KR20090031053A - Respiratory syncytial virus vaccine - Google Patents

Abstract

An adenovirus expression vector is provided to induce high blood serum IgG and respiratory organ mucosa IgA through one immunization, thereby securing an effective defense against RSV replication. An adenovirus expression vector comprises a base sequence which codes 120th amino acid to 230th amino acid from N-terminal of the RSV G protein and a base sequence which codes 130th amino acid to 230th amino acid of the RSV G protein. The vector additionally includes a secretion signal sequence in an amino terminal of the RSV G protein.

Description

Respiratory Syncytial Virus Vaccine

The present invention relates to an adenovirus expression vector comprising a nucleotide sequence encoding amino acids 120-230 of RSV G protein and a vaccine comprising the vector.

Respiratory syncytial virus (RSV) is a genome of non-segmented RNA and belongs to paramyxoviridae. It is largely divided into A subtype and B subtype, and A subtype is generally dominant species. RSV synthesizes 10 proteins, including NS1, NS2, P, N, M, SH, G, F, M2 and L, in infected host cells. The N (nucleocapsid), P (phosphorus) and L (large polymerase subunit) proteins of RSV form the nucleoprotein core, which is considered the smallest infectious unit (Brown et al., J. Virol, 1). : 368-373, 1967), forming viral RNA dependent RNA transcriptases responsible for transcription and replication of the RSV genome (Yu et al., J. Virol. 69: 2412-2419, 1995; Grosfeld et al., J Virol. 69: 5677-5686, 1995). The M2 protein is known to induce an immune response by cytotoxic T lymphocytes involved in the removal of virus-infected cells. Recent studies have shown that M2 gene products (M2-1 and M 2-2) It has been shown to be involved in this transcription (Collins et al., 1996, Proc. Natl. Acad. Sci. 93: 81-85). Surface antigens include F protein (fusion protein), G protein, and SH protein. Among them, G protein and F protein, which are relatively high molecular weights and are present in the virus's outer membrane, are glycosylated glycosylated proteins. It plays the most important role in the variation of antigenicity. G proteins are involved in attachment to host cells to be infected, F proteins are involved in the formation of giant cells and invasion and attachment of viruses, and F and G proteins cause neutralizing antibodies.

RSV is a major pathogen of children's lower extremity infections, causing pneumonia and bronchitis. In particular, it is a high-risk group that can cause fatal infections in pulmonary dysplasia, congenital heart disease, cystic fibrosis, cancer or infants with various immunodeficiencies, and adults with immunocompromised conditions before bone marrow transplantation. In the elderly, the infection is similar to that of the influenza virus, and the excess mortality during the RSV epidemic was reported to be higher than during the influenza epidemic. There are 100,000 to 200,000 high-risk patients in the United States, with hospitalizations of more than 90,000 RSV infections each year, of which about 4,500 are reported to die. In Korea, RSV is prevalent every year, and a large number of patients are admitted to pediatric hospitals. 60% of all viral lower extremity infections isolated from Seoul National University Children's Hospital are caused by RSV. In Korea, hospitalization is also caused by RSV infection. It is estimated that there are a lot of deaths.

Despite these serious problems, no vaccines or specific therapies are currently available. In particular, formalin-inactivated vaccine (FI-vaccine) was developed in the past and clinical trials were conducted.However, 80% of children who were vaccinated with FI-vaccine were hospitalized due to RSV infection. He died, and severe lower respiratory tract disease was observed in the lungs. Currently, the approved treatment is Ribavirin (Ribavirin, Virazole) is used, but the clinical efficacy is low, high toxicity, and the inconvenience of spraying in the form of aerosol (aerosol) is used only in limited cases. In addition, many countries, including the United States, use RSV intravenous immunoglobulins (RSV-IGIV, Respigam) or the RSV monoclonal antibody palivizumab (Synagis) to prevent severe RSV infection in high-risk groups. It is not available to many people because it is preventive rather than therapeutic and expensive. Therefore, the development of a treatment for RSV is very urgent.

There are several important points to consider when developing an RSV vaccine. First, there should be no immunopatholgy induced by the vaccine. Second, because the main subject of RSV vaccine is infants, one dose at the beginning of birth should induce an effective protective immune response, and third, it should not be neutralized by the parental antibody.

 G proteins, which are being studied as vaccine candidates for RSV, do not have MHC I species-restricted epitopes and do not induce immune responses by cytotoxic T lymphocytes (CTLs). However, the protein has an I-Ed-limited immunodominant epitope from amino acid sequences 183 to 195, which induces many CD4 T cells expressing Vβ4. Many studies have shown that immunization with RSV G and infection with RSV augment Th2 type immune responses with respiratory eosinophilia (Hancock et al., J Virol 70: 7783-91, 1996 J Virol et al., 72: 2871-80, 1998; Openshaw, et al., Int Immunol 4: 493-500, 1992; Tebbey, et al., J Exp Med 188: 1967-72, 1998).

