KR20080108876A - Recombinant ec-sod protein, prepration method and use thereof - Google Patents

Abstract

A manufacturing method of a recombinant EC-SOD(extracellular superoxide dismutase) protein is provided to mass produce the recombinant EC-SOD protein which is useful for prevention and treatment of allergy disease or cancer disease. The manufacturing method of the recombinant EC-SOD protein comprises the steps of: (a) cloning the recombinant EC- SOD gene having the nucleotide sequence of SEQ ID NO:1 to an expression vector; (b) transforming the expression vector into a host cell to transform the host cell; (c) culturing transformed host cell to express the recombinant EC-SOD protein; (d) obtaining an inclusion body of the expressed recombinant EC-SOD protein; and (e) inducing the melting and refolding of the inclusion body.

Description

Recombinant EC-SOD protein, prepration method and use thereof

1 is a graph showing the results of liquid chromatography for high-speed protein purification of recombinant EC SOD protein according to the present invention. (A: line balance section, B: sample injection section, C: column washing section, D: refolding section, E: refolding equilibrium section, F: elution section, G: column washing section, X axis: time and volume ( Hours: minutes: seconds, mL), Y-axis: UV absorbance (Unit))

Figure 2 is a Coomassie-blue protein staining picture showing the results of refolded and purified recombinant EC SOD protein according to the present invention by SDS-PAGE. (M: Molecular weight size marker, A: 8M urea buffer solution (sample before refolding purification) dissolved, B: inclusion body impurities eluted without adsorption on column, C: EC-SOD eluted after refolding purification , D: EC-SOD concentrated by ultrafiltration after desalting)

Figure 3 shows the results confirmed by Western blot recombinant EC-SOD protein using an anti-EC-SOD protein antibody. (SM: size marker, 1: control (HaCaT human EC-SOD), 2: recombinant EC-SOD protein of the present invention)

4 shows the results of confirming the SOD activity during the purification process. (209 FT: sample eluted without adsorption during purification, 209 E1: primary purified recombinant EC-SOD protein refolded with metal affinity chromatography column, 209 E2: separated by gel-filtration column, purified ash Combination EC-SOD protein)

Figure 5 is a result confirming the inhibitory effect of UVB induced ROS in HaCaT cells by recombinant EC-SOD protein. (UVB: UVB irradiation only ECSOD + UVB: UVB irradiation and EC-SOD treatment)

Figure 6 shows the results of confirming the cytoplasm and nuclear permeability of the recombinant EC-SOD protein.

7 is a result confirming the inhibition of activation of NF-κB of recombinant EC-SOD protein. (Control: group not irradiated with EC-SOD transfected HaCaT cells, UVB: group irradiated with UVB at 100 J / m ² in HaCaT cells, ECSOD / UVB: treated with recombinant EC-SOD protein in HaCaT cells UVB irradiated at 100 J / m ² )

8 is a result of irradiating the skin keratinocytes with UV rays and immunohistochemical expression of VEGF expression according to the recombinant EC SOD treatment of the present invention (A: control, B: UVB irradiation, C: recombinant EC SOD treatment) + UVB irradiation, D: recombinant EC SOD treatment)

Figure 9 is a result of confirming the inhibitory effect of mast cell degranulation of recombinant EC-SOD protein (A) and its micrograph (B). (Con: group of human mast cells without any treatment, EC SOD: group treated with EC-SOD, A + P: group that increased calcium concentration in cells, A + P + EC SOD: pretreated with EC-SOD Increased calcium levels in the body)

10 is a result confirming the effect on T-cell proliferation when the recombinant EC-SOD protein treatment. (Neg: test group that did nothing)

11 is a result confirming the effect on the differentiation of T-cells in the treatment of recombinant EC-SOD protein with IL-4 secretion amount. (neg .: test group not treated with antigen,-: test group treated with antigen (Ova peptide) only, p: test group treated with antigen (Ova peptide) and EC-SOD in PBS, NB: antigen) (Ova peptide) and test group treated with EC-SOD in sodium borate)

The present invention relates to a recombinant EC-SOD protein, a method for producing the same, and a use thereof, and more particularly, a recombinant EC-SOD protein having a nucleotide sequence represented by SEQ ID NO: 1, and the protein produced by mass expression of the protein. The present invention relates to a method for producing a recombinant EC-SOD protein by inducing dissolution and refolding of the inclusion bodies thereof, and to the use of the recombinant EC-SOD protein.

Superoxide dismutase (SOD), which not only removes free radicals but also protects cells by allowing other antioxidant enzymes to act, is a Cu / Zn SOD (SOD 1) containing copper and zinc atoms and Mn containing manganese atoms. SOD (SOD 2) and extracellular superoxide dismutase (EC-SOD) present on the cell surface or extracellular fluid.

In particular, although EC-SOD has copper and zinc atoms like Cu / Zn SOD, heparin binding domain is present at the C-terminal side. Since EC-SOD has a heparin binding domain, it is believed that EC-SOD binds to heparin in the cell membrane and protects the cell membrane. According to the literature, EC-SOD is known to be responsible for biological defenses in plasma and extracellular matrix (Marklund et al, Biochem . J. 266, 213-219, 1990; Su et al., Am J Respir). Cell Mol Biol ., Feb 16 (2), 162-70, 1997; Luoma et al., Thromb . Vasc . Bio . 18, 157-167,1998). In addition, the heparin-binding domain of EC-SOD acts as a nuclear localization signal, located in the nucleus of the thymus and testis cells to protect genomic DNA from oxidative stress and to reduce redox reactions. It has been reported to modulate sensitive transcription (Ookawara T et al., BBRC , 296, 54-61, 2002).

