KR20090007670A - Sivmac239 immunogenic plasmids and aids dna vaccine containing the same - Google Patents

Abstract

The immunogenic plasmid of SIVmac239(Simian Immunodeficiency Virus) is provided to minimize the immunity disturbance activity of the supplementary gene and optimize the codon to increase the expression efficiency of the inserted gene, thereby increasing the expression efficiency and immune efficacy of immunogen. The plasmid comprises the gene vif derived from SIVmac239, the signal sequence of secretory protein which is linked to the 3'-terminal of the gene vif, and the gene nef derived from SIVmac239 linked to the 5-terminal of the gene vif.

Description

SIVmac239 Immunogenic Plasmids And AIDS DNA Vaccine Containing The Same}

The present invention relates to an AIDS DNA vaccine. More specifically, the present invention relates to immunogenic plasmids against SIVmac239 and HIV and AIDS DNA vaccines containing these plasmids.

DNA vaccines are the most recently developed of several vaccine methods. As a related document, there are the following. Ert et al., J. Immunol. 156,3579-3582 (1996) disclose a method of administering a "live" vaccine or a "dead" vaccine in a conventional immunization strategy. Hastett et al., Trends in Microbiol. 8,307-312 (1996), live vaccines can generally provide an effective immune response in the immunized body, but because live vaccines can be returned to pathogenic organisms or contaminated with other pathogens, It is warned that if immunity is compromised or pregnant, it can be dangerous. Recently, in Tang, DC, et al., Nature (Lond.) 356, 152-154, (1992), direct injection of expression plasmids encoding foreign proteins into the skin of mice induced antibody responses. Was found, suggesting that injection of "naked" DNA expresses an antigen in a form that causes an immune response. Ulmer, J. B., et al., Science 259, 1745-1749, (1993); Fynan, E. F., et al., Proc. Natl. Acad. Sci. USA 90, 11, 478-11, 482, (1993)] developed a vaccine by discovering that intramuscular injection of plasmid DNA encoding the influenza's nucleoprotein could protect mice infected with live influenza virus. Has opened a new chapter. It has also been found that immunization with plasmid DNA activates both humoral and cellular immunity, including the generation of CD4 + T helper cells as well as antigen-specific CD8 + cytotoxic T cells (Donnellym, JJ, et al., Ann Rev. Immunol. 15, 617-648, (1997)). Felgner et al., USP 5,589,466 also discloses the isolation of isolated polynucleotides by injecting polynucleotides, such as DNA or RNA, into the muscles of mammals, such that the polynucleotides exhibit therapeutic effects in the body by absorption of muscle cells. A delivery method is disclosed.

Although the level of defense achieved with DNA vaccines is generally lower than that observed with virus-infected and naturally recovered (Manickan et al., Critical Review Immunol. 17,139-154, (1997)), conventional protein specificity It is known to be similar to the level induced by antigen vaccines and dead or attenuated viral vaccines. However, DNA vaccines composed of naked plasmids have several advantages over immunization methods that rely on the injection of purified or recombinant proteins or attenuated live or recombinant viruses. (1) One or more genes are readily introduced simultaneously, allowing simultaneous introduction of genes encoding specific tumor antigens and / or immune regulatory cytokines. (2) Only the desired gene is transcribed from the viral protein in vivo and ex vivo without immunological interference. (3) There is no risk of recombination that can result from using a replication-deficient viral vector. (4) It is unlikely that the insertion of foreign DNA into the genome is due to the transient nature of gene transfer. (5) This method can easily prepare the DNA vector used. (6) It is possible to induce humoral and cellular immune responses against various antigens simultaneously and to modulate the characteristics of the immune response by simultaneously delivering genes encoding immunoregulatory cytokines or costimulatory molecules.

Acquired immunodeficiency syndrome (AIDS) is a disease that has been studied since its first diagnosis in 1981. When HIV is infected, T cells carrying CD4 protein on the cell surface are dramatically reduced, leading to severe immune damage. It was characterized by multiple opportunistic infections and neoplasias caused by damage to the immune system. Until now, inactivated whole virus vaccines, live recombinant virus vaccines, attenuated viruses vaccines, specific antigen subunits and synthetic peptides have been used to treat AIDS. Many types of vaccines have been developed, including synthetic peptide vaccines and anti-idiotype antibodies. For example, John Sidney, US Pat. No. 5,698,432, inert whole virus vaccine, US Pat. No. 6,004,799 to Luciw et al., Attenuated virus vaccine, US Pat. No. 6,331,404 to Bermann et al., US Pat. No. 6,083,504 to Cotropia, Dolin et al., Ann Intern Med, 114,119-127, (1991) disclose specific peptide vaccines, US Pat. No. 6,139,843 to Rubistein et al. And US Pat. No. 5,817,318 to Sia et al. Synthetic peptide vaccines. These vaccine methods, however, may not only prevent the body's immune response, such as HIV mutating and escape the immune response, but also the risk of infection by attenuating and recovering the pathogenicity of the viral vector administered with the vaccine. Did not indicate the prevention or treatment of AIDS.

In contrast, plasmid DNA, when administered to primates, induces a good humoral and cell-mediated immune response and is particularly important for Th1 (T helper-1) bias, which is known to be important for the defense of viruses such as HIV-1. Immune and CTL responses (Cytotoxic T lymphocyte responses) are known to be effective in small animals, monkeys, chimpanzees and humans. DNA vaccines against AIDS have also been reported in considerable numbers. For example, EP 0276591 discloses a vaccine consisting of a viral vector and recombinant DNA encoding the p25 protein of the AIDS virus. This viral vector is part of the genome of a vector virus; One of the complete gag gene or fragment thereof, in particular the gene encoding the p25 protein of the HIV virus or the gene encoding the p18 protein; And all components which ensure expression of this protein in cells in culture. EP 0572737 discloses a substantially pure HIV antigen characterized by comprising a Gag-Env fusion protein in which the Env peptide is fused at the C-terminus of the Gag polypeptide. French patent 2596771 discloses a portion of the viral genome of AIDS; A gene encoding one of the glycoproteins (gp) of the envelope of the causative virus; And a viral vector comprising components which ensure expression of this glycoprotein in a cell. WO 9927958 discloses AIDS vaccines based on HIV-1 Tat as an immunogen, wherein HIV-1 Tat is administered in the form of DNA and / or recombinant proteins or peptides; Administered alone or in combination with other genes or viral gene products (Nef, Rev, Gag) or portions thereof; It relates to an AIDS vaccine administered in combination with various immunoregulatory cytokines (IL-12, IL-15) or genes encoding immunoregulatory cytokines or portions thereof. In this patent application, Tat, Nef, Rev, Gag and immunomodulatory cytokines are mixtures of recombinant proteins, peptides or fusion proteins (Tat / Nef, Tat / Rev, Tat / Gag, Tat / IL012, Tat / IL-15) or Administered with plasmid DNA.

See also Roger Miller and Nava Sarver, HIV Vif as a Therapeutic Target, DAIDS, NIAID, Sept. 18, 2000, in experiments inoculating vif gene-deficient SIVmac239 in rhesus macaques monkeys, form low levels of antibodies against SIVmac239, and the defective virus exhibits a highly attenuated phenotype. However, monkeys immunized with this vif-deficient SIV could not be defended against infection with wild-type SIV. H. Zhang and L. Qiao, 184 HIV Gag DNA Vaccine, ADIS VACCINE, Foundation for AIDS Vaccine Research and Development, (2001) suggest that mutated Gag induces increased cytotoxic T cells compared to wild-type Gag. have. However, the results were obtained by immunizing mice with DNA vaccines encoding mutated Gag. AIDSWEEKLY Plus, Monday, (AW) Conference Coverage (Retrovirus), March 24, 1997, have shown that Britta Wahren and his colleagues show HIV-1 nef, rev and tat auxiliary genes; p24 structural protein coding gene; And plasmids containing the gp160 envelope precursor glycoprotein coding gene have been shown to induce cellular and humoral anti-HIV immune responses. But the study also involved mice. AIDSWEEKLY Plus, Monday, (AW) Conference Coverage (NCVDG), June 23, 1997, published by Velpandi Ayyavoo and its colleagues naked with the attenuated HIV-1 accessory genes vif, nef, vpr and vpu. ) DNA vaccines have been shown to induce cellular and humoral anti-HIV immune responses. Amara RR, et al., Science 292, 69-74, (2001) include a number of HIV and SIV genes (HIV-1 envelope, tat and rev genes and SIV gag, pol, vif, vpx and vpr genes). A study of immunizing primates with Modified Vaccinia Ankara (MVA) booster vaccine containing genes derived from HIV and SIV along with a DNA vaccine containing DNA is described. This study is a potent vaccine in the rhesus macaque monkey / SHIV model. Induced immune responses show that they regulate viral replication and disease

However, despite the various previous studies, there are still no DNA vaccines reported to be able to successfully prevent or treat AIDS, and new immunogenic plasmids that are continuously improved in terms of expression efficiency and immune efficacy of immunogenic plasmids and Safe DNA vaccines are required.

We have developed immunogenic plasmids with excellent expression efficiency and immunopotency in SIVmac239 / rhesus monkey models and AIDS human patients, and DNA vaccines for preventing or treating AIDS containing them. We have developed two types of vaccine plasmids for AIDS in the preceding study (Korean Patent Publication No. 2001-0054338 and its corresponding US Patent Publication No. 2001004531). The first immunogenic plasmids of these immunogenic plasmids, currently published in the patent application, include gag, dpol (corresponding to proteases) and the env gene and regulatory genes rev from SIVmac239 in the vector pTV2 developed as a base vector for DNA vaccines. However, the accessory genes tat and nef are not included; Another second immunogenic plasmid is Herpes simplex virus (HSV, fused to gene pol encoding Reverse Transcriptase (RT) and Integrase from SIVmac239 to vector pTV2 developed as a base vector for DNA vaccines. Glycoprotein D (gD) signal sequence of Herpes Simplex Virus). These first and second immunogenic plasmids have been developed by the use of auxiliary genes, such as nef and tat, as immunogens, which are known to inhibit and disrupt the immune response of existing AIDS DNA vaccines (Lindemann et al., J. Exp. Med, 179, 797 (1994) and Viscidi, et al., Science, 246, 1606 (1989)) and the disadvantages of not using the gene pol, which contains many CTL epitopes, which are known to be important for protective immunity. It was a supplement. Experimental results showed that these first and second immunogenic plasmids exhibited somewhat better expression efficiency and immunopotency in the SIVmac239 / rhesus monkey model.

However, the present inventors have developed an AIDS DNA vaccine which shows a better effect by improving the above prior invention. One feature of the present invention is the development of pGX10 as a base vector for DNA vaccines. Compared with the vector pTV2, the vector pGX10 has a higher expression intensity through cell infection in vitro and can induce a better immune response in vivo (when immunizing the mouse). In addition, in the present invention, the vectors nef and tat, which are excluded from the previous invention, are designed and manufactured so that only a part of genes are expressed without using all of the genes and are fused with other accessory genes, thereby minimizing and inserting the immune disturbance activity of the accessory genes. Codons were optimized to increase the expression efficiency of the genes, resulting in successful development of immunogenic plasmids and effective and safe DNA vaccines containing them, which show significantly increased expression efficiency and immunological efficacy of immunogens.

In one aspect, the present invention provides the vector pGX10 as a base vector for the preparation of immunogenic plasmids contained in the AIDS DNA vaccine according to the present invention.

In another aspect, the present invention provides an immunogenic plasmid pGX10-SIV / GE contained in the AIDS DNA vaccine composition according to the present invention, which comprises genes gag, dpol and env derived from virus SIVmac239 and auxiliary gene rev. .

In another aspect, the present invention provides a vector pGX10 in which the signal sequence of the secretory protein fused to the gene pol encoding reverse transcriptase (RT) and integrase (INT, Integrase) derived from the virus SIVmac239 and its 3 'end thereof. It provides an immunogenic plasmid contained in the AIDS 백신 DNA vaccine according to the invention, characterized in that it is operatively linked to.

In another aspect, the invention comprises a signal sequence of a secreted protein fused to the gene vif derived from virus SIVmac239 and its 3 'and 5' ends, and a gene nef derived from SIVmac239, according to the present invention. Provided are immunogenic plasmids contained in the AIDS DNA vaccine.

In another aspect, the present invention includes a signal sequence of a secreted protein fused to any of the exon 1 to all sequences of gene tat derived from virus SIVmac239 and its 3 'and 5' ends, and a gene vpx derived from SIVmac239, respectively. It provides an immunogenic plasmid contained in the AIDS 백신 DNA vaccine according to the present invention, characterized in that.

In another aspect, the present invention provides a signal sequence of (i) the gene vif derived from virus SIVmac239 and its secreted protein fused to its 3 'and 5' ends, the gene nef derived from SIVmac239 and (ii) the gene tat derived from SIVmac239, respectively. AIDS DNA vaccine according to the invention, characterized in that it comprises a signal sequence of the secreted protein fused to any one of the exon 1 to the entire sequence of the 3 'and 5' end thereof and the gene vpx derived from SIVmac239 Provided is an immunogenic plasmid.

In another aspect, the present invention comprises the genes gag, protease and env derived from the virus HIV-1 and the auxiliary gene rev, immunogenic plasmid pGX10-HIV / contained in the AIDS DNA vaccine according to the present invention. Provide GE.

As another aspect, the present invention provides that the signal sequence of the reverse transcriptase derived from virus HIV-1, the gene pol encoding integrase, and the secreted protein fused to its 3 'end is operably linked to the vector pGX10. Characterized in that, there is provided an immunogenic plasmid contained in the AIDS DNA vaccine according to the present invention.

As another aspect, the present invention is characterized in that the present invention includes a signal sequence of a secreted protein fused to HIV-1 derived gene vif and its 3 'and 5' ends, and a nef derived from HIV-1. It provides an immunogenic plasmid contained in the AIDS DNA vaccine according to the invention.

In another aspect, the present invention provides a signal sequence of a secreted protein fused to any one of the exon 1 to the entire sequence of gene tat derived from HIV-1 and its 3 'and 5' ends and a gene derived from HIV-1, respectively. It provides an immunogenic plasmid contained in the AIDS DNA vaccine according to the invention, characterized in that it comprises a vpu.

In another aspect, the present invention provides a signal sequence of (i) HIV-1-derived gene vif and its secreted protein fused to its 3 'and 5' ends, and HIV-1-derived gene nef and (ii) HIV- The present invention includes a signal sequence of a secreted protein fused to any one of the exon 1 to the entire sequence of gene tat derived from 1 and its 3 'and 5' ends, and the gene vpu derived from HIV-1. It provides an immunogenic plasmid contained in the AIDS DNA vaccine according to the invention.

In another aspect, the present invention provides an adjuvant plasmid pGX10-hIL-12m, which may be contained in the AIDS DNA vaccine according to the present invention.

In another aspect, the invention provides a signal sequence of (i) the plasmid pGX10-SIV / GE and (ii) the gene pol encoding reverse transcriptase and integrase from virus SIVmac239 and a secreted protein fused to its 3 'end. Provided is a DNA vaccine composition for preventing or treating AIDS, comprising a plasmid operably linked to a vector pGX10.

In another aspect, the present invention is directed to a method comprising: (i) a plasmid comprising genes gag, dpol, env and rev derived from SIVmac239, (ii) a reverse transcriptase derived from SIVmac239 and a gene pol encoding integrase and a 3 'terminus thereof A plasmid containing the signal sequence of the secreted protein, (iii) a plasmid containing the signal sequence of the secreted protein fused to the 3 'and 5' ends of the gene vif derived from SIVmac239 and (v) the SIVmac239 Prevention of AIDS, comprising a plasmid comprising a signal sequence of a secreted protein fused to any of the genes exon 1 to the entire sequence of the gene tat derived from the 3 'and 5' end thereof, and the gene vpx derived from SIVmac239 Or a therapeutic DNA vaccine composition.

In another aspect, the invention provides an antibody comprising (i) a plasmid comprising genes gag, dpol, env and rev derived from SIVmac239, (ii) a plasmid comprising gene pol encoding reverse transcriptase and integrase derived from SIVmac239 and (iii) ( a) a signal sequence of a gene vif derived from SIVmac239 and a glycoprotein fused to its 3 'and 5' ends, a gene nef derived from SIVmac239, and (b) an exon 1 to all sequences of gene tat derived from SIVmac239, and It provides a DNA vaccine composition for preventing or treating AIDS, comprising a plasmid comprising a vpx gene derived from SIVmac239 fused to its 5 'end.

In another aspect, the invention provides a signal of (i) the plasmid pGX10-HIV / GE and (ii) the gene pol encoding reverse transcriptase and integrase derived from virus HIV-1 and a secreted protein fused to its 3 'end. It provides a DNA vaccine composition for preventing or treating AIDS, characterized in that the sequence comprises a plasmid operably linked to the vector pGX10.

In another aspect, the invention provides an antibody comprising (i) a plasmid comprising genes gag, dpol, env and rev derived from HIV-1, (ii) a gene pol encoding reverse transcriptase and integrase derived from HIV-1 and its 3 ' A plasmid containing the signal sequence of the secreted protein fused at the end, (i) the gene vif derived from HIV-1 and the signal sequence of the secreted protein fused at the 3 'and 5' ends thereof and the nef derived from HIV-1, respectively The plasmid containing the gene and the signal sequence of the secreted protein fused to any one of the exon 1 to all sequences of the gene tat derived from HIV-1 and its 3 'and 5' ends, and the vpu derived from HIV-1, respectively. It provides a DNA vaccine composition for preventing or treating AIDS comprising a plasmid comprising a.

In another aspect, the present invention provides a plasmid comprising (i) a plasmid comprising genes gag, dpol, env and rev derived from HIV-1, (ii) a plasmid comprising gene pol encoding reverse transcriptase and integrase derived from HIV-1; (Iii) the signal sequence of (a) the gene vif derived from HIV-1 and its glycine protein fused to its 3 'and 5' ends, and the nef derived from HIV-1 and (b) the gene tat derived from HIV-1, respectively. It provides a DNA vaccine composition for preventing or treating AIDS, comprising a plasmid comprising the gene vpu derived from HIV-1 fused to any one of the exon 1 to the entire sequence and its 5 'end.

As noted earlier, there are many reports of observations of the protective effect against AIDS virus in monkeys. In order to confirm the efficacy of a certain vaccine substance in a primate model, it is tested to protect various species of monkeys by infecting them with a variety of viruses. The type of monkeys used (chimpanzee, monkey) and the type of infected virus (HIV-1, HIV) are tested. -2, SHIV, SIVmne, SIVmac), several models exist. Some are very easy to induce defenses, and some models do not induce AIDS. As a result, the model is classified into (1) the extent of viral proliferation and disease induction, and (2) the degree of induction of defense.

A typical model for inducing AIDS in monkeys is known to infect the monkey with the virus SHIV89.6P. However, this model uses (1) artificially recombined viruses, (2) leads to abnormally fast CD4 drop and death, and (3) not only symptoms of disease caused by immunodeficiency, but also the infection itself. (4) Although this model is a very recently developed model unlike SIVmac239, it has been reported that many successful cases such as attenuated virus, DNA, and recombinant viral vectors have been published. I think it's easier than a monkey model. However, when the attenuated virus is used as a vaccine, the attenuated virus has a safety problem because it can be transmitted to the virus causing the disease. As another example, experiments have been made to protect against immunization with DNA and blood infection of the virus SIVmac251, but have not succeeded in defense (causing monkey CD4 reduction and death).

The present invention uses a model to find out whether a DNA vaccine can be administered and the virus SIVmac239 can be protected by blood infection in rhesus macaque monkeys. Virus SIVmac239 is subjected to two in vivo passages of virus SIVmac251, with very similar sequences, virulence, pathology and the like. DNA vaccines that have shown protective efficacy against blood infections of the virus SIVmac239 are currently unknown. This model is characterized by the induction of AIDS, the path of viral infection, immunological markers after infection (CD4 numbers, CD29 + CD4 + T cells), and the peak of viral titers in humans. Is similar. For this reason, the model used in the present invention is also used in studies to find out the nature of the immune defense against HIV-1 in humans, namely what immune response should be induced to protect against HIV-1 infection. The disadvantage is that AIDS appears and dies faster than people. However, this can work advantageously as an experimental model in that the result can be known quickly. Another feature of this model is that the vaccines that have been successful in this model are difficult to defend, as they have only been known to be immunized with the attenuated virus.