Therefore, the present inventors have tried to develop a safer and more effective RSV vaccine, and as a result, expressing some sequences of RSV G protein with adenovirus expression vector is effective for RSV replication without causing immunopathology such as eosinophilia. The present invention has been accomplished by discovering that it may represent a defense.

One object of the present invention is to provide an adenovirus expression vector comprising a nucleotide sequence encoding the 120th to 230th amino acid of the RSV G protein.

Another object of the present invention is to provide a vaccine composition comprising the adenovirus expression vector.

In one embodiment, the present invention provides an adenovirus expression vector comprising a nucleotide sequence encoding the RSV G protein.

In the present invention, the G protein of RSV is a major adhesion protein of RSV and important for RSV infection defense, and wild type nucleotide and amino acid sequences of RSV G protein are known in the art (Wertz et al., Proc. Natl. Acad). Sci. USA 92: 4075-4079, 1985; Satake et al., Nucl.Acids Res. 13 (21): 7795-7810, 1985). G protein does not have an MHC I species-restricted epitope and does not induce an immune response by cytotoxic T lymphocytes. However, the protein has an I-Ed-limited immunodominant epitope from amino acids 183 to 195, which induces many CD4 T cells expressing Vβ4. The RSV G protein used in the present invention includes the 120th to 230th amino acids from the N-terminus, more preferably the 130th to 230th amino acids.

In addition, the RSV G protein used in the present invention includes not only a protein having a wild type amino acid sequence but also an amino acid sequence variant thereof. Variant of a G protein means a protein in which the natural amino acid sequence of the G protein and one or more amino acid residues have a different sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof. In addition, G proteins may be glycosylated or lipidated and may be derivatized to include molecules that enhance antigen presentation and enhance the antigen's targeting to antigen presenting cells.

The RSV G protein may be in the form of a monomer comprising 120-230 amino acids, or 130-230 amino acids, from the N-terminus, but in order to further enhance immunogenicity, the amino acid sequence has two or more, preferably 3 to 8, more preferably 3 to 6 may be in the form of linked multimers, and more preferably three linked trimers may be used. In a specific embodiment of the invention, RSV G protein fragments were constructed to be repeated three times in succession. In the present invention, in order to enhance the efficacy of RSV G protein fragment (130th to 230th amino acid) as a vaccine, the amino acid translation codon was optimized to enhance the expression of RSV G protein fragment (SEQ ID NO: 1), and RSV G fragment 3 The dogs were attached (tandem repeat) to increase the immunogenicity.

When the RSV G protein takes the form of a multimer, the amino acid sequences forming the monomers can be covalently linked directly or via a linker. When linked through a linker, amino acids such as glycine, alanine, leucine, isoleucine, proline, serine, threonine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, lysine, arginine acid are used, respectively. And, preferably, valine, leucine, aspartic acid, glycine, alanine and proline. More preferably, a plurality of amino acids selected from glycine, valine, leucine, aspartic acid, and the like may be used in connection with ease of genetic manipulation. In a specific embodiment of the present invention, a linker sequence consisting of four glycine residues is interposed between RSV G fragments in order to connect the RSV G protein portion so that the RSV G protein is repeatedly expressed three times. It was.

In a specific embodiment of the present invention, in the adenovirus vector rAd / 1xG prepared by inserting only one RSV G protein fragment, no specific band was observed in the HEp-2 cell supernatant, but the RSV G protein fragment was repeated three times. In the case of the inserted adenovirus vector rAd / 3xG, several bands were observed between about 20 kDa and 30 kDa (Fig. 2). These results indicate that rAd / 3xG specifically expresses the RSV G fragment antigen. The expression efficiency of the outward secreted fragment antigens is increased. In addition, immunization of mice with rAd / 3xG to the respiratory tract and intramuscularly induced a very high serum total IgG response with a single dose, whereas with immunization of the same dose of rAd / 1xG, an IgG response greater than the control group. Invisible (Fig. 3), RSV G protein fragment was confirmed that the immune function is more effective when produced to repeat three times in succession.

As used herein, the term “expression vector” refers to a gene construct that is capable of expressing a protein of interest in a suitable host cell, and includes a gene construct that includes essential regulatory elements operably linked to express a gene insert.

As used herein, the term “operably linked” refers to a functional linkage of a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. The promoter and the nucleic acid sequence encoding the protein may be operably linked to affect the expression of the encoding nucleic acid sequence.Operative linkage with the recombinant vector may be prepared using genetic recombination techniques well known in the art. Site-specific DNA cleavage and ligation uses enzymes generally known in the art, and the like.

As used herein, the term "adenovirus expression vector" refers to any adenovirus vector comprising exogenous DNA inserted into its genome encoding a polypeptide. Adenovirus vectors contain one or more (preferably, at least about 90% of the total ITR sequence) of each terminal repeat necessary to aid in the replication of the viral DNA and contain the DNA necessary to encapsulate the genome into the viral capsid. It is preferable. Many suitable adenovirus vectors are described in the art (see US Pat. No. 6,440,944; 6,040,174 (non-replicated E1 deleted vectors and differentiated packaging cell lines)). Preferred adenovirus expression vectors are replication-defection vectors that do not replicate in normal cells.