As described above, research on various functions of EC-SOD is being conducted, but in order to study its functions, there is a need to produce a large amount of proteins having activity. The mass production method of proteins developed to date is to transform host cells, such as E. coli, into expression vectors and induce their expression. Mass production of proteins often results in the formation of inclusion bodies. There has been a problem that the original activity of the protein is lost or reduced.

Therefore, the inventors of the present invention conducted a study on EC-SOD when a large amount of recombinant EC-SOD, in which a signal peptide in the N-terminal region and 13 amino acids in the C-terminal region were removed from human EC-SOD of full length, was removed. By forming an inclusion body, it was found that the EC-SOD having full activity can be separated and purified by inducing dissolution and refolding, thus completing the preparation method of the recombinant EC-SOD protein of the present invention.

Accordingly, it is an object of the present invention to provide a method for producing recombinant EC-SOD and its application.

In order to achieve the above object, the present invention provides a method for producing a recombinant EC-SOD.

In order to achieve another object of the present invention, the present invention provides a recombinant EC-SOD produced by the above production method.

In order to achieve another object of the present invention, the present invention provides a pharmaceutical composition comprising the recombinant EC-SOD.

Hereinafter, the content of the present invention will be described in more detail.

Method for producing a recombinant EC-SOD of the present invention is characterized by cloning the recombinant EC-SOD gene having a nucleotide sequence represented by SEQ ID NO: 1 in an expression vector, introducing it into a host cell and expressing it, and then inducing refolding thereof. It is done.

More specifically, the method for producing a recombinant EC-SOD of the present invention

(a) cloning a recombinant extracellular superoxide dismutase (EC-SOD) gene having the nucleotide sequence represented by SEQ ID NO: 1 into an expression vector;

(b) transforming the host cell by introducing the expression vector into the host cell;

(c) culturing the transformed host cell to express a recombinant EC-SOD protein;

(d) obtaining an inclusion body of the expressed recombinant EC-SOD protein;

(e) inducing dissolution and refolding of the inclusion body.

Cloning the recombinant EC-SOD gene in the expression vector in step (a) can be performed using a conventional recombinant DNA technique known in the art, wherein the gene is the nucleotide sequence represented by SEQ ID NO: 1 Can have The gene encodes a signal peptide at the N-terminal site and 209 amino acids (SEQ ID NO: 2) from which the 13 amino acids at the C-terminal region of the full length human EC-SOD are removed.

The gene can be constructed by PCR amplification using appropriate primers. Alternatively, DNA sequences may be synthesized by standard methods known in the art, such as using automated DNA synthesizers (such as those sold by Biosearch or Applied Biosystems).

As the expression vector, a conventional expression vector used in the art can be used, and an appropriate one can be selected and used according to the host cell. For example, when the host cell is Escherichia coli, a pET28a vector (Novagene, USA) can be used. . Since the preparation method of the present invention is intended to produce recombinant EC-SOD by expressing a large amount, one of ordinary skill in the art can appropriately select and use it.

In the present invention, the expression vector is a vector capable of expressing a target protein or a target RNA in a suitable host cell, and refers to a gene construct including essential regulatory elements operably linked to express a gene insert. As used herein, the term “operably linked” refers to the functional linkage of a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein or RNA of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the encoding nucleic acid sequence.Operative linkage with recombinant vectors may be accomplished using genetic recombination techniques well known in the art. And site-specific DNA cleavage and ligation using enzymes generally known in the art.

Vectors of the invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like. Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers (promoter) and can be prepared in various ways depending on the purpose. Can be. The promoter of the vector may be constitutive or inducible. The expression vector also includes a selection marker for selecting a host cell containing the vector and, in the case of a replicable expression vector, a replication origin.

Transforming by introducing the expression vector of step (b) into the host cell includes any method of introducing a nucleic acid into the host cell, it can be carried out by transformation techniques known to those skilled in the art. Preferably, microprojectile bombardment, electroporation, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, PEG-mediated fusion, microinjection (microinjection) and liposome-mediated methods, including but not limited to.

In this case, the host cell may be a prokaryotic cell or a eukaryotic cell, but preferably, the host cell may be Escherichia coli. coli ), Bacillus Subtilis ( Bacillus subtilis), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Pro Chateau's Mira Billy's (Proteus mirabilis) or Staphylococcus (Staphylococcus) and prokaryotic host cells, fungi (e.g., Aspergillus (Aspergillus like)), yeast (e.g., Pichia Pastries ( Pichia pastoris ), Saccharomyces Servigroup jiae (Saccharomyces cerevisiae), investigating car break in Rome Seth (Schizosaccharomyces), neuro-La Spokane Chrysler Corporation (Neurospora cells of higher eukaryotes, including lower eukaryotic cells such as crassa ), insect cells, plant cells, mammals, etc. may be used as host cells, but are not limited thereto. More preferably, the host cell of the present invention may use E. coli.

Cultivation and expression of the host cell of step (c) includes culturing under appropriate media and conditions such that the recombinant EC-SOD protein of the present invention is expressed in the transformed host cell. Methods for culturing the transformed cells to express the recombinant protein are known in the art, and for example, seeded in a suitable medium in which the transformed cells can be grown and seeded, and then seeded in the culture medium. And expression of the protein by incubation in suitable conditions.

The obtaining of the inclusion bodies in the step (d) may be a known method for separating and obtaining the insoluble inclusion bodies, and for example, the inclusion bodies may be obtained in the cell precipitate by centrifugation.

