KR20080054963A - Polydiacetylene sensor chip comprising aptamer and manufacturing process thereof - Google Patents

Abstract

A polydiacetylene sensor chip comprising aptamer is provided to detect rapidly protein or microorganism by using aptamer as a probe, and reduce the required amount of vesicle, polyacetylene and analytes by performing the detection on a solid material, so that the sensor chip is useful for rapid diagnosis of anthrax bacteria. A polydiacetylene sensor chip comprises a substrate, a vesicle bound to the substrate and having polymerized diacetylene represented by the formula(1): A-(L1)d-(CH2)e-C=C-C=C-(CH2)f-(L2)g-B, wherein a sum of d and g is 0, 1 or 2; a sum of e and f is an integer from 2 to 50; e and f are each independently an integer of 1 or more; A and B are each independently methyl group, amine group, carboxyl group, hydroxyl group, maleimide group, biotin group, hydroxysuccinimide group, benzoic acid group or ester group; and L1 and L2 are each independently alkyl group having carbon number of 2 or more, at least one ethylene oxide group, amine group, amide group, ester group or carbonyl group, and a probe aptamer bound to the vesicle, wherein the binding between substrate and vesicle, and between the vesicle and probe aptamer is avidin-biotin binding, streptavidin-biotin binding or amine substitution binding by hydroxysuccinimide; and the diacetylene is a mixture of PCDA(poly(cyclohexanedimethylene adipate))-aminobutyric acid(PCDA-ABA) and PCDA-biotin.

Description

Polydiacetylene Sensor Chip Comprising Aptamer and Manufacturing Method thereof {Polydiacetylene Sensor Chip Comprising Aptamer and Manufacturing Process}

Figure 1 is a schematic diagram of an embodiment for the production of the polydiacetylene sensor chip and analyte detection of the present invention.

2 to 6 are photographs taken of embodiments of the E. coli detection result of the present invention.

7 is a photograph of the result of detecting E. coli with a sensor lacking the probe aptamer.

FIG. 8 is a photograph of an embodiment of a Bacillus detection result of the present invention. FIG.

Figure 9 is a picture taken an embodiment of the Salmonella detection results of the present invention.

Figure 10 is a picture taken an embodiment of the results of the Listeria detection of the present invention.

The present invention relates to a polydiacetylene sensor chip including an aptamer and a method for manufacturing the same, and include a probe aptamer corresponding to an analyte, a polydiacetylene vesicle, and a vesicle. And it relates to a sensor chip showing a fast response time without a separate labeling treatment by combining the substrate and a method for manufacturing the same.

Nanobiosensors are biosensors that are improved by advanced nanotechnology, which converts reactions by binding to biocognitive materials into signals, and refers to sensors that can quickly test specific materials. This is the same principle as the enzyme-substrate complex of the biological concept, in which one ligand is only reactive with one substance having a specific component for the ligand and measures the degree of reactivity. Miniaturized biosensor using nanotechnology minimizes human injury and enables painless human diagnosis and has the advantage of directly analyzing single cells. In addition, biosensors with improved operating characteristics such as high stability, fast response time, high sensitivity, and high selectivity using nanotechnology enable continuous measurement of human diagnosis and single-molecule analysis.

On the other hand, conjugated polydiacetylene vesicles have been studied as a chemical or biological sensor because of their unique color development properties. Diacetylene monomers such as 10,12-pentacosadiynoic acid (PCDA) are polymerized by 1,4-addition reaction under ultraviolet irradiation, and their form is en- yne) A chain of polymerization in which bonds appear alternately, forming vesicles similar to liposomes.

The polydiacetylene vesicles have a color expression ability that changes from blue to red due to external disturbances such as heat, pH, physical or chemical stimuli, or solvents. Furthermore, red polydiacetylene vesicles have the property of expressing fluorescence, and have been developed as various sensors using such properties. For example, polydiacetylene sensors have successfully detected influenza viruses, cholera toxicants, E. coli, oligonucleotides, lipopolysaccharides, antibodies and antigens.

However, until now, the application of polydiacetylene as a biosensor has been mostly made in an aqueous solution, so that a large amount of vesicles, antibodies, and analytes were required. Due to these limitations, the possibility of biosensors, that is, biochips, in the form of fine patterns immobilized on solid materials is being explored.