The present invention has developed a DNA vaccine that can successfully defend against blood infection of virus SIVmac239. A successful defense concept in the field of vaccines is that when a virus is infected after administration of the vaccine, (1) if no proliferation of the virus is found and eliminated (inducing sterilizing immunity), (2) at the beginning of the infection (3) If the growth of the virus appears but is subsequently eliminated (of course, no disease occurs), (3) the growth of the virus is suppressed for a long time and the disease has not occurred (no transmission), and (4) he gradually But it can keep viral titers low and only prevent transmission. The protective efficacy of the DNA vaccine developed in the present invention in rhesus macaque monkeys corresponds to the cases (2) and (3) above.

It is believed that the DNA vaccine of the present invention was able to successfully defend against blood infection of virus SIVmac239 in the development of good vaccine vectors, codon optimization and effective use of codon (regulator) genes. The vector pGX10 developed as an aspect in the present invention improves on the vector pTV2 and the known vector pTX (Lee AH, et al., Vaccine 1999, 17: 473-9) previously developed by the present inventors. In vitro expression was not only high (10 times of vector pTV2) but also excellent in vivo (induced 10 times antibody response of vector pTX). In addition, the immunogenic plasmid used in the DNA vaccine of the present invention is a signal sequence of a secreted protein, for example, a gene in which the signal sequence of gD (glycoprotein D) of herpes simplex virus (HSV) is fused thereto. Because it has been found to increase the expression level of and increase the immune response (especially cellular immune response) in vivo (Lee et al., J. Virol 72 (10), 8430-36 (1998); HCV structural genes ( In the DNA immunization of ST) we observed an increase in CTL response compared to the immunization of ST DNA), gene pol and co-regulatory genes were fused with the signal sequence of the secreted protein to optimize codons. In addition, cogenes were effectively used in the immunogenic plasmids used in the DNA vaccine of the present invention. That is, the genes gag, pol and env genes, as well as the cogenes vif, nef, tat and vpx, which were used previously, were used for immunization. Specifically, the gene vpr in the supplementary genes was not known to have an immunosuppressive effect (Ayyavoo V., et al., Int Immunol., 14 (1), 13-22 (2002)), and the immunosuppressive effect was not used. Genes nef and tat, which have not been used in the past and are expected to be present, are prepared by (a) fusion with different accessory genes vif and vpx, respectively, to reduce immunodisruptive activity, and in some cases (b) genes nef and Only part of each sequence was used without using the full length of tat.

Definition of Terms

Unless otherwise defined in the present invention, all technical and scientific related terms have the meaning commonly used in the technical field to which the present invention belongs. The following terms are defined as follows to clarify their meaning.

As used herein, the term "vector" refers to a DNA molecule as a carrier that can stably transport foreign genes into a host cell. To be a useful vector, it must be replicable, have a way to enter the host cell, and have a means to detect its presence. Here, the foreign genes correspond to, for example, SIVmac239 and HIV structural and auxiliary genes.

As used herein, the term "plasmid" generally refers to a circular DNA molecule formed operably linked to a vector such that a foreign gene can be expressed in a host cell. However, the plasmid can be used as a vector which is degraded by specific restriction enzymes and introduces a new gene by gene recombination to construct a plasmid containing the gene of interest. Thus, plasmids and vectors are used interchangeably herein, and those skilled in the art of genetic engineering will fully understand their meanings even if they do not distinguish their names.

As used herein, the term "immunogenic plasmid" refers to a circular DNA molecule that induces antigen-specific humoral and cell-mediated immune responses, including genes encoding antigens.

As used herein, the term "adjuvant plasmid" refers to a circular DNA molecule that expresses an immunomodulatory molecule to increase antigen-specific humoral and cell-mediated immune responses induced by an immunogenic plasmid.

As used herein, the term “structural gene” refers to the genes encoding the structural proteins of SIVmac239 and HIV-1, gag, env and pol. The products of the gene gag are proteins with molecular weights of 55,000 (p55), 24,000 (p24), 17,000 (p17) and 15,000 (p15) daltons, and the p55 antigen is a precursor that is produced early in infection and divided into other core proteins. Gag protein is present in the viral inner nucleocapsid, which forms the substrate between the core and the envelope and is embedded in the inner region of the envelope. p24 and p15 proteins make up a core coat surrounding the nucleic acid. The product of the gene env is a glycoprotein having a molecular weight of 160,000 (gp160), 120,000 (gp120) and 41,000 (gp41) daltons. gp160 is a precursor to the envelope glycoproteins gp120 and gp41 and is not a component of the virus. gp41 is called the transmembrane protein because it exists between the inner and outer membranes. gp120 is composed of 72 protrusions (knobs) present in the outer shell. gp41, in conjunction with gp120, is involved in binding to the CD4 molecule of the host cell. The products of gene pol include p66, p51 (reverse transcriptase), and p31 (integrase or endonuclease) proteins. The polymerase component acts as a reverse transcription of RNA into DNA, the integration of viral DNA into cellular DNA, and the division of precursors into smaller active substances. The polymerase antigen is present in association with the nucleic acid inside the core. gp160 and p55 are precursors, which are released into the blood during virus replication to form antibodies, so serological assays can detect antibodies against these precursors. In the present invention, the structural gene pol in the first immunogenic plasmid uses only the nucleotide sequence corresponding to the protease, not the entire nucleotide sequence, and a part thereof is represented by dpol. In addition, the second immunogenic plasmid includes only the nucleotide sequence encoding the reverse transcriptase and integrase, including the structural gene pol, but not using the entire nucleotide sequence, which is indicated herein as RT-INT. The RT-INT moiety can be optionally mutated.

As used herein, the term "regulatory gene" or "assistant gene" refers to the genes nef, vpr, vpu, tat, rev and vif, which encode regulatory proteins of SIVmac239 and HIV-1. The products of these regulatory genes act to alter the expression of viral proteins and the replication of the virus and to regulate the infectivity of the virus. Their exact role is unknown, but tat (p14) usually has transcriptional activity, rev (p19 / 20) regulates viral mRNA expression, and nef (p27) is involved in the inhibition of CD4 receptors and T cell activity. Vif (p23) increases virus infectivity, vpr (p15) supports virus replication, vpu (p16) is involved in virus release, and vpx (p15) is virus infected Affect ability However, the present invention does not specifically use vpr among the regulatory genes.

As used herein, the term "operably linked" refers to an arrangement of components formed such that each component of the plasmid or vector can have a unique function. Thus, a control sequence operably linked to a coding sequence can affect the expression of the coding sequence. The regulatory sequence need not be contiguous with the coding sequence as long as the regulatory sequence acts to direct expression of the coding sequence. For example, an intervening sequence may be present between the promoter sequence and the coding sequence, in which case the promoter sequence may be said to be "operably linked" to the coding sequence.

Vector pGX10

We have developed a base vector for immunogenic plasmids contained in AIDS DNA vaccines and named it pGX10. Vector pGX10 (SEQ ID NO: 60) of the present invention is SV40 ori, simian virus 40 replica, cytomegalovirus (CMV) initial promoter / enhancer sequence, adenovirus triple leader sequence (TPL) as shown in FIGS. ), Multi-cloning site (MCS), simian virus 40 polyadenylation sequence (SV40PA), simian virus 40 enhancer sequence (SV40Eh), and ColE1 Ori and kanamycin resistance gene (KanR) to allow plasmids to grow in E. coli It is a novel vector of 3.6 kb that contains a plurality of specific restriction sites.

The vector pGX10 of the present invention is a known vector, as described and illustrated in detail in Example 1 and FIG. 1, ie, the pTX (Lee AH, et al., Vaccine 17: 473-9, (1999) previously published by the present inventors. PTV2 vectors (Lee, et al., J Virol. 72,8430 (1998) and Cho, et al., Which were prepared on the basis of)) and have already been used as DNA vaccine vectors in small animal studies. Vaccine 17,1136 (1999)) can be prepared by known methods using the starting vector, and for the purpose of patenting was deposited with accession number 10212BP to KCTC on March 29, 2002 under the Budapest Convention. The deposit is named pGX10 / XL1blue but it is the same vector as pGX10. On the other hand, it will be apparent to those skilled in the art that the type of promoter and the type and length of the glycoprotein signal sequence may be variously modified according to the purpose of the present invention. For example, the promoter may be a viral promoter RSV promoter, a cellular promoter EF1, MCK (muscle specific promoter), LCK (T cell specific promoter) can be used, in the case of glycoprotein VZV (varicella zoster virus) ) gB, human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus outer capsid glycoprotein (VTA), VP7 and the like.

The vector pGX10 of the present invention is an improvement of the known vectors pTX and pTV2 as described above, not only has a high in vitro expression level (10 times of pTV2-see FIG. 18) but also shows excellent immune response in vivo. The vector pGX10 of the present invention induces a 10-fold antibody response of pTX and pGX10-HIV / RT (reverse transcriptase) has been shown to produce a 10-fold anti-RT antibody to pTX10-HIV / RT (data not shown). The known vector pTV2 is disclosed in Korean Patent Publication No. 2001-0054338 (July 02, 2001) and its corresponding US Patent Publication No. 2001004531 (June 21, 2001).

SIV immunogenic plasmids

According to the present invention, four kinds of immunogenic plasmids were basically constructed for use as AIDS DNA vaccines to confirm its efficacy in rhesus macaque monkeys:

1) Protease among gene gag encoding matrix protein (MA), capsid protein (CA) and nucleocapsid protein (NC) derived from virus SIVmac239, gene pol from virus SIVmac239 ) Nucleotides dpol encoding the gene env encoding the envelope protein derived from the virus SIVmac239 and a regulatory gene rev encoding the protein Rev derived from the virus SIVmac239 operably linked to the vector pGX10. Immunogenic plasmids (hereinafter may be abbreviated as “first SIV immunogenic plasmids”);

2) The signal sequence of the gene pol encoding reverse transcriptase (RT) and integrase (INT, Integrase) derived from the virus SIVmac239 and the secreted protein fused to its 3 'end is operably linked to the vector pGX10. Immunogenic plasmids characterized as follows (hereinafter abbreviated as "second SIV immunogenic plasmid");

3) An immunogenic plasmid comprising the signal sequence of the vif gene from virus SIVmac239 and a secreted protein fused to 3 'and 5', respectively, and the gene nef from SIVmac239 (hereinafter referred to as "third SIV immunogenic plasmid"). May be abbreviated as "); And

4) Immunogenicity, comprising the signal sequence of the secreted protein fused to any of the genes exon 1 to the entire sequence of gene tat derived from virus SIVmac239 and its 3 'and 5' ends, respectively, and vpx from SIVmac239. Plasmid (hereinafter may be abbreviated as “fourth SIV immunogenic plasmid”).

(1) first SIV immunogenic plasmid

The gene gag, dpol (protease) and env of the virus SIVmac239 and the env and auxiliary genes rev are introduced into the multi-cloning site (MCS) of the vector pGX10 according to the present invention, thus showing the present invention for the SIVmac239 / Resus macaque monkey model. The new immunogenic plasmid of 8.7 kb is used for the DNA vaccine of the invention. Detailed construction of this plasmid is described in Example 2 and FIG. 5 and named pGX10-SIV / GE. This plasmid was deposited with the International Deposit Organization KCTC on accession number 10215BP on March 29, 2002 under the Budapest Convention for the purpose of patenting. The deposit is named pGX10-SIV / GE / XL1blue but it is the same vector as pGX10-SIV / GE.

The plasmid pGX10-SIV / GE of the present invention is disclosed and pending in Korean Patent Application Publication No. 2001-0054338 (July 02, 2001) and its corresponding US Patent Publication No. 2001004531 (06, 2001). Excellent expression efficiency compared to the 10.0 kb immunogenic plasmid pTV-SIV / GE claimed on (21 March). FIG. 31 demonstrates this with Western blotting pictures of pGX10-SIV / GE and pTV-SIV / GE.

(2) second SIV immunogenic plasmid

To the multi-cloning site of the vector pGX10 according to the present invention, a reverse transcriptase derived from virus SIVmac239, a gene pol encoding integrase, and a signal sequence of a secreted protein fused to its 3 'end are introduced. In addition, the AIDS DNA vaccine of the present invention forms a second SIV immunogenic plasmid, which is contained together with the first SIV immunogenic plasmid.

In one preferred embodiment of the invention, the pol gene can be mutated to inhibit the enzymatic activity of integrase. This use of the mutant gene can increase safety by lowering the very low risk of producing a proliferative virus in the subject after administration of the DNA vaccine. For example, since the base sequence 5130-5135 site of the integrase site is known as an important site for the enzymatic activity of integrase (corresponding to Asp 116, Fields Virology Third edition p1893, Lippincott-Raven Co., 1996), the host cell In order to prevent proliferation in the region of the base sequence 5130-5135 can be modified to inhibit the activity of integrase. Specifically, the integrase sequence 5130-5132 is deleted and / or the integrase sequence 5133-5135 is replaced with a serine codon. That is, it was mutated to express Ser117 instead of Asn117. In their own experiments, the modified SIVmac239 virus did not proliferate further in the host cell. The position number of the nucleotide sequence was according to the SIVmac239 clone (Fig. 4) of GenBank Accession Number M33262.

In addition, the method of inhibiting the activity of integrase is to modify the sequence where Asp116 and other Asp64 and Glu152 are conserved, and these amino acids are divalent metal ions at the active site. (E.g., Mg2 +) is known to stabilize the transition state. For HIV-1 integrase His12, His16, Cys40, Cys43 are important amino acids for constructing DNA-binding structures (metal-finger) (Field virology, p1893).

The signal sequence of the secreted protein is fused to the 3 'end of the reverse transcriptase derived from virus SIVmac239 and the gene pol (indicated by RT-INT in Fig. 6) encoding integrase. This fusion increases the expression intensity of reverse transcriptase and integrase by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned.

In one embodiment, the integrase-coding gene pol, which has a reverse transcriptase derived from virus SIVmac239 and a nucleotide sequence 5130-5132, is substituted in the multicloning region of the vector pGX10 according to the present invention, and the nucleotide sequence 5133-5135 is substituted with a serine codon. The signal sequence of the glycoprotein D (gD) of the herpes simplex virus (HSV) fused to the 3 'end is introduced to operably link to form a 6.3 kb second SIV immunogenic plasmid formed. . The gene pol is fused with a signal sequence encoding the N-terminal 33 amino acids of gD of HSV at its 3 'end to be subjected to direct transcriptional regulation of the CMV promoter, thereby increasing the expression intensity of reverse transcriptase and integrase. This plasmid is a 8.7 kb second SIV immunogenic plasmid used in the DNA vaccine of the present invention for the SIVmac239 / Resus macaque monkey model, the detailed construction process of which is described in Example 3 and FIG. 6, pGX10-. It was named SIV / dpol. This plasmid was also deposited with the International Depository KCTC on accession number 10214BP on March 29, 2002 under the Budapest Convention for patent purposes. The deposit is named pGX10-SIV / dpol / XL1blue but it is the same vector as pGX10-SIV / dpol.

On the other hand, in addition to the above, other mutation methods, types of promoters, types and lengths of glycoprotein signal sequences, etc. may be variously modified according to the purpose of the present invention as described above, and such modifications will be apparent to those skilled in the art.

The plasmid pGX10-SIV / dpol of the present invention is a 10.0 kb immunogenic plasmid pTV-SIV / dpol as claimed in Korean Patent Publication No. 2001-0054338 and its corresponding US Patent Publication No. 2001004531 filed and pending by the inventors. Better in expression efficiency compared to (data not shown).

(3) third SIV immunogenic plasmid

According to the present invention, a plasmid in which the signal sequence of the secreted protein fused to the gene vif derived from virus SIVmac239 and its 3 'and 5' ends and the gene nef derived from SIVmac239 are operably linked to the vector is constructed. The vector may be a mammalian cell expression vector, and is preferably a DNA vaccine vector that is expressed in muscle cells, DCs, T cells, etc. and optimized to induce an immune response. More preferred vectors are vectors with a CMV promoter and optionally with a TPL sequence SV40 pA. Specific examples of vectors that may be used in the present invention include, but are not limited to, pGX10 and pTV2, as well as pVAX1, pRC / CMV, pREP4 and pREP10 (including but available RSV promoters), pcDNA1, pcDNA1.1, pcDNA3 from Invitrogen, pcDNA3 / CAT, pRC / CMV and pRC / CMV2, pCMV-script from Stratagene and pSI, pCI and pCI-neo from Promega. Most preferred is pGX10.

The plasmid thus constructed is delivered with the first SIV immunogenic plasmid pGX10-SIV / GE and the second SIV immunogenic plasmid (eg pGX10-SIV / pol) of the present invention so that the first and second SIV immunogenic plasmids are Increase the protective effect of inducing.

In addition, the third SIV immunogenic plasmid may comprise the first SIV immunogenic plasmid pGX10-SIV / GE, the second SIV immunogenic plasmid (eg pGX10-SIV / dpol) and the fourth SIV immunogenic plasmid (eg, and pGX10-SIV / TV) to increase the protective efficacy induced by the first and second SIV immunogenic plasmids.

In one preferred embodiment of the invention, the auxiliary gene vif from virus SIVmac239 and the auxiliary gene nef from SIVmac239 fused to its 5 'end are modified to prevent immunosuppressive effects that may be caused by their immuno disturbance action. Can be. Such modification methods can vary considerably, for example, Ser114-Leu150, etc. can be modified in Vif (Fields Virology Third edition, p1901, Lippincott-Raven Co., 1996), and Nef, along with Arg137 and Arg138, Gly2 (preliminary). Involvement of sterilization) may be modified.

The signal sequence of the secreted protein is fused to the 3 'end of the auxiliary gene vif derived from the virus SIVmac239. This fusion increases the expression intensity of the proteins Vif and Nef by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned.

In one embodiment, the MCS of the vector pGX10 according to the present invention is introduced so as to operably link the signal sequence of the gene vif of SIVmac239 and the gD of HSV fused to its 3 'and 5' ends with the gene nef derived from the modified SIVmac239, respectively. One new 5.1 plasmid was constructed. This plasmid is the third SIV immunogenic plasmid used in the DNA vaccine of the invention against the SIVmac239 / Resus macaque monkey model, the detailed construction process of which is described in Example 4 and FIG. 7 and pGX10-SIV / VN. Was named. This plasmid was also deposited under the Budapest Convention on March 29, 2002 under the name of the International Depository KCTC under Accession No. 10213BP for the purposes of the patent. The deposit is named pGX10-SIV / VN / XL1blue but it is the same vector as pGX10-SIV / VN.

Specifically, the third SIV immunogenic plasmid pGX10-SIV / VN includes a gene (expressed as VN) that binds gene vif and nef derived from SIVmac239 and is also used for down regulation activity of CD4 of gene nef. The genes corresponding to Arg137 and Arg138, which are known to be important (J. Biol. Chem. 270: 15307, 1995), were removed to prevent the immunosuppressive effects of nef proteins. In other words, it is intended to increase Vif-Nef fusion expression intensity by fusing the signal sequence encoding the N-terminal 33 amino acids of gD of HSV to the 5 'end of gene VN and undergoing direct transcriptional regulation of CMV promoter.

On the other hand, in addition to the above, the mutation method, the type of promoter, the type and length of the glycoprotein signal sequence and the like can be variously modified according to the purpose of the present invention as described above and these modifications will be apparent to those skilled in the art.