Induction of dissolution and refolding of the inclusion bodies in step (e) is performed by conventional methods known in the art, for example, by dissolving the inclusion bodies in a buffer solution containing a protein denaturant and then adsorbing the metal affinity resin column. And inducing refolding while lowering the denaturant concentration.

For example, the induction of dissolution and refolding of the inclusion body may be performed by dissolving the inclusion body in Tris buffer solution (8M urea, 50 mM Tris-Cl, 100 mM NaCl) to which the denaturant 8M urea is added, followed by metal affinity resin. Adsorption is carried out in the column filled with a 1M urea, Tris buffer solution with 1M urea can be carried out by a method of inducing refolding by slowly removing the urea while giving a concentration gradient to the column.

Next, the elution buffer solution having a high adsorption with the column or the elution buffer solution having a low pH (typically 4 or less) may be introduced from the top of the column to obtain the refolded pure protein. For example, this can be accomplished by introducing an elution buffer solution containing imidazole (typically 1 M) with a high adsorption to a metal affinity chromatography column from the top of the column to obtain it from the bottom of the column to obtain pure refolded protein. Can be. In addition, the elution buffer solution is preferably added to the column so that the concentration of the solution is gradually added over time, that is, to have a concentration gradient can increase the yield of the refolded protein.

The preparation method of EC-SOD of the present invention may further include the step of (f) separating and purifying by a gel-filtration column, and then for further purification, concentration, solvent exchange, and the like. Can be carried out through various separation and purification methods known in the art, for example, salting out (ammonium sulfate precipitation and sodium phosphate precipitation), solvent precipitation (protein fraction precipitation using acetone, ethanol, etc.), dialysis, gel Techniques such as filtration, ion exchange chromatography, reverse phase column chromatography and affinity chromatography can be applied alone or in combination to produce the recombinant EC-SOD protein of the invention.

Standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd) ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984); and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

On the other hand, the present invention provides a recombinant EC-SOD protein produced by the above method. The recombinant EC-SOD protein of the present invention consists of a signal peptide at the N-terminal part and 209 amino acids from 13 amino acids at the C-terminal part of the full-length human EC-SOD, preferably SEQ ID NO: 2 It may have an amino acid sequence of. Recombinant EC-SOD protein of the present invention has the same SOD activity as human EC-SOD, cell permeability, transcription factor activity inhibition, angiogenesis inhibition, human mast cell degranulation and IL-4 (interleukin-4) reduction effect Indicates.

In one embodiment of the present invention, the recombinant EC-SOD gene was cloned and expressed in large quantities, and the EC-SOD protein was prepared by inducing lysis and refolding of the EC-SOD protein in the formed inclusion bodies.

Meanwhile, in another embodiment of the present invention, to confirm whether the recombinant EC-SOD protein prepared above is an EC-SOD protein, Western blot, SOD activity test, and ROS removal effect were confirmed. As a result, the recombinant EC-SOD protein prepared above was able to bind to the anti-EC-SOD antibody, it can be seen that it has SOD activity and ROS removal activity.

In another embodiment of the present invention, the cell permeability of the recombinant EC-SOD protein was confirmed. As a result, it was found that the purified recombinant EC-SOD protein penetrated into the cell and a part of it moved to the nucleus. Therefore, it was found that the recombinant EC-SOD protein of the present invention can also perform the function in the cell or in the nucleus.

In another embodiment of the present invention was confirmed the effect of inhibiting the transcription factor activity and angiogenesis of recombinant EC-SOD protein. As a result, the recombinant EC-SOD protein of the present invention inhibits the activation of the transcription factor NF-κB, inhibits the expression of VEGF (vascular endothelial growth factor), it can be seen that also inhibits angiogenesis.

On the other hand, in another embodiment of the present invention it was confirmed that the effect of reducing the recombination of human mast cells of recombinant EC-SOD protein. As a result, treatment with recombinant EC-SOD protein reduced the degranulation of mast cells.

Accordingly, the present invention provides a pharmaceutical composition for the prevention and treatment of allergic diseases containing the recombinant EC-SOD protein as an active ingredient.

The pharmaceutical compositions according to the invention may comprise a pharmaceutically effective amount of recombinant EC-SOD protein alone or may comprise one or more pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically effective amount” refers to an amount that exhibits a higher response than the negative control, and preferably an amount sufficient to treat or prevent an allergic disease.

The pharmaceutically effective amount of the recombinant EC-SOD protein according to the invention is 0.1 μg to 100 mg / day / kg body weight, preferably 1 μ to 10 mg / day / kg body weight. However, the pharmaceutically effective amount may be appropriately changed depending on various factors such as the disease and its severity, the patient's age, weight, health condition, sex, route of administration and duration of treatment.

The disease to which the pharmaceutical composition of the present invention may be applied may be an allergic disease. In the present invention, "allergic disease" refers to a disease caused by the hypersensitivity of the body's immune system to a substance, such as hypersensitivity to a substance of the human body. Preferably, it refers to hypersensitivity in which a mediator, such as histamine, is released by a substance from the outside to cause disease. Examples of the allergic disease may include allergic asthma, allergic rhinitis, allergic otitis media, anaphylatic shock and allergic skin diseases. In particular, the allergic skin diseases may include atopic dermatitis, psoriasis, contact allergic dermatitis and urticaria.

As used herein, "pharmaceutically acceptable" is a non-toxic composition that, when administered physiologically and when administered to humans, does not inhibit the action of the active ingredient and typically does not cause gastrointestinal disorders, allergic reactions such as dizziness or the like. Say Such carriers include all kinds of solvents, dispersion media, oil-in-water or water-in-oil emulsions, aqueous compositions, liposomes, microbeads and microsomes.

