KR20090001096A - Transgenic esculent plants producing high amount of s-adenosylmethionine and use thereof, and a method for controlling physiological cycle of plant by changing amount of s-adenosylmethionine - Google Patents

Abstract

A method for preparing an edible plant, an edible plant prepared by the method, a food composition containing the edible plant, and a method for controlling the physiological period of a plant are provided to obtain the edible plant producing s-adenosylmethionine of high quantity. A method for preparing an edible plant comprises the steps of introducing the coding gene of the s-adenosylmethionine biosynthesis enzyme derived from Solanum brevidense represented by the sequence number 1 to a plant; and transforming it to prepare an edible plant. Preferably the edible plant is a potato or Arabidopsis thaliana.

Description

Transgenic esculent plants producing high amount of S-adenosylmethionine and use according to the edible plant producing high content of S-adenosylmethionine, and its use method for controlling physiological cycle of plant by changing amount of S-adenosylmethionine}

1 shows the biosynthesis and metabolic pathways of SAM in plants.

2 is cloned An electrophoretic picture of the SbSAMs gene is shown.

Figure 3 shows the nucleotide sequence of the SAM-s gene isolated from Solanum brevidense ( Solanum brevidense ).

4 is a solarium bredides ( Solanum brevidense ) The result of comparing the amino acid sequence of the derived SAM-s enzyme is shown.

5 is a solarium bredides ( Solanum brevidense ) The results of homology analysis of the derived SAM-s enzyme are shown.

6 is a solarium bredides ( Solanum cloned into a vector). brevidense ) shows electrophoretic photographs of the SAM-s gene.

Figure 7 is a solarium bredides ( Solanum brevidense ) shows gel photograph of SDS-PAGE after separation and purification of SAM-s enzyme.

Figure 8 is a Solanum ( Solanum) expressed in E. coli brevidense ) The results of functional analysis of the derived SAM-s are shown.

9 is Solanum Brevidens ( Solanum) brevidense ) The structure of the plasmid cloned with the derived SAM-s gene is shown.

Figure 10 shows the regeneration after the transformation of potato magnetic core.

Figure 11 shows the results of PCR amplification of transformed T-DNA from redivided potatoes.

12 shows the results of competitive duplex-PCR amplification of transgenic potato cores.

13 shows the results of Northern blot analysis of transgenic potato cores.

Figure 14 shows the seed potato forming process of the transformed potato magnetic core using the underwater cultivation method.

Figure 15 shows the results confirmed the increase in the content of SAM in potato tubers.

Figure 16 shows the structural map of the SAM-s gene vector cloned from S. brevidense ( S. brevidense ).

Figure 17 shows a PCR gel photograph for Arabidopsis screening overexpressing the SAM-s gene.

Figure 18 shows the 32-day growth of the Arabidopsis overexpressing the SAM-s gene.

Figure 19 shows the 42-day growth of the Arabidopsis overexpressing the SAM-s gene.

The present invention relates to an edible plant for producing a high content of es- adenosyl methionine and its use, and to a method for regulating the menstrual cycle of plants by changing the content of es- adenosyl methionine. More specifically, the present invention is a solanum bredides ( Solanum) brevidense ) Plants that can be applied to prevent various diseases by overexpressing S-adenosylmethionine and easily ingesting it through food by introducing and transforming genes encoding S-adenosylmethionine biosynthetic enzymes derived from brevidense ) into food plants. The present invention relates to a method of preparing a transformant and controlling the growth cycle of a plant by changing the content of es-adenosylmethionine in the plant.

S-adenosylmethionine (SAM) is a biological substance produced by binding adenosine to methionine, an essential amino acid, from ATP by its synthetase (SAM synthetase (SAM-s)). Used as a methyl donor in vivo (Lu, SC (2000), Int . J. Biochem . Cell Biol ., 32: 391-399). SAM's bio functions have been found to be cofactors of methylation during the process of methylation of nucleic acids, regulation of gene expression by methylation of proteins, formation of choline phosphate, which plays an important role in fluidity of biofilms, and biosynthesis of biomolecules with bioactivity. As a raw material, the use of amine groups, ribosyl groups, aminealkyl groups as raw materials, and 5 'deoxidation adenosyl radical reactions (Fontecave, M., M. Atta, and E. Mulliez (2004), Trends ) . Biochem Sci, 29:.. 243-249). Recently, morphogenesis is inhibited by the accumulation of SAM in cells in yeast and Bacillus (Rooke, A., M. McDaniel, FJ Grundy, I. Artsimovitch, and TM Henkin (2003), Proc . Natl . Acad . .. Sci USA, 100: 3083-3088 Hilti, N., R. Graub, M. Jorg, P. Arnold, AM Schweingruber, and ME Schweingruber (2000), Yeast, 16:. 1-10), functions accompanying Research is underway to identify them.

Currently, SAM is used as a health food by increasing anti-depression by increasing acetylcholine, an animal neurotransmitter. In view of the sharp decrease of SAM content in brain cells in patients with Alzheimer's disease, SAM has been developed as a treatment for Alzheimer's disease (Fava M, Rosenbaum JF, MacLaughlin R, Falk WE, Pollack MH, Cohen LS, Jones L, Pill L (1990) J Psychiatr Res 24: 177-184; Bressa GM (1994), Acta Neurol Scand 154 (suppl): 74. If a SAM high functional food is developed that can partially replace such a therapeutic agent, the economic effect is great. If no dementia treatment is currently developed, the prevention of dementia in crops with high SAM content could provide economic as well as quality of life that cannot be converted into money.