(4) a fourth SIV immunogenic plasmid

According to the present invention, a signal sequence of a secreted protein fused to the gene of any one of exon 1 to the entire sequence of gene tat derived from virus SIVmac239 and its 3 'and 5' ends and the gene vpx derived from SIVmac239 are operably linked to the vector. Linked plasmids are constructed. The vector may be a mammalian cell expression vector, and is preferably a DNA vaccine vector that is expressed in muscle cells, DCs, T cells, etc. and optimized to induce an immune response. More preferred vectors are vectors with a CMV promoter and optionally with a TPL sequence SV40 pA. Specific examples of vectors that may be used in the present invention include, but are not limited to, pGX10 and pTV2, as well as pVAX1, pRC / CMV, pREP4 and pREP10 (including but available RSV promoters), pcDNA1, pcDNA1.1, pcDNA3 from Invitrogen, pcDNA3 / CAT, pRC / CMV and pRC / CMV2, pCMV-script from Stratagene and pSI, pCI and pCI-neo from Promega. Most preferred is pGX10.

The plasmid thus constructed is delivered with the first SIV immunogenic plasmid pGX10-SIV / GE and the second SIV immunogenic plasmid (eg pGX10-SIV / dpol) of the present invention so that the first and second SIV immunogenic plasmids are Increase the protective effect of inducing. In addition, the plasmids thus constructed include the first SIV immunogenic plasmid pGX10-SIV / GE, the second SIV immunogenic plasmid (eg pGX10-SIV / dpol) and the third SIV immunogenic plasmid (eg pGX10-) of the present invention. SIV / VN) to increase the protective efficacy induced by the first and second SIV immunogenic plasmids.

The gene tat from SIVmac239 can be used in its entire sequence, but it is preferable to use a modified one due to the immuno disturbance action of the gene. The modifiable range of gene tat includes all sites other than exon 1. Exon 1 also has tat enzyme potency (immunosuppression), but has a disadvantage that it is lower than exon 1 + exon 2 and the immune epitope in exon 2 cannot be used. Thus, most preferably the gene tat is to use only exon 1 site.

At the 3 'end of the auxiliary gene tat from virus SIVmac239, the signal sequence of the secreted protein is fused. This fusion increases the expression intensity of the proteins Tat and Vpx by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned.

In one embodiment, the MCS of the vector pGX10 according to the present invention operably comprises a signal sequence of gD of HSV fused to exon 1 of the gene tat of SIVmac239 and its 3 'and 5' ends, and a modified vIV derived from SIVmac239. Another novel plasmid of 4.3 kb introduced to be linked is constructed. This plasmid is the fourth SIV immunogenic plasmid used in the DNA vaccine of the present invention for the SIVmac239 / Resus macaque monkey model, the detailed construction process of which is described in Example 5 and FIG. 8 and described with pGX10-SIV / TV. Named. This plasmid was also deposited with the International Depository KCTC on accession number 10216BP on March 29, 2002 under the Budapest Convention for the purpose of patenting. The deposit is named pGX10-SIV / TV / XL1blue but it is the same vector as pGX10-SIV / TV.

Specifically, the fourth SIV immunogenic plasmid pGX10-SIV / TV of the present invention includes a gene (expressed as TV) in which exon 1 and vpx genes of gene tat of SIVmac239 are fused. In other words, a signal sequence encoding the N-terminal 33 amino acids of gD of HSV was fused to the 5 'end of gene TV.

Meanwhile, mutation methods other than the above, types of promoters, types and lengths of glycoprotein signal sequences, etc. may be variously modified according to the purpose of the present invention as described above, and these modifications will be apparent to those skilled in the art.

(5) immunogenic plasmids with auxiliary genes vif, nef, tat and vpx from SIVmac239

In a preferred embodiment of the present invention, (i) the signal sequence of the gene vif derived from SIVmac239 and its secreted protein fused to its 3 'and 5' ends, and the gene nef derived from SIVmac239 and (ii) the gene tat derived from SIVmac239, respectively. A plasmid is constructed in which a signal sequence of a secreted protein fused to either the gene of exon 1 to the whole sequence and its 3 'and 5' ends, and a gene vpu derived from HIV-1 are operably linked to one vector. Specific examples of vectors that may be used in the present invention include, but are not limited to, pGX10 and pTV2, as well as pVAX1, pRC / CMV, pREP4 and pREP10 (including but available RSV promoters), pcDNA1, pcDNA1.1, pcDNA3 from Invitrogen, pcDNA3 / CAT, pRC / CMV and pRC / CMV2, pCMV-script from Stratagene and pSI, pCI and pCI-neo from Promega. Most preferred is pGX10. The plasmid thus constructed is delivered with the first SIV immunogenic plasmid pGX10-SIV / GE and the second SIV immunogenic plasmid (eg pGX10-SIV / pol) of the present invention so that the first and second SIV immunogenic plasmids are Increase the protective effect of inducing. In addition, such immunogenic plasmids are advantageous for cost reduction because they can reduce the number of plasmids to be prepared for DNA vaccines.

In one preferred embodiment of the invention, the auxiliary gene vif from virus SIVmac239 and the auxiliary gene nef from SIVmac239 fused to its 5 'end are modified to prevent immunosuppressive effects that may be caused by their immuno disturbance action. Can be. Such modification methods can vary considerably, for example, Ser114-Leu150, etc. can be modified in Vif (Fields Virology Third edition, p1901, Lippincott-Raven Co., 1996), and Nef, along with Arg137 and Arg138, Gly2 (preliminary). Involvement of sterilization) may be modified.

In another preferred embodiment, the gene tat from SIVmac239 can be used with the entire sequence, but it is preferred to use a modified one due to the immuno disturbance action of this gene. The modifiable range of gene tat includes all sites other than exon 1. Exon 1 also has tat enzyme potency (immunosuppression), but has a disadvantage that it is lower than exon 1 + exon 2 and that the immune epitope in exon 2 cannot be used. Thus, most preferably the gene tat is to use only exon 1 site. The genes nef and tat as described above may each be modified independently. For example, the gene nef may be modified without altering only the gene tat, the gene tat without altering the gene nef, or both the gene net and tat may be modified.

At each 3 'end of the auxiliary genes vif and tat derived from the virus SIVmac239, the signal sequence of the secreted protein is fused respectively. This fusion increases the expression intensity of the proteins Vif and Nef by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned. The signal sequences fused to the 3 'end of the accessory genes vif and tat may be the same or different from each other.

In one embodiment, the signal sequence of the gene vif of SIVmac239 and the gD of HSV fused to the 3 'and 5' ends thereof, respectively, to the MCS of the vector pGX10 according to the present invention and the modified gene nef derived from SIVmac239 (corresponding to Arg137 and Arg138) A signal sequence of gD of HSV and a signal sequence from gV of HSV fused to exon 1 of gene tat of SIVmac239 and its 3 'and 5' ends, respectively, to a third SIV immunogenic plasmid in which codons are deleted to operably link mutations). Another new 7.5 kb immunogenic plasmid was constructed in which the gene vpx was operably linked. This constructed plasmid corresponds to the third SIV immunogenic plasmid used with the first and second SIV immunogenic plasmids in the DNA vaccine of the invention for the SIVmac239 / Resus macaque monkey model. Its detailed construction process is described in Example 6 and FIG. 9 and named pGX10-SIV / VNTV.

In another embodiment, the signal sequence of gD of HSV fused to exon 1 of gene tat of SIVmac239 and its 3 'and 5' ends to the MCS of vector pGX10 according to the present invention so as to operably link the gene vpx derived from SIVmac239 7.5 kb of the introduced viv of the SIVmac239 gene vif, the signal sequence of gD of HSV fused to its 3 'and 5' ends, and the modified gene nef derived from SIVmac239 into the fourth SIV immunogenic plasmid. Another novel immunogenic plasmid is constructed. This constructed plasmid corresponds to the third SIV immunogenic plasmid used with the first and second SIV immunogenic plasmids in the DNA vaccine of the invention for the SIVmac239 / Resus macaque monkey model. Its detailed construction process is described in Example 7 and FIG. 10 and named pGX10-SIV / TVVN.

Meanwhile, mutation methods other than the above, types of promoters, types and lengths of glycoprotein signal sequences, etc. may be variously modified according to the purpose of the present invention as described above, and such modifications will be apparent to those skilled in the art.

It is believed that the present invention will be effective even in human HIV-1 infection. HIV-1 and SIV are lentiviruses, but the structure and function of the constituent genes are not completely identical, but they are very similar. Also, genes such as gag have high homology with HIV and SIV, and polyclonal antibodies against gag cross-reactive with each other. And most of all, the pattern of HIV-induced human infection is similar to that of SIV after monkey infection. For this reason, it can be expected to have similar efficacy when used as a model and the SIV gene is replaced with HIV. Of course, there is no guarantee that the evaluation in the SIVmac / monkey model is perfect for humans, since there have been no AIDS vaccines in humans so far. Humans have their own factors, so substances that are effective in primate models, such as the SIVmac239 / monkey model, can be ineffective in humans. However, this method (using a primate model) is an effective way to reduce the risk in clinical trials by evaluating candidates prior to examining the vaccine's efficacy in humans (clinical trials), and has shown excellent efficacy in non-primate models such as mice and cats. It is easy to anticipate that what is shown to be superior in primates is likely to apply to humans.

HIV immunogenic plasmids

Four types of immunogenic plasmids were constructed essentially for use as AIDS DNA vaccines to confirm their efficacy in humans according to the present invention:

1) The gene gag, which encodes a matrix protein (MA), capsid protein (CA), and nucleocapsid protein (NC) derived from the virus HIV-1, encodes a protease in gene pol An nucleotide sequence region dpol and a gene env encoding an envelope protein and a regulatory gene rev encoding a protein HIV-derived Rev are operatively linked to the vector pGX10. Original plasmids (hereinafter may be abbreviated as “first HIV immunogenic plasmids”);

2) The signal sequence of the gene pol encoding reverse transcriptase (RT) and integrase (INT) derived from the virus HIV-1 and the secreted protein fused to its 3 'end is operably linked to the vector pGX10. Immunogenic plasmids characterized by conjugation (hereinafter may be abbreviated as “second HIV immunogenic plasmid”);

3) An immunogenic plasmid comprising a signal sequence of a secreted protein fused to 3 'and 5' of vif gene derived from virus HIV-1 and nef derived from HIV-1 (hereinafter referred to as "third HIV"). Immunogenic plasmid "may be abbreviated); And

4) a signal sequence of a secreted protein fused to either one of the exon 1 to the entire sequence of the gene tat derived from the virus HIV-1 and its 3 'and 5' ends and the vpu derived from HIV-1 Characterized immunogenic plasmid (hereinafter may be abbreviated as "fourth HIV immunogenic plasmid").

(1) first HIV immunogenic plasmid

The genes gag, dpol (protease) and env of viral HIV and activating gene rev are introduced into the multi-cloning site (MCS) of the vector pGX10 according to the present invention, thereby providing a DNA vaccine of the present invention for AIDS human patients. A new immunogenic plasmid of 8.7 kb used is formed. Detailed construction of this plasmid is described in Example 8 and FIG. 11 and named pGX10-HIV / GE.

The plasmid pGX10-HIV / GE of the present invention is disclosed and pending in Korean Patent Application Publication No. 2001-0054338 (July 02, 2001) and its corresponding US Patent Publication No. 2001004531 (06, 2001). The expression efficiency and immunogenicity are superior to the immunogenic plasmid pTV-HIV / GE of 11.0 kb, claimed on March 21).

(2) the second HIV immunogenic plasmid

Introduced to the multi-cloning site of the vector pGX10 according to the present invention such that the reverse transcriptase derived from virus HIV-1, the gene pol encoding integrase, and the signal sequence of the secreted protein fused to its 3 'end are operably linked. Characterized in that, the AIDS DNA vaccine of the present invention forms a second HIV immunogenic plasmid, which is contained together with the first HIV immunogenic plasmid.

In one preferred embodiment of the invention, the pol gene can be mutated to inhibit the enzymatic activity of integrase. This use of the mutant gene can increase safety by lowering the very low risk of producing a proliferative virus in the subject after administration of the DNA vaccine. For example, since the base sequence 5130-5135 site of the integrase site is known as an important site for the enzymatic activity of integrase (corresponding to Asp 116, Fields Virology Third edition p1893, Lippincott-Raven Co., 1996), the host cell In order to prevent proliferation in the region of the base sequence 5130-5135 can be modified to inhibit the activity of integrase. Specifically, the integrase sequence 5130-5132 is deleted and / or the integrase sequence 5133-5135 is replaced with a serine codon. That is, it was mutated to express Ser117 instead of Asn117. In their own experiments, the modified HIV-1 virus did not proliferate further in host cells. The position number of the base sequence was according to the HIV-1 JR-CSF clone of GenBank Accession Number M38429.

In addition, the method of inhibiting the activity of integrase is to modify the sequence where Asp116 and other Asp64 and Glu152 are conserved, and these amino acids are divalent metal ions at the active site. (E.g., Mg2 +) is known to stabilize the transition state. In addition, His12, His16, Cys40, and Cys43 are amino acids that are important for constructing a DNA-binding structure (metal-finger) (Field virology, p1893), and can be achieved by modifying them.

The signal sequence of the secreted protein is fused to the 3 'end of the gene pol (represented by RT-INT in the figure) encoding a reverse transcriptase derived from viral HIV and integrase. This fusion increases the expression intensity of reverse transcriptase and integrase by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned.

In one embodiment, the integrase-coding gene pol in which the multi-cloning site of the vector pGX10 according to the present invention is deleted from the reverse transcriptase derived from the virus HIV-1 and the nucleotide sequence 5130-5132, and the nucleotide sequence 5133-5135 is substituted with a serine codon. And a 6.2 kb second HIV immunogenic plasmid formed by introducing a signal sequence of a glycoprotein D (gD) of the herpes simplex virus (HSV) fused to its 3 'end to be operably linked. Form. The gene pol is fused with a signal sequence encoding the N-terminal 33 amino acids of gD of HSV at its 3 'end to be subjected to direct transcriptional regulation of the CMV promoter, thereby increasing the expression intensity of reverse transcriptase and integrase. This plasmid is the second HIV immunogenic plasmid used in the DNA vaccine of the present invention for the SIVmac239 / Resus macaque monkey model, the detailed construction process of which is described in Example 9 and FIG. 12, pGX10-HIV / dpol. Was named.

On the other hand, in addition to the above, other mutation methods, types of promoters, types and lengths of glycoprotein signal sequences, etc. may be variously modified according to the purpose of the present invention as described above, and such modifications will be apparent to those skilled in the art.

The plasmid pGX10-HIV / dpol of the present invention is a 7.5 kb immunogenic plasmid pTV-HIV / pol filed by the inventors and claimed in Korean Patent Publication No. 2001-0054338 and its corresponding US Patent Publication No. 2001004531. It is superior in expression efficiency compared to

(3) third HIV immunogenic plasmid

According to the present invention, a plasmid in which the signal sequence of the secreted protein fused to the viral vi-1 derived gene HIV and its 3 'and 5' ends and the nef derived HIV-1 gene are operably linked to the vector is constructed. The vector may be a mammalian cell expression vector, and is preferably a DNA vaccine vector that is expressed in muscle cells, DCs, T cells, etc. and optimized to induce an immune response. More preferred vectors are vectors with a CMV promoter and optionally with a TPL sequence SV40 pA. Specific examples of vectors that may be used in the present invention include, but are not limited to, pGX10 and pTV2, as well as pVAX1, pRC / CMV, pREP4 and pREP10 (including but available RSV promoters), pcDNA1, pcDNA1.1, pcDNA3 from Invitrogen, pcDNA3 / CAT, pRC / CMV and pRC / CMV2, pCMV-script from Stratagene and pSI, pCI and pCI-neo from Promega. Most preferred is pGX10.

The plasmid thus constructed is delivered together with the first HIV immunogenic plasmid pGX10-HIV / GE and the second HIV immunogenic plasmid (eg pGX10-HIV / pol) of the present invention so that the first and second HIV immunogenic plasmids are Increase the protective effect of inducing.

In addition, the constructed third immunogenic plasmids include the first HIV immunogenic plasmid pGX10-HIV / GE, the second HIV immunogenic plasmid (eg pGX10-HIV / pol) and the fourth HIV immunogenic plasmid (eg , pGX10-HIV / TV), to increase the protective efficacy induced by the first and second HIV immunogenic plasmids. In one preferred embodiment of the present invention, the auxiliary gene vif derived from virus HIV-1 and the auxiliary gene nef derived from HIV-1 fused to the 5 'end thereof have an immunosuppressive effect that can be generated by their immuno disturbance action. It can be modified to prevent. Such modification methods can vary considerably, for example, Ser114-Leu150, etc. can be modified in Vif (Fields Virology Third edition, p1901, Lippincott-Raven Co., 1996), and Nef, along with Arg137 and Arg138, Gly2 (preliminary). Involvement of sterilization) may be modified. And variants of the Pro-Xa-Xa-Pro motif between Nef 69-80 (Fields Virology Third edition, p1904-1908, Lippincott-Raven Co., 1996).

At the 3 'end of the auxiliary gene vif derived from virus HIV-1, the signal sequence of the secreted protein is fused. This fusion increases the expression intensity of the proteins Vif and Nef by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned.

In one embodiment, the signal sequence of the gene vif of HIV-1 and the gD of HSV fused to its 3 'and 5' ends, respectively, to the MCS of the vector pGX10 according to the present invention and the modified neV-1 derived gene nef Another new plasmid of 5.1 kb introduced to be linked to was constructed. This plasmid is the third HIV immunogenic plasmid used in the DNA vaccine of the present invention for AIDS human patients, the detailed construction process of which is described in Examples 10 and 13 and named pGX10-HIV / VN.

Specifically, the third HIV immunogenic plasmid pGX10-HIV / VN includes a gene (expressed as VN) that binds HIV-1-derived genes vif and nef, and is also important for the inhibitory activity of CD4 of gene nef. Genes corresponding to known Arg137 and Arg138 were removed (J. Biol. Chem. 270: 15307, 1995) to prevent the immunosuppressive effects that nef protein might induce. In other words, it is intended to increase Vif-Nef fusion expression intensity by fusing the signal sequence encoding the N-terminal 33 amino acids of gD of HSV to the 5 'end of gene VN and undergoing direct transcriptional regulation of CMV promoter.

On the other hand, in addition to the above, the mutation method, the type of promoter, the type and length of the glycoprotein signal sequence and the like can be variously modified according to the purpose of the present invention as described above and these modifications will be apparent to those skilled in the art.

(4) a fourth HIV immunogenic plasmid

According to the present invention, a signal sequence of a secreted protein fused to any one of the exon 1 to the entire sequence of the gene tat derived from the virus HIV-1 and its 3 'and 5' ends, and the gene vpu derived from the HIV-1 vector A plasmid operably linked to is constructed. The vector may be a mammalian cell expression vector, and is preferably a DNA vaccine vector that is expressed in muscle cells, DCs, T cells, etc. and optimized to induce an immune response. More preferred vectors are vectors with a CMV promoter and optionally with a TPL sequence SV40 pA. Specific examples of vectors that may be used in the present invention include, but are not limited to, pGX10 and pTV2, as well as pVAX1, pRC / CMV, pREP4 and pREP10 (including but available RSV promoters), pcDNA1, pcDNA1.1, pcDNA3 from Invitrogen, pcDNA3 / CAT, pRC / CMV and pRC / CMV2, pCMV-script from Stratagene and pSI, pCI and pCI-neo from Promega. Most preferred is pGX10. The plasmid thus constructed is delivered together with the first HIV immunogenic plasmid pGX10-HIV / GE and the second HIV immunogenic plasmid (eg pGX10-HIV / dpol) of the present invention so that the first and second HIV immunogenic plasmids are Increase the protective effect of inducing.

The plasmid thus constructed is delivered with the first HIV immunogenic plasmid pGX10-HIV / GE and the second HIV immunogenic plasmid (eg pGX10-HIV / dpol) of the present invention so that the first and second HIV immunogenic plasmids are Increase the protective effect of inducing.

In addition, the fourth HIV immunogenic plasmids constructed may comprise the first HIV immunogenic plasmids pGX10-HIV / GE of the present invention, a second HIV immunogenic plasmid (e.g., pGX10-HIV / dpol) and a third HIV immunogenic plasmid ( Eg, with pGX10-HIV / VN) to increase the protective efficacy induced by the first and second HIV immunogenic plasmids.