On the other hand, the pharmaceutical composition according to the present invention can be formulated with a suitable carrier depending on the route of administration. The route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but may be administered orally or parenterally. Parenteral routes of administration include, for example, several routes such as transdermal, nasal, abdominal, muscle, subcutaneous or intravenous.

In the case of oral administration of the pharmaceutical composition of the present invention, the pharmaceutical composition of the present invention is prepared in powder, granule, tablet, pill, dragee, capsule, liquid, gel according to a method known in the art together with a suitable oral carrier. , Syrups, suspensions, wafers and the like. Examples of suitable carriers include sugars, including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol and starch, cellulose, starch including corn starch, wheat starch, rice starch and potato starch, and the like. Fillers such as cellulose, gelatin, polyvinylpyrrolidone, and the like, including methyl cellulose, sodium carboxymethylcellulose, hydroxypropylmethyl-cellulose, and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate and the like may optionally be added as a disintegrant. Furthermore, the pharmaceutical composition may further include an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, and a preservative.

In addition, when administered parenterally, the pharmaceutical compositions of the present invention may be formulated according to methods known in the art in the form of injections, transdermal and nasal inhalants together with suitable parenteral carriers. Such injections must be sterile and protected from contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media comprising water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycols, etc.), mixtures thereof and / or vegetable oils Can be. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanol amine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be further included. In addition, the injection may in most cases further comprise an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administrations, ointments, creams, lotions, gels, external preparations, pasta preparations, linen preparations, air rolls and the like are included. As used herein, "transdermal administration" means that the pharmaceutical composition is topically administered to the skin such that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin. These formulations are formulated in Remington's , a commonly known formula in pharmaceutical chemistry. Pharmaceutical Science , 15th Edition, 1975, Mack Publishing Company, Easton, Pennsylvania.

In the case of inhaled dosages, the compounds used according to the invention may be pressurized packs or by means of suitable propellants, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be delivered conveniently from the nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or blowers can be formulated to contain a mixture of the compound and a suitable powder base such as lactose or starch.

Other pharmaceutically acceptable carriers may be referred to those described in the following documents (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

In addition, the pharmaceutical compositions according to the invention may comprise one or more buffers (e.g. saline or PBS), carbohydrates (e.g. glucose, mannose, sucrose or dextran), antioxidants, bacteriostatic agents, chelating agents (Eg, EDTA or glutathione), adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents, and / or preservatives.

In addition, the pharmaceutical compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

In addition, the pharmaceutical composition of the present invention can be administered in parallel with known compounds such as immunostimulants or antihistamines, which have the effect of preventing or treating allergic diseases.

In addition, in another embodiment of the present invention confirmed the effect on the cytokine of the recombinant EC-SOD protein. As a result, the recombinant EC-SOD reduced the formation of IL-4, a type of cytokine.

Accordingly, the present invention provides a pharmaceutical composition for preventing and treating cancer diseases comprising a recombinant EC-SOD protein as an active ingredient. Effective amounts of the pharmaceutical composition, formulation, route of administration and method of administration are as described above, and those skilled in the art can be appropriately changed depending on the condition of the subject to be administered.

The disease to which the pharmaceutical composition of the present invention may be applied may be a cancer disease. The cancer disease, but is not limited to, colon cancer, lung cancer, liver cancer, stomach cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, chorionic cancer, ovarian cancer, breast cancer, Thyroid cancer, brain cancer, head and neck cancer, malignant melanoma, lymphoma, aplastic anemia and the like.

Below. The present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

Recombination EC - SOD  Fusion for Protein Expression EC - SOD  Gene Cloning

To prepare a recombinant EC-SOD protein with biological activity, a recombinant peptide consisting of 209 amino acids from which the signal peptide at the N-terminal region of EC-SOD was removed and 13 amino acids at the C-terminal region were removed EC-SOD was cloned in the following manner.

PUC 18-hEC SOD (supplied by Clinical chemistry, Marklund professor) vector containing human EC-SOD cDNA as a template by PCR amplification using primers of SEQ ID NO: 3 (tagattctggacgggcgagga) and SEQ ID NO: 4 (tactcgagtcactctgagtgct) CDNA of human EC-SOD was prepared. PCR amplification conditions were performed using Pfu I polymerase under conditions of 5 minutes at 95 ° C, 30 seconds at 95 ° C, 30 seconds at 55 ° C, 30 minutes at 72 ° C, and 5 minutes at 72 ° C.

The amplified gene product was digested with restriction enzymes EcoRI and XhoI and then conjugated to the pET28a vector (NovaGene, USA) which was digested with the same restriction enzymes using T4 ligase at 4 ° C for 12 hours.

The vector was transfected with E. coli DH5a, and the transformants were then cultured and selected in LB solid medium containing 25 mg / mL kanamycin. Whether the recombinant EC-SOD gene was correctly inserted into the selected transformants was confirmed by performing gene sequencing (SEQ ID NO: 1). The vector was isolated from the transformant confirmed that the recombinant EC-SOD gene was inserted, inserted into Escherichia coli BL21 (NovaGene, USA), an overexpressing Escherichia coli host cell, and cultured in an LB solid medium containing kanamycin 25 mg / mL. Were screened.

< Example  2>

Recombination EC - SOD  Expression of proteins and Refold ( refolding ) Judo

<2-1> recombination EC - SOC  Expression of protein

The strain selected in Example 1 was incubated in an LB liquid medium containing 25 mg / mL of kanamycin at 37 ° C. When it reached 0.6 at 600 nm of OD (Optical Density), IPTG (1 mM) was added to induce protein expression, and main culture was performed at 37 ° C. for 6 hours to express recombinant EC-SOD protein.