In addition, SAM has been active in detoxifying toxins in the liver, which has been demonstrated to improve liver function (Fern ghortdez-Checa JC, Colell A, Garccia-Ruiz C (2002)).Alcohol. 27: 179-183 .; Lieber CS (2002) S-adenosyl-L-methionine:Am J Clin Nutr 76: 1183-1187 .; Ji C, Deng Q, Kaplowitz N (2004)Hepatology . 40: 442-451). On the other hand, SAM is a substance that is not recognized legal status as a food raw material in Korea, but has been widely used for oral or injection as a therapeutic drug for liver function improving disease. Currently, it is widely used in the United States and the EU as a dietary supplement. Especially, research papers on alcoholic disorders (Stickel F, Hoehn B, Schuppan D, Seitz HK (2003)Aliment Pharmacol Ther . 18: 357-373; Stickel F, Seitz HK, Hahn EG, Schuppan D (2003)J. Gastroenterol. 41: 333-42) has been published several hundred times a year in recent years, attracting attention as a raw material that will continue to receive attention. As SAM is used as a treatment for modern diseases that frequently occur, if a functional crop (fruit vegetable) artificially overproducing SAM is developed, it will greatly contribute to disease prevention.

And, as shown in Figure 1 SAM in the plant is a precursor of plant hormone ethylene and polyamines deeply involved in growth. Ethylene is produced by converting SAM, a precursor, into ACC by 1-aminocyclopropane-1-carboxylate (ACC) syntase, and polyamine is SAM dicarboxylase. Produced after conversion to an azeta and putrescine aminotransferase. Ethylene is a gaseous plant hormone that inhibits most plant growth and promotes aging. Polyamines, on the other hand, are bioactive substances that delay aging. As such, ethylene and polyamines share SAM as a precursor and are located in the regeneration pathway of methionine, but exhibit physiological effects contrary to aging that affect plant productivity and function.

The present inventors recently discovered the world's first new physiological function of SAM that promotes the secretion of secondary metabolites that directly bind to signaling proteins in microorganisms to overcome stress (Kim, DJ, JH Huh, YY Yang, CM Kang, IH Lee, CG Hyun, SK Hong, and JW Suh (2003), J. Bacteriol ., 185: 592-60). Since these stress-resistant signaling protein groups are also present in plants, their physiology may be regulated by SAM, so this study of plants will reveal the new physiological function of SAM beyond species. It will give you a chance to develop stress resistant plants. With the rapid growth of cities and industries, there is a diminishing amount of effective arable land all over the world, and research is underway to transform crops so that they can grow in harsh environments. As the agricultural environment is threatened, the improvement of agricultural productivity through the development of physiologically controlled crops suitable for the agricultural environment is urgently needed.

On the other hand, potato has been used as a research material since the early generation of transformation research (An G. Ebert PR, Mitra A, Ha SB (1988) Binary Vectors.In: Gelvin SB, Schilperoort RA, Verma DPS, Plant Molecular Biology Manual.Kluwer Academic Publisher, Boston, PMAN-A3: 1-19; De Block M (1988) Theor Appl Genet 76: 767-774), which is known to perform relatively well transformation. However, for the in-flight regeneration and transformation of potatoes, there are many differences in the composition and culture conditions of different hormones according to potato varieties and tissues (D'Amato F (1975) The problem of genetic stability in plant tissue and cell cultures. Crop Genetic Resources for Today and Tomorrow.Cambridge Univ Press.pp 333-348; De Block M (1988) Theor Appl Genet 76: 767-774; Dobigny A, Ambroise A, Haicour R, David C, Rossignol L, Sihachakr D (1995) Plant Cell Tiss Org Cult 40: 225-230). In the case of potatoes, leaf tissue (De Block M (1988) Theor Appl Genet 76: 767-774) or tuber tissue (Sheerman S, Bevan MW (1988) Plant Cell Rep 7: 13-16; Stiekema WJ, Heidekamp F, Louwerse JD, Verhoeven HA, Dijkhuis P (1988) Plant Cell Rep 7: 47-50) is used as a material for transformation, but it has been reported that not only the reproducibility and transformation rate are different depending on the tissue used, but also a lot of variation depending on the variety. There have been many reports of transformation studies using potatoes in Korea (Choi KH, Jeon JH, Kim HS, Joung YH, Yang DC, Joung H (1996) Korean J Plant tissue culture 23: 97-101; Joung YH, Jeon JH, Choi KH, Kim HS, Joung H (1996) Kor J Plant tiss cult 23: 77-81; Yuom JW, Jeon JH, Jung JY, Lee BC, Kang WJ, Kim MS, Kim CJ, Joung H, Kim HS (2002) Korean J Plant Biotechnology 29: 93-98) There have been no reports identifying potato re-differentiation conditions or transformation conditions that are restricted to a few varieties and that may differ from one variety to another. Until recently, domestic and overseas transformation research materials (Yuom JW, Jeon JH, Jung JY, Lee BC, Kang WJ, Kim MS, Kim CJ, Joung H, Kim HS (2002) Korean J Plant Some varieties, such as 'Desiree', which are widely used in Biotechnology 29: 93-98), are known to have superior regeneration or transformation efficiency compared to other potato varieties (Choi KH, Jeon JH, Kim HS, Joung YH, Yang). DC, Joung H (1996) Korean J Plant tissue culture 23: 97-101), which are not currently cultivated in our country, have problems with their use after transformation. Potatoes that do not have to go through a separate breeding process for genetic fixation of the transformants are developed for practical use, and it is necessary to use varieties that can be grown in Korea as materials.