The gene tat derived from HIV-1 can be used in its entire sequence, but it is preferable to use a modified one due to the immuno disturbance action of the gene. The modifiable range of gene tat includes all sites other than exon 1. Exon 1 also has tat enzyme potency (immunosuppression) but is lower than exon 1 + exon 2. However, since there is a disadvantage that the immune epitope in exon 2 cannot be used, most preferably, the gene tat uses only the exon 1 site.

At the 3 'end of the auxiliary gene tat derived from the virus HIV-1, the signal sequence of the secreted protein is fused. This fusion increases the expression intensity of the proteins Tat and Vpx by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned.

In one embodiment, the signal sequence of gD of HSV fused to the exon 1 of gene tat of HIV-1 and its 3 'and 5' ends to the MCS of vector pGX10 according to the present invention and the gene vpu derived from HIV-1 Another novel plasmid of 4.3 kb introduced to be linked to each other is constructed. This plasmid is the fourth HIV immunogenic plasmid used in the DNA vaccine of the present invention for AIDS human patients, the detailed construction process of which is described in Examples 11 and 14 and named pGX10-HIV / TV.

Specifically, the fourth HIV immunogenic plasmid pGX10-HIV / TV of the present invention includes a gene (expressed as TV) in which exon 1 and vpu gene of the gene tat of HIV-1 are fused. In other words, a signal sequence encoding the N-terminal 33 amino acids of gD of HSV was fused to the 5 'end of gene TV.

Meanwhile, mutation methods other than the above, types of promoters, types and lengths of glycoprotein signal sequences, etc. may be variously modified according to the purpose of the present invention as described above, and these modifications will be apparent to those skilled in the art.

(5) immunogenic plasmids with accessory genes vif, nef, tat and vpu derived from HIV-1

In a preferred embodiment of the present invention, a signal sequence of (i) a gene vif derived from HIV-1 and its secreted protein fused to its 3 'and 5' ends, and a gene nef derived from HIV-1 and (ii) HIV-1, respectively A plasmid in which the signal sequence of the secreted protein fused to any of the genes exon 1 to the entire sequence of the derived gene tat and its 3 'and 5' ends, and the gene vpu derived from HIV-1 are operably linked to one vector. Is constructed. Specific examples of vectors that may be used in the present invention include, but are not limited to, pGX10 and pTV2, as well as pVAX1, pRC / CMV, pREP4 and pREP10 (including but available RSV promoters), pcDNA1, pcDNA1.1, pcDNA3 from Invitrogen, pcDNA3 / CAT, pRC / CMV and pRC / CMV2, pCMV-script from Stratagene and pSI, pCI and pCI-neo from Promega. Most preferred is pGX10. The plasmid thus constructed is delivered with the first HIV immunogenic plasmid pGX10-HIV / GE and the second HIV immunogenic plasmid (eg pGX10-HIV / dpol) of the present invention so that the first and second HIV immunogenic plasmids are Increase the protective effect of inducing. In addition, these immunogenic plasmids can reduce the number of plasmids to be prepared for DNA vaccines, which is advantageous for cost reduction.

In one preferred embodiment of the invention, the HIV-1 derived gene nef fused to the 5 'end of the viral gene HIV-1 derived gene vif prevents the immunosuppressive effects that may be caused by its immuno disturbance action. It can be modified to make. Such modification methods can vary considerably, for example, Ser114-Leu150, etc. can be modified in Vif (Fields Virology Third edition, p1901, Lippincott-Raven Co., 1996), and Nef, along with Arg137 and Arg138, Gly2 (preliminary). Involvement of sterilization) may be modified. And Pro-Xa-Xa-Pro motifs between Nef 69-80 can be modified (Fields Virology Third edition, p1904-1908, Lippincott-Raven Co., (1996)).

In another preferred embodiment, the gene tat from HIV-1 can be used in its entire sequence, but it is preferable to use a modified one due to the immuno disturbance action of this gene. The modifiable range of gene tat includes all sites other than exon 1. Exon 1 also has tat enzyme potency (immunosuppression). However, there is a disadvantage that the immune epitope in exon 2 is lower than exon 1 + exon 2 and cannot be used. Thus, most preferably the gene tat is to use only exon 1 site. The genes nef and tat as described above may each be modified independently. For example, the gene nef may be modified without altering only the gene tat, the gene tat without altering the gene nef, or both the gene nef and tat may be modified.

At each 3 'end of the auxiliary genes vif and tat derived from the virus HIV-1, the signal sequence of the secreted protein is fused respectively. This fusion increases the expression intensity of the proteins Vif and Nef by allowing direct transcriptional regulation of the CMV promoter. Preferably, the signal sequence of the glycoprotein is used as the signal sequence of the secreted protein. Examples of glycoproteins include glycoprotein gD derived from herpes simplex virus, varicella zoster virus (VZV), human cytomegalovirus (HCMV) gH, gL, gO, vesicular stomatitis virus (VSV) G protein, rotavirus envelope membrane capsid glycoprotein, VP7 etc. are mentioned. The signal sequences fused to the 3 'end of the accessory genes vif and tat may be the same or different from each other.

In one embodiment, the signal sequence of the gene vif of HIV-1 and the gD of HSV fused to its 3 'and 5' ends to the MCS of the vector pGX10 according to the present invention and the modified gene nef derived from HIV-1 (Arg137 and Of the gD of HSV fused to exon 1 of gene tat of HIV-1 and its 3 'and 5' ends, respectively, to a third HIV immunogenic plasmid in which a codon corresponding to Arg138 was deleted to operatively link the mutation). Another novel 7.5 kb immunogenic plasmid was constructed in which the signal sequence and the HIV-1 derived gene vpu were operably linked. The plasmid thus constructed corresponds to a third HIV immunogenic plasmid for use with the first and second HIV immunogenic plasmids in the DNA vaccine of the present invention for AIDS human patients. Its detailed construction process is described in Example 12 and FIG. 15 and named pGX10-HIV / VNTV.

In another embodiment, the signal sequence of gD of HSV and HIV-1 derived gene vpu fused to MCS of vector pGX10 according to the present invention fused to exon 1 of gene tat of HIV-1 and its 3 'and 5' ends, respectively. The fourth HIV immunogenic plasmid introduced to be linked to each other operably carries the signal sequence of the gene vif of HIV-1 and the gD of HSV fused to its 3 'and 5' ends, respectively, and a modified gene nef derived from HIV-1. Another new 7.5 kb immunogenic plasmid introduced to be linked to was constructed. The plasmid thus constructed corresponds to a third HIV immunogenic plasmid for use with the first and second HIV immunogenic plasmids in the DNA vaccine of the present invention for AIDS human patients. Its detailed construction process is described in Example 13 and FIG. 16 and named pGX10-HIV / TVVN.

Meanwhile, mutation methods other than the above, types of promoters, types and lengths of glycoprotein signal sequences, etc. may be variously modified according to the purpose of the present invention as described above, and such modifications will be apparent to those skilled in the art.

DNA vaccine

According to the test examples of the present invention, when the present invention is administered to the rhesus monkey using pTV-SIV / GE and pTV-SIV / dpol, which are immunogenic plasmids of the present invention, as a DNA vaccine, they contain more regulatory genes. In addition, pGX10-SIV / GE and pGX10-SIV / dpol using the vector pGX10 with excellent expression intensity are co-administered or pGX10-SIV / GE, pGX10-SIV / dpol, pGX10-SIV / VN and pGX10-SIV / TV In addition, the inhibition of SIVmac239 proliferation as well as the inhibition of CD4 + cell count, a typical symptom of AIDS progression by infection with SIVmac239, was found in rhesus monkeys. Therefore, the composition containing the immunogenic plasmid of the present invention can be usefully used as a vaccine for preventing AIDS.

Immunotherapy is a method of inhibiting virus growth by increasing the immune response to the virus, rather than treating chemicals that inhibit the enzymes necessary for virus growth (eg, reverse transcriptase and protease). DNA immunization methods also include HIV-infected chimpanzees (Boyer JD, et al., AIDS 14: 1515-22, (2000); Boyer JD, et al., J. Infect. Dis. 176: 1501-9, (1997)). Therapeutic immunization is being attempted on HIV infected persons (MacGregor RR J. Infect. Dis. 178: 92-100, 1998). Since the efficacy of a therapeutic vaccine correlates with the ability to induce an immune response that can inhibit the growth of the virus, it is generally possible in the art for a vaccine to be used that is excellent for prevention. It is accepted. Therefore, the composition containing the immunogenic plasmid of the present invention can be usefully used as a vaccine for treating AIDS.

The method of administration and formulation of the DNA vaccine for preventing AIDS according to the present invention is in accordance with the general vaccine, in particular the method and formulation of administration of the DNA vaccine. In the case of therapeutic vaccines, the purpose is to increase the immune response to the virus, and thus the same administration method and dosage form as the prophylactic case.

The DNA vaccine of the present invention is preferably administered by direct (in vivo) gene delivery. Naked DNA can be administered by intramuscular, intradermal, pia, intravenous, intraarterial or buccal injection. Plasmid DNA can be coated on gold particles and injected into the epithelial or oral or vaginal mucosa of the skin using a gene-gun (Fynan et al., Proc. Natl. Acad. Sci. USA 90: 11478, (1993) Tang et al., Nature 356: 152, (1992); Fuller, et al., J. Med. Primatol. 25: 236, (1996); and Keller et al., Cancer Gene Ther., 3: 186, (1996)). DNA vaccine vectors can also be used in conjunction with various delivery systems. Delivery of DNA vaccines by intramuscular injection (Gregoriadis et al., FEBS Lett. 402: 107, 1997) or delivery of DNA vaccines to the respiratory system by non-invasive means such as nasal inhalation (Fynan et al., Proc. Natl. Acad. Sci. USA 90: 11478, 1993) liposomes can be used. Other possible delivery systems include microcapsules (Fynan et al., Proc. Natl. Acad. Sci. USA 90: 11478, 1993) or cochleates (Mannino et al., 1995, Lipid matrix-based vaccines for mucosal and systemic immunization.Vaccine Designs: The Subunit and Adjuvant Approach, MF Powell and MJ Newman, eds., Pleum Press, New York, 363-387), which are parenteral, nasal (e.g., nasal spray) or oral (e.g., Liquids, gelatin capsules, solids in food). In addition, the DNA vaccine of the present invention can be injected directly into lymphoid tissue. In addition, immunogenic and adjuvant plasmids can be formulated to deliver specific cell types, such as antigen-presenting cells (APCs). Targeting to APCs (eg, branched cells) may be possible through binding of mannose residues (branched cells have a high density of mannose receptors) or via ligands to one of the other receptors predominantly present on APC. As long as the transfected cells express an antigen to induce an immune response, there is no limitation in the route of delivery or formulation of the DNA vaccine.

The DNA vaccine of the present invention may be set up as a pharmaceutically acceptable suspension, solution or emulsion when administered to the mucosa. Suitable media include saline and liposome preparations. More specifically, preferred pharmaceutically acceptable carriers used in the DNA vaccines of the invention include sterile aqueous or non-aqueous solutions, suspensions and emulsions suitable for ingestion, inhalation or administration to the rectum or vagina by suppositories. Can be. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (eg olive oil) and certain organic esters (eg ethyl oleate). Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions (including saline and buffered media). In addition, preservatives and other additives may be present, such as antibacterial agents, antioxidants, chelating agents and inert gases. In addition, the DNA vaccines of the present invention can be lyophilized using methods well known in the art and then administered by aerosol by inhalation or subsequently reconstituted and injected.

Preferred media for maximal uptake of the expression plasmids contained in the DNA vaccines of the invention is an isotonic buffer. It is also desirable to use absorption promoters, detergents and mild chemical stimulants to enhance delivery of the DNA vaccine such that the DNA vaccine is in contact with or containing tissues adjacent to mucosal derivative sites. General principles regarding accelerators and cleaning agents that have been successfully used for mucosal delivery of organic and peptide-based drugs are described in Chien, Novel Drug Delivery Systems, Ch. 4 (Marcel Dekker, 1992). Specific details regarding the means and principles of intranasal drug delivery can also be found in Chien, supra. Examples of suitable nasal absorption promoters are described in Chien, Ch. 4, Tables 2 and 3, preferred are milder materials. Suitable materials known to enhance absorption of drugs through the skin are described in Sloan, Use of Solubility Parameters from Regular Solution Theory to Describe Partitioning-Driven Processes, Ch. 5, "Prodrugs: Topical and Ocular Drug Delivery" (Marcel Dekker, 1992). The term "detergent / absorption accelerator" as used above refers to chemicals known in the art to promote the absorption and transfection of specific small molecules as well as peptides. The term “mucosa” refers to all mucosal tissue present in the body, including, for example, the respiratory tract (including the bronchial tract, pulmonary epithelium and nasal epithelium), the genitals (including the vagina, penis and anal mucosa), urinary (eg, urethra and Bladder), oral cavity, eyeball and vocal cords. The term "inlet point" refers to the site of entry of a polynucleotide into a host, including adjacent tissue. The term “mucosa derivative site” refers to the site where the DNA vaccine is absorbed into the mucosa, but is not limited to Waldale rings, Fayer's plates, intestinal-associated lymphoid tissue, bronchial-associated lymphoid tissue, non-associated lymphoid tissue, genital-associated Lymphoid tissue and tonsils are included.

The dosage of the DNA vaccine according to the invention may vary depending on the method of administration, the tissue to which the vaccine is administered (eg skeletal muscle, skin), the desired antibody titer, the specific therapeutic requirements of the subject to be immunized, and the like. The effective dose of each plasmid contained in the DNA vaccine of the present invention is 0.01 to 0.2 mg / kg body weight, preferably 0.02 to 0.1 mg / kg body weight. If a coated microprojectile is used, a smaller amount of vaccine can be introduced.

Lyophilization of DNA Vaccines

The DNA vaccine compositions of the present invention can be lyophilized to increase stability at room temperature, reduce the need for costly cold storage, and to extend shelf-life. The lyophilization process may consist of successive stages of freezing, primary drying and secondary drying. The primary drying process after freezing the composition is to drop the pressure and heat it for sublimation of water vapor. The secondary drying step is to evaporate the residual moisture absorbed from the dry matter.

In one embodiment, the lyophilization method of the DNA vaccine according to the present invention is as follows: (1) The collapse temperature of the preparation is determined using lyophilization microscopy (Pikal, MJ, et al. , Int. J. Pharm. 62, 165-186, 1990); (2) The vial is placed on a freeze-dryer shelf at room temperature and then equilibrated at −1 ° C. for about 30 minutes. (3) Cool the shelf to -55 ° C and hold this temperature for 2 hours. (4) The secondary drying is carried out at a temperature of about 5 DEG C lower than the product temperature or the collapse temperature of about -32 DEG C. (5) Secondary drying is performed at 35 ° C. Drying is completed after adjusting the chamber pressure to 55-120 μm mHg. (6) The vial was capped under vacuum in the freeze-dryer and the freeze-dried vial was crimp-sealed and stored at 2-8 ° C.

Excipients and lyoprotectants are used for lyophilized DNA vaccine preparations. Excipients include, but are not limited to, buffers of 0.9% NaCl and 10 mM sodium phosphate (pH 7.0) or 10 mM sodium citrate (pH 7.0). Freeze drying protectants serve to protect biological molecules during the freezing and drying process and to provide mechanical support to the final product, such as PBS (pH 7.0), PBS / 4%, 12% or 15% tre Halose, PBS / 12% or 20% mannitol, PBS / 15% or 20% lactose, PBS / 4% sucrose, PBS / 2% sorbitol, PBS / 2% PEG (polyethylene glycol), PBS / 4% tre Halose / 1% PEG / 1% PVP (polyvinyl pyrrolidone), PBS / 4% mannitol / 1% PEG / 1% PVP, PBS / 4% lactose / 2% PEG and PBS / 12% lactose / 0.9% benzoyl alcohol.

Adjuvant

The DNA vaccine of the present invention may further contain adjuvant plasmids expressing immunoregulatory molecules such as cytokine proteins. Such adjuvant plasmids include, but are not limited to, plasmids expressing IL-1, IL-2, IL-4, IL-7, IL-12, IFN-gamma and GM-CSF. Examples of IL-4 expressing plasmids include plasmid pCAGGSIL-4 (FIG. 21). Examples of IL-12 expressing plasmids include plasmid pCAGGSIL-12 (FIG. 22) and plasmid pGX10-hIL-12m (FIG. 17).

An adjuvant plasmid used particularly preferably in the DNA vaccine of the present invention is the plasmid pGX10-hIL-12m developed by the inventors.

The present invention relates to an immunogenic plasmid with excellent expression efficiency and immunogenicity in a SIVmac239 / rhesus monkey model, wherein a DNA vaccine containing an immunogenic plasmid of the present invention and optionally an adjuvant plasmid can be used for the prevention or treatment of AIDS. Very effective.

Hereinafter, the present invention will be described in more detail in the following examples. However, these examples are only illustrative of the present invention and do not limit the scope of the present invention.

Example

Treatment of restriction enzymes: Treatment of all restriction enzymes in the following examples was performed as follows. 2ug (1ug / ul) of plasmid DNA or purified PCR product was treated with 20 units (2ul) of restriction enzymes (all restriction enzymes were used by Takara Shuzo Co., Ltd and New England Biolab, Inc). After adding the buffer solution (10-fold concentrate) supplied by the company together, distilled water was added to a final volume of 50ul and reacted at 37 ° C for 2 hours.

Conjugation of DNA fragments and transformation of Escherichia coli: DNA solution treated with restriction enzymes was electrophoresed on 0.8% agarose gel (GIBCO-BRL), and agarose fragments containing DNA fragments of the desired size were cut and gel extracted from QIAEN. Pure separation was performed using the kit (Gel Extraction Kit). DNA fragments were put in a T4 DNA ligase (Takara) and a buffer solution provided by the manufacturer and conjugated for 10 hours in a 16 ℃ thermostat. The conjugated DNA was transformed into E. coli by the method introduced in Molecular Cloning (Second Edition) of Sambrook et al. (1.74).

Identification of DNA with Plasmid Conjugated in Transformed Escherichia Coli: After a small amount of DNA was purified by the method introduced in Molecular Cloning (Second Edition) by Sambrook et al. Based on the restriction map of the DNA of interest, a method was used to cut the size of the restriction enzyme and check its size.

Pure purification of plasmid DNA: A large amount of pure DNA was obtained by the method (1.3-1.4) introduced in Molecular Cloning (Second Edition) by Sambrook et al.

PCR amplification: All PCR amplifications were performed as follows. Add two oligonucleotides (primers) 200 pmol each, 20 ng of template DNA, 10 units of Takara exTaq (polymerase), 5 ul of Takara exTaq 10x buffer, 5 ul of 2.5 mM dNTP mixture and distilled water and a final volume of 50 ul. It was made. The PCR method is predenaturation 94 ° C 4 minutes, denaturation 94 ° C 1 minute, annealing 52 ° C 1 minute, polymerization 1 minute per kb (0.5 kb amplification) at 72 ° C for all PCR. 0.5 min, 3 kb amplification, 3 min), 30 cycles from denaturation to polymerization, and final extension at 72 ° C. for 5 min. The PCR machine used 2400 Kinkin GeneAmp PCR system of Perkin Elmer. The obtained PCR product was purified by the method provided by the product using the gel extraction kit of QIAGEN after agarose electrophoresis. The product was then cut into restriction enzymes as in the restriction enzyme treatment and used for cloning to conjugate with other fragment DNA or another PCR product.

Other experiments on gene recombination, which are not specifically specified below, were performed with minimal modification to the methods introduced in Molecular Cloning (Second Edition) by Sambrook et al.