<2-2> recombination EC - SOC  Protein Refold  Induction and purification

Cells were obtained by centrifugation in the finished cultures, and then suspended in 50 mM Tris buffer (pH 7.5) containing 100 mM calcium chloride and disrupted by an ultrasonic mill. After centrifugation to separate only the precipitate layer, the mixture was washed three times with 50 mM Tris buffer containing 100 mM calcium chloride. The washed cell precipitate contains an insoluble protein inclusion body. 10 mg of the washed inclusion bodies (50% fusion protein content) was added to Tris buffer solution (50 mM Tris-Cl, 100 mM NaCl, pH 7.5) and dissolved by addition of 8M urea. After completely suspended at room temperature for 2 hours, the phases were separated by centrifugation, and an aqueous layer of the upper layer was obtained because it contained a dissolved insoluble recombinant EC-SOD protein inclusion (inclusion solution).

Fast Protein Purification Liquid Chromatography (FPLC) was used to refold and purify recombinant EC-SOD as follows: The buffer (8M urea, 50 mM Tris-Cl, 100 mM) NaCl, pH 7.5) was introduced into an equilibrium chromatography column (HisTrap FF crude 5 mL, GE Healthcare, USA) filled with a metal affinity resin at a flow rate of 1 ml / min, and then equilibrated with 5 ml of the inclusion solution obtained above. Was injected at 1 mL / min in an upward direction of an equilibrium chromatography column (3 ml) filled with a metal affinity resin to adsorb the folded protein to a solid support in the column.

After the injection, 50 ml of the buffer solution was injected at the top of the column at 1 mL / min to remove unadsorbed solid matter. After completely removing the cell debris in the column, Tris buffer solution containing 50 mM Tris buffer, 1 mM urea, 100 mM NaCl, 100 mM ZnCl ₂ containing Zn and Cu and 1M urea affecting the activity of EC-SOD , 50 mM CuSO ₄ , pH 7.5) was injected with a linear concentration gradient of 0.5 mL / min toward the top of the column, gradually reducing the denaturant concentration in the column, thereby releasing the folded protein adsorbed on the solid matrix. With three-dimensional structure of the state, the metal ions (Zn and Cu) were completely replaced by the target protein and refolded to have activity.

Then Tris buffer containing 2M imidazole and 1M urea was fed in a concentration gradient from the top to the bottom of the column. The refolded fusion protein was eluted when the elution buffer at 0.5 M imidazole concentration was fed (see FIG. 1).

<2-3> recombination EC - SOD  Isolation and Purification of Proteins

Fast Protein Purification Liquid Chromatography (FPLC) for removing a large amount of imidazole from the eluted protein from Example <2-2> and completely refolding and separating the target protein complex by size ) And a gel filtration chromatography column (Sepharose 12 column) were used. In this process, Tris buffer solution (50 mM Tris-Cl, 100 mM NaCl pH 7.5) or phosphate buffer solution (Phosphate Buffered Saline pH 7.5) was introduced at 0.5 mL / min toward the top of the column for separation and purification. The isolated target protein was concentrated by ultrafiltration.

As a result, the recombinant EC-SOD protein of the present invention was obtained, and as a result of analyzing the samples in each purification step by SDS-PAGE, it was found that the recombinant EC-SOD was well separated as shown in FIG. 2.

< Example  3>

Isolation and Purification EC - SOD  Identification and activity test of protein

<3-1> Weston Blot  Recombination Through EC - SOD  Identification of Protein

Western blot was performed to confirm that the isolated and purified recombinant EC-SOD is an EC-SOD. As a standard protein of EC-SOD, human EC-SOD expressed from HaCaT (provided by Professor N. Fusenig of Cancer Resaerch, Germany), a human keratinocyte cell line, was used. Human EC-SOD expressed from HaCaT and recombinant EC-SOD proteins isolated and purified in Example 2 were electrophoretically separated on a 10% polyacrylamide gel and then polyvinylidene fluoride membrane (Gelman Laboratory, MI) , USA). The polyvinylidene fluoride membrane was then blocked with 5% skim milk powder and then incubated with anti-EC-SOD polyclonal antibody (1: 500, Santa Cruz, USA). The membrane was washed with water, washed again with a secondary antibody IgG (Santa Cruz, USA) bound to peroxidase, and then developed using the manufacturer's instructions using the ECL detection kit (GE Healthcare, USA).

As a result, as shown in FIG. 3, the human EC-SOD (lane “1”) expressed from HaCaT was positive, and the purified and purified protein was detected in the recombinant EC-SOD protein (lane “2”). It was found that the SOD.

<3-2> recombination EC - SOD  Protein activity test

To confirm whether the isolated and purified recombinant EC-SOD protein has SOD biological activity, an activity test was performed using the SOD Assay Kit-WST (Dojindo Molecular Technology, USA) according to the manufacturer's instructions.

As a result, as shown in FIG. 4, the non-adsorbed, eluted sample (209FT) during the purification process showed no activity and was re-folded into the first purified recombinant EC-SOD protein (209 E1) with a metal affinity chromatography column. The activity of was 250 unit / mg protein and the activity of the recombinant EC-SOD protein (209 E2) purified and purified using a gel-filtration column showed 360 unit / mg protein.

<3-3> Isolated and Purified Recombination EC - SOD  Protein ROS  Confirm removal effect

In order to see the effect of removing reactive oxygen species (ROS) from HaCaT cells of recombinant EC-SOD protein, the recombinant EC-SOD protein isolated and purified in Example 2 was treated as follows.