The vector of the present invention may further include a nucleic acid sequence encoding a secretory signal sequence at the N-terminus of the nucleic acid sequence encoding a G protein to enhance an antigen specific immune response. As used herein, the term “signal sequence” (also referred to as a “signal sequence”, “signal peptide”, “leader sequence” or “leader peptide”) refers to about 20 synthesized at the N-terminus of a polypeptide. Refers to a short peptide sequence (generally hydrophobic herein) comprising from 30 to 30 amino acids, and refers to a peptide that directs the transport of the protein to which it is linked Eukaryotic secretion signal sequence is an exogenous gene of an adenovirus expression vector A variety of sequences are known in the art and include secretory signal sequences such as human growth hormone, immunoglobulin kappa chains, etc. In specific embodiments of the invention, humans are preferred for inducing product secretion. Signal sequence derived from human tissue plasminogen activator (t-PA) (5'-ATGGACGCCATGAAGAGGGGCCTGTG CTGCGTGCTGCTGCTGTGCGGCGCCGTGTTTGTGAGCCCCAGCGCT -3 ') The nucleic acid can be prepared by artificially synthetic or genetic recombination methods and provided by operably linked to a vector capable of expressing it.

In addition, the vector of the present invention may further include a protein tag that can be removed using an endopeptidase, in order to facilitate the detection of G protein. As used herein, the term "tag" refers to a molecule that exhibits quantifiable activity or properties, and refers to a polypeptide fluorescent substance such as chemical fluorescer, fluorescent protein (GFP) or related protein such as fluorescein. It may be a fluorescent molecule included, or may be an epitope tag such as a Myc tag, a flag tag, a histidine tag, a leucine tag, an IgG tag, and a straptavidin tag. Suitable tag polypeptides generally have 6 or more amino acid residues and typically have about 8 to 50 amino acid residues, wherein 6 histidine tags were used in the present invention. Preferably, the tag is in the C terminal region of the G protein.

In addition, the vector of the present invention may further include a stop codon at the C-terminal portion of the G protein, a preferred vector is a vector shown in the cleavage map of FIG.

In addition, the expression vectors of the present invention include expression control elements such as promoters, operators, initiation codons, polyadenylation signals, and enhancers as elements that a suitable expression vector generally has. Initiation and termination codons are generally considered to be part of the nucleotide sequence encoding the immunogenic target protein and must be functional in the subject and be in frame with the coding sequence when the gene construct is administered. The promoter of the vector may be constitutive or inducible.

In a specific embodiment of the present invention, when immunized with a combination of rAd / 3xG, RSV F protein (rAd / Fco) and RSV M2 protein (rAd / M2) adenovirus vaccine (rAd / Mix), the protective immunity is the same as that of the mixed vaccine. An increase was observed, similar to when immunized with a dose of rAd / 3xG vaccine (FIG. 11). However, when the immunized recombinant adenovirus vaccine expressing RSV F protein (rAd / Fco) or RSV M2 protein (rAd / M2) alone, it was confirmed that the protective effect was low (FIG. 11). This indicates that adenovirus vectors containing G proteins may have significant prophylactic and therapeutic effects as RSV related disease vaccines, unlike vectors containing other RSV proteins.

As another aspect, the present invention relates to a vaccine composition for the prevention and treatment of respiratory diseases caused by RSV comprising the vector.

As used herein, the term "prevention" means any action that inhibits or delays the onset of a disease caused by RSV infection by administration of the composition. As used herein, the term "treatment" means any action that improves or benefits the condition of a disease already caused by RSV infection by administration of the composition.The symptoms and diseases caused by respiratory synschia virus infection are coughing, sneezing, and high fever. Examples include wheezing, bronchitis, bronchiolitis, pneumonia, asthma, bronchitis, croup and respiratory failure.

As used herein, adenovirus vectors of the invention can be administered as a vaccine to induce immunity to respiratory diseases caused by RSV infection. Viral vectors may be suitably formulated with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers can be used as oral administration binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments and flavors, etc. Non-aqueous solvents such as aqueous solvents such as liquids and ring gel solutions, vegetable oils, higher fatty acid esters (e.g., oleic acid, etc.), and alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.) And buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers and the like can be used in combination. In the case of propellants, suitable propellants, such as compressed air, nitrogen, carbon dioxide, or hydrocarbon-based low boiling point solvents, etc., may be conveniently delivered in the form of aerosol spray presentation from pressurized packs or nebulizers.

The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elesir, suspensions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms.

The route of administration of the composition may be administered via any general route as long as it can reach the desired tissue.

As used herein, the term "administration" means the introduction of certain substances into a patient in any suitable manner, formulated for human or veterinary administration and administered by various routes. Viral vectors can be administered by parenteral routes such as intravascular, intravenous, intraarterial, intramuscular or subcutaneous. It may also be administered by inhalation route via oral, nasal, rectal, transdermal or aerosol. Viral vectors can be administered by bolus or injected slowly. The vector is preferably administered by the subcutaneous route.

