttttt tgagacctag 3960 ggctggagtg cagttgagcg gtctgggctc actgcaacct ctgcctcccg ggttccagcg 4020 attctcctgc ctcagcctcc tgagtagctg ggattacaga tgtatgctac cacgcccagg 4080 tagtttttgt atttttagta gagacagggt ttcactatgt tggccaggct ggtctccaac 4140 tcctggcctc aaatgatcag cccgcttcag cctcccaaag tggggggatt acaggcgtga 4200 gccttgcacc ccgctaagtc ccctatcctc ttgcaagggt ctcgcctctg tgcctcaatt 4260 cctcattctc tgggcccttc tcctcctcag ggcctcctgt tctcagggcc tcccccctcc 4320 ccgctccctc cctctctcaa ggtctcctcc ttccctcccc cccccgtctc ccccctcccc 4380 cgcctgggct tcacttcctt tcctacttgg attctcctgc tcgctgcctc ccagcatctt 4440 ttttggaggc ccgtctcttg ctgtggggaa gactgggctg gctgcgggca gtttgcaagg 4500 ggtgggtggg gcgggggggg gagctggacc agaagatgcc ccttggagtg gcaaggaagc 4560 tggacagggc aggcctctgg ggacgggaca cagggaagcc cgaaggggcg ccttggccag 4620 gtctgccatc tcctccagcg aggctctggc cagcactggg tgagagtggg gagggggcac 4680 tggcctttgc agcacagtaa aacatggtcc agacaacctg tggccccggc ctcatgagca 4740 ccccctgcac aggcccggcc caagccaggc gctagaaggg ctggttgtgg agtgcttatc 4800 cttgacaggt atggggccag gtgagggcag gggacaaggt gcagctgagg ccgagcccaa 4860 ctaggtcctg ggcacccctg caggtgggag tggtccttgt cctcctggta tccagcagac 4920 acccccctct ccccaccagc cccattctca ggtcctttcc tctttgtcac caacaccaag 4980 aatctgtcca gggttcttgg cttatctttt atctcttttc actcctagag aggaattgca 5040 attgactcag aatgacacat tttggcacca cgtgtgtaga aagcccccac tgttagatga 5100 tagcctcgtg aaattcatgt ttctgtattc tcctatttct tttcaaaaac taattttttt 5160 tttagtgtaa taaatcctaa gagggaactg atttaagaaa caaggccgcc aaacaaaggc 5220 agcagttccg actccagcag ctgggaaagg aaggaaagtg accccacttt cactcctgca 5280 cagcccactg gttaccaaaa ccaccgtgca agtcgggatg acagcaggga cttctggcca 5340 ggtgggaaag gtgcctggaa gcgggatgcg cctgtgcgtc tcttggccat gatgttcttg 5400 tgggcatgtt attcttggtg ctgcctgggg tgttgctgag cggacaggct ctccagctgg 5460 agtccatgga gaggccagag gctggcggcc ctgcctgggc cttcggagcc tcctgcctgc 5520 accctccacc tcttctaaac catgatgtgg cacattttgg tgttaataaa acacaacaca 5580 caaagtaaaa aaaaaaaaaa aaaa 5604 <210> 56 <211> 325 <212> PRT <213> Artificial Sequence <220> <223> p.R325X <400> 56 Met Ala Arg Arg Ser Gln Ser Ser Ser Gln Gly Asp Asn Pro Leu Ala   1 5 10 15 Pro Gly Tyr Leu Pro Pro His Tyr Lys Glu Tyr Tyr Arg Leu Ala Val              20 25 30 Asp Ala Leu Ala Glu Gly Gly Ser Glu Ala Tyr Ser Arg Phe Leu Ala          35 40 45 Thr Glu Gly Ala Pro Asp Phe Leu Cys Pro Glu Glu Leu Glu His Val      50 55 60 Ser Arg His Leu Arg Pro Pro Gln Tyr Val Thr Arg Glu Pro Pro Glu  65 70 75 80 Gly Ser Leu Leu Asp Val Asp Met Asp Gly Ser Ser Gly Thr Tyr Trp                  85 90 95 Pro Val Asn Ser Asp Gln Ala Val Pro Glu Leu Asp Leu Gly Trp Pro             100 105 110 Leu Thr Phe Gly Phe Gln Gly Thr Glu Val Thr Thr Leu Val Gln Pro         115 120 125 Pro Pro Pro Asp Ser Pro Ser Ile Lys Asp Glu Ala Arg Arg Met Ile     130 135 140 Arg Ser Ala Gln Gln Val Val Ala Val Val Met Asp Met Phe Thr Asp 145 150 155 160 Val Asp Leu Leu Ser Glu Val Leu Glu Ala Ala Ala Arg Arg Val Pro                 165 170 175 Val Tyr Ile Leu Leu Asp Glu Met Asn Ala Gln His Phe Leu Asp Met             180 185 190 