Dissociate the skin keratinocytes (HaCaT) with 1 × 10 ⁴ cells / well in 18 mm coverslips, and then add 10% fetal bovine serum (FBS, GIBCO) and 100 units / ml penicillin and 100 g / ml streptomycin to 1%. Cultured at 5% CO ₂ , 37 ° C using IMDM (Isocove's modified Dulbecco's medium, GIBCO) medium. When attached cells are 30-40% confluent, fetal calf serum is removed and cultured for 24 hours, and when the cells are 50-60% confluent, 10 μg of the EC-SOD is 30 Pretreat for minutes. After irradiating UVB with (100 J / m ² ) for 3 hours, 10 Mm DCFH-DA was reacted at 37 ° C. for 30 minutes and observed with a fluorescence microscope. Photos were taken using a Zeiss digital camera.

As a result, as shown in FIG. 5, ROS was not removed when only UVB was irradiated (UVB), but ROS was effectively removed when UVB was irradiated and treated with the recombinant EC-SOC of the present invention (ECSOD + UVB).

< Example  4>

Recombination EC - SOD  Confirm cell permeability of protein

In order to confirm that the isolated and purified recombinant EC-SOD protein has cell wall permeability, the isolated and purified recombinant EC-SOD protein was labeled with FITC (Fluorescein isothiocyanate) as follows. That is, 1 mg of recombinant EC-SOD protein was reacted with 100 mg of FITC at room temperature for 2 hours in PBS (phosphate buffered saline) buffer. In order to remove unreacted FITC in FITC-labeled recombinant EC-SOD protein solution, it was purified by Fast Protein Purification Liquid Chromatography (FPLC) and desalting column, and used in the following experiment.

Dissociate the skin keratinocytes (HaCaT) with 1 × 10 ⁴ cells / well in 18 mm coverslips, then 10% fetal bovine serum (FBS, GIBCO) and 100 units / ml penicillin and 100 g / ml streptomycin at 1%. Cultured at 5% CO ₂ , 37 ° C using IMDM (Isocove's modified Dulbecco's medium, GIBCO) medium. When the attached cells were 30-40% confluent, they were incubated for 24 hours after removing fetal bovine serum. When the cells were 50-60% confluent, 10 μg of the recombinant EC-SOD protein isolated and purified in Example 2 and labeled with FITC was treated in the cell culture solution immediately after confocal laser scanning (confocal laser scanning). microscope, Carl Zeiss LSM 510).

As a result, as shown in FIG. 6, 10 minutes after the purified recombinant EC-SOD protein was administered to the cell preparation solution, permeation was observed into the cells, and after 15 minutes, some of the target proteins were observed to migrate to the nucleus. . This suggests that the recombinant EC-SOD protein of the present invention can penetrate the cell wall of keratinocytes (HaCaT) and finally migrate to the nucleus.

< Example  5>

Recombination EC - SOD  Inhibition of transcription factor activity of protein

In order to examine the effect of EC-SOD on UV-induced NF-κB activation, cells were seeded on a 14 mm culture slide with HaCaT cells, followed by DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum. ) Cultured in the medium for 24 hours. After 24 hours of culture, starvation was performed for 24 hours in DMEM medium containing 1% fetal calf serum. After treatment, each 10 μg of EC-SOD was treated for 30 minutes (pretreatment), and the cells were washed three times with phosphate buffered saline (PBS), and then 100 J / m ² to induce NF-κB activation. UV light was irradiated. Immediately after UV irradiation, the cells were washed again with phosphate buffer and further cultured for 4 hours by treating EC-SOD with pretreatment concentration in DMEM medium containing 1% fetal calf serum. After that, the cells were fixed in methanol for 5 minutes and then immunostained. The fixed cells were blocked with 10% normal goat serum and then washed three times with phosphate buffer (PBS). In addition, the mouse anti-EC-SOC antibody (Labfrontier, Korea) and rabbit anti-NF-kB antibody (rabbit anti NF-kB antibody, santacuz, USA) and treated at 4 ° C for at least 16 hours. The anti-rabbit IgG secondary antibody (serotec, UK) fused with tetramethyl rhodamine isothiocyanate (TRITC) and the fused anti-mouse-IgG secondary antibody fused with FITC (anti-mouse IgG) secondary antibody, zymed, USA) and then stained with hoechst (Sigma, USA).

As a result, as shown in Fig. 7 (200-fold magnification), NF-κB was not immunostained in the cytoplasm and nucleus in the control group (control group, which did not UV-treated HaCaT cells transfected with EC-SOD). NF-κB was found to be inactive (A, D, G, J). In the UVB group (HaCaT cells irradiated with UVB at 100 J / m ² ), NF-κB was rapidly activated at the nuclear and perinuclear sites (B, E, H, K). . In contrast, in the ECSOD / UVB group (group treated with the recombinant EC-SOD protein of the present invention in a HaCaT cell and irradiated with UVB at 100 J / m ² ), the activation of NF-κB at the nuclear site was significantly inhibited compared to the UVB group. Was observed (C, F, I, L). As a result, the recombinant EC-SOD of the present invention was found to inhibit the activation of the transcription factor NF-κB.