The vaccine composition of the present invention is administered in a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to exhibit a vaccine effect and an amount not causing side effects or severe or excessive immune responses, and an effective dose level means a disorder, disorder to be treated. Severity, activity of a particular compound, route of administration, rate of viral vector removal, duration of treatment, drug used in combination or concurrent with the viral vector, age, weight, sex, diet, general health of the subject, and the pharmaceutical industry and medicine It will depend on various factors including factors known in the art. Various general considerations considered in determining a "therapeutically effective amount" are known to those skilled in the art and are described, for example, in Gilman et al., Eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990 And Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, Pa., 1990. In the case of administration of adenovirus vectors, the number of particles to be administered in a single dose is usually about 1 × 10 ⁷ to 1 × 10 ¹¹ , more preferably 1 × 10 ⁸ to 5 × 10 ¹⁰ , even more preferably Is in the range of 5 × 10 ⁸ to 2 × 10 ¹⁰ .

The compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.

The vaccine composition of the present invention may further comprise an adenovirus expression vector comprising all or part of the RSV F protein. In addition, the vaccine composition of the present invention may further include an adenovirus expression vector comprising all or part of the RSV M2 protein. In addition, the vaccine composition of the present invention may further include an adenovirus expression vector comprising all or part of the RSV F protein and all or part of the RSV M2 protein.

RSV F protein is considered to be one of the antigens involved in virus neutralization. RSV M2 is known to induce an immune response by cytotoxic T lymphocytes involved in the removal of viral infected cells. In a specific embodiment of the present invention, when immunized with a combination of rAd / 3xG, RSV F protein (rAd / Fco) and RSV M2 protein (rAd / M2) adenovirus vaccine (rAd / Mix), the protective immunity is the same as that of the mixed vaccine. A similar increase was observed when immunized with a dose of rAd / 3xG vaccine (FIG. 11). However, when the immunized recombinant adenovirus vaccine expressing RSV F protein (rAd / Fco) or RSV M2 protein (rAd / M2) alone, it was confirmed that the protective effect was low (FIG. 11). Thus, the combination of rAd / 3xG vaccines with rAd / Fco and rAd / M2 vaccines indicates that rAd / 3xG alone may induce the same or better protective immunity than when the same dose of the combined vaccine is used.

In a specific embodiment of the present invention, the effect of the adenovirus expression vector according to the invention on the prevention and treatment of respiratory diseases caused by RSV.

 In in vivo experiments in mice, the recombinant replication-defective adenovirus vaccine (rAd / 3xG) according to the invention induces very high serum IgG and respiratory mucosal IgA through one immunization ( 3 and 5), even if the immunity already had a sufficient amount of IgG and IgA was induced (Fig. 6). In addition, RSV replication was inhibited in the group immunized with rAd / 3xG to the respiratory tract, so that almost no virus was found (FIG. 9).

In addition, mice immunized with Vaccinia virus (vvG) and rAd / 3xG, which express live RSV, RSV G, were infected with RSV after 3 weeks, and the number of eosinophils contained in bronchoalveolar lavage fluid. In the group immunized with vvG, eosinophils increased significantly (Fig. 8, 15-25% of the total BAL cells), whereas in the group immunized with rAd / 3xG, 1-3% of the total BAL cells were detected. Only eosinophils were observed. This was about the same as when immunizing live RSV. Therefore, when the vaccinia virus expression vector is used, the effect of reducing eosinophilia cannot be expected at all, but when the adenovirus expression vector according to the present invention is used, the pathology of the lung due to the increase of eosinophils does not occur. In addition, the mice immunized with rAd / 3xG showed a significant reduction in body weight and disease due to immunopathology while maintaining the protective effect against RSV as compared to mice immunized with vvG (FIG. 10).

Therefore, the present invention is a very effective vaccine that can induce an effective protective immune response with a single administration at the early stage of birth of infants, which is the main target of RSV vaccine, without causing secondary immunopatholgy such as eosinophilia. Able to know.

Recombinant replication-defective adenovirus vaccine (rAd / 3xG) according to the present invention induces very high serum IgG and respiratory mucosal IgA through one immunization, without exacerbating immunopathology due to vaccine upon RSV infection Represents an effective defense against RSV replication.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example  One : RSV stock  Ready

The RSV A2 strain contains 3% heat-inactivated fetal calf serum (FCS), 2 mM glutamine, 20 mM 2- [4- (2-hydrocyethyl) -1-piperazinyl] ethane. Cultured in HEp-2 cells (ATCC, Manassas, VA) in DMEM medium (Dulbecco's Modified Eagle Medium; Life Technologies, Gaithersburg, MD) to which sulfonic acid (HEPES) and non-essential amino acids were added. Specifically, the RSV A2 virus diluted in HEp-2 cells of about 70% confluency is infected with a frequency of MOI = 0.01, and 72-96 are most likely to exhibit cytopathic effects due to virus replication. After time, the culture and the cells were recovered. After crushing the cells by repeated freeze-thaw, the supernatant was collected, the virus was precipitated by ultra-high-speed centrifugation, and suspended in an appropriate amount of DMEM medium to prepare a stock.