The present invention has been made to solve the above problems, an object of the present invention is to provide a probe chip (probe) aptamers, polydiacetylene vesicles, and a sensor chip combined with a substrate corresponding to the analysis target.

It is another object of the present invention to provide a method for manufacturing the polydiacetylene sensor chip.

Another object of the present invention is to provide a polydiacetylene sensor chip manufactured by the above manufacturing method.

In order to achieve the object as described above, the polydiacetylene sensor chip of the present invention,

Board;

Vesicles bonded to the substrate and polymerized with diacetylene having a structure of Formula 1; And

Probe aptamers bound to the vesicles

Characterized in that it comprises:

A- (L ₁ ) _d- (CH ₂ ) _e -C≡CC≡C- (CH ₂ ) _f- (L ₂ ) _g -B (1)

In the above formula

d + g is 0, 1 or 2,

e + f is an integer from 2 to 50,

e and f are integers greater than 1,

A and B are the same or different from each other and are a methyl group, an amine group, a carboxyl group, a hydroxyl group, a maleimide group, a biotin group, a hydroxysuccinimide group, a benzoic acid group or an ester group,

L ₁ and L ₂ are the same as or different from each other and are an alkyl group having 2 or more carbon atoms, at least one ethylene oxide group, an amine group, an amide group, an ester group or a carbonyl group.

In addition, it is preferable that some of said diacetylene is A or B is a biotin group or a hydroxysuccinimide group.

Also, between the substrate and the vesicle, between the vesicle and the probe aptamer, or between the substrate and the vesicle and between the vesicle and the probe aptamer, an avidin-biotin bond, a streptavidin-biotin bond, Or it is preferable that it is an amine substituted bond by hydroxysuccinimide.

In addition, the diacetylene is preferably a mixture of PCDA-aminobutyric acid (PCDA-ABA), and PCDA-biotin.

In addition, it is preferable that the molar ratio of said PCDA-ABA: PCDA-biotin is 100: 5-25.

In addition, it is preferable that a lipid is added to the diacetylene.

In addition, the lipid is preferably 1,2-dimyristoyl-lac-glycero-3-phosphocholine (1,2-dimyristoyl- rac -glycero-3-phosphocholine.DMPC).

In addition, the lipid is preferably added in a molar ratio of diacetylene: lipid = 100: 0.001 to 70.

In addition, the probe aptamer is preferably fluorine (stabilized) treatment.

In addition, the substrate is preferably a substrate made of glass, metal or plastic material whose surface is modified with amine, aldehyde, carboxylic acid, ester, maleimide or carbohydrate.

On the other hand, the manufacturing method of the polydiacetylene sensor chip of the present invention,

(A) dissolving the diacetylene having the structure of Formula 1 in a hydrophobic solvent and mixing it with water or a hydrophilic solvent, or directly mixing with water or a hydrophilic solvent;

(B) sonicating and dispersing the mixed diacetylene mixture;

(C) spotting the dispersed diacetylene dispersion onto a substrate; And

(D) immobilizing the instilled diacetylene dispersion

Comprising, after the step (B),

(E) reacting probe aptamer with the diacetylene; And

(F) polymerizing the diacetylene by exposing ultraviolet light to the dispersed diacetylene dispersion or to the substrate dipped with the diacetylene dispersion.

Characterized in that it further comprises.

In addition, it is preferable that the substrate of step (C) is treated with a biotin group-containing compound and then binds avidin or streptavidin to the biotin group.

In addition, the probe aptamer of the step (E) is treated with a biotin group, and the biotin group of the diacetylene is preferably combined with avidin or streptavidin to react the probe aptamer with the diacetylene.

In addition, the hydrophobic solvent of step (A) is chloroform, dimethylformamide (dimethylformamide. DMF), dimethylsulfoxide (dimethylsulfoxide. DMSO), dichloromethane, hexane, cyclohexane, tetrahydrofuran (THF), acetone, Preference is given to those selected from the group consisting of alcohols and mixtures thereof.

Further, after dissolving in the hydrophobic solvent in the step (A), before mixing it with water or a hydrophilic solvent,

Removing the hydrophobic solvent by injecting nitrogen or inert gas

It is preferable to further include.