Ala Asp Lys Cys Arg Val Asn Leu His His Val Asp Phe Leu Arg Val         195 200 205 Arg Thr Val Ala Gly Pro Thr Tyr Tyr Cys Arg Thr Gly Lys Ser Phe     210 215 220 Lys Gly His Val Lys Glu Lys Phe Leu Leu Val Asp Cys Ala Val Val 225 230 235 240 Met Ser Gly Ser Tyr Ser Phe Met Trp Ser Phe Glu Lys Ile His Arg                 245 250 255 Ser Leu Ala His Val Phe Gln Gly Glu Leu Val Ser Ser Phe Asp Glu             260 265 270 Glu Phe Arg Ile Leu Phe Ala Gln Ser Glu Pro Leu Val Pro Ser Ala         275 280 285 Ala Ala Leu Ala Arg Met Asp Ala Tyr Ala Leu Ala Pro Tyr Ala Gly     290 295 300 Ala Gly Pro Leu Val Gly Val Pro Gly Val Gly Ala Pro Thr Pro Phe 305 310 315 320 Ser Phe Pro Lys Xaa                 325 <210> 57 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> p.Q398X <400> 57 Met Ala Arg Arg Ser Gln Ser Ser Ser Gln Gly Asp Asn Pro Leu Ala   1 5 10 15 Pro Gly Tyr Leu Pro Pro His Tyr Lys Glu Tyr Tyr Arg Leu Ala Val              20 25 30 Asp Ala Leu Ala Glu Gly Gly Ser Glu Ala Tyr Ser Arg Phe Leu Ala          35 40 45 Thr Glu Gly Ala Pro Asp Phe Leu Cys Pro Glu Glu Leu Glu His Val      50 55 60 Ser Arg His Leu Arg Pro Pro Gln Tyr Val Thr Arg Glu Pro Pro Glu  65 70 75 80 Gly Ser Leu Leu Asp Val Asp Met Asp Gly Ser Ser Gly Thr Tyr Trp                  85 90 95 Pro Val Asn Ser Asp Gln Ala Val Pro Glu Leu Asp Leu Gly Trp Pro             100 105 110 Leu Thr Phe Gly Phe Gln Gly Thr Glu Val Thr Thr Leu Val Gln Pro         115 120 125 Pro Pro Pro Asp Ser Pro Ser Ile Lys Asp Glu Ala Arg Arg Met Ile     130 135 140 Arg Ser Ala Gln Gln Val Val Ala Val Val Met Asp Met Phe Thr Asp 145 150 155 160 Val Asp Leu Leu Ser Glu Val Leu Glu Ala Ala Ala Arg Arg Val Pro                 165 170 175 Val Tyr Ile Leu Leu Asp Glu Met Asn Ala Gln His Phe Leu Asp Met             180 185 190 Ala Asp Lys Cys Arg Val Asn Leu His His Val Asp Phe Leu Arg Val         195 200 205 Arg Thr Val Ala Gly Pro Thr Tyr Tyr Cys Arg Thr Gly Lys Ser Phe     210 215 220 Lys Gly His Val Lys Glu Lys Phe Leu Leu Val Asp Cys Ala Val Val 225 230 235 240 Met Ser Gly Ser Tyr Ser Phe Met Trp Ser Phe Glu Lys Ile His Arg                 245 250 255 Ser Leu Ala His Val Phe Gln Gly Glu Leu Val Ser Ser Phe Asp Glu             260 265 270 Glu Phe Arg Ile Leu Phe Ala Gln Ser Glu Pro Leu Val Pro Ser Ala         275 280 285 Ala Ala Leu Ala Arg Met Asp Ala Tyr Ala Leu Ala Pro Tyr Ala Gly     290 295 300 Ala Gly Pro Leu Val Gly Val Pro Gly Val Gly Ala Pro Thr Pro Phe 305 310 315 320 Ser Phe Pro Lys Arg Ala His Leu Leu Phe Pro Pro Arg Glu Glu                 325 330 335 Gly Leu Gly Phe Pro Ser Phe Leu Asp Pro Asp Arg His Phe Leu Ser             340 345 350 Ala Phe Arg Arg Glu Glu Pro Pro Arg Met Pro Gly Gly Ala Leu Glu         355 360 365 Pro His Ala Gly Leu Arg Pro Leu Ser Arg Arg Leu Glu Ala Glu Ala     370 375 380 Gly Pro Ala Gly Glu Leu Ala Gly Ala Arg Gly Phe Phe Xaa 385 390 395 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse FAM83H forward primer <400> 58 tgcgctcatc actcatcttt 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse FAM83H reverse primer <400> 