Example 2: Preparation of adenovirus expressing cloned out of the RSV G fragment

A 333mer long base nucleotide DNA was prepared in which the DNA sequence corresponding to amino acid sequence 130-230 of the RSV G protein (RSV A2 strain) was replaced with the most frequently used codon (Bioneer Corp., Daejeon, Korea). PCR using 5 ': GCTAGC TACCCCTAC GAC GTG CCC GAC TAC GCC GTG AAG ACC AAA AAC ACC (SEQ ID NO: 2), 3': GGATCC GCCGCCTCCGCC AGG CTT GGT GGT GGG CAC (SEQ ID NO: 3) After the amplification through the oligonucleotide primer was synthesized again by PCR, the base sequence encoding the six histidines and two consecutive stop codons (sequence codon) was attached to the 3 'end. In order to connect the RSV G protein portion, it was amplified with an oligonucleotide primer containing an appropriate restriction enzyme recognition site and manipulated to be expressed three times by including four glycine residue linkers in the middle (FIG. 1). And a signal sequence derived from a start codon and a human tissue plasminogen activator (t-PA) (5'- ATG GACGCCATGAAGAGGGGCCTGTGCTGCGTGCTGCTGCTGTGCGGCGCCGTGTTTGTGAGCCCCAGCG sequence 3 '); Attached to the N-terminus. The entire open reading frame from the start codon to the stop codon was transferred to the pShuttle-CMV vector using the restriction enzyme Kpn I / Xho I. The recombinant shuttle vector plasmid was recombined by electroporation with pAdEasy-1 adenovirus genomic DNA in electrocompetent cells BJ5183 cells to obtain recombinant adenovirus DNA.

The recombinant adenovirus DNA thus produced was transfected into HEK293 cells to make a replication-defective adenovirus expression vector (rAd / 3xG). The control adenovirus was made in the same way with the pShuttle-CMV vector containing nothing. Control virus and rAd / 3xG virus were amplified in HEK293 cells and purified using CsCl gradient centrifugation (interpreted CsCl gradient as CsCl gradient centrifugation? (TCID ₅₀ ; Tissue Culture Infectious Dose 50%) was measured. Expression of RSV G fragments by non-replicating adenovirus (rAd / 3xG) results in infection of HEp-2 cells with the same virus and supernatant, followed by monoclonal antibodies specific for G protein (clone No. 131-2G) and HRP. (HRP-conjugated streptavidin streptavidin, Zymed Laboratories, San Francisco, Calif.) Was confirmed by Western blotting method (Horseradish peroxidase) attached.

As a result, several bands were observed between about 20 kDa and 30 kDa in supernatants infected with rAd / 3xG in HEp-2 cells, and specific bands in HEp-2 cells supernatants infected with rAd / control or rAd / 1xG. Was not observed (FIG. 2). These results show that rAd / 3xG specifically expresses the RSV G fragment antigen and increases the expression efficiency of the fragment antigen secreted out of the cell.

Example  3: immunization ( Immunization )Wow RSV  infection

To determine whether the rAd / 3xG vaccine induces an antigen-specific immune response in vivo, female BALB / C mice (Charles River Laboratories Inc. Yokohama, Japan), 6 to 8 weeks old, were given multiple doses of non-replicating adenovirus. And immunization via respiratory, intramuscular injection or oral route. For respiratory immunization, 5 × 10 ⁷ PFU / 50 μl of rAd / 3 × G was injected through the nasal cavity of mice anesthetized with ether or chloroform. In intramuscular immunization, the femoral muscles of mice were injected with 5 × 10 ⁷ PFU / 100 μl of rAd / 3 × G. Oral immunization was performed via proximal esophageal intubation with a mouse feeding needle for fasting mice 2-3 hours prior to infusion and diluting 5 × 10 ⁷ PFU rAd / 3xG in 200 μl of PBS. . In the case of Vaccinia virus (vvG) expressing RSV G, 5 × 10 ⁷ PFU / 5 μl of virus was injected into the tail base of BALB / c mice using a 26-gauge needle. scarification). After 4-12 weeks of immunization, mice were anesthetized with ether or chloroform and then exposed to 1 × 10 ⁶ PFU of RSV A2 virus via the nasal cavity.