Example 1

Preparation of DNA Vaccine Vector pGX10 (SEQ ID NO: 60) (FIG. 1)

A. Construction of the vector pTV-3 (FIG. 1A)

2 ug of vector pMT-3 (Sambrook, et al., Molecular cloning 2nd Ed., Vol. 3 16.20; Kaufman RJ, et al., Mol. Cell Biol. 9,946-958, (1989)) was identified as HpaI (20 unit) and Cut by NheI (20 unit) by the above restriction enzyme treatment method, add Klenow fragment (New England Biolabs) (5 unit) and add dNTP (Takara) to the final 100 μM, and then process for 30 minutes at 25 ℃. A blunt end was made. After agarose gel electrophoresis, a 0.7 kb fragment (including the entire VAI and part of the SV40 polyA) was added to the SV40 polyA of vector pTV-2 (Lee, et al., J. Virol., 72,8430-36, (1998)). A 5.3 kb vector pTV-3 was prepared by insert conjugation to the unique Hpa I site of the portion.

B. Construction of the vector pGX-1 (FIG. 1A)

Using the constructed vector pTV-3 as a template, the polymerase chain reaction (PCR) was carried out with the following primers, and the PCR product (2.0 kb) was cleaved according to the method for treating restriction enzyme described above with NruI:

CMV5 (TCG CGA CCC GGG CGA CGG CCA GTG AAT TGT ACC G): SEQ ID NO: 1 (sense)

VA3 (TCG CGA GGC GCG CCA CGA GCC GCC GCG CCT GGA AGG): SEQ ID NO: 2 (antisense)

In addition, using the vector pZero-2 (Invtrogen) as a template, PCR was carried out using the following PCR amplification method with the following primers, and the amplified product was digested with SspI, and the DNA fragment (1.8kb) was linked to the above fragment (2.0kb). 3.8 kb of vector pGX-1 was prepared:

Zero5 (AAT ATT GTC GAC TTC AGA AGA ACT CGT CAA GAA G): SEQ ID NO: 3 (Sense)

Zero3 (AAT ATT GGG CCC GAA CAT GTG AGC AAA AGG CCA G: SEQ ID NO: 4 (antisense)

C. Construction of the vector pGX10 (FIG. 1B)

Vector pGX-1 was cut with restriction enzymes XbaI and SalI and the larger of the two fragments (3.1 kb) of DNA were isolated as in the method of conjugation of the DNA fragments and transformation of E. coli. The small one (0.5 kb) of the two fragments produced by cutting the vector pGL3-Enhancer (Promega) with restriction enzymes XbaI and SalI was isolated in the above manner. Two separate sections were combined to obtain vector pGX10.

2 and 3 show the genetic map of the vector pGX10 (3.5 kb) of the present invention constructed as described above and the positions of the total 3641 nucleotide sequences.

Example 2

Preparation of Plasmid pGX10-SIV / GE Used as Immunogen of SIV (FIG. 5)

A. Construction of the vector pTV-SIV / GE (FIG. 5)

(a) The following oligonucleotides 1193Kpn and 3464Xba with the sequences KpnI and XbaI, respectively, were synthesized:

1193 Kpn (cgggtcggtaccagacggcg): SEQ ID NO: 5 (Sense)

3464Xba (atctagaggtatggagaaatat): SEQ ID NO: 6 (antisense)

These synthetic oligonucleotides were used as PCR primers and described above using SIVmac239 DNA clone (GeneBank Accession No. M33262; Regier, et al., AIDS Res. Hum.Retroviruses, 6,1221-1231, (1990)). After amplification by the PCR amplification method, the amplified product was digested with Kpn and XbaI. The sequence of nucleotides 1193 to 3464 of the SIVmac239 DNA (based on the designation number of the Gene Bank from the position cut by the restriction enzyme at the end of the primer) was cut, pBluescript SK + (Stratagene) was cut with SalI and XbaI, and A of Example 1 was used. Clonowoo fragment was processed in the same manner as in the paragraph was inserted into the site to make a smooth end to prepare a vector pSK-SIVgag (5.3kb).

(b) the following oligonucleotides 6695Xba and 9641NotI were synthesized with XbaI and NotI sequences, respectively:

6695Xba (gccctctaga agcatgctat): SEQ ID NO: 7 (sense)

9641NotI (ggaagcggcc gcctcactga tacccctacc aa): SEQ ID NO: 8 (antisense)

These synthetic oligonucleotides were used as PCR primers and the products amplified using SIVmac239 DNA clone (GeneBank Accession: M33262) as templates were cut with restriction enzymes NotI and XbaI. The vector pSK-SIVgag was partially cleaved with restriction enzymes NotI and XbaI, and the amplified and cleaved sequences were inserted at the sites to prepare vector pSK-SIV / ge-1 (8.2 kb).

(c) the following oligonucleotides 8328Cla and 9535Xho were synthesized:

8328Cla (actgtatcgattggaattgg): SEQ ID NO: 9 (Sense)

9535Xho (ctccctcgagtattcatatactgtccctga): SEQ ID NO: 10 (antisense)

Amplified by PCR using SIVmac239 clone DNA (GeneBank Accession: M33262) as a template and using the synthetic oligonucleotide as a primer, and inserting the product into the SmaI position of pBluescript SK + (Stratagene) to obtain vector pSK-SIVenv3 (4.2kb). )

(d) The part containing the vector which cut | disconnected vector pSK-SIV / ge-1 with restriction enzyme ClaI and NotI (6.7kb), and the part which does not contain the vector which cut pSK-SIVenv3 with restriction enzymes ClaI and NotI (1.2kb) Was combined to prepare a vector pSK-SIV / ge (7.9 kb). The KpnI and NotI of the prepared pSK-SIV / ge DNA were cut and inserted into the KpnI / NotI site of the vector pTV2 (Lee SW et al., J. Virol., 72: 8430-36, 1998) and the plasmid pTV-SIV / GE (10.0). kb) was prepared.

E. coli DH5 ′ transformed with the prepared plasmid pTV-SIV / GE was deposited with Accession No. 0702BP to KCTC on 27 November 1999 under the Budapest Convention for patent purposes.

B. Construction of the plasmid pGX10-SIV / GE (FIG. 5)

The plasmid pTV-SIV / GE was cut with restriction enzymes MluI and XhoI to obtain the CMV promoter, TLP sequence and the part containing the SIV gene (6.1kb), and then the pGX10 vector was cut with restriction enzymes MluI and XhoI and then the CMV promoter and TLP sequence. Plasmid pGX10-SIV / GE (8.7 kb) was prepared by binding to DNA fragments without (2.6 kb).

Example 3

Preparation of plasmid pGX10-SIV / pol used as immunogen of SIV (FIG. 6)

A. Construction of the vector pTV-SIV / dpol (FIG. 6)

(a) the following synthetic oligonucleotides with BamHI and XhoI sites were prepared:

BamHI (aatggatcca tagctaaagt agag): SEQ ID NO: 11 (Sense)

XhoI (atttctcgag gctatgccac ctctc): SEQ ID NO: 12 (antisense)

These synthetic oligonucleotides were used as PCR primers to amplify the sequences of nucleotides 3105 to 5668 of the SIVmac239 DNA clone (GeneBank Accession: M33262), cut them with restriction enzymes BamHI and XhoI, and remove p2 with restriction enzymes BglI and XhoI. Plasmid pSK-gDsSIV / pol (5.7) by inserting the PCR amplified BamHI / XhoI fragment (2.6 kb) into -gDs / E2t (Lee, et al., J. Virol., 72,8430-6, (1998)). kb) was prepared.

(b) removing the sequence of nucleotides 5130-5132 from the integrase site of the plasmid pSK-gDsSIV / pol and mutating the sequence of nucleotides 5133-5135 to express Ser117 instead of Asn117 to prepare pSK-gDsSIV / polm (5.7kb) It was. PCR was performed using pSK-gDsSIV / pol as a template for mutation of the pol gene and using the following two synthetic oligonucleotide primers:

(agtggtgcta actttgcttc gcaa): SEQ ID NO: 13 (Sense)

(tgtgtgtaga tgtgtaatag gcc): SEQ ID NO: 14 (antisense)

ATP and 10 units of T4 polynucleotide kinase (New England BioLabs) were treated for 1 hour at 37 ° C. to self-ligation to conjugate the DNA fragments so that the final amplification product was 100 uM. Purification was carried out to prepare a vector pSK-gDsSIV / polm (5.7 kb).

(c) The vector pSK-gDsSIV / polm was cut with restriction enzymes NotI and XhoI and inserted into the same restriction enzyme site of pTV2 (Lee et al., J. Virol., 72: 8430, 1998) to plasmid pTV-SIV / dpol (7.6kb). ) Was prepared.

E. coli DH5 ′ transformed with the prepared plasmid pTV-SIV / dpol was deposited with Accession No. 0703BP to KCTC on 27 November 1999 under the Budapest Convention for patent purposes.

B. Construction of the plasmid pGX10-SIV / dpol (FIG. 6)

The plasmid pTV-SIV / dpol was cut with restriction enzymes NotI and XhoI, and the fragment containing the SIV gene (2.7 kb) was inserted into the vector pGX10 (3.6 kb) cut with the same restriction enzyme and plasmid pGX10-SIV / dpol (6.3 kb). Was prepared.

Example 4

Preparation of Plasmid pGX10-SIV / VN Used as Immunogen of SIV (FIG. 7)

A. Construction of pGX10-gDs (FIG. 7A)

The following oligonucleotides were synthesized:

PstIgDs (CAA CTGCAG ATG GGG GGG GCT GCC G): SEQ ID NO: 15 (Sense)

gDsAscINotI (ATT GCG GCC GCA GGC GCG CCG ATC TGA GAG AGG CAT CC): SEQ ID NO: 16 (antisense)

PCR was carried out using these synthetic oligonucleotides as primers and PCR of the constructed vector pGX10-SIV / pol as a template, and the product (0.1 kb) was inserted into a vector pBluescriptSK (Stratagene) (3.0 kb) cut with restriction enzymes PstI and NotI. To prepare plasmid pSK-gDs (3.1 kb).

B. Construction of pSK-gDs / Vif (FIG. 7B)

The following oligonucleotides were synthesized:

AscI5'vif (T ATG GCG CGC CTG GAG GAG GAA AAG AGG): SEQ ID NO: 17 (Sense)

vif3'XbaINotI (AAAGCGG CCGC AAT CT AGA TCATGCCAG TATTCCCAAG): SEQ ID NO: 18 (antisense)

These synthetic oligonucleotides were used as primers, PCR was performed using the SIVmac239 clone (GenBank Accession No. M33262) as a template, and the product was cut with restriction enzymes AscI and NotI and the resulting fragment (0.6kb) was cut with the same restriction enzyme. Inserted into gDs (3.1 kb) to prepare plasmid pSK-gDs / Vif (3.7 kb).

C. Construction of pSK-5nef (FIG. 7B)

The following oligonucleotides were synthesized:

BH5'nef (TAC GGA TCC ATG GGT GGA GCT ATTT T): SEQ ID NO: 19 (Sense)

5'SpeI (TCT ACT AGT ACT GTA ATA AAT CCC TTC): SEQ ID NO: 20 (antisense)

Using these synthetic oligonucleotides as primers, PCR was performed using the SIVmac239 clone (GenBank Accession No. M33262) as a template, and the product was inserted into the BamHI and SpeI positions of pBluscriptSK + (Stratagen) to make plasmid pSK-5nef (3.0kb). .

D. Construction of pSK-nefM (FIG. 7B)

The following oligonucleotides were synthesized:

Spe5'nef (AGA ACT AGT AGA ATC TTA GAC ATA TA): SEQ ID NO: 21 (Sense)

3'nefNotI (AAA GCGGCCGC TGT TTC AGC GAG TTT): SEQ ID NO: 22 (antisense)

Using these synthetic oligonucleotides as primers, PCR was performed using the SIVmac239 clone (GenBank Accession No. M33262) as a template, and the product was cut with restriction enzymes SpeI and NotI, and the obtained fragment (0.4kb) was pSK cut with restriction enzymes SpeI and NotI. Inserted into -5nef (3.4kb) to make plasmid pSK-nefM (3.8kb).

E. Construction of pSK-SIV / VN (FIG. 7B)

PSK-gDs / Vif (3.7kb) digested with restriction enzymes NotI and XbaI by PCR of the following synthetic oligonucleotides with a primer using vector pSK-nefM as a template and cleavage with restriction enzymes NotI and XbaI Inserted into plasmid pSK-SIV-VN (or pSK-VN) (4.5 kb) to prepare:

Xba5'nef (ACC TCT AGA ATG GGT GGA GCT ATT T): SEQ ID NO: 23 (sense)

3'nefNotI (AAA GCGGCCGC TGT TTC AGC GAG TTT): SEQ ID NO: 22 (antisense)

F. Construction of pGX10-SIV / VN (FIG. 7C)

The vector pSK-VN was digested with restriction enzymes AscI and NotI, and a small DNA fragment (1.4 kb) was prepared using pGX10-SIV / TV (which can be made first using the intermediates pSK-gDs / Vif and pGX10). Plasmid pGX10-SIV / VN (5.1kb) was prepared by binding to DNA fragments (3.7kb) generated after cutting with restriction enzymes AscI and Not I.

Example 5

Preparation of Plasmid pGX10-SIV / TV Used as Immunogen of SIV (FIG. 8)

A. Construction of pSK-gDs / tat (FIG. 8A)

Using the SIVmac239 clone (GenBank Accession No. M33262) as a template, PCR of the following synthetic oligonucleotides with a primer was carried out, and the product was digested with restriction enzymes AscI and NotI and exon 1 (0.3kb) of gene tat was cut with the same restriction enzyme. Inserted into pSK-gDs / Vif (3.1 kb) to prepare plasmid pSK-gDs / tat (3.4 kb):

AscI5'tat (TAT GGCG CGCC TGG AGA CAC CCT TGA GG): SEQ ID NO: 24 (Sense)

tat3'NheNotI (AAA GCGG CCG CAA TCT AGA GTT TGA TGC AGA AGA TGT A): SEQ ID NO: 25 (antisense)

B. Construction of pSK-SIV / TV (FIG. 8A)

PSK-gDs obtained by PCR of the following synthetic oligonucleotides with primers using the SIVmac239 clone (GenBank Accession No. M33262) as a template, and digestion of the product (0.3kb) digested with restriction enzymes NotI and XbaI with restriction enzymes NotI and NheI. Inserted in / tat to make pSK-SIV / TV (3.7kb).

Xba5'vpx (aaa TCTAGA atg tca gat ccc agg gag): SEQ ID NO: 26 (Sense)

3'vpxNoI (aaaa gcgg ccgc tta tgc tag tcc tgg agg): SEQ ID NO: 27 (antisense)

C. Preparation of Plasmid pGX10-SIV / TV (FIG. 8B)

Plasmid pSK-SIV / TV was digested with restriction enzymes PstI and NotI, and then a small size DNA fragment (0.7kb) was inserted at the site where pGX10 was cut with the same restriction enzymes PstI and NotI and plasmid pGX10-SIV / TV (4.3kb) Was prepared.

Example 6

Construction of pGX10-SIV / VNTV (FIG. 9)

The following oligonucleotides were synthesized:

Sal5CMV (CCCG GTCGAC GGCCAG TGA ATT G): SEQ ID NO: 28 (Sense)

Sal3enh (CTT CTG AA GTCGAC GGA TCC GC): SEQ ID NO: 29 (antisense)

PCR was carried out using these synthetic oligonucleotides as a primer and plasmid pGX10-SIV / TV as a template, and the product (2.4 kb) cut with the restriction enzyme SalI was inserted into pGX10-SIV / VN cut with the same restriction enzyme SalI. pGX10-SIV / VNTV was prepared.

Example 7

Construction of pGX10-SIV / TVVN (FIG. 10)

PCR products of the same synthetic oligonucleotides Sal5CMV (sense) and Sal3enh (antisense), which were used in Example 6 using plasmid pGX10-SIV / VN as a template, were digested with restriction enzyme SalI (3.2 kb). Plasmid pGX10-SIV / TVVN was prepared by inserting into pGX10-SIV / TV digested with SalI.

The following example is an illustration of an immunogenic plasmid for HIV vaccine obtained by replacing the SIVmac239 gene with the corresponding HIV-1 gene. HXB2 and JRCSF were used as HIV-1 genes, but were prepared using the same or similar method (using different restriction enzymes when the restriction enzyme site was in the HIV gene) using different species of HIV.

Example 8

Preparation of pGX10-HIV / GE (FIG. 11)

Plasmid pTX (Lee A H et al., Vaccine 17: 473-9, 1999) has the genes gag, env and rev of HXB2 (Gene Bank Accession No. K03455) as HIV genes and genes vpr and tat are not expressed. The plasmid pTX was cut with restriction enzymes HpaI and MluI to cut 7.5 kb of DNA fragments (including CMV promoter, TPL sequence, HIV gene, and a portion of SV40 polyA) into 2.2 kb DNA fragments isolated from pGX10 with the same restriction enzyme. Plasmid pGX10-HIV / GE (9.7 kb) was prepared by binding to the original and kanamycin resistance genes).

Example 9

Preparation of pGX10-HIV / dpol (FIG. 12)

A. Preparation of pSK-polMjr (FIG. 12A)

(a) The following oligonucleotides were synthesized:

BH5pol (AAT GGA TCC ATT AGT CCT ATT GA): SEQ ID NO: 30 (Sense)

PstIN (GCC CTG CAG TGT ATG TAT TGT TGT TA): SEQ ID NO: 31 (antisense)

PCR using the synthetic oligonucleotide as a primer and the proviral gene (pYK-JRCSF, NIH, AIDS Research and Reference Regent Program) of HIV-1 JR-CSF (Gene Bank Accession No. M38429) as a PCR template Amplified. The resulting product was digested with restriction enzymes BamHI and PstI, and a 2.0 Kb DNA fragment was inserted into the site where pBluescriptSK + (Stratagen) was digested with the same restriction enzymes BamHI and PstI to make plasmid pSK-5pol (5.0kb).

(b) the following oligonucleotides were synthesized:

Pst3pol (ACA CTG CAG GGC AGC AAT TTC ACC): SEQ ID NO: 32 (Sense)

polClaI (CTT ATC GAT GTT CTA ATC CTC ATC): SEQ ID NO: 33 (antisense)

The product obtained by PCR amplification using these oligonucleotides as a primer and using the HIV-1 JR-CSF clone as a template was digested with restriction enzymes PstI and ClaI, and the plasmid pSK-5pol was inserted at the sites where the same restriction enzymes PstI and ClaI were cleaved. PSK-polMjr (5.5bk) was obtained.

(c) pSK-polMjr was digested with restriction enzymes BamHI and NaeI, a DNA fragment containing the HIV-1 pol gene (2.8kb) and pSK-gDs / E2t (Lee et al., J. Virol., 72: 8430, 1998) The plasmid pSK-gDs / polMjr (5.6 kb) was obtained by concatenating DNA cut with the same restriction enzyme BamHI and NaeI (2.8 kb).

B. Preparation of pGX10-HIV / dpol (FIG. 12B)

pSK-gDs / polMjr was cut with restriction enzymes NotI and XhoI to insert a 2.6 kb DNA fragment into the NotI and XhoI sites of vector pGX10 to prepare pGX10-HIV / dpol (6.2 kb).

Example 10

Preparation of pGX10-HIV / VN (FIG. 13)

A. Construction of pSK-gDs / Vifjr (FIG. 13A)

The following oligonucleotides were synthesized:

AscIvif (ATC GGCGCGC CTG GAA AAC AGA TGG CAG GT): SEQ ID NO: 34 (Sense)

VifXbaI (CAT TCT AGA GTG TCC ATT CAT TGT ATG GC): SEQ ID NO: 35 (antisense)

The product obtained by PCR amplification using the synthetic oligonucleotide as a primer and HIV-1 JR-CSF clone (Gene Bank Accession No. M38429) as a template was cut with restriction enzymes AscI and XbaI and pSK-gDs / Vif (FIG. 6A). PSK-gDs / Vifjr (3.7kb) was prepared by cutting the same restriction enzymes AscI and XbaI and removing the vif gene of SIV.

B. Construction of pSK-nefMjr (FIG. 13B)

(a) the following oligonucleotides were synthesized:

BH5'nef-HIV (TAC GGA TCC ATG GGT GGC AAG TGG TCA): SEQ ID NO: 25 (Sense)

5'SpeI (ATC ACT AGT TGA GTA AAT TAG CCC TTC): SEQ ID NO: 36 (antisense)

These synthetic oligonucleotides were used as primers, PCR was performed using HIV-1 JR-CSF clone (GenBank Accession No. M38429) as a template, and the product was treated with the restriction enzymes BamHI and SpeI to obtain a DNA fragment (0.3 kb) pBluscriptSK +. The vector pSK-5nefjr (3.3kb) was prepared by inserting the restriction enzymes BamHI and SpeI at (Stratagen).