Accordingly, it is an object of the present invention to provide a renal functional crop having an increased content of S-adenosylmethionine.

Another object of the present invention is to provide a use of the new functional crops.

It is another object of the present invention to provide a method of improving agricultural productivity by changing a plant's menstrual cycle by genetically controlling the synthesis of S-adenosylmethionine as described above.

The object of the present invention is to analyze the nucleotide sequence of the gene encoding the S-adenosylmethionine biosynthesis enzyme isolated from the Solanum brevidense ( Solanium brevidense ), to prepare a carrier for plant transformation on which the gene is mounted , The carrier is transformed by infecting the potato self-cultivation varieties or Arabidopsis using Agrobacterium, and the transformants are transferred to the soil to be purified to check the content of S- adenosylmethionine, and to investigate the growth pattern of the plant This was accomplished by investigating the effects on the menstrual cycle following SAM overexpression.

The present invention comprises the steps of isolation and sequencing of genes encoding S-adenosylmethionine biosynthesis enzymes from solanum brevidense ; Manufacturing a carrier for plant transformation; Transformation step using potato or Arabidopsis; And the step of identifying the S-adenosylmethionine content of the transformant and examining the growth pattern.

The present invention can be easily applied by developing and applying crops having increased contents of S-adenosylmethionine, a candidate substance expected to be useful for diseases such as depression, Alzheimer's disease, dementia, and detoxification of toxins. Production is possible, and the easy intake of food through the disease can be prevented. An over-expression of SAM-s and SAM metabolism-related genes identified as an example was developed in potato tubers to develop high-functional crops that produce many SAMs and polyamines that have clinical effects on liver deterioration and dementia.

S-adenosylmethionine content comprising the step of transforming by introducing the coding gene of the S- adenosylmethionine biosynthesis derived from Solanum brevidense in SEQ ID NO: It is characterized by providing a method for producing this enhanced edible plant.

The type of the edible plant used in the present invention is a vegetable plant ingested without applying heat, for example, any plant that can be grown in Korea, such as cabbage, tomatoes, lettuce, potatoes, sweet potatoes, but can be In potato was used.

Another feature of the invention provides a method of controlling the menstrual cycle of a plant by controlling the plant content of S-adenosylmethionine.

In-plant content control of S-adenosylmethionine was performed using the solanum brevidens described in SEQ ID NO: 1. brevidense ) is to introduce a gene encoding the S- adenosyl methionine biosynthetic enzyme derived from the plant to be transformed to increase the production of S- adenosyl methionine.

Arabidopsis thaliana L. was used as a plant for use in the method of regulating the plant menstrual cycle of the present invention.

The transformed Arabidopsis was characterized by deciduous leaf rapid development after flowering.

Hereinafter, the specific configuration of the present invention will be described through Examples, but the scope of the present invention is not limited to these Examples.

EXAMPLE

Example  One: Wild species  potato( Solanum brevidense )from SAM -s Gene Isolation and Analysis

The cDNA library of S. brevidense of wild relative potato Sola brevidense was subcloned into pBluescript SK (+/-) vector by in vivo monoclonal expansion and cloned SbSAMs The results of electrophoresis of the genes are shown in FIG. 2. Lane 11 is a SbSAMs clone and the restriction enzyme Eco RI / Xho I was used.

 The ORF sequence of this gene was confirmed from EST including the SAM-s gene sequence, and the final analyzed sequence was registered in NCBI GenBank AY635050 and the Korean Gene Registry (GeneIn KS109049) (FIG. 3).

The nucleotide sequences read were compared for similarity with previously reported genes by searching GenBank, EMBL and DDBJ databases using the web-site http://www.ncbi.nlh.nih.gov/Blast search engine.

Comparison of the compared intergenic amino acid sequences compared the gene amino acid sequences of the previously registered tomato (Z24741) petunia (AF170798), Arabidopsis (M55077), Chinese cabbage (AF379014) and tobacco (AF127243).

When the base sequence of the clone determined to be the SAM biosynthesis gene was partially decoded from the first cDNA library, the ORF of the 1182 bp SAM biosynthetic enzyme gene was included in the total sequence of 1532 bp.

A total of 394 amino acid sequences to be expressed when they are deciphered were analyzed from plants of other species and compared with amino acids of the registered genes.At least 93% between plants of the same family and 88% of plants of other families The above homology was shown to determine the SAM-s gene (FIGS. 4 and 5).

To ensure that the expression product of ORF of the cloned gene can be synthesized SbSAMs the final product of SAM on the plane containing the reaction solution to the actual substrate, in vitro translation analysis (in In vitro translation assay was performed. To the cloning site of pET28a (+), the carrier for in vitro translation To construct the carrier with the SbSAMs gene inserted, amplify the ORF of the SbSAMs gene by PCR using primers F: 5'-GAATTCATGGAAACTTTCCTATTCACCTCCG-3 'and primer R: 5'-CTCGAGTGGGGGTTTTCCCACTTGAGGGGCT-3', and the carrier and PCR products were respectively amplified. Restriction enzyme Ligation was performed with Eco RI and Xho I. Subsequently, E. coli BL21 (DE3) was transformed to isolate the amplified plasmid, followed by restriction enzymes. Treatment with Eco RI and Xho I confirmed the insert size and confirmed that the target gene was successfully inserted (FIG. 6).