Example  4 : IgG  Induction effect measurement

Blood was collected by heparinized capillary tube from the retroorbital plexus of each immunized mouse by the method of Example 3 to obtain serum by centrifugation, and anti-RSV specific to RSV G protein. IgG titers were confirmed by ELISA. 96 well plates were coated with 100 μl / well of 108 μg / ml RSV A2 Ag (US Biological, Swampscott, Mass.) Or RSV 2 × 10 ⁴ PFU and incubated at 4 ° C. until morning. After blocking for 2 hours with 2% BSA PBS (serial or lavage fluid) was serially diluted with 1% BSA Phosphate Buffered Saline Tween 20 (serial dilution) and incubated for 2 hours at room temperature. The plate was washed 5 times with 0.05% PBST, and then HRP-conjugated affinity-purified rabbit anti-mouse antibody IgG, IgG1, IgG2a and IgA Secondary antibody (Zymed Laboratories, San Francisco, CA) was attached for 1 hour. Thereafter, after washing five times, color development was performed with 3,3 ', 5,5'-tetramethylbenzidine, and color development was stopped with 1M H ₃ PO ₄ , and then absorbance was measured at 450 nm.

As a result, immunization of rAd / 3xG through the respiratory tract and intramuscularly induced very high serum total IgG response even with a single dose (FIG. 3). When injected through the mouth showed a relatively low RSV specific serum IgG response compared to the respiratory and intramuscular injection (Fig. 3). However, immunization of the same dose of rAd / 1xG through the respiratory tract showed no IgG response over control (FIG. 3). In mice immunized with rAd / 3xG (respiratory), the degree of serum IgG response is similar to that induced by live RSV. This means that rAd / 3xG vaccines induce very potent immunogenicity similar to live RSV in vivo.

Example  5: IgA  Induction effect measurement

Secretory IgA present in the mucosa is the first foremost mechanism by which the host defends against foreign pathogens invading through the mucosa. Therefore, an effective RSV vaccine should be able to induce virus specific secretory IgA in the respiratory mucus region. To investigate whether the rAd / 3xG vaccine induces an IgA response in the respiratory tract, we performed the following experiment.

Four days after RSV infection, the mice were sacrificed via anesthesia, the trachea was dissected and a tube connected to a 1 ml syringe was inserted to wash the lungs and bronchus three times with 0.8 ml PBS. Bronchoalveolar lavage fluid; BAL Cells contained in) were collected by centrifugation, and secretory IgA titers were measured by ELISA.

As a result, when BAL was tested 21 days after immunization, as shown in FIG. Rats in the group immunized with rAd / 3xG intramuscularly and orally showed basal level IgA responses. We also checked RSV-specific IgA levels in the lung 4 days after RSV infection. rAd / 3xG and live RSV immunized mice showed significantly higher IgA levels compared to controls (p <0.01; FIG. 5). Although the rAd / 3xG group showed slightly higher levels, there was no statistical difference between the rAd / 3xG immunization group and the live RSV group.

Example  6: already Immune  Occation IgG  And IgA  Induction effect measurement

To determine the vaccine's efficacy when already immunized against adenovirus vectors, we immunized the rAd / 3xG vaccine after 3 weeks in mice that had been previously exposed to rAd / control. As a result, the adenovirus vector was 1 X 10⁷ There was no significant difference in anti-RSV IgG antibody formation between the groups exposed to doses of PFU and those not exposed (FIG. 6). More unusually, the levels of anti-RSV secreted IgA secreted in BAL fluid did not differ significantly from that in the other groups. And four weeks after the immunization, RSV infection showed complete protection in all groups of mice. The above results suggest that single immunization of the rAd / 3xG vaccine through the respiratory tract is sufficient and more effective in inducing IgA in serum IgG and respiratory tract even when anti-adenovirus immunity is already present.

Example  7: eosinophils ( eosinophil Number measurement

7-1. Determination of Response of G Protein-Specific T Cells

In mice immunized with RSV G expressing vaccinia virus (vvG), eosinophilia of the respiratory tract by G protein specific CD4 T cells and subsequent RSV infection is well known. Since the G protein fragment expressed by the rAd / 3xG vaccine has a known I-Ed-restricted CD4 T-cell epitope, we investigated whether rAd / 3xG immunization induced G protein specific CD4 T cells. Mice immunized with rAd / 3xG or vvG were infected with RSV, and after 4 days, lung immune cells were isolated and stimulated with I-Ed-restricted G (183-195) epitope peptides to determine IFN-γ production. Dyed to find out.

The method for isolating immune cells is as follows. 5 ml PBS containing 10 U / ml heparin (Sigma-Aldrich, St. Louis, Mo.) was perfused through the syringe of a 25-gauge needle into the right ventricle of the mouse heart. The lungs were extracted and ground on an RPMI Medium steel screen containing 10% FBS (HyClone, Logan, UT) to form a single cell suspension, followed by a 70 μm cell strainer (BD Labware, Filtered by Franklin Lakes, NJ). Cells were then separated by centrifugation and PBS / 3% FBS / 0.09% NaN ₃ Staining was performed with appropriate fluorochrome-conjugated antibodies in the buffer. The antibody used was anti-CD3e (clone 145-2C11), anti-CD4 (clone RM4-5), anti-CD44 (clone IM7), anti-CD49d (clone R1-2), and anti-Vβ14 TCR (clone 14-2) were all purchased from BD PharMingen (San Diego, Calif.). After staining, the cells were fixed with PBS / 2% (wt / vol) paraformaldehyde and analyzed using a FACSCalibur ™ flow cytometer (BD Biosciences, San Diego, Calif.).