< Example  6>

Recombination EC - SOD  Protein Angiogenesis Inhibitory Effect

By using the recombinant EC-SOD protein isolated and purified in Example 2 The effects of inhibiting angiogenesis were investigated. The dermal keratinocytes (HaCaT) are dispensed at 1 × 10 ⁴ cells / well in 18 mm coverslips. 5% using IMDM (Isocove's modified Dulbecco's medium, GIBCO) medium with 10% fetal calf serum (FBS, GIBCO) and 100 units / ml penicillin and 1 g of 100 g / ml streptomycin It was incubated under conditions of CO ₂ , 37 ° C. When the attached cells are 30-40% confluent, they are incubated for 24 hours after removing fetal bovine serum. When cells are 50-60% confluent, 10 μg of EC-SOD is pretreated. After treatment with purified recombinant EC-SOD protein for 30 minutes, the skin keratinocyte cell line was fixed with paraformaldehyde at 24 hours after UV treatment with 100J and immunostaining was performed. Fixed cells were blocked with 10% normal goat serum and then washed three times with phosphate buffer (PBS). Here, the rabbit anti-VEGF antibody (rabbit anti VEGF antibody, santacuz, USA) was treated for at least 16 hours at 4 ° C for immunostaining for VEGF (Vascular endothelial growth factor). After fluorescence staining using a fused anti-mouse-IgG secondary antibody (anti-mouse IgG secondary antibody, zymed, USA) fused with FITC was observed by fluorescence microscope (Carl Zeiss, Germany).

As a result, as shown in FIG. 8, the expression of VEGF was significantly increased when UVB was irradiated (UVB) compared to a control without UVB irradiation. In addition, when the recombinant protein was treated in the group irradiated with UVB (EC-SOC / UVB), it was confirmed that the expression of VEGF was significantly suppressed, indicating that angiogenesis was inhibited by the recombinant EC-SOD protein.

< Example  7>

Recombination EC - SOD  Protein Human mast cells Degranulation  Confirmation of reduction effect

To determine the effect of EC-SOD on the degranulation of human mast cells, the number of degranulated cells among 100 cells was counted after staining with toluidine blue.

Human mast cells (Semi, Human Mast Cell-1 (HMC-1), provided by Kyung Hee University Professor Hyung Min) were dispensed at 18 × 18 mm coverslips at 1 × 10 ⁴ cells / coverslip. Medium was cultured using 5% CO ² , 37 ° C using IMDM (Isocove's modified Dulbecco's medium, GIBCO) with 10% fetal calf serum (FBS, GIBCO) and 100 units / ml penicillin and 100 g / ml streptomycin at 1%. The culture was carried out under the conditions of. Because these cells are semi-adhesions, the ratio of cells attached and non-attached is about 4: 6, and EC-SOC 5 when attached cells are 30-40% confluent. After pretreatment with μg and EC-SOD treatment for 1 hour, calcium concentrations of A23187 1 μM and phorbolmyristate acetate (Phorbol 12-Myristate 13-Acetate (PMA) 50 nM) were treated to increase calcium concentration in cells. .

After 12 hours, human mast cells were washed with phosphate buffer solution (PBS) and fixed for 10 minutes with 4% paraformaldehyde. After washing with phosphate buffer solution (PH 2.3), 0.1% toluidine blue solution dissolved in acidic 1% brine (dyed for 2-3 minutes with toluuidine. After washing with water, dehydrated with 95%, 100% alcohol) After fixing with xylene, the number of degranulated cells in 100 cells was counted.

As a result, as shown in Fig. 9A, the number of degranulated cells in the non-treated human mast cell group (control group) was 10, and the number of cells in the EC-SOD-treated group (EC SOD) was 16. . On the other hand, the number of degranulated cells increased more than five times to 55 cells in the group (A + P) which increased the concentration of calcium in the cells to activate the mast cells to induce degranulation, but pretreated EC-SOD and increased the concentration of calcium in the cells. In the subgroup (A + P + EC SOD), the number of degranulated cells decreased by 25 again. This shows that degranulation reduction occurred due to inhibition of free radicals due to the action of EC-SOD. Micrographs of mast cell degranulation are shown in Figure 9B.

< Example  8>

Recombination EC - SOD  By protein IL -4 reduction

<8-1> Recombination EC - SOD The effect on T cell proliferation

To determine if EC-SOD affects T cells, which are immune cells, TCR (T cell receptor) transgenic mice that respond to specific antigens (DO.11.10, provided by Professor Sung Young-Chul from Pohang University) I tried to find out.

To see if EC-SOD affects the proliferation of T cells, cells isolated from the transgenic mouse spleen were incubated with the antigen Ova peptide for 72 hours and lasted for ³ h. After incubation with the radiation dose was measured to confirm the proliferation of T cells.

As a result, as shown in FIG. 10, there was little difference in the radiation dose in the group without addition of EC-SOD and the addition of 1 μg / ml or 10 μg / ml of EC-SOD, respectively. It was found that it does not affect.

<9-2> Recombination EC - SOD Effects on T cell differentiation

Cytokines of T cells whose differentiation could be known were measured because they could affect the differentiation of T cells without affecting the proliferation of T cells.

After splenocytes were incubated with the antigen of albumin peptide for 48 hours, IL-4 (interleukin-4) cytokines produced in the culture medium were measured. The measurement was performed using an ELISA-kit from BD (Becton, Dickinson and Company, USA) and measured according to the manufacturer's instructions.

As a result, as shown in Figure 11 EC-SOD reduced the formation of IL-4. As a result, it can be seen that EC-SOD influences the differentiation of T cells. (neg .: test group not treated with antigen,-: test group treated with antigen (Ova peptide) only, p: test group treated with antigen (Ova peptide) and EC-SOD in PBS, NB: antigen) (Ova peptide) and test group treated with EC-SOD in sodium borate, all test groups were treated together in 48 hours culture medium)

As described above, the method for producing a recombinant EC-SOD of the present invention has an effect that can be obtained in large quantities by expressing the EC-SOD having a complete activity. Therefore, the preparation method of the present invention can be used not only for producing a large amount of recombinant EC-SOD, but also for the purpose of providing a composition for the prevention and treatment of allergic diseases or cancer diseases by using the activity of EC-SOD. have.