A carrier constructed to perform in vitro translation was transformed into E. coli BL21 (DE3), and the expressed protein was recovered using Sepex G10 Gel (Pharmacia) to recover the expressed protein via 10% SDS-PAGE. The size was confirmed and the result is shown in FIG. 7. In FIG. 7, M is a molecular weight size marker, B is 1 mM IPTG before induction, A is 1 mM IPTG after induction, SN is the supernatant, De is debris, W4 is wash 4, and E is 500 mM imidazole eluate.

As shown in FIG. 7, the protein band of 47.3 kDa was confirmed by staining the Coomassie Brilliant Blue solution, indicating that the SbSAMs enzyme protein was normally expressed.

15 μl (60 μg) of the enzyme protein recovered from Sephadex Gel was added to the biological buffer HEPES-K ⁺ 50 mM in 50 mM KCl, 10 mM MgCl ₂ , 5 mM DTT, 5 mM ATP and 10 mM L-methionine. The reaction solution containing the substrate was reacted for 2 hours at 37 ℃ to check whether the target product SAM is synthesized normally. Partial purification was performed with a 0.2 μm pore filter and then separated by HPLC (High Performance Liquid Chromatography, waters) to identify the fractions consistent with the peaks identified by 0.5 mM SAM at OD 259 nm. In FIG. 8, 1 is a 5 mM SAM standard, 2 is a reaction product with SbSAMs, and 3 is a negative control containing no enzyme.

As shown in FIG. 8, the amount of the reaction product was relatively low, but in the control treatment that did not process the expressed protein, an unidentified SAM peak was confirmed to show normal activity.

Example  2: Preparation of Potato Transformant

Solanium bredides ( Solanum) isolated in Example 1 To produce transformants with SAM-s genes derived from brevidense ), plant subjects were selected for potato "Jasim" varieties.

In order to manufacture a plant transformation carrier, the same adapter (by PCR) was treated with an Xba I site located at the MCS site of the plant transformation carrier pBI121 and Sac I which can remove the reporter gene GUS (β-glucronidase) site. SbSAM biosynthetic genes to which the adapter was attached were ligated with the same restriction enzyme to construct the carrier pBISAM-1 (FIG. 9A).

The resulting carrier pBISAM-1 was transformed into E. coli DH5a, amplified, recovered, double-cut with Xba I / Sac I, and then inserted into a 1% (w / v) agarose gel. It was confirmed that was successfully introduced (FIG. 9B). In Figure 9B, M is λ / Hind III size marker, lane 1 is enzyme-free plasmid vector, lane 2 is Xba I / Sac Results are shown after cleavage with I.

The reason why GUS gene, which is a histochemical reporter gene, among the structural genes of the plant transformation carrier pBI121 was removed during the vehicle manufacturing process was to reduce the number of foreign genes that have not been identified as harmful during potato transformation, Because of the traits of quantum breeding, no studies on the genetic segregation of the transformants were necessary. In addition, previous studies have reported that GUS trans genes reduce potato yield and plant vitality in field trials using transformed potatoes (Belknap, WR, Corsini D, Pavek JJ, Synder GW, Rockhold DR, Vayda). ME (1994) Amer . Potato J. 71: 285-296; Dale, PJ, MacPortlan, HC (1992) Theor . Appl. Genet . 84: 585-591; Davies, HV (1996) Potato Res . 39: 411-427). In fact, for Roundup Ready, a transgenic soybean developed and cultivated by the Monsanto company, strains without the GUS gene were identified (Diane, BL, Padgette SR (1992) Petition for determination of non-regulated status : soybeans with a Roundup Ready ^TM gene. USDA-ARS-FCR Report). In addition, since expression of GUS gene that is continuously accumulated in cells after expression is likely to interfere with the action or metabolic process of other enzymes, it is removed from the transgene except in the case of special expression study. It was because it was judged that it would be desirable.

The media composition with the best regeneration efficiency from the leaves of Jasimsim, the target varieties for transformation, was Joung YH, Jeon JH, Choi KH, Kim HS, Joung H (1996) K or J Plant tiss M5 medium composition reported by cult 23: 77-81) was used for the transformation experiments of Jasimsim varieties.

Agrobacterium (Agrobacterium) transformation (Holster MD Agrobacterium bacteria such as Titanium (Agrobacterium) Holster the LBA4404 strain, de Waele A, Depicker E, Messens M, Montagu V, Schell J (1978) Mol Gen Genet 163: 81-187) and An et al. (An G. Ebert PR, Mitra A, Ha SB (1988) Binary Vectors.In: Gelvin SB, Schilperoort RA, Verma DPS, Plant Molecular Biology Manual.Kluwer Academic Publisher, Boston, PMAN -A3: 1-19) was transformed using a slightly modified freeze-thaw method. Agrobacterium cultures overnight in YEB medium at 30 ± 1 ℃ tumefaciens (Agrobacterium) 0.5 mL of LBA4404 culture was added to 20 mL of fresh medium, followed by incubation at 30 ± 1 ° C. for 5-6 hours, followed by centrifugation. 4 mL of YEB medium was added to the recovered cells, suspended, and centrifuged again. 800 µl of YEB medium was added to the recovered cells and suspended, and 200 µl was dispensed into small centrifuge tubes. After dispensing the cells, the tube was placed on ice for 1 to 2 minutes to cool, then rapidly frozen in a -70 ° C. cryogenic freezer for 5 minutes, and then dissolved at 37 ° C. for 3 minutes to prepare competent cells. After mixing 90 μl of YEB medium and 5 μg of DNA to be transformed into 200 μl of the prepared competent cells, they were frozen at −70 ° C. for 5 minutes, dissolved at 37 ± 1 ° C. for 25 minutes, and incubated at 30 ° C. for 1 hour. 5mL 523 medium was added to the culture mixture, suspended incubated at 30 ° C for 1 hour, centrifuged, and 200µl of 523 medium was collected in the collected cells.Then, 100µl of each plate was coated on 523 solid medium containing antibiotics. Transformed colonies were selected by incubating for 48 hours at ℃.