(b) the following oligonucleotides were synthesized:

Spe5'nef-HIV (TCA ACT AGT GAT ATC CTT GAT CTG TGG): SEQ ID NO: 37 (Sense)

3'nefNotI-HIV (GAT GCGGCCGC TCA GCA GTC CTT GTA GTA): SEQ ID NO: 38 (antisense)

PCR was carried out using these synthetic oligonucleotides as primers, PCR using a HIV-1 JR-CSF clone (GenBank Accession No. M38429) as a template, and then cutting the product with restriction enzymes SpeI and NotI (0.3 kb), and the same restriction enzyme. Plasmid pSK-nefMjr (3.6 kb) was prepared by inserting into pSK-5nefjr cut into SpeI and NotI.

C. Construction of pSK-VNjr (FIG. 13B)

PCR was performed using the following synthetic oligonucleotides as primers and pSK-nefM as a template, and the product (0.6kb) cut with restriction enzymes NotI and XbaI was inserted into pSK-gDs / vifjr cut with restriction enzymes XbaI and NotI. -VNjr (4.3kb) was prepared:

Xba5'nef (CAC TCT AGA ATG GGT GGC AAG TGG TCA): SEQ ID NO: 39 (Sense)

3'nefNotI-HIV (GAT GCGGCCGC TCA GCA GTC CTT GTA GTA): SEQ ID NO: 38 (antisense)

D. Construction of pGX10-HIV / VN (FIG. 13C)

The vector pSK-VNjr was cleaved with restriction enzymes AscI and NotI, and then a small size DNA fragment (1.2kb) was combined with a plasmid pGX10-HIV / TV with a DNA fragment cut with restriction enzymes PstI and NotI (3.7kb). HIV / VN (4.9 kb) was prepared.

Example 11

Preparation of pGX10-HIV / TV (FIG. 14)

A. Construction of pSK-gDs / tatjr (FIG. 14A)

The following oligonucleotides were synthesized:

AscI5'tat-HIV (ATC GGCG CGCC TGG AGC CAG TAG ATC CT): SEQ ID NO: 40 (Sense)

tat3'XbaI-HIV (CCC TCT AGA CTT TGG TAG AGA AAC TTG): SEQ ID NO: 41 (antisense)

PCR was performed using these synthetic oligonucleotides as primers and PCR using the HIV-1 JR-CSF clone (GenBank Accession No. M38429) as a template, and the product was digested with restriction enzymes AscI and NotI (exon 1, 0.2kb of gene tat). ) Was cut with pSK-gDs / Vif with the same restriction enzyme and combined with the resulting DNA (3.1 kb) to prepare plasmid pSK-gDs / tatjr (3.3 kb).

B. Construction of pSK-TVjr (FIG. 14A)

The following oligonucleotides were synthesized:

Xba5'vpu (CCC TCT AGA ATG CAA CCT TTA CAA AT): SEQ ID NO: 42 (Sense)

3'vpuNotI (CGA GCGGCCGC CTA CAG ATC ATT AAT GTC): SEQ ID NO: 43 (antisense)

These synthetic oligonucleotides were used as primers, PCR was performed using HIV-1 JR-CSF clone (GenBank Accession No. M38429) as a template, and DNA (0.2 kb) cut with restriction enzymes NotI and XbaI was digested with the same restriction enzymes NotI and XbaI. Plasmid pSK-TVjr (3.5kb) was prepared by inserting into pSK-gDs / tatjr cut into pieces.

C. Preparation of Plasmid pGX10-HIV / TV (FIG. 14B)

The plasmid pSK-TVjr was digested with restriction enzymes AscI and NotI, and then a small size DNA fragment (0.5 kb) was cut with pGX10-HIV / TV with the same restriction enzymes AscI and NotI, and then combined with the resulting DNA fragment (3.7 kb). pGX10-HIV / TV (4.2 kb) was prepared.

Example 12

Preparation of pGX10-HIV / VNTV (FIG. 15)

The following oligonucleotides were synthesized:

Sal5CMV (CCCG GTCGAC GGCCAG TGA ATT G): SEQ ID NO: 28 (Sense)

Sal3enh (CTT CTG AA GTCGAC GGA TCC GC): SEQ ID NO: 29 (antisense)

PCR was performed using these synthetic oligonucleotides as a primer, and the plasmid pGX10-HIV / TV was used as a template, and the product (2.3 kb) digested with restriction enzyme SalI was inserted into plasmid pGX10-HIV / VN digested with the same restriction enzyme SalI. Plasmid pGX10-HIV / VNTV was prepared.

Example 13

Construction of pGX10-HIV / TVVN (FIG. 16)

PCR was performed using the following synthetic oligonucleotide as a primer and plasmid pGX10-HIV / VN as a template, and the product (3.0 kb) digested with restriction enzyme SalI was inserted into plasmid pGX10-HIV / TV digested with the same restriction enzyme SalI. Plasmid pGX10-HIV / TVVN was prepared by:

Sal5CMV (CCCG GTCGAC GGCCAG TGA ATT G): SEQ ID NO: 28 (Sense)

Sal3enh (CTT CTG AA GTCGAC GGA TCC GC): SEQ ID NO: 29 (antisense)

Example 14

Preparation of pGX10-hIL-12m (pGX10-hp35 / IRES / hp40) (FIG. 17)

A. Manufacturing pSK-hp35 and pSK-hp40 (FIG. 17A)

820 bp using RT-PCR (PCR System 2400, Perkin Elmer) using complementary primers from NC37 cells, human B cells activated by phorbol myrystic acetate (PMA). The cDNAs of human p35 subunits and p40 subunits of 1050 bp were cloned and amplified by PCR. The complementary primers used for amplifying human p35 subunits are as follows:

hp35 (5'-CCCGGGAAAGTCCTGCCGCGCCTCG-3 '): SEQ ID NO: 44 (Sense)

hp35 (5'-ACAACGGTTTGGAGGGA-3 '): SEQ ID NO: 45 (antisense)

The complementary primers used for amplifying human p40 subunits are as follows:

hp40 5'-AGAGCACCATGGGTCACCAGCAGTTGG-3 ': SEQ ID NO: 46 (Sense)

hp40 5'-CGATGCGGCCGCACCTAACTGCAGGG-3 ': SEQ ID NO: 47 (antisense)

By subcloning the amplified cDNA into the starting vector pBluescriptSK + (Stratagene) and inserting the p35 and p40 subunit genes into the SmaI portion of the vector pBluescriptSK + (Stratagene), respectively, pSK-hp35 (3.8kb) and pSK-hp40 ( 4.0 kb) was prepared.

B. Preparation of pSK-IRES (FIG. 17A)

In order to construct a bibictronic vector expressing genes encoding p35 and p40 subunits, the IRES gene of EMCV was first obtained by RT-PCR and digested with EcoRV, followed by EcoRV restriction enzyme of vector pBluescriptSK + (Stratagene). Insertion into the site produced a vector pSK-IRES (3.5 kb). The complementary primers used were as follows:

IRES 5'-AAGATATCGAATTCCCCCTC-3 ': (SEQ ID NO: 48; Sense)

IRES 5'-TTGCCATGGCCATATTTATCA-3 ': (SEQ ID NO: 49; antisense)

C. pSK-hp35 / IRES / hp40 (FIG. 17A)

Vector pSK-IRES was digested with restriction enzyme EcoRV and pSK- fragment was obtained by cutting pSK-hp35 with restriction enzymes SmaI and NotI and inserting an hp35 fragment (0.8kb) filled with T4 DNA polymerase. hp35 / IRES (4.3 kb) was prepared. The hp40 fragment (1.0 kb) obtained by cleaving pSK-hp40 with NcoI and NotI was inserted into a site where pSK-hp35 / IRES was cleaved with the same restriction enzyme to prepare a vector that expresses genes encoding p35 and p40 subunits together. It was. The vector was treated with restriction enzymes SmaI and ClaI, and then sewn with ligase to remove some of the front portion of the hp35 restriction enzyme. The thus prepared vector was named pSK-hp35 / IRES / hp40.

D. pSK-hp40-N222L (FIG. 17B)

PCR was performed using pSK-hp40 as a template and replacing with T7 primer and hp40-N222L antisense primer to replace asparagine acid, the 222nd amino acid of hp40, with leucine. Similarly, secondary PCR was performed using T3 primers and hp40-N222L sense primers. This resulted in the formation of two PCR fragments that shared a common site containing mutational points. Secondary PCR was performed using a mixture of the fragments as a template and using flanking primers. As a result, their fusion products were formed and the fragments were digested with restriction enzymes NcoI and NotI. Plasmid pSK-hp40-N222L (4.0 kb) was prepared by inserting into a vector pBluescriptSK + (Stratagene) (3.0 kb) digested with restriction enzyme SmaI. The primers used are as follows:

T7 (5'-GTAATACGACTCACTATAGGGC-3 '): SEQ ID NO: 50 (Sense)

hp40-N222L (5'-TAT GAGCTC TACACCAGCAGC-3 '): SEQ ID NO: 51 (antisense)

T3 (5'-AATTAACCCTCACTAAAGGG-3 '): SEQ ID NO: 52 (antisense)

hp40-N222L (5'-GGTGTA GAGCTC ATACTTGAG-3 '): SEQ ID NO: 53 (Sense)

The bolded part shows the wild-type hp40 and the altered base sequence, and the underlined part shows the SacI restriction enzyme site generated by mutation.

E. Preparation of pSK-hp35 / IRES / hp40-N222L (FIG. 17B)

Plasmid pSK-hp35 / IRES / hp40-N222L (5.3kb) was prepared by replacing hp40-N222L fragment of plasmid pSK-hp40-N222L with hp40 fragment of plasmid pSK-hp35 / IRES / hp40 using restriction enzymes NcoI and NotI. It was.

F. Preparation of pGX10-hp35 / IRES / hp40-N222L (FIG. 17C)

The following oligonucleotides were synthesized to transfer the hp35 / IRES / hp40-N222L fragment into a vector capable of expression in mammalian cells:

hIL-12 (5'-AACTCGAGGTCGACGGTATC-3 '): SEQ ID NO: 54 (Sense)

hIL-12 (5'-TTCTCGAGCGGCCGCACCT-3 '): SEQ ID NO: 55 (antisense)

These synthetic oligonucleotides were used as primers and amplified using the vector pSK-hp35 / IRES / hp40-N222L as a template to obtain hp35 / IRES / hp40-N222L fragments. The obtained fragment was treated with restriction enzyme XhoI and then inserted into the site cut with the restriction enzyme XhoI to prepare plasmid pGX10-hp35 / IRES / hp40-N222L (or pGX10-hp35 / IRES / hp40) (5.9kb). .

Laboratory Example 1

Expression of the vector pGX10

As described below, the human growth hormone (hGH) gene was inserted into the multi-cloning site of the pGX-10 vector according to the present invention, and the hGH expression level was compared with the control vector. The experimental results are shown graphically in FIG. 18.

A. Construction of plasmids expressing hGH

Construction of pTV2 / hGH (FIG. 19): DNA with genes of human growth hormone (GeneBank Accession No. K02382; Ikehara M., et al., Proc. Natl. Acad. Sci USA 81,5956-60, (1984) ) And amplified PCR using hGHF (AAGAA TTC GAT ATG TTCCCAA CTAT TC: SEQ ID NO: 56 sense) and hGHR (TTT TCT AGA ATTA GAAgCC ACAC GACC: SEQ ID NO: 57 antisense) as primers, and the product. PTV2 was prepared by cutting with restriction enzymes EcoRI and XbaI and inserting it into the sites cut with EcoRI and XbaI.

Construction of pGX1 / hGH (FIG. 20): pTV2 / hGH was cut with restriction enzymes EcoRI and XbaI and a 0.6 kb DNA fragment was prepared by inserting the vector pGX1 into a site cut with restriction enzymes EcoRI and XbaI.

Construction of pGX10 / hGH (FIG. 24): pTV2 / hGH was cut with restriction enzymes EcoRI and XbaI and a 0.6 kb DNA fragment was prepared by inserting vector pGX10 into a site cut with restriction enzymes EcoRI and XbaI.

Construction of pGX0 / hGH (FIG. 23): KanXmF (TTG GAA AAC GTT CTT CGG GCG GCC TAT TGG TTA AAA AAT GAG C: SEQ ID NO: 58 sense) and KanXmR (CTT GAA CGT TTT) with pZero-2 (Invitrogen) as a template CCT TTT CAC GTA GAA AGC (SEQ ID NO: 59 antisense) was used as a primer for PCR amplification, and the product was cut with restriction enzyme XmnI to insert vector pTV2 into the site cut with restriction enzyme XmnI to prepare vector pGX0. pGX0 / hGH was prepared by cutting pTV2 / hGH with restriction enzymes EcoRI and XbaI and inserting a 0.6 kb DNA fragment into the site cut with vector pGX0 with the same restriction enzymes EcoRI and XbaI.

B. Transfecting HeLa Cells

(a) Each 2.0 × 10 5 cells were placed in each well of a 6-well plate, and 2 ml of DMEM (10% FCS) medium was added and incubated at 37 ° C. and 5% carbon dioxide for 18 hours. (b) 8 ug of hGH expressing plasmid DNA was mixed with 100ul of 0.2M CaCl ₂ solution and mixed well. (c) The solution of (b) was dropped dropwise into 100ul 2X HBS solution and left at room temperature for 15 minutes. (d) The solution of (c) was gently mixed with a pipette and sprinkled onto the cells cultured in (a). (e) After 12 hours of incubation under the same conditions as in (a), the medium was changed and cultured for another 24 hours, and then the hGH of the medium was quantified.

C. hGH Assay

Medium in which the transfected cells were cultured was used. Roche's hGH ELISA kit (product number 1585878) was used to dilute the medium 200 times with the attached sample buffer and other methods were followed in the attached manual.

The values shown in FIG. 18 indicate the relative expression level (hGH concentration of the culture medium) of each vector when the expression level of hGH of pTV2 / hGH is defined as 100. That is, the larger the value, the higher the expression level of hGH in the culture medium after infection of the vector DNA. Therefore, it can be seen from FIG. 18 that the vector pGX10 of the present invention shows hGH expression intensity three times higher than that of the control vector pTV2.

Laboratory Example 2

Immunogenicity of Vector pGX10

Female BALB / c, 8-week-old, was prepared in Lab Example 1 with a solution of hGH expressing plasmid DNA (pTV-2 / hGH, pGX-0 / hGH and pGX-10 / hGH) dissolved in physiological saline to 1 ug / ul. 100 ul of each mouse was injected into the leg muscle (tibialis anterior muscle) to observe the immune response. Three weeks after the injection, blood was collected from the sublingual vein of the mouse and antibody ELISA was performed. Antibody ELISA was performed according to the method described in Song et al., J. Virol, 74, 2920, (2000). At 9 weeks, 100 ug of DNA was injected again in the same manner. At 11 weeks, blood was collected from mice in the same manner as before, and the relative IgG levels were measured by absorbance at 450 nm. The result is shown in FIG.

In Figure 25, the leftmost of the values of each plasmid represents the amount of hGH antibody before immunization as an OD (absorbance) value, and the middle values are the OD values of anti hGH in serum collected at 3 weeks after immunization. The value on the right represents the OD value of anti hGH in serum taken at 9 weeks after immunization. Higher O.D values indicate a stronger hGH antibody response. Therefore, it can be seen from FIG. 25 that the immunization of pGX10-hGH according to the present invention induced high antibody response at both 3 and 9 weeks compared to the control group pTV-hGH.

Comparing the degree of in vitro expression with the production of antibody after immunization using hGH as the indicator gene, the results of this Example 1 and 2 demonstrate that the vector pGX10 of the present invention is superior and improved over the control vector pTV.

Laboratory Example 3

Evaluation of Immune Efficacy of Plasmids of the Invention I

A. Immunization of Monkeys with Immunogenic Plasmids (see FIG. 26-Experiment Protocol)

As a control, plasmids pTV-SIV / GE and pTV-SIV / dpol were dissolved in saline (0.85% NaCl) at a concentration of 1 mg / ml, and then pTV-SIV / GE and pTV-SIV per rhesus macaque monkey. A total of 800 ug was injected into the monkey leg in total of 400 ug / dpol of 400 ug each (3 in total) (groups 2 and 5).

As a test group, 400 mg (2 mg / ml) of plasmids pGX10-SIV / GE, pGX10-SIV / dpol, pGX10-SIV / VN, and pGX10-SIV / TV of the present invention, respectively, totaled 1.6 mg (rhesus macaque monkey). A total of four intramuscular injections were made to the legs (3 in total) (group 3).

B. Immunization of Monkeys with Immunogenicity and Adjuvant Plasmids (see FIG. 26-Experiment Protocol)

In another rhesus macaque monkey (all three), another adjuvant of the invention with pGX10-SIV / GE, pGX10-SIV / dpol, pGX10-SIV / VN and pGX10-SIV / TV Plasmid) pGX10-hIL-12m was also inoculated with a total of 2mg of DNA, 400ug (2.5mg / ml), respectively (Group 4).

At the 8th, 17th, 25th and 44th days after the initial immunization, the same DNA was injected using the same DNA as the first immunization of each group of monkeys.

C. Determination of the number of immune cells infected with SIVmac239 in the blood

To investigate the degree of immunization with various plasmid DNA induced the immune response to inhibit the proliferation of virus SIVmac239 in monkeys, the degree of SIVmac239 infection of peripheral blood mononuclear cells (PBMC) was examined. The extent of infection was determined by examining the proportion of infectious immune cells in the blood cells.

Two weeks after the last immunization (46 weeks after the first immunization), infection was done by intravenous injection of 10 times SIVmac239 (primate center, Deutsches Primatenzentrum, Germany; dose 1 ml) of a predetermined MID50 (monkey infectious dose). At two, four, eight, twelve, sixteen, twenty, and twenty-four weeks after infection with SIVmac239, immune cells (PBMCs) from control and test monkey blood were isolated and infected with SIV in one million PBMCs. The number of PBMCs was determined by the limiting-dilution cocultivation method (Lu et al., J. Virol. 70: 3978, 1996). To explain this method briefly, 6 ml of monkey blood (citrate-treated blood) is placed in a tube (lympho-prep, Greiner) containing 3 ml of Ficoll-hypaque (Pharmacia) and centrifuged at 20 ° C. and 1200xg for 20 minutes. Red blood cells, PBMC and plasma were separated. Serial dilutions were performed by dividing the separated PBMCs from 1 x 10 ⁶ cell numbers by 1/2, and 10 ⁵ numbers of C8166 were added to the target cells and cultured together (culture solution RPMI 1640 + 10% fetal bovine serum). After 3-4 days, the cells were cultured for 2 weeks by reducing half of the culture solution containing the cells and filling the new culture solution with the rest. After the incubation (centrifuged at 800 xg for 10 minutes), the supernatant was taken, and the p27 antigen detection ELISA was performed by the method provided by the manufacturer using the Coulter's kit to confirm the final dilution rate of PBMC that was positive. The proportion of infectious cells in one million PBMC cells was measured. If p27 positive in 2.5 X 10 ⁵ PBMC and p27 negative in the next dilution (1.25X105), the number of infectious cells in this PBMC is 4 per million cells.

The result is shown in FIG. 27. The reduced percentage of infectious immune cells means that the percentage of cells that SIVmac239 can proliferate is reduced, which means that SIVmac239 proliferation is better inhibited in monkeys.