<110> BIO CLUE & SOLUTION CO., LTD.          SHIN, Dong-Heon <120> Recombinant EC-SOD protein, preparation method and use <130> NP07-0082 <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 627 <212> DNA <213> Homo sapiens <400> 1 tggacgggcg aggactcggc ggagcccaac tctgactcgg cggagtggat ccgagacatg 60 tacgccaagg tcacggagat ctggcaggag gtcatgcagc ggcgggacga cgacggcacg 120 ctccacgccg cctgccaggt gcagccgtcg gccacgctgg acgccgcgca gccccgggtg 180 accggcgtcg tcctcttccg gcagcttgcg ccccgcgcca agctcgacgc cttcttcgcc 240 ctggagggct tcccgaccga gccgaacagc tccagccgcg ccatccacgt gcaccagttc 300 ggggacctga gccagggctg cgagtccacc gggccccact acaacccgct ggccgtgccg 360 cacccgcagc acccgggcga cttcggcaac ttcgcggtcc gcgacggcag cctctggagg 420 taccgcgccg gcctggccgc ctcgctcgcg ggcccgcact ccatcgtggg ccgggccgtg 480 gtcgtccacg ctggcgagga cgacctgggc cgcggcggca accaggccag cgtggagaac 540 gggaacgcgg gccggcggct ggcctgctgc gtggtgggcg tgtgcgggcc cgggctctgg 600 gagcgccagg cgcgggagca ctcagag 627 <210> 2 <211> 209 <212> PRT <213> Homo sapiens <400> 2 Trp Thr Gly Glu Asp Ser Ala Glu Pro Asn Ser Asp Ser Ala Glu Trp   1 5 10 15 Ile Arg Asp Met Tyr Ala Lys Val Thr Glu Ile Trp Gln Glu Val Met              20 25 30 Gln Arg Arg Asp Asp Asp Gly Thr Leu His Ala Ala Cys Gln Val Gln          35 40 45 Pro Ser Ala Thr Leu Asp Ala Ala Gln Pro Arg Val Thr Gly Val Val      50 55 60 Leu Phe Arg Gln Leu Ala Pro Arg Ala Lys Leu Asp Ala Phe Phe Ala  65 70 75 80 Leu Glu Gly Phe Pro Thr Glu Pro Asn Ser Ser Ser Arg Ala Ile His                  85 90 95 Val His Gln Phe Gly Asp Leu Ser Gln Gly Cys Glu Ser Thr Gly Pro             100 105 110 His Tyr Asn Pro Leu Ala Val Pro His Pro Gln His Pro Gly Asp Phe         115 120 125 Gly Asn Phe Ala Val Arg Asp Gly Ser Leu Trp Arg Tyr Arg Ala Gly     130 135 140 Leu Ala Ala Ser Leu Ala Gly Pro His Ser Ile Val Gly Arg Ala Val 145 150 155 160 Val Val His Ala Gly Glu Asp Asp Leu Gly Arg Gly Gly Asn Gln Ala                 165 170 175 Ser Val Glu Asn Gly Asn Ala Gly Arg Arg Leu Ala Cys Cys Val Val             180 185 190 Gly Val Cys Gly Pro Gly Leu Trp Glu Arg Gln Ala Arg Glu His Ser         195 200 205 Glu     <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer <400> 3 tagattctgg acgggcgagg a 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer <400> 4 tactcgagtc actctgagtg ct 22  

Claims (9)

(a) cloning a recombinant extracellular superoxide dismutase (EC-SOD) gene having the nucleotide sequence represented by SEQ ID NO: 1 into an expression vector; (b) transforming the host cell by introducing the expression vector into the host cell; (c) culturing the transformed host cell to express a recombinant EC-SOD protein; (d) obtaining an inclusion body of the expressed recombinant EC-SOD protein; (e) a method of producing a recombinant EC-SOD protein having biological activity, characterized by inducing dissolution and refolding of the inclusion body. The method of claim 1, wherein the method further comprises the step of (f) separating and purifying by a gel-filtration column. The method of claim 1, wherein the host cell is E. coli. The method of claim 1, wherein the inducing and refolding of the inclusion body in step (e) is performed by dissolving the inclusion body in a buffer solution containing a protein denaturant and then adsorbing the metal affinity resin column and lowering the concentration of the denaturing agent. And a method of inducing refolding. A recombinant EC-SOD protein produced by the method of any one of claims 1 to 4. A pharmaceutical composition for preventing and treating allergic diseases comprising the recombinant EC-SOD protein of claim 5 as an active ingredient. The method of claim 6, wherein the allergic disease consists of allergic asthma, allergic rhinitis, allergic otitis media, anaphylatic shock, allergic skin disease, atopic dermatitis, psoriasis, contact allergic dermatitis and urticaria Composition selected from the group. A pharmaceutical composition for preventing and treating cancer diseases comprising the recombinant EC-SOD protein of claim 5 as an active ingredient. The method of claim 8, wherein the cancer disease is colon cancer, lung cancer, liver cancer, stomach cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, chorionic cancer, ovarian cancer, breast cancer, Thyroid cancer, brain cancer, head and neck cancer, malignant melanoma, lymphoma, aplastic anemia, characterized in that the composition selected from the group consisting of.

Images