Jassim varieties have purple and purple skins and stems on stems and tubers. However, during the transformation process, individuals whose reddish vegetation did not have a purple surface were identified. However, the cause of this phenomenon could not be determined. However, in general, purple expression of Jasimsim varieties is well performed under high cross-sectional conditions, and thus, polyamines, which act as ethylene precursors, or vice versa, are stress-related plant hormones. It can be assumed to be due to the action.

Experimental Example  1: Asexual reproduction through tissue culture of transformed potatoes

For in-flight selection and assay of transformed potatoes, transfer to 1 × MS medium without plant growth regulators to induce rooting of re-differentiated shoots in a medium containing the antibiotics kanamycin and cabenicillin for selection Induce complete plants (FIG. 10). 10A and 10B show the results of inducing callus in PSM medium containing kanamycin under fluorescent lamps of 3000-3500 Lux on growth control, and C is in-flight proliferation of shoots re-differentiated in MS medium without hormones. And rooting induction results, D shows the expected T2 transformants grown in the topsoil.

After induction of complete plants, single leaves were extracted from each subdivided individual and DNA was extracted. Primers capable of amplifying the CaMV 35S promoter site and the NOS terminator site located at both ends of the inserted target gene in the transformed T-DNA (35S-S: GCTCCTACAAATGCCATCA; 35S-AS, GATAGTGGGATTGTGCGTCA; NOS-S, GAATCCTGTTGCCGG TCTTG; PCR using NOS-AS, TTATCCTAGTTTGCGCGCTA (conditions: pre-denaturation, 94 ° C./5 min; denaturing, 94 ° C./20 sec; annealing, 50 ° C./20 sec; expansion, 72 ° C./1 min (40 cycles) and full extension; 72 ℃, 5 minutes) was performed to determine the transformation.

As shown in Figure 11, the first selected predicted transformants were confirmed that most of the transformation in the T2 generation.

The PCR method used in this experiment used primers according to the protocol recommended by the EU (Promega Note, 1998) for GMO determination, and PCR conditions were performed in the same process. The process of amplifying the internal control DNA in the process of identifying transformants by PCR is essential for ensuring the reliability of the results (Meyer R (1999) Food. Control 10: 391-399). This is because the method of amplifying only the carrier-specific genes and assaying can not determine the specificity of the crops and whether the PCR is performed correctly, which lowers the reliability of the results.

Therefore, in this Example, PCR primer for internal control (internal gene of potato: rAGU4A; 5 'designed to amplify potato-specific DNA in order to more accurately determine whether the primary screened regeneration plants were transformed or not. -GACTCGATAACA GGCTCCA-3 '35S-S: 5'-GCTCCTACAAATGCCA TCA-3'; 35S-AS, 5'-GATAGTGGGATTGTGCGTCA-3 '; NOS-S, 5'-GAATC CTGTTGCCGGTCTTG-3'; NOS-AS, 5 ' -TTATCCTAGTTTGCGCGCTA-3 '; Journal of Plant Biotechnology 29 (4): 235-240.), The accuracy of discrimination was increased (FIG. 12). PCR conditions are shown in FIG. 11.

Experimental Example  2: Comparison of Transgene Expression Levels of Transgenic Potatoes

Northern blot analysis was performed using total RNA extracted from individuals tested by PCR and duplex-competitive PCR to determine the levels of transcripts expressed in potato strains of Jasim varieties transformed with SbSAMs ( 13). In Figure 13 lane 1-2 is a non-transformant self- cultivation varieties, lanes 3-9 shows a Jasim variety transformed with a gene encoding the S- adenosylmethionine biosynthetic enzyme derived from Solanum brevidense ( Solanum brevidense ) will be.

As shown in FIG. 13, a small amount of transcript was also detected in the non-transformant as a result of the final detection using the DIG probe, which is judged to be the detection result of the potato-specific SAM-s gene transcript. Among the individuals selected as transformants, similar or less expression level (lanes 2, 4, 5, and 8 in FIG. 13) was determined as a result of introduction into non-translative sites on the chromosome. In the growth system.

Experimental Example  3: SbSAMs  Proliferation of Transgenic Potatoes Incorporated with Genes

Transformants selected by assay by primary PCR were transferred to the topsoil, purified, and then grown above ground to obtain a tuber tube after about 90 days (FIG. 14). Seed potato forming process of the transformed potato seedling varieties using the underwater cultivation method is shown in FIG. 14 shows the growth of the transformed potato in the aquaculture system, 2 shows the tuber of the transformed potato in the underwater culture bed, 3 shows the potato harvested from the transformed Jasim variety.