In order to analyze the cells secreting IFN-γ, intracellular staining was performed. Put 2 X 10 ⁶ lung cells in the culture tube and add 10 μM G (183-195) peptide (WAICKRIPNKKPG) for 5 hours at 37 ℃ 5% CO ₂ Incubate in incubator. 5 μg / ml of Brefeldin A (Sigma-Aldrich) was also added during incubation time to allow IFN-γ to accumulate in the cells. The cell surface markers were stained, washed and fixed, infiltrated with FACS buffer containing 0.5% saponin (Sigma-Aldrich, Seoul, Korea) and stained with IFN-γ (clone XMG1.2) antibody. Dead cells were excluded by forward and side light scatter patterns. Data is collected via CELLQuest ™ software (BD Biosciences) and CELLQuest ™ and WinMDI versions 2.9 software (The Scripps Research Institute, La Jolla, CA).

As a result, as shown in FIG. 7, the response of G-specific T cells was rarely seen in mice immunized with rAd / 3xG when viewed through intracellular IFN-γ staining (less than about 0.2% of all CD4 T cells in the lung). . On the other hand, the group immunized with vvG showed a strong CD4 T cell response, including Vβ14 + IFNγ + cells (more than 10% of the total CD4 T cells in the lung).

Previous reports indicate that CD4 T cell immune responses exhibited by I-Ed-limited immunodominant epitopes from RSV G amino acid sequences 183 to 195 are sufficient to indicate exacerbated pathology after RSV infection. Our results show that rAd / 3xG rarely induces G specific CD4 T cells. Therefore, it can be predicted that rAd / 3xG immunization will not show vaccine-enhanced eosinophilia due to G specific CD4 T cells.

7-2. Eosinophils ( eosinophil Number measurement

In order to investigate whether rAd / 3xG immunity actually causes secondary immunopathology, immunized mice were infected with RSV three weeks after 3 weeks, and then mice were sacrificed via anesthesia after trachea. The lungs and bronchus were washed three times with 0.8 ml PBS by inserting a tube connected to a 1 ml syringe incision. Cells contained in the bronchoalveolar lavage fluid were collected by centrifugation, attached to a slide through cytospin, and stained with H & E (hematoxylin-eosin) to measure the number of eosinophils under a microscope.

As a result, as expected, there was a marked increase in eosinophils in the group immunized with vvG (FIG. 8, 15-25% of total BAL cells), while in the group immunized with rAd / 3xG, 1-3% in total BAL cells. Only eosinophils were observed. This is about the same as when immunizing live RSV. Therefore, rAd / 3xG rarely causes lung pathology due to eosinophilia.

Example  8: mice Lung tissue  undergarment RSV Titer  Measure

To investigate the protective properties of the induced immune response, we examined immunity of rAd / 3xG through mucous membrane and spleen, and RSV infection through respiratory tract. Four weeks after the mice were immunized RSV A2 was infected with 5 × 10 ⁶ PFU. Four days later, the mice were anesthetized and killed, and the lung tissue was removed and placed in Eagle's modified essential medium. The tissues were then ground on a steel screen into single cell suspensions and filtered through a 70 μm cell strainer (BD Labware, Franklin Lakes, NJ). Supernatants were collected and RSV titers were measured by plaque assay.

As a result, live RSV was found in the lung tissues of the control mice, whereas RSV replication was suppressed in the group immunized with the respiratory immunity with rAd / 3xG, and almost no virus was detected (FIG. 9). The same protective effect was observed in the RSV-infected group after live RSV A2 infection. However, the group that immunized rAd / 3xG intramuscularly showed only a partial partial defense at the point of peak viral replication (after 4 days). Mice immunized with rAd / 3xG also showed significant reduction in body weight and disease due to immunopathology while retaining the protective effect against RSV as compared to mice immunized with vvG (FIG. 10). ). Taken together, these results show that intranasal rAd / 3xG vaccination via mucosa induces effective protective immunity without pathological CD 4 T cell responses or secondary immunopathology with eosinophilia due to vaccine.

Example  9: rAd / 3 xG Efficacy of Mixed Vaccines Including

RSV infection was attempted after intranasal immunization with a 1 × 10 ⁷ PFU dose to determine if defensive efficacy could be maintained even with a smaller dose of rAd / 3xG vaccine. It was confirmed that the protective effect is slightly reduced compared to the case of immunization with 1 X 10 ⁸ PFU dose (Fig. 9).

In addition, when immunized with a mixture of rAd / 3xG, rAd / Fco, and rAd / M2 adenovirus vaccines, each 1 × 10 ⁷ PFU dose (rAd / Mix), the protective immunity of the rAd / 3xG vaccine was 1 × 10 ⁸ PFU dose. It was observed to increase similarly to the case of immunization with (Fig. 11). However, when a recombinant adenovirus vaccine expressing either RSV F protein (rAd / Fco) or RSV M2 protein (rAd / M2) was immunized with intranasal alone at a dose of 1 × 10 ⁷ PFU, the protective effect was low after 4 days of RSV infection. May be (FIG. 11). These results indicate that the combination of rAd / 3xG vaccine with rAd / Fco and rAd / M2 vaccines may induce the same or better protective immunity when using a 1 × 10 ⁸ PFU dose with rAd / 3xG alone.