59 ataaggcagc tggtgtgtcc 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 60 ccaaggtcat ccatgacaac 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 61 gcttcaccac cttcttgatg 20 <210> 62 <211> 1179 <212> PRT <213> Human FAM83H <400> 62 Met Ala Arg Arg Ser Gln Ser Ser Ser Gln Gly Asp Asn Pro Leu Ala   1 5 10 15 Pro Gly Tyr Leu Pro Pro His Tyr Lys Glu Tyr Tyr Arg Leu Ala Val              20 25 30 Asp Ala Leu Ala Glu Gly Gly Ser Glu Ala Tyr Ser Arg Phe Leu Ala          35 40 45 Thr Glu Gly Ala Pro Asp Phe Leu Cys Pro Glu Glu Leu Glu His Val      50 55 60 Ser Arg His Leu Arg Pro Pro Gln Tyr Val Thr Arg Glu Pro Pro Glu  65 70 75 80 Gly Ser Leu Leu Asp Val Asp Met Asp Gly Ser Ser Gly Thr Tyr Trp                  85 90 95 Pro Val Asn Ser Asp Gln Ala Val Pro Glu Leu Asp Leu Gly Trp Pro             100 105 110 Leu Thr Phe Gly Phe Gln Gly Thr Glu Val Thr Thr Leu Val Gln Pro         115 120 125 Pro Pro Pro Asp Ser Pro Ser Ile Lys Asp Glu Ala Arg Arg Met Ile     130 135 140 Arg Ser Ala Gln Gln Val Val Ala Val Val Met Asp Met Phe Thr Asp 145 150 155 160 Val Asp Leu Leu Ser Glu Val Leu Glu Ala Ala Ala Arg Arg Val Pro                 165 170 175 Val Tyr Ile Leu Leu Asp Glu Met Asn Ala Gln His Phe Leu Asp Met             180 185 190 Ala Asp Lys Cys Arg Val Asn Leu His His Val Asp Phe Leu Arg Val         195 200 205 Arg Thr Val Ala Gly Pro Thr Tyr Tyr Cys Arg Thr Gly Lys Ser Phe     210 215 220 Lys Gly His Val Lys Glu Lys Phe Leu Leu Val Asp Cys Ala Val Val 225 230 235 240 Met Ser Gly Ser Tyr Ser Phe Met Trp Ser Phe Glu Lys Ile His Arg                 245 250 255 Ser Leu Ala His Val Phe Gln Gly Glu Leu Val Ser Ser Phe Asp Glu             260 265 270 Glu Phe Arg Ile Leu Phe Ala Gln Ser Glu Pro Leu Val Pro Ser Ala         275 280 285 Ala Ala Leu Ala Arg Met Asp Ala Tyr Ala Leu Ala Pro Tyr Ala Gly     290 295 300 Ala Gly Pro Leu Val Gly Val Pro Gly Val Gly Ala Pro Thr Pro Phe 305 310 315 320 Ser Phe Pro Lys Arg Ala His Leu Leu Phe Pro Pro Arg Glu Glu                 325 330 335 Gly Leu Gly Phe Pro Ser Phe Leu Asp Pro Asp Arg His Phe Leu Ser             340 345 350 Ala Phe Arg Arg Glu Glu Pro Pro Arg Met Pro Gly Gly Ala Leu Glu         355 360 365 Pro His Ala Gly Leu Arg Pro Leu Ser Arg Arg Leu Glu Ala Glu Ala     370 375 380 Gly Pro Ala Gly Glu Leu Ala Gly Ala Arg Gly Phe Phe Gln Ala Arg 385 390 395 400 His Leu Glu Met Asp Ala Phe Lys Arg His Ser Phe Ala Thr Glu Gly                 405 410 415 Ala Gly Ala Val Glu Asn Phe Ala Ala Ala Arg Gln Val Ser Arg Gln             420 425 430 Thr Phe Leu Ser His Gly Asp Asp Phe Arg Phe Gln Thr Ser His Phe         435 440 445 His Arg Asp Gln Leu Tyr Gln Gln Gln Tyr Gln Trp Asp Pro Gln Leu     450 455 460 Thr Pro Ala Arg Pro Gln Gly Leu Phe Glu Lys Leu Arg Gly Gly Arg 465 470 475 480 Ala Gly Phe Ala Asp Pro Asp Asp Phe Thr Leu Gly Ala Gly Pro Arg                 485 490 495 Phe Pro Glu Leu Gly Pro Asp Gly His Gln Arg Leu Asp Tyr Val Pro             500 505 510 Ser Ser Ala Ser Arg Glu Val Arg His Gly Ser Asp Pro Ala Phe Ala         515 520 525 Pro Gly Pro Arg Gly Leu Glu Pro