As a result of analyzing tubers obtained from the above, it was confirmed that the transformed potato produced in the Examples of the present invention increased the amount of SAM easily detected, as compared with the non-transformed potato in which the SAM was not analyzed (FIG. 15). .

Example  3: s - Adenosylmethionine  Control of plant menstrual cycle according to the content of plant

There are four SAM-s genes in Arabidopsis, and their function is expected to be different. In addition, since SAM is used as a precursor of physiological control substances in plants, it was expected that physiological changes would be large when the genes overexpressing SAM were overexpressed.

In view of the advantage, the inventors have found that potato solar titanium breather non Dense (Solanum brevidense) NCBI GenBank Agrobacterium the SAM -s gene cloned from AY635050 tumefaciens tyumeo a transgenic method for Pacifico Enschede the medium (Agrobacterium tumefacients -mediated transformation) was used to transform Arabidopsis s according to a conventional method.

In order to manufacture a plant transformation carrier, the Bam HI and the SbSAM biosynthesis genes with adapters attached to the Sac I site at the MCS region of the plant transformation carrier pBI121 were treated with the same restriction enzymes and ligated to each other. Was constructed (FIG. 16).

Seed cultured Agrobacterium was put into 1L YEP containing antibiotics, incubated at 28 ° C. overnight, and then centrifuged to recover only the cells. The cells were resuspended in 1 L of transgenic B5 and 40 μl / L of Silwet L-77 was added. The solution was placed in a 2 L beaker and the plant was immersed for 1-2 minutes and then covered with a plastic bag to fix the vinyl (after 3 days).

Seeds were obtained from the transformed individuals to obtain 81 lines of seeds in the F1 generation through antibiotic screening. Among them, the SAM-s gene was inserted to identify the individual inserted into the chromosome. About 10 to 20 seeds were germinated in each of the obtained 81 lines, and only the surviving individuals in MS medium containing kanamycin were transferred to the soil and cultured. Genomic DNA was isolated from the leaves of the grown individuals, and PCR was performed to confirm that the SAM-s gene was inserted (the same conditions as in Experiment 1 of Example 1). In Figure 17, M is 100bp ladder, W1 is wild type 1, lane 1 is 1-4, 2: 5-2, 3: 5-3, 4: 6-3, 5: 8-3, 6: 9-4, 7: 9-5, 8: 14-8, 9: 16-8, 10: 19-2, 11: 22-1, 12: 22-2, 13: 23-1, 14: 24-3, 15: 24-4, 16: 25-1, 17: 36-4, 18: 39-3, 19: 54-9, 20: 58-6, 21: 59-1, 22: 59-2, 23: 59- 3, 24: 59-5, 25: 64-2, 26: 64-4, 27: 76-6, 28: 76-8.

As shown in FIG. 17, in the wild type, a band of 195 bp, which is a PCR product by the 35S promoter in the transformant, was not found. However, all of the 28 transgenic individuals except for plant 1-4 lines in lane 1 can be confirmed that the transformed SAM-s.

Later, Southern blotting confirmed how many copies were entered (not shown).

Thus going to the selected SAM -s gene grow the overexpressed Arabidopsis thaliana was observed a growth base s.

As shown in FIG. 18 and FIG. 19, there was no change in germination and initial growth, but it was found that defoliation of Arabidopsis leaves overexpressing SAM-s progressed rapidly after flowering.

Experimental Example  1: Asexual reproduction of Arabidopsis transformants

The parent strain to be used as the explants is grown on the basis of the stem of the growing individual as an explant in the in-flight culture in MS basic medium, or sowing the seed stored at 5 ℃.

In the case of seed sowing, the seeds stored at 5 ° C. were sterilized for 10 minutes in 70% ethanol and 5% sodium hypochloride solution, and washed with sterile water several times. Seeds were washed in MS basic medium, and then grown for 3-4 weeks in growth control phase (temperature 23 ± 1 ℃, relative humidity 70 ~ 80%, 2,000 fluorescent lights, photoperiod 16 hours, Korea Instruments, Seoul). After that, 5 ~ 6 leaves were selected and seeded 4 per culture vessel. After that, it was managed by propagation through nutrient breeding in the form of cutting.

As described through the above Examples and Experimental Examples, the present invention relates to an edible plant for producing high content of es-adenosylmethionine and its use, and to a method for regulating the menstrual cycle of plants by changing the content of es-adenosylmethionine By introducing a coding gene of S-adenosylmethionine biosynthetic enzyme derived from Solanum brevidense into edible plants, it is excellent for producing an edible plant transformant that overexpresses S-adenosylmethionine. It works. Edible plant transformant over-expressing the S- adenosyl methionine of the present invention is effective to enable the prevention of the disease by easily ingesting the S- adenosyl methionine through food. In addition, the present invention has an excellent effect on improving plants useful for agriculture by controlling the growth cycle of the plant by genetically controlling the synthesis of S- adenosylmethionine. Therefore, the present invention is a very useful invention for agriculture.