1 shows a cleavage map of the entire adenovirus expression vector according to the present invention.

FIG. 2 shows an adenovirus expression vector (rAd / 3xG) in which the amino acid sequence of RSV G protein is inserted three times, the adenovirus expression vector in which the amino acid sequence of RSV G protein is inserted once (rAd / 1xG) and RSV G protein. The degree of G protein expression of the adenovirus expression vector (rAd / control) to which the amino acid sequence of was not inserted was confirmed by Western blotting.

Figure 3 is confirmed by the IgG titer to measure the serum IgG induction when immunized rAd / 3xG through the respiratory, intramuscular, oral. (Preimmune: when not immunized, in: respiratory administration, im: in the muscle Administration, oral: oral administration)

Figure 4 is confirmed by ELISA the degree of IgA induction of the respiratory tract when immunized rAd / 3xG through the respiratory, intramuscular and oral, respectively.

Figure 5 is confirmed by ELISA the degree of IgA induction of the respiratory tract when immunized with the control (rAd / control), rAd / 3xG and live RSV, respectively.

Figure 6 shows the degree of IgG and IgA induction in the case of having already immunized against adenovirus vectors by IgG titer and ELISA.

Figure 7 confirms whether the induction of G-specific T cell response through IFN-γ staining when immunized with vaccinia virus vector (vvG) expressing the control (rAd / control), rAd / 3xG and RSV G protein, respectively will be.

Figure 8 is the result of measuring the number of eosinophils contained in the bronchoalveolar lavage fluid when immunized with rAd / 3xG and vvG, respectively.

9 shows the RSV titers in lung tissue in the control group (rAd / control), the group immunized with rAd / 3xG (in), the group immunized with rAd / 3xG intramuscularly (im), and the group infected with live RSV. It is a result of a measurement.

FIG. 10 shows the results of measuring weight loss by immunopathology in the control group (rAd / control), the group immunized with rAd / 3xG, and the group infected with live RSV.

FIG. 11 shows a control group (rAd / control), rAd / 3xG, adenovirus expression vector (rAd / Fco) for RSV F protein, adenovirus expression vector (rAd / M2) and rAd / 3xG, rAd / for RSV M2 protein. RSV titers in lung tissues were measured when immunized with a combination of Fco and rAd / M2 (rAd / Mix).

<110> ewha university industry collaboration foundation <120> Respiratory Syncytial Virus Vaccine <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 300 <212> DNA <213> Artificial Sequence <220> RSV G optimized sequence <400> 1 gtgaagacca aaaacaccac cactacacaa acccagccga gcaagcccac caccaaacag 60 cgccagaata agcccccatc caagcccaac aacgacttcc acttcgaggt attcaatttc 120 gtgccctgtt ccatctgttc aaacaatccc acctgctggg ccatctgcaa gcggattccc 180 aataagaagc ccggcaagaa gaccacgacc aagcccacga agaagcctac gctgaagacc 240 accaaaaaag accctaagcc ccagaccacg aagtccaagg aggtgcccac caccaagcct 300                                                                          300 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> primer for RSV G gene amplification <400> 2 gctagctacc cctacgacgt gcccgactac gccgtgaaga ccaaaaacac c 51 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer for RSV G gene amplification <400> 3 ggatccgccg cctccgccag gcttggtggt gggcac 36 <210> 4 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> signal sequence of t-PA <400> 4 atggacgcca tgaagagggg cctgtgctgc gtgctgctgc tgtgcggcgc cgtgtttgtg 60 agccccagcg ct 72  

Claims (10)

An adenovirus expression vector comprising a nucleotide sequence encoding the 120th to 230th amino acids from the N- terminal of the RSV G protein. The adenovirus expression vector according to claim 1, comprising a base sequence encoding amino acids 130-230 of RSV G protein. The vector of claim 1, wherein the nucleotide sequence encoding the 120-230 amino acids of the RSV G protein comprises a nucleotide sequence repeated three times. The vector of claim 3, wherein the vector comprises a linker sequence between the nucleotide sequence encoding the 120 to 230 amino acids of the RSV G protein and the repeating nucleotide sequence. The vector of claim 4, wherein the linker sequence is glycine. The vector of claim 1, further comprising a secretory signal sequence at the amino terminus of the RSV G protein. The vector of claim 1, further comprising a protein tag and a stop codon at the carboxyl terminus of the RSV G protein. The vector of claim 1, represented by the cleavage map of FIG. 1. Vaccine composition for preventing and treating respiratory diseases caused by RSV comprising the vector of claim 1. The vaccine composition of claim 9, further comprising one or two vectors selected from adenovirus vectors expressing RSV F protein and adenovirus vectors expressing RSV M2 protein.

Images