Ser Gly Ala Pro Arg Pro Asn Leu     530 535 540 Thr Gln Arg Phe Pro Cys Gln Ala Ala Ala Arg Pro Gly Pro Asp Pro 545 550 555 560 Ala Pro Glu Ala Glu Pro Glu Arg Arg Gly Gly Pro Glu Gly Arg Ala                 565 570 575 Gly Leu Arg Arg Trp Arg Leu Ala Ser Tyr Leu Ser Gly Cys His Gly             580 585 590 Glu Asp Gly Gly Asp Asp Gly Leu Pro Ala Pro Met Val Ala Glu Ala         595 600 605 Tyr Glu Asp Asp Val Leu Ala Pro Gly Gly Arg Ala Pro Ala Gly Asp     610 615 620 Leu Leu Pro Ser Ala Phe Arg Val Pro Ala Ala Phe Pro Thr Lys Val 625 630 635 640 Pro Val Pro Gly Pro Gly Ser Gly Gly Asn Gly Pro Glu Arg Glu Gly                 645 650 655 Pro Glu Glu Pro Gly Leu Ala Lys Gln Asp Ser Phe Arg Ser Arg Leu             660 665 670 Asn Pro Leu Val Gln Arg Ser Ser Arg Leu Arg Ser Ser Leu Ile Phe         675 680 685 Ser Thr Ser Gln Ala Glu Gly Ala Ala Gly Ala Ala Ala Ala Thr Glu     690 695 700 Lys Val Gln Leu Leu His Lys Glu Gln Thr Val Ser Glu Thr Leu Gly 705 710 715 720 Pro Gly Gly Glu Ala Val Arg Ser Ala Ala Ser Thr Lys Val Ala Glu                 725 730 735 Leu Leu Glu Lys Tyr Lys Gly Pro Ala Arg Asp Pro Gly Gly Gly Ala             740 745 750 Gly Ala Ile Thr Val Ala Ser His Ser Lys Ala Val Val Ser Gln Ala         755 760 765 Trp Arg Glu Glu Val Ala Ala Pro Gly Ala Val Gly Gly Glu Arg Arg     770 775 780 Ser Leu Glu Ser Cys Leu Leu Asp Leu Arg Asp Ser Phe Ala Gln Gln 785 790 795 800 Leu His Gln Glu Ala Glu Arg Gln Pro Gly Ala Ala Ser Leu Thr Ala                 805 810 815 Ala Gln Leu Leu Asp Thr Leu Gly Arg Ser Gly Ser Asp Arg Leu Pro             820 825 830 Ser Arg Phe Leu Ser Ala Gln Ser His Ser Thr Ser Pro Gln Gly Leu         835 840 845 Asp Ser Pro Leu Pro Leu Glu Gly Ser Gly Ala His Gln Val Leu His     850 855 860 Asn Glu Ser Lys Gly Ser Pro Thr Ser Ala Tyr Pro Glu Arg Lys Gly 865 870 875 880 Ser Pro Thr Pro Gly Phe Ser Thr Arg Arg Gly Ser Pro Thr Thr Gly                 885 890 895 Phe Ile Glu Gln Lys Gly Ser Pro Thr Ser Ala Tyr Pro Glu Arg Arg             900 905 910 Gly Ser Pro Val Pro Pro Val Pro Glu Arg Arg Ser Ser Pro Val Pro         915 920 925 Pro Val Pro Glu Arg Arg Gly Ser Leu Thr Leu Thr Ile Ser Gly Glu     930 935 940 Ser Pro Lys Ala Gly Pro Ala Glu Glu Gly Pro Ser Gly Pro Met Glu 945 950 955 960 Val Leu Arg Lys Gly Ser Leu Arg Leu Arg Gln Leu Leu Ser Pro Lys                 965 970 975 Gly Glu Arg Arg Met Glu Asp Glu Gly Gly Phe Pro Val Pro Gln Glu             980 985 990 Asn Gly Gln Pro Glu Ser Pro Arg Arg Leu Ser Leu Gly Gln Gly Asp         995 1000 1005 Ser Thr Glu Ala Ala Thr Glu Glu Arg Gly Pro Arg Ala Arg Leu Ser    1010 1015 1020 Ser Ala Thr Ala Asn Ala Leu Tyr Ser Ser Asn Leu Arg Asp Asp Thr 1025 1030 1035 1040 Lys Ala Ile Leu Glu Gln Ile Ser Ala His Gly Gln Lys His Arg Ala                1045 1050 1055 Val Pro Ala Pro Ser Pro Gly Pro Thr His Asn Ser Pro Glu Leu Gly            1060 1065 1070 Arg Pro Pro Ala Ala Gly Val Leu Ala Pro Asp Met Ser Asp Lys Asp        1075 1080 1085 Lys Cys Ser Ala Ile Phe Arg Ser Asp Ser Leu Gly Thr Gln Gly Arg    1090 1095 1100 Leu Ser Arg Thr Leu Pro