<110> Myongji University Industry and Academia Cooperation          RURAL DEVELOPMENT ADMINISTRATION <120> Transgenic esculent plants producing high amount of          S-adenosylmethionine and use according, and a method for          controlling physiological cycle of plant by changing amount of          S-adenosylmethionine <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 1523 <212> DNA <213> Solanum brevidens <220> <221> gene (222) (1) .. (1523) <223> S-adenosyl methionine synthase <220> <221> CDS (109). (1287) <400> 1 acgaggcaaa gaggtttttt ctctcaaggg gtataaagat tgctcctttc cgacatttct 60 aaacctcttt ttctattagt tcgctgttgg gttccctttt tcttgaga atg gaa act 117                                                        Met glu thr                                                          One ttc cta ttc acc tcc gag tct gtg aac gag ggt cac cca gac aag ctc 165 Phe Leu Phe Thr Ser Glu Ser Val Asn Glu Gly His Pro Asp Lys Leu       5 10 15 tgt gat cag atc tct gat gca gtt ctt gat gcc tgc ctt gag caa gat 213 Cys Asp Gln Ile Ser Asp Ala Val Leu Asp Ala Cys Leu Glu Gln Asp  20 25 30 35 cct gag agc aaa gtt gca tgt gaa act tgc acc aag acc aac ttg gtc 261 Pro Glu Ser Lys Val Ala Cys Glu Thr Cys Thr Lys Thr Asn Leu Val                  40 45 50 atg gtc ttt ggt gag atc aca acc aag gct att gta gac tat gag aaa 309 Met Val Phe Gly Glu Ile Thr Thr Lys Ala Ile Val Asp Tyr Glu Lys              55 60 65 atc gtg cgt gac aca tgc cgt aac att gga ttt gtt tct gat gat gtt 357 Ile Val Arg Asp Thr Cys Arg Asn Ile Gly Phe Val Ser Asp Asp Val          70 75 80 ggt ctt gat gcc gac aac tgc aag gtc ctt gtt tac att gag cag caa 405 Gly Leu Asp Ala Asp Asn Cys Lys Val Leu Val Tyr Ile Glu Gln Gln      85 90 95 agt cct gat att gct caa ggt gtc cac ggc cat ctg acc aaa cgc cct 453 Ser Pro Asp Ile Ala Gln Gly Val His Gly His Leu Thr Lys Arg Pro 100 105 110 115 gag gag att ggt gct ggt gac cag ggt cac atg ttt ggc tat gcc acc 501 Glu Glu Ile Gly Ala Gly Asp Gln Gly His Met Phe Gly Tyr Ala Thr                 120 125 130 gat gag acc cct gaa tta atg cct ctc agt cac gtg ctt gca act aaa 549 Asp Glu Thr Pro Glu Leu Met Pro Leu Ser His Val Leu Ala Thr Lys             135 140 145 ctt ggt gcc cgc ctt aca gaa gtt cgc aag aat ggc acc tgc cgc tgg 597 Leu Gly Ala Arg Leu Thr Glu Val Arg Lys Asn Gly Thr Cys Arg Trp         150 155 160 ttg aag cct gat ggc aaa act caa gtt act gtt gag tac tgc aat gac 645 Leu Lys Pro Asp Gly Lys Thr Gln Val Thr Val Glu Tyr Cys Asn Asp     165 170 175 aat ggt gcc atg att cca att agg gtc cac act gtt ctc atc tcc act 693 Asn Gly Ala Met Ile Pro Ile Arg Val His Thr Val Leu Ile Ser Thr 180 185 190 195 caa cac gat gag act gtt aca aat gat gag att gcc cgc gac ctt aag 741 Gln His Asp Glu Thr Val Thr Asn Asp Glu Ile Ala Arg Asp Leu Lys                 200 205 210 gag cat gct atc aag cca gtc atc cca gag aag tac ctt gac gag aag 789 Glu His Ala Ile Lys Pro Val Ile Pro Glu Lys Tyr Leu Asp Glu Lys             215 220 225 aca atc ttc cac ctt aac cca tct ggc cga ttt gtt att ggt gga cct 837 Thr Ile Phe His Leu Asn Pro Ser Gly Arg Phe Val Ile Gly Gly Pro         230 235 240 cat ggt gat gct ggt ctc act ggt cgt aaa atc atc att gac act tat 885 His Gly Asp Ala Gly Leu Thr Gly Arg Lys Ile Ile Ile Asp Thr Tyr     245 250 255 ggt ggt tgg ggt gcc cat ggt ggt ggt gca ttc tct ggc aag gac cca 933 Gly Gly Trp Gly Ala His Gly Gly Gly Ala Phe Ser Gly Lys Asp Pro 260 265 270 275 acc aag gtt gac agg agt ggt gca tac att gta agg cag gct gca aag 981 Thr Lys Val Asp Arg Ser Gly Ala Tyr Ile Val Arg Gln Ala Ala Lys                 280 285 290 agt att gta gct agt gga ctc gct cgc aga tgc atc gtg cag gtt tct 1029 Ser Ile Val Ala Ser Gly Leu Ala Arg Arg Cys Ile Val Gln Val Ser             295 300 305 tat gcc atc ggt gtg cct gag cca ttg tct gta ttc gtt gac acc tat 1077 Tyr Ala Ile Gly Val Pro Glu Pro Leu Ser Val Phe Val Asp Thr Tyr         310 315 320 ggc act gga aag atc ccc gac agg gaa att ttg aag atc gtt aag gag 1125 Gly Thr Gly Lys Ile Pro Asp Arg Glu Ile Leu Lys Ile Val Lys Glu     325 330 335 aac ttc gac ttc aga cct gga atg atg tcc att aac ttg gat ttg aag 1173 Asn Phe Asp Phe Arg Pro Gly Met Met Ser Ile Asn