FIG. 27 shows infectious cell numbers per million PBMCs at 0, 2, 4, 8, 12, 16 weeks after blood infection of SIVmac239 in each group of monkeys. As shown in FIG. 27, the monkeys immunized with pTV-SIV / GE and pTV-SIV / dpol (group 2 + 5) dropped to less than 0.13% (128/1000000) after 8 weeks of infection, and then 24 weeks later. Two out of five (of 1 million immune cells) had a value of less than 1 (number of infected cells) and one had a value of 16, compared to 1024-2048 of monkeys (group 1) immunized with the vector at this point. It has been shown to inhibit virus proliferation by 100-1000 fold. However, the remaining two of the five in Group 2 + 5 had values of 128-256 at 24 weeks, indicating that virus proliferation was inhibited by only eight-fold compared to Group 1. Three monkeys (group 3) immunized with plasmids pGX10-SIV / VN and pGX10-SIV / TV with plasmids pGX10-SIV / GE and pGX10-SIV / dpol according to the present invention were used until 12 weeks and 24 weeks after infection. The number of infectious cells per million PBMCs was as low as 16 or less, indicating that the efficacy of the DNA vaccine used in this group to protect against the proliferation of the virus induced by the control plasmids pTV-SIV / GE and pTV-SIV / dpol. Means better than immunization.

Monkeys immunized with an adjuvant plasmid pGX10-hIL-12m with immunogenic plasmids pGX10-SIV / GE, pGX10-SIV / dpol, pGX10-SIV / VN and pGX10-SIV / TV according to the present invention (Group 4 ) Shows that the number of infected cells per million PBMCs is on average 10 times lower (4-512) compared to other groups (Group 1, Group 2 + 5, Group 3) at 2 weeks after infection. The proliferation inhibitory effect is thought to be excellent at 2 weeks when the virus's most proliferation occurs. However, after 12-24 weeks of infection, the number of infected cells in one of the three monkeys increased slowly. The monkey had a very low number of infected cells at 2 weeks post-infection, resulting in a low increase in viral loads decline at the peak of the virus titer (2 weeks post-infection), resulting in a gradual increase in infected cells after 20 weeks. Appeared. This is consistent with previous reports (Staprans SI J. Virol 73,4829) that the rate of reduction of virus titers is important in determining set-point titers of virus titers. However, the other two animals in this group show less than 8 low infectious cells per million PBMCs even at 24 weeks, indicating better protective efficacy than group 2 + 5. Comparing the results of groups 3 and 4 with the results of group 2 + 5, the vaccine immunized with the secondary plasmids apparently reduced the number of SIVmac239 infectious cells in the blood, thus immunizing the DNA vaccine with the secondary plasmid according to the present invention. Suggests excellent efficacy in inhibiting virus proliferation following AIDS virus infection.

Lab Example 4

Evaluation of Immune Efficacy of Plasmids of the Present Invention II

A. Immunization of Monkeys with Immunogenic Plasmids (see FIG. 26-Experiment Protocol)

The monkey was immunized using an immunogenic plasmid in the same manner as A of Experimental Example 3.

B. Immunization of Monkeys with Immunogenic Plasmids and Adjuvant Plasmids (see FIG. 26-Experiment Protocol)

Monkeys were immunized using immunogenic plasmids in the same manner as B of Laboratory Example 3.

C. Measurement of SIVmac239 RNA Copies in Plasma

The RNA copy number in plasma was measured by Quantitative Competitive Reverse Transcription PCR (RT-PCR) at Biomedical Primate Research Center (BPRC). The principle of this method is to mix the RNA isolated from the plasma with the standard SIVmac239 RNA already known as a template, and perform RT-PCR with primers with conserved sequences such as gene gag. If the copy number of the RNA in plasma is higher than the copy number of the standard RNA, the PCR product is amplified from the plasma RNA and vice versa. This is confirmed by agarose gel electrophoresis to check the size. Standard RNA uses the same primers engineered so that the PCR product is smaller or larger than the original SIVmac239 RNA, thus correcting for differences due to different product sizes. A detailed description of this method is described in the paper by Watson et al. (J. Virol 71,284-290, (1997)).

The measurement of RNA copy number in plasma is another indicator of the extent of viral infection. When SIV proliferates, RNA is secreted into the plasma, and if the number of RNA copies in the plasma is low, the virus's host (monkey) inhibits the growth of RNA. The result is shown in FIG.

As shown in FIG. 28, group 1 infected monkeys (all monkeys) showed more than 500,000 copies of SIV RNA titers in 1 ml of plasma at 4-24 weeks post infection. In addition, three of five monkeys (group 2 + 5) immunized with plasmids pTV-SIV / GE and pTV-SIV / dpol, which were used as controls in the present invention, decreased from less than 100,000 copies at 12 weeks after infection, and then ( A further decrease was observed in weeks 16 and 24). However, the other two showed lower viral copies than infected monkeys (Group 1) at 12 weeks, but increased to over 100,000 copies at 16 weeks, indicating no significant difference from infected monkeys (Group 1). there was.

In group 3 using a regulatory gene according to the present invention, all three animals were found to show titers between 10,000 and 100,000 at 12 and 16 weeks, 100 times compared to monkeys infected at the same time (group 1). The low titer was found.

As a result, the viral titers of plasma were similar to those of the infected cells, with the immunogenic plasmids pGX10-SIV / GE and pGX10-SIV / dpol, rather than immunized with the immunogenic plasmids pTV-SIV / GE and pTV-SIV / dpol. Immunization with the addition of a supplementary gene was judged to be the most effective in inhibiting virus proliferation after infection.

Monkeys immunized with the adjuvant gene and adjuvant plasmid pGX10-IL-12m DNA (Group 4) showed the lowest plasma copy number compared to all groups at 2 weeks post-infection, after which they were similar to those of Group 3 monkeys. . One group of pGX10-hIL-12m coadministered had very low viral titers at 2 weeks and increased titers at 16 weeks.

Laboratory Example 5

Evaluation of Immune Efficacy of Plasmids of the Present Invention III

A. Immunization of Monkeys with Immunogenic Plasmids (see FIG. 26-Experiment Protocol)

Monkeys were immunized using immunogenic plasmids in the same manner as A of Laboratory Example 3.

B. Immunization of Monkeys with Immunogenic Plasmids and Adjuvant Plasmids (see FIG. 26-Experiment Protocol)

Monkeys were immunized using immunogenic plasmids in the same manner as B of Laboratory Example 3.

C. Determination of the Number of Absolute CD4 + Cells in Blood

As the most common method for determining the progression of AIDS in monkeys and humans, the number of absolute CD4 + cells per unit blood was measured. When SIVmac239 is infected with monkeys, CD4 + cells, the main infectious cell, develop apoptosis, which gradually decreases in number. Reduction of CD4 + cells reduces the monkey's ability to immunize, causing the monkey to die from AIDS-associated disease. In other words, a decrease in the absolute CD4 + cell number indicates a decrease in the host's immune capacity and implies that the SIVmac239 did not defend well against infection.

Peripheral blood lymphocytes (PBL) of monkey blood at 1, 2, 4, 6, 8, 12, 16, 20, 24, and 28 weeks after infection with SIVmac239. The number of CD4 + cells was measured using a FACS (fluorescent automated cell sorter; Becton-Dickinson, FACScan) (Bjorn, et al., J. Virol. 72,7846, (1998)). The result is shown in FIG.

FIG. 29 shows the percentage of absolute CD4 + T cells per ul of blood at each time point with 100% prevalue before infection. Prevalued CD4 + T cell numbers were measured by blood collection at least two time points prior to infection with SIV. In FIG. 29 one of group 1 decreased slowly, showing less than 50% of prevalue values at 28 weeks post infection. Monkeys immunized with the immunogenic plasmids pTV-SIV / GE and pTV-SIV / dpol had an absolute CD4 + T cell count of less than 50% at this time point (28 weeks). However, according to the present invention, both group 3 and group 4 using the auxiliary gene showed normal CD4 + cell numbers. This means that immunization of the adjuvant gene with the immunogenic plasmids pGX10-SIV / GE and pGX10-SIV / dpol according to the present invention can best prevent the reduction of CD4 + cell number due to SIVmac239 infection.

Laboratory Example 6

Evaluation of Immune Efficacy of Plasmids of the Invention IV

A. Immunization of Monkeys with Immunogenic Plasmids (see FIG. 26-Experiment Protocol)

Monkeys were immunized using immunogenic plasmids in the same manner as A of Laboratory Example 3.

B. Immunization of Monkeys with Immunogenic Plasmids and Adjuvant Plasmids (see FIG. 26-Experiment Protocol)

Monkeys were immunized using immunogenic plasmids in the same manner as B of Laboratory Example 3.

C. Measurement of gag specific T cell responses induced by SIVmac239 DNA immunization

To measure the T cell immune response induced by the SIV DNA vaccine, an ELISPOT assay method was used in which PBMCs were stimulated with a gag peptide pool and then the number of PBMCs secreting INF-γ was used.

5 ug per well (100 ul in PBS) of anti-IFN-γ mAb was placed in a 96 well plate (product of U-cytech) for 4 hours and washed 6 times with PBST (PBS + 0.05% Tween-20). Add 200 ul of 2% BSA / PBS per well and block where the mAb is not bound at 37 ° C. for one hour, followed by 2 × 10 ⁵ PBMC (purification of PBMC is shown in Example 3B). 100 μL per well of ELISPOT assay medium (45% RPMI1640, 45% X-VIVO, 10% fetal bovin serum, 1% antibiotic), followed by SIV gag p15 and p26 overlapping peptides (NIBSC, cat. Number ARP714.1-22 and EVA776.1-776.14,) were added to the 10ul ELISPOT assay medium so that the final concentration of each peptide was 1 ug / ml. After the plate was left in a CO ₂ incubator for 24 hours, the culture medium was removed, and 200 μl of cold distilled water (ice-cold deionized water) was lysed. After washing the plate 10 times with PBST, 1 ug (100 ul in PBS + 1% BSA) rabbit polyclonal biotinylated anti-IFN-gamma detector Ab, U- cytech) was added and left at 37 ° C. for 1 hour, and washed 7 times with PBST. 50 ul of gold-labeled anti-biotin IgG (U-cytech) per well was added to the plate, and washed 10 times with PBST after standing at 37 ° C for one hour. 35 ul of an activator mixture (U-cytech) was added to each well and left for 30 minutes to generate a spot. The number of spots was measured within 48 hours after washing the plate with water.

The result is shown in FIG. Figure 30 shows the number of T cells secreting IFN-γ by stimulation of gag peptide in 1 million PBMCs. This indicates the number of T cells specific for SIVmac239 gag, indicating that the higher the value, the stronger gag specific T cell immune response was induced.

As shown in FIG. 30, the group immunized with the control immunogenic plasmids pTV-SIV / GE and pTV-SIV / pol (group 5) and the immunogenic plasmids pGX10-SIV / GE, pGX10-SIV / pol, pGX10- according to the present invention In the group immunized with SIV / VN and pGX10-SIV / TV (group 3), gag specific immune responses were induced but the intensity was not different. It means that pTV2 and pGX10 vectors do not show a significant difference in inducing T cell immune responses in monkeys, and because gag specific cellular immune responses are similar, the immunogenic plasmids pGX10-SIV / GE, pGX10-SIV according to the present invention. The superior viral growth inhibitory effect observed in the groups immunized with / dpol, pGX10-SIV / VN and pGX10-SIV / TV is expected to be due to the immunization of the cogene rather than the difference of the vector pGX10.

In addition, since there is no difference in gag-specific T cell responses of groups 5 and 3, in the present invention, a quantitative difference in immune active sequences such as CpG motifs resulting from a difference in the amount of immunized DNA increases the immune response. The assumption that there is a difference in defense effectiveness (Cafaro A., et al., Vaccine 19,2867, (2001)) can be excluded. On the other hand, when the co-plasmid pGX10-hIL-12m DNA was immunized together, it showed higher gag-specific cellular immune response than the group not administered with it (Group 3).

Laboratory Example 7

Confirmation of expression of immunogenic plasmids pGX10-SIV / pol and pGX10-SIV / GE of the present invention (FIG. 31)

Each 3.0 × 10 ⁵ HeLa cells were plated with a 60 mm plate (Felcon), 4.5 ml of DMEM (10% FCS) medium, and incubated at 37 ° C. and 5% carbon dioxide for 12 hours. 10 ug of each DNA (pGX10, pTV2, pGX10-SIV / GE, pGX10-SIV / pol, pTV2-SIV / GE) was mixed with 250ul of 0.2M CaCl2 solution and mixed well. The solution was dropped dropwise into 250ul 2X HBS solution, left at room temperature for 15 minutes, and then gently mixed with a pipette and sprinkled onto the cultured HeLa cells. After incubating for 60 hours at 37 ° C. and 5% carbon dioxide conditions, the medium was discarded, washed once with PBS, and the cells were scraped to perform SDS-PAGE (SDS-polyacrylamide gel electrophorsis). After the PAGE was completed, the gel protein was transferred to the nitrocellulose membrane (Schleicher & Schuell) (transfer conditions and buffer composition were determined by molecular cloning, 18.64-66). Reference). The membrane is blocked with a blocking solution (5% skim milk / TBS) at room temperature for 2 hours and at 5 minute intervals with a washing buffer (TBS + 0.05% tween-20). It was washed in a shaker three times. A blocking buffer containing 1/3000 (v / v) of SIVmac anti-serum (NIBSC APR416) was reacted at room temperature for 3 hours, and then washed three times with a washing buffer every 10 minutes. washing). A blocking buffer containing 1/3000 (v / v) of HRP-conjugated anti-human IgG (Sigma) was reacted at room temperature for 2 hours and then washed again for 10 minutes. (washing buffer) was washed four times (washing). After washing the membrane with distilled water five times, 10 ml of a mixture of Luminol / Enhancer solution (Pierce) and Stable Peroxide Solution (Pierce) in a 1: 1 ratio was poured into a peroxidase reaction and an X-ray. The film was exposed for 10 minutes and then developed to obtain expression pictures.

As shown in FIG. 31, pGX10-SIV / GE expresses Env and Gag proteins of SIV, and pGX10-SIV / dpol expresses RT-INT polyprotein. 31 and 32, the expression levels of Gag and Env proteins and RT-INT polyproteins in the case of pTV2-SIV / GE and pTV2-SIV / dpol were compared to pGX10-SIV / GE and pGX10-SIV / dpol. Was significantly lower. This result means that the vector pGX10 has better expression efficiency than pTV2 in vitro.

Laboratory Example 8

Expression of the immunogenic plasmids pGX10-SIV / VN and pGX10-SIV / VNTV of the present invention (FIG. 33)

Plasmids pGX10, pGX10-SIV / VN, pGX10-SIV / VNTV were introduced into HeLa cells (tansfection), and SIV Nef polyclonal Ab (NIBSC APR444) was used to detect Vif-Nef protein. HRP-linked anti-rabbit IgG was used. The rest of the experimental method is the same as in Experimental Example 7.

As shown in FIG. 33, pGX10-SIV / VN and pGX10-SIV / VNTV expressed Vif-Nef protein well in HeLa cells.

Laboratory Example 9

Confirmation of expression of immunogenic plasmid pGX10-SIV / TV of the present invention (FIG. 34)

Plasmids pGX10, pGX10-SIV / TV were introduced into HeLa cells (tansfection) and SIV Tat polyclonal Ab (NIBSC APR4006) was used to detect Tat-Vpx protein and HRP-coupled anti-rabbit as secondary antibody. IgG was used. The rest of the experimental method is the same as in Experimental Example 7.

As shown in FIG. 34, pGX10-SIV / TV expressed Tat-Vpx protein well in HeLa cells.

Toxicity Experiment Example 1

Administration of HIV DNA Vaccines in Chimpanzees

HIV DNA of the present invention containing immunogenic plasmids pGX10-HIV / dpol, pGX10-HIV / GE and pGX10-HIV / VNTV and auxiliary plasmid pGX10-hIL-12m of chimpanzees infected with HIV-1 (HIV IIIB) The vaccine was administered by intramuscular injection (Gluteus maximus or deltoid muscle) at 2 mg for each construct. One chimpanzee was administered four times at a monthly interval, and another chimpanzee was administered four times at a monthly interval, followed by four month intervals, followed by another five month intervals.

During the first year after immunization, the clinical signs, body weight, body temperature, physical examination, blood cell abnormalities, and excreta abnormalities (urinalysis) were observed, but all showed normal values.

Toxicity Laboratory Example 2

Administration of HIV DNA Vaccines in Humans

HIV DNA vaccine of the present invention containing the immunogenic plasmids pGX10-HIV / dpol, pGX10-HIV / GE and pGX10-HIV / VNTV and the auxiliary plasmid pGX10-hIL-12m of the present invention to 8 Ukrainians infected with HIV-1 Was administered 1 mg once for each construct. Four men were given six times at two month intervals, two at five times at two month intervals, and four at two months for two others. For each route, parenteral intramuscular injection was adopted, and the gluteus maximus and deltoid muscle were alternately administered at each round.

During the immunization period, diseased (clinical sign), weight, body temperature (physical examination), blood cell (haematology), fecal abnormalities (urinalysis) were observed, but all showed normal values.

1 is a construction map of the vector pGX10 used to express the immunogenic genes of SIVmac239 or HIV-1 according to the present invention.

2 is a genetic map of the vector pGX10 (3.6 kb) used to express the immunogenic gene of SIVmac239 according to the present invention.

3 is a restriction map of the vector pGX10 (3.6 kb) consisting of 3641 nucleotides as a vector used to express the immunogenic gene of SIVmac239 according to the present invention (wherein the CMV promoter is nucleotides 3619-3641 and nucleotides 1-661) TPL is nucleotide 666-1101; SV40 late polyA is nucleotide 1236-1457; SV40 enhancer is nucleotide 1469-1713; kanamycin resistant ORF is nucleotide 1727-2521; ColE1 origin corresponds to nucleotide 2907-3580). Specific restriction sites are shown in blue and underlined.

4 is a restriction map of the SIVmac239 clone.

5 is a construction map of pGX10-SIV / GE according to the present invention used as an immunogenic plasmid of SIVmac239.

6 is a construction map of pGX10-SIV / dpol according to the present invention used as an immunogenic plasmid of SIVmac239.

7 is a construction map of pGX10-SIV / VN according to the present invention used as an immunogenic plasmid of SIVmac239.

8 is a construction map of pGX10-SIV / TV according to the present invention used as an immunogenic plasmid of SIVmac239.

9 is a construction map of pGX10-SIV / VNTV according to the present invention used as an immunogenic plasmid of SIVmac239.

10 is a construction map of pGX10-SIV / TVVN according to the present invention used as an immunogenic plasmid of SIVmac239.

11 is a construction map of pGX10-HIV / GE according to the present invention used as an immunogenic plasmid of HIV-1.

12 is a construction map of pGX10-HIV / dpol according to the present invention used as an immunogenic plasmid of HIV-1.

13 is a construction map of pGX10-HIV / VN according to the present invention used as an immunogenic plasmid of HIV-1.

14 is a construction map of pGX10-HIV / TV according to the present invention used as an immunogenic plasmid of HIV-1.

15 is a construction map of pGX10-HIV / VNTV according to the present invention used as an immunogenic plasmid of HIV-1.

16 is a construction map of pGX10-HIV / TVVN according to the present invention used as an immunogenic plasmid of HIV-1.

17 is a construction map of the adjuvant plasmid pGX10-hp35 / IRES / hp40 (also referred to as pGX10-hIL-12m) according to the present invention used as an adjuvant for the AIDS DNA vaccine of the present invention.

FIG. 18 is a graph showing a comparison of human growth hormone expression levels of the vector pGX10 of the present invention used to express the immunogenic gene of SIVmac239 according to the present invention and the known vectors pTV2 and pGX1 used as controls.

19 is a construction map of the plasmid pTV2 / hGH used as a control for comparing human growth hormone expression levels with the vector pGX10 of the present invention used for expressing immunogenic genes of SIVmac239 or HIV-1 according to the present invention.

20 is a construction map of the plasmid pGX1 / hGH used as a control for comparing human growth hormone expression levels with the vector pGX10 of the present invention used for expressing immunogenic genes of SIVmac239 or HIV-1 according to the present invention.

FIG. 21 is a restriction map of the accessory plasmid pCAGGSIL-4 used as an adjuvant for the AIDS DNA vaccine of the present invention.