Ala Ser Ala Glu Glu Arg Asp Arg Leu Leu 1105 1110 1115 1120 Arg Arg Met Glu Ser Met Arg Lys Glu Lys Arg Val Tyr Ser Arg Phe                1125 1130 1135 Glu Val Phe Cys Lys Lys Glu Glu Ala Ser Ser Pro Gly Ala Gly Glu            1140 1145 1150 Gly Pro Ala Glu Glu Gly Thr Arg Asp Ser Lys Val Gly Lys Phe Val        1155 1160 1165 Pro Lys Ile Leu Gly Thr Phe Lys Ser Lys Lys    1170 1175 <210> 63 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> common motif <400> 63 Asp Leu Leu Ser Glu Val Leu Glu Ala   1 5  

Claims (15)

A composition for the treatment of dominant hypocalcified enamel dysplasia comprising a normal FAM83H (family with sequence similarity 83, member H) protein or a mammal homologous protein thereof. The therapeutic composition of claim 1, wherein the mammal is any one selected from the group consisting of rats, rabbits, pigs, cows, monkeys, goats, and cats. The therapeutic composition of claim 1, wherein the normal FAM83H protein has the amino acid sequence set forth in SEQ ID NO: 62. 3. The therapeutic composition of claim 1, wherein the homologous protein has at least 70% homology with the amino acid sequence of SEQ ID NO: 62. 3. 2. The therapeutic composition of claim 1, wherein the homologous protein has at least 80% homology with the amino acid sequence of SEQ ID NO: 62. The therapeutic composition of claim 1, wherein the homologous protein has at least 90% homology with the amino acid sequence of SEQ ID NO: 62. 3. A method for treating dominant hypocalcified enamel dysplasia of a patient comprising administering the composition for treatment of any one of claims 1 to 6 to a patient suffering from dominant hypocalcified enamel dysplasia. Normal FAM83H A composition for the treatment of dominant low calcification-type enamel dysplasia gene containing gene or a gene carrier including a mammal homologous gene thereof as an active ingredient. 9. The gene therapy composition of claim 8, wherein the mammal is any one selected from the group consisting of rats, rabbits, pigs, cows, monkeys, goats and cats. 9. The gene therapy composition according to claim 8, wherein the gene carrier is selected from the group consisting of liposomes, plasmids, adenoviruses, reproviruses and adeno accessory viruses. The gene therapy composition of claim 8, wherein the normal FAM83H gene has a nucleotide sequence set forth in SEQ ID NO: 55. 10. 9. The gene therapy composition of claim 8, wherein the homologous gene has at least 70% homology with the nucleotide sequence of SEQ ID NO. 9. The gene therapy composition of claim 8, wherein the homologous gene has at least 80% homology with the nucleotide sequence of SEQ ID NO. 10. The gene therapy composition of claim 8, wherein the homologous gene has at least 90% homology with the nucleotide sequence of SEQ ID NO. A method for treating dominant hypocalcified enamel dysplasia of a patient comprising administering the composition for gene therapy according to any one of claims 8 to 14 to a patient suffering from dominant hypocalcified enamel dysplasia.

Images