Leu Asp Leu Lys 340 345 350 355 agg ggt ggc aat ggg aga ttc ttg aaa act gct gcc tat ggt cat ttt 1221 Arg Gly Gly Asn Gly Arg Phe Leu Lys Thr Ala Ala Tyr Gly His Phe                 360 365 370 gga cgt gac gac gct gat ttc aca tgg gaa gtt gtc aag ccc ctc aag 1269 Gly Arg Asp Asp Ala Asp Phe Thr Trp Glu Val Val Lys Pro Leu Lys             375 380 385 tgg gaa aac ccc caa gac taa taagtgtctg aaagtgcttg cctatgtttt 1320 Trp Glu Asn Pro Gln Asp         390 ttttctcttt gttgtttgct tgtggcttta gaatcccctg tgtttgcttg tctatgtatt 1380 ttctcttttg accctttttt tgctattgtc ctgtttccat tgtgttggaa cttggatatc 1440 ttaggccttg gaatattaag gaaaaaaaac tattattata tacataaaaa ttagtgcatt 1500 tgtggaaaaa aaaaaaaaaa aaa 1523 <210> 2 <211> 393 <212> PRT <213> Solanum brevidens <400> 2 Met Glu Thr Phe Leu Phe Thr Ser Glu Ser Val Asn Glu Gly His Pro   1 5 10 15 Asp Lys Leu Cys Asp Gln Ile Ser Asp Ala Val Leu Asp Ala Cys Leu              20 25 30 Glu Gln Asp Pro Glu Ser Lys Val Ala Cys Glu Thr Cys Thr Lys Thr          35 40 45 Asn Leu Val Met Val Phe Gly Glu Ile Thr Thr Lys Ala Ile Val Asp      50 55 60 Tyr Glu Lys Ile Val Arg Asp Thr Cys Arg Asn Ile Gly Phe Val Ser  65 70 75 80 Asp Asp Val Gly Leu Asp Ala Asp Asn Cys Lys Val Leu Val Tyr Ile                  85 90 95 Glu Gln Gln Ser Pro Asp Ile Ala Gln Gly Val His Gly His Leu Thr             100 105 110 Lys Arg Pro Glu Glu Ile Gly Ala Gly Asp Gln Gly His Met Phe Gly         115 120 125 Tyr Ala Thr Asp Glu Thr Pro Glu Leu Met Pro Leu Ser His Val Leu     130 135 140 Ala Thr Lys Leu Gly Ala Arg Leu Thr Glu Val Arg Lys Asn Gly Thr 145 150 155 160 Cys Arg Trp Leu Lys Pro Asp Gly Lys Thr Gln Val Thr Val Glu Tyr                 165 170 175 Cys Asn Asp Asn Gly Ala Met Ile Pro Ile Arg Val His Thr Val Leu             180 185 190 Ile Ser Thr Gln His Asp Glu Thr Val Thr Asn Asp Glu Ile Ala Arg         195 200 205 Asp Leu Lys Glu His Ala Ile Lys Pro Val Ile Pro Glu Lys Tyr Leu     210 215 220 Asp Glu Lys Thr Ile Phe His Leu Asn Pro Ser Gly Arg Phe Val Ile 225 230 235 240 Gly Gly Pro His Gly Asp Ala Gly Leu Thr Gly Arg Lys Ile Ile Ile                 245 250 255 Asp Thr Tyr Gly Gly Trp Gly Ala His Gly Gly Gly Ala Phe Ser Gly             260 265 270 Lys Asp Pro Thr Lys Val Asp Arg Ser Gly Ala Tyr Ile Val Arg Gln         275 280 285 Ala Ala Lys Ser Ile Val Ala Ser Gly Leu Ala Arg Arg Cys Ile Val     290 295 300 Gln Val Ser Tyr Ala Ile Gly Val Pro Glu Pro Leu Ser Val Phe Val 305 310 315 320 Asp Thr Tyr Gly Thr Gly Lys Ile Pro Asp Arg Glu Ile Leu Lys Ile                 325 330 335 Val Lys Glu Asn Phe Asp Phe Arg Pro Gly Met Met Ser Ile Asn Leu             340 345 350 Asp Leu Lys Arg Gly Gly Asn Gly Arg Phe Leu Lys Thr Ala Ala Tyr         355 360 365 Gly His Phe Gly Arg Asp Asp Ala Asp Phe Thr Trp Glu Val Val Lys     370 375 380 Pro Leu Lys Trp Glu Asn Pro Gln Asp 385 390  

Claims (7)

Solanum brevidens described in SEQ ID NO: 1 brevidense ) a method for producing an edible plant having an enhanced content of es-adenosylmethionine, comprising the step of transforming the coding gene of the S-adenosylmethionine biosynthetic enzyme derived from brevidense ) into an edible plant. According to claim 1, wherein the edible plant is characterized in that the potato or Arabidopsis s-adenosylmethionine content method for producing an edible plant. An edible plant having an increased content of S-adenosylmethionine prepared according to the method of claim 1. A food composition comprising an edible plant or an extract thereof having an enhanced content of S-adenosylmethionine prepared according to the method of claim 1 as an active ingredient. A method of regulating the menstrual cycle of a plant by introducing a coding gene of S-adenosylmethionine biosynthesis into the plant to control the content of S-adenosylmethionine in the plant. The method according to claim 5, wherein the gene is solanum bredides ( Solanum) described in SEQ ID NO: brevidense ) a method for regulating the menstrual cycle of a plant, characterized in that it is a coding gene of S-adenosylmethionine biosynthesis. The method of claim 5, wherein the plant is a Arabidopsis.

Images