FIG. 22 is a restriction map of the accessory plasmid pCAGGSIL-12 used as an adjuvant for the AIDS DNA vaccine of the present invention. FIG.

Figure 23 shows the plasmid pGX0 / hGH of the plasmid pGX0 / hGH of the present invention used to express the immunogenic genes of SIVmac239 or HIV-1 according to the present invention and immune inducibility through human growth hormone expression This is a map.

Figure 24 Construction of the plasmid pGX10 / hGH used to confirm immunoinducibility through human growth hormone expression of the vector pGX10 according to the invention used to express the immunogenic genes of SIVmac239 or HIV-1 according to the invention It is a map.

Figure 25 Immune induction via human growth hormone expression of plasmids pTV2 / hGH and pGX0 / hGH of the vector pGX10 of the present invention used to express the immunogenic genes of SIVmac239 or HIV-1 according to the present invention and plasmids pTV2 / hGH and pGX0 / hGH used as controls This graph shows the last name results.

Figure 26 is an experimental protocol for evaluating the immune efficacy of immunogenic plasmids according to the present invention.

Figure 27 is a result of evaluating the immune efficacy of the immunogenic plasmid according to the present invention by measuring the number of immune cells in the blood of rhesus monkey infected with SIVmac239 (that is, each test group according to the time elapsed after monkey infection of SIVmac239 A graph showing the number of infected immune cells (Infectious PBMC) out of 1 million immune cells (PBMCs) in the blood of monkeys. The x-axis represents the time elapsed after infection with SIVmac239, the y-axis represents the number of infectious immune cells in the million immune cells, and the four or five digits in the graph are unique numbers for each monkey.

28 shows the results of evaluating the immunological efficacy of immunogenic plasmids according to the present invention by measuring the copy of SIV RNA in the plasma of rhesus monkey infected with SIVmac239 (ie, each test group according to the time elapsed after infection of SIVmac239). In monkeys, showing the titer of SIV RNA detected in 1 ml of plasma). The x-axis represents the number of weeks elapsed after infection with SIVmac239, the y-axis represents the number of molecules of SIVmac239 RNA per ml of plasma, and the four or five digits in the graph are unique numbers for each monkey.

FIG. 29 shows the results of evaluating the immune efficacy of immunogenic plasmids according to the present invention by measuring the number of absolute CD4 + cells in the blood of rhesus monkeys infected with SIVmac239 (ie, each test according to the time elapsed after infection with SIVmac239). In group monkeys, expressed as a percentage of the value before infecting the number of absolute CD4 + cells per unit blood. The x-axis represents the time elapsed after infection with SIVmac239, and the number on the y-axis represents the percentage of each time point after converting the number of CD4 + immune cells in 1 ul of blood to 100% before infecting SIVmac239. will be. Also, the four or five digits in the graph are unique numbers for each monkey.

FIG. 30 shows the results of evaluating the immune efficacy of immunogenic plasmids according to the present invention by measuring gag-specific T cell responses induced by SIV DNA immunization (ie, induced by immunization in monkeys of each test group just prior to infection of SIVmac239). T cell immune response measured by ELISPOT assay). The x-axis represents the unique number of each monkey, and the y-axis represents the number of cells that secrete IFN-γ by stimulation of gag peptide among 1 million immune cells.

Figure 31 shows the antigen using immunoblotting after transfection of the immunogenic plasmids pGX10-SIV / GE and pGX10-SIV / dpol of the present invention and the immunogenic plasmid pTV2-SIV / GE as a control group to HeLa cell line Figure showing the expression of the protein.

Figure 32 Immunble after transfection of HeLa cell lines with immunogenic plasmids pTV2-SIV / GE and pTV2-SIV / dpol used as controls for immunogenic plasmids pGX10-SIV / GE and pGX10-SIV / dpol of the present invention This is a figure confirming the expression of the antigenic protein using the lottery.

33 is a diagram showing the expression of the auxiliary antigen protein (Vif-Nef) using immunoblotting after transfection of the immunogenic plasmids pGX10-SIV / VN and pGX10-SIV / VNTV according to the present invention into HeLa cell lines.

34 is a diagram confirming the expression of the auxiliary antigen protein (Tat-Vpx) using immunoblotting after transfection of the immunogenic plasmid pGX10-SIV / TV according to the present invention to HeLa cell line.

<110> POSTECH FOUNDATION          Genexine Inc. <120> SIVmac239 Immunogenic Plasmids and AIDS DNA Vaccine containing          the same <130> PA080658 / KR <150> KR10-2001-0079870 <151> 2001-12-07 <160> 60 <170> KopatentIn 1.71 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tcgcgacccg ggcgacggcc agtgaattgt accg 34 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tcgcgaggcg cgccacgagc cgccgcgcct ggaagg 36 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aatattgtcg acttcagaag aactcgtcaa gaag 34 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aatattgggc ccgaacatgt gagcaaaagg ccag 34 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cgggtcggta ccagacggcg 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 atctagaggt atggagaaat at 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gccctctaga agcatgctat 20 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggaagcggcc gcctcactga tacccctacc aa 32 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 actgtatcga ttggaattgg 20 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ctccctcgag tattcatata ctgtccctga 30 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 aatggatcca tagctaaagt agag 24 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 atttctcgag gctatgccac ctctc 25 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agtggtgcta actttgcttc gcaa 24 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tgtgtgtaga tgtgtaatag gcc 23 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 caactgcaga tggggggggc tgccg 25 <210> 16 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 attgcggccg caggcgcgcc gatctgagag aggcatcc 38 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tatggcgcgc ctggaggagg aaaagagg 28 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 aaagcggccg caatctagat catgccagta ttcccaag 38 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tacggatcca tgggtggagc tatttt 26 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 tctactagta ctgtaataaa tcccttc 27 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 agaactagta gaatcttaga catata 26 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 aaagcggccg ctgtttcagc gagttt 26 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 acctctagaa tgggtggagc tattt 25 <210> 24 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tatggcgcgc ctggagacac ccttgagg 28 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 aaagcggccg caatctagag tttgatgcag aagatgta 38 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 aaatctagaa tgtcagatcc cagggag 27 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 aaaagcggcc gcttatgcta gtcctggagg 30 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cccggtcgac ggccagtgaa ttg 23 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 cttctgaagt cgacggatcc gc 22 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 aatggatcca ttagtcctat tga 23 <210> 31 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 gccctgcagt gtatgtattg ttgtta 26 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 acactgcagg gcagcaattt cacc 24 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 cttatcgatg ttctaatcct catc 24 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 atcggcgcgc ctggaaaaca gatggcaggt 30 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 cattctagag tgtccattca ttgtatggc 29 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 atcactagtt gagtaaatta gcccttc 27 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 tcaactagtg atatccttga tctgtgg 27 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 gatgcggccg ctcagcagtc cttgtagta 29 <210> 39 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 cactctagaa tgggtggcaa gtggtca 27 <210> 40 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 atcggcgcgc ctggagccag tagatcct 28 <210> 41 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ccctctagac tttggtagag aaacttg 27 <210> 42 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 ccctctagaa tgcaaccttt acaaat 26 <210> 43 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 cgagcggccg cctacagatc attaatgtc 29 <210> 44 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 cccgggaaag tcctgccgcg cctcg 25 <210> 45 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 acaacggttt ggaggga 17 <210> 46 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 agagcaccat gggtcaccag cagttgg 27 <210> 47 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 cgatgcggcc gcacctaact gcaggg 26 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 aagatatcga attccccctc 20 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 ttgccatggc catatttatc a 21 <210> 50 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 gtaatacgac tcactatagg gc 22 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 tatgagctct acaccagcag c 21 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 aattaaccct cactaaaggg 20 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 ggtgtagagc tcatacttga g 21 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 aactcgaggt cgacggtatc 20 <210> 55 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 ttctcgagcg gccgcacct 19 <210> 56 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 aagaattcga tatgttccca actattc 27 <210> 57 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 ttttctagaa ttagaagcca cacgacc 27 <210> 58 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 ttggaaaacg ttcttcgggc ggcctattgg ttaaaaaatg agc 43 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 cttgaacgtt ttccttttca cgtagaaagc 30 <210> 60 <211> 3641 <212> DNA <213> Artificial Sequence <220> <223> vector <400> 60 acgcgttgac attgattatt gactagttat taatagtaat caattacggg gtcattagtt 60 catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc gcctggctga 120 ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca 180 atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca 240 gtacatcaag tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg 300 cccgcctggc attatgccca gtacatgacc ttatgggact ttcctacttg gcagtacatc 360 tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt 420 ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt 480 ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg 540 acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc tctctggcta 600 actagagaac ccactgctta ctggcttatc gaaattaata cgactcacta tagggagacc 660 caagctcgat actctcttcc gcatcgctgt ctgcgagggc cagctgttgg gctcgcggtt 720 gaggacaaac tcttcgcggt ctttccagta ctcttggatc ggaaacccgt cggcctccga 780 acggtactcc gccaccgagg gacctgagcg agtccgcatc gaccggatcg gaaaacctct 840 cgactgttgg ggtgagtact ccctctcaaa agcgggcatg acttctgcgc taagattgtc 900 agtttccaaa aacgaggagg atttgatatt cacctggccc gcggtgatgc ctttgagggt 960 ggccgcgtcc atctggtcag aaaagacaat ctttttgttg tcaagcttga ggtgtggcag 1020 gcttgagatc tggccataca cttgagtgac aatgacatcc actttgcctt tctctccaca 1080 ggtgtccact cccaggtcca actgcaggtc gaagcttggt accgagctcg gatccactag 1140 taacggccgc cagtgtgctg gaattctgca gatatccatc acactggcgg ccgctcgagc 1200 atgcatctag agtcggggcg gccggccgct tcgagcagac atgataagat acattgatga 1260 gtttggacaa accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga 1320 tgctattgct ttatttgtaa ccattataag ctgcaataaa caagttaaca acaacaattg 1380 cattcatttt atgtttcagg ttcaggggga ggtgtgggag gttttttaaa gcaagtaaaa 1440 cctctacaaa tgtggtaaaa tcgataagga tctgaacgat ggagcggaga atgggcggaa 1500 ctgggcggag ttaggggcgg gatgggcgga gttaggggcg ggactatggt tgctgactaa 1560 ttgagatgca tgctttgcat acttctgcct gctggggagc ctggggactt tccacacctg 1620 gttgctgact aattgagatg catgctttgc atacttctgc ctgctgggga gcctggggac 1680 tttccacacc ctaactgaca cacattccac agcggatccg tcgacttcag aagaactcgt 1740 caagaaggcg atagaaggcg atgcgctgcg aatcgggagc ggcgataccg taaagcacga 1800 ggaagcggtc agcccattcg ccgccaagct cttcagcaat atcacgggta gccaacgcta 1860 tgtcctgata gcggtccgcc acacccagcc ggccacagtc gatgaatcca gaaaagcggc 1920 cattttccac catgatattc ggcaagcagg catcgccatg ggtcacgacg agatcctcgc 1980 cgtcgggcat gctcgccttg agcctggcga acagttcggc tggcgcgagc ccctgatgct 2040 cttcgtccag atcatcctga tcgacaagac cggcttccat ccgagtacgt gctcgctcga 2100 tgcgatgttt cgcttggtgg tcgaatgggc aggtagccgg atcaagcgta tgcagccgcc 2160 gcattgcatc agccatgatg gatactttct cggcaggagc aaggtgagat gacaggagat 2220 cctgccccgg cacttcgccc aatagcagcc agtcccttcc cgcttcagtg acaacgtcga 2280 gcacagctgc gcaaggaacg cccgtcgtgg ccagccacga tagccgcgct gcctcgtctt 2340 gcagttcatt cagggcaccg gacaggtcgg tcttgacaaa aagaaccggg cgcccctgcg 2400 ctgacagccg gaacacggcg gcatcagagc agccgattgt ctgttgtgcc cagtcatagc 2460 cgaatagcct ctccacccaa gcggccggag aacctgcgtg caatccatct tgttcaatca 2520 tgcgaaacga tcctcatcct gtctcttgat cagatcttga tcccctgcgc catcagatcc 2580 ttggcggcga gaaagccatc cagtttactt tgcagggctt cccaacctta ccagagggcg 2640 ccccagctgg caattccggt tcgcttgctg tccataaaac cgcccagtct agctatcgcc 2700 atgtaagccc actgcaagct acctgctttc tctttgcgct tgcgttttcc cttgtccaga 2760 tagcccagta gctgacattc atccggggtc agcaccgttt ctgcggactg gctttctacg 2820 tgaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg 2880 agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc 2940 ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg 3000 tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag 3060 cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact 3120 ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg 3180 gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc 3240 ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg 3300 aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg 3360 cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag 3420 ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc 3480 gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct 3540 ttttacggtt cctgggcttt tgctggcctt ttgctcacat actcgggccc aatcgacccg 3600 ggcgacggcc agtgaattgt accgatgtac gggccagata t 3641  

Claims (29)

(i) the gene vif from virus SIVmac239, (ii) the signal sequence of the secreted protein linked to the 3 'end of the gene vif, and (iii) A plasmid comprising gene nef from SIVmac239 linked to the 5 ′ end of gene vif. The plasmid of claim 1, wherein the signal sequence of the secretory protein of (ii) is a signal sequence of a glycoprotein. The plasmid of claim 1, which is pGX10-SIV / VN shown in FIG. (i) the gene of any one of exon 1 to the entire sequence of gene tat from virus SIVmac239, (ii) the signal sequence of the secreted protein linked to the 3 'end of the gene, and (iii) A plasmid comprising the gene vpx from SIVmac239 linked to the 5 'end of the gene of (i). The plasmid according to claim 4, wherein the signal sequence of the secretory protein of (ii) is the signal sequence of the glycoprotein. The plasmid of claim 4 which is pGX10-SIV / TV as shown in FIG. 8. (i) the signal sequence of the gene vif from virus SIVmac239 and the secreted protein linked to its 3 'and 5' ends, and the gene nef from SIVmac239, and (ii) the exon 1 to the entire sequence of gene tat from SIVmac239 A plasmid comprising a signal sequence of a secreted protein linked to one gene and its 3 'and 5' ends, respectively, and a vpx from SIVmac239. The plasmid according to claim 7, wherein the signal sequence of the secreted protein linked to the 3 'end of the gene vif derived from SIVmac239 is the signal sequence of the glycoprotein. The plasmid according to claim 7, wherein the signal sequence of the secreted protein fused to the 3 'end of any one of the exon 1 to the entire sequence of the gene tat derived from SIVmac239 is the signal sequence of the glycoprotein. 10. The plasmid of claim 9, which is pGX10-SIV / VNTV shown in FIG. (i) gene vif derived from HIV-1, (ii) the signal sequence of the secreted protein linked to the 3 'end of the vif gene, and (iii) A plasmid comprising a gene nef derived from HIV-1 linked to the 5 'end of the vif gene. 12. The plasmid of claim 11, wherein the signal sequence of the secretory protein linked to the 3 'end of (ii) is the signal sequence of the glycoprotein. (i) the gene of any one of exon 1 to the entire sequence of gene tat derived from HIV-1, (ii) the signal sequence of the secreted protein linked to the 3 'end of the gene, and (iii) A plasmid comprising the gene vpu derived from HIV-1 linked to the 5 'end of the gene (i). The plasmid of claim 13, wherein the signal sequence of the secretory protein of (ii) is a signal sequence of a glycoprotein. (i) the signal sequence of the secreted protein linked to HIV-1 derived gene vif and its 3 'and 5' ends, and the nef derived from HIV-1, and (ii) exon 1 of gene tat derived from HIV-1 A plasmid comprising a signal sequence of a secreted protein linked to the gene of any one of the entire sequences and its 3 'and 5' ends, and a gene vpu derived from HIV-1. The plasmid according to claim 15, wherein the signal sequence of the secreted protein linked to the 3 'end of the HIV-1 derived gene vif is the signal sequence of the glycoprotein. The plasmid according to claim 15, wherein the signal sequence of the secretory protein linked to the 3 'end of any one of the exon 1 to the entire sequence of the gene tat of HIV-1 is the signal sequence of the glycoprotein. (i) a plasmid comprising genes gag, dpol, env and rev from SIVmac239, (ii) a plasmid comprising a signal sequence of a secreted protein linked to the 3 'end of gene pol encoding reverse transcriptase and integrase from SIVmac239 (iii) a plasmid comprising the signal sequence of the secreted protein linked to the vi 'of SIVmac239 and its 3' and 5 'ends, and the nef from SIVmac239, and (iv) the exon 1 to the complete sequence of gene tat from SIVmac239. A DNA vaccine composition for preventing or treating AIDS, comprising a plasmid comprising a signal sequence of a secreted protein linked to each of the genes and its 3 'and 5' ends, and a gene vpx derived from SIVmac239. The method according to claim 18, wherein the gene pol in the plasmid including the reverse transcriptase derived from SIVmac239 and the signal sequence of the gene pol encoding the integrase and its secreted protein linked to its 3 'end is mutated to inhibit the enzymatic activity of integrase DNA vaccine composition. 19. The DNA vaccine composition of claim 18, further comprising the plasmid pGX10-hIL-12m shown in FIG. (i) a plasmid containing genes gag, dpol, env and rev from SIVmac239, (ii) a plasmid comprising a signal sequence of a secreted protein linked to the 3 'end of gene pol encoding reverse transcriptase and integrase from SIVmac239 And (iii) a signal sequence of (a) a gene vif derived from SIVmac239 and a glycoprotein linked to its 3 'and 5' ends, a gene nef derived from SIVmac239, and (b) exons 1 to all sequences of gene tat derived from SIVmac239. A DNA vaccine composition for preventing or treating AIDS, comprising a plasmid comprising a gene and a vpx from SIVmac239 linked to a 5 'end thereof. 22. The method of claim 21, wherein the gene pol in the plasmid comprising the reverse transcriptase derived from SIVmac239 and the signal sequence of the gene pol encoding integrase and its secreted protein linked to its 3 'end is mutated to inhibit the enzymatic activity of integrase. DNA vaccine composition. The DNA vaccine composition of claim 21, further comprising the plasmid pGX10 -hIL-12m shown in FIG. 17. (i) a plasmid comprising HIV-1 derived genes gag, dpol, env and rev, (ii) a gene pol encoding reverse transcriptase and integrase derived from HIV-1 and a secreted protein linked to its 3 'end A plasmid comprising the sequence, (iii) a plasmid comprising a signal sequence of HIV-1-derived gene vif and its secreted protein linked to its 3 'and 5' ends, and a gene nef derived from HIV-1, and (iv) HIV-1 AIDS prophylaxis or treatment comprising a plasmid comprising a signal sequence of a secreted protein linked to any of the genes exon 1 to the entire sequence of the gene tat derived from the 3 'and 5' ends thereof, and a gene vpu derived from HIV-1 DNA vaccine composition. 25. The method according to claim 24, wherein the gene pol in the plasmid comprising the reverse transcriptase derived from HIV-1 and the gene pol encoding the integrase and the secreted protein linked to its 3 'end is inhibited in the enzyme activity of the integrase. The DNA vaccine composition is mutated. 25. The DNA vaccine composition of claim 24, further comprising the plasmid pGX10-hIL-12m shown in FIG. (i) a plasmid containing the genes gag, dpol, env and rev derived from HIV-1, (ii) a plasmid containing the gene pol encoding reverse transcriptase and integrase derived from HIV-1, and (iii) (a) HIV- The signal sequence of the glycoprotein linked to the gene vif derived from 1 and its 3 'and 5' ends, the gene nef derived from HIV-1, and (b) the exon 1 to the entire sequence of gene tat derived from HIV-1 And DNA vaccine composition for preventing or treating AIDS comprising a plasmid comprising a vpu derived from HIV-1 linked to its 5 'end. 28. The method according to claim 27, wherein the gene pol in the plasmid including the reverse transcriptase derived from HIV-1 and the gene pol encoding the integrase and the secreted protein linked to its 3 'end is inhibited from enzymatic activity of the integrase. The DNA vaccine composition is mutated. The DNA vaccine composition of claim 27, further comprising the plasmid pGX10-hIL-12m shown in FIG.

Images