In addition, the hydrophilic solvent preferably comprises a buffer.

In addition, after mixing in water or a hydrophilic solvent of step (A) and heating for 10 to 30 minutes at 70 to 95 ℃

It is preferable to further include.

On the other hand, the polydiacetylene sensor chip of the present invention is characterized in that it is manufactured by the above method.

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. In addition, in the following description there are shown a number of specific details such as specific components, which are provided only to help a more comprehensive understanding of the present invention, it is common in the art that the present invention may be practiced without these specific details. It is self-evident to those who have knowledge of the world. In describing the present invention, when it is determined that a detailed description of a related known function or configuration may unnecessarily obscure the subject matter of the present invention, the detailed description thereof will be omitted.

The present invention aims to provide a polydiacetylene sensor chip in which a polydiacetylene vesicle, a probe aptamer, and a substrate are bonded to cause a color transition from blue to red by an external stimulus and exhibit red fluorescence.

Here, polydiacetylene is prepared by aligning and polymerizing a diacetylene monomer having the structure of Chemical Formula 1.

The present invention not only expresses embolism and fluorescence, but also has a biotin group at a terminal thereof so that a part of the diacetylene can structurally bind the polydiacetylene vesicle which mediates the substrate and the probe aptamer to the substrate and the aptamer, respectively. Or a hydroxysuccinimide group.

In particular, between the substrate and the vesicle, between the vesicle and the probe aptamer, or between the substrate and the vesicle and between the vesicle and the probe aptamer, an avidin-biotin bond, streptavidin-biotin bond, or hydroxysuccinimide It is preferable to couple | bond by amine substitution bond by. Through this, by providing a certain direction to the probe aptamer, as the embolism is more clearly expressed, it is possible to increase the analysis efficiency.

Examples of diacetylene which binds to the substrate and probe aptamer by avidin-biotin bond, streptavidin-biotin bond, or amine substitution by hydroxysuccinimide are PCDA-EDEA-SA-NHS (Formula 2) , PCDA-biotin (Formula 3) and the like.

These binding die-acetylenes and other diacetylenes, such as PCDA (Formula 4), PCDA-aniline (Formula 5), PCDA-ABA (Formula 6), or PCDA-mBzA (Formula 7) by mixing the die for the defoaming of the present invention Prepare the acetylene mixture.

In the mixture, the biotin group of PCDA-biotin is bound to the substrate or probe aptamer via avidin or streptavidin, and the hydroxysuccinimide group of PCDA-EDEA-SA-NHS is amine of the substrate or probe aptamer. The vesicles bind to the substrate or probe aptamer while being substituted with a group.

In the present invention using an aptamer as a probe, it is particularly preferable to use PCDA-biotin as the binding diacetylene and PCDA-ABA as the other diacetylene.

The diacetylene mixture of the present invention may contain, for example, PCDA when the other diacetylene: bonding diacetylene molar ratio is 100: 5 to 25, and simultaneously contains diacetylene having a hydroxysuccinimide group and diacetylene having a biotin group. When the molar ratio of PCDA-EDEA-SA-NHS: PCDA-Biotin is 100: 3 to 15: 2 to 10, the binding and analytical efficiencies were found to be high. .

Furthermore, lipids such as 1,2-dimyristoyl-lac-glycero-3-phosphocholine (1,2-dimyristoyl- rac -glycero-3-phosphocholine.DMPC. When the (lipid) was added, it was confirmed that the time required for analysis was shortened and the embolism was expressed more clearly. This is because as the lipid is added to the vesicles, the alignment of the diacetylene is disturbed and the hydrogen bonding force is weakened, which causes the vesicles to be more sensitive to external stimuli. The amount of the lipid added is preferably added in a molar ratio of diacetylene: lipid = 100: 0.001 to 70.

On the other hand, aptamers used as probes in the present invention refer to short oligonucleotides having high avidity for various molecular targets, and the aptamers are nucleic acids optimized to specifically bind to a given ligand. Such aptamers are obtained by SELEX technology that isolates and amplifies RNA having a specific enzymatic function or RNA having a ligand function that binds to a specific receptor from a randomly synthesized RNA sequence library. Because the aptamer sequence is folded into a unique tertiary structure and is produced to bind only a given ligand with high selectivity and binding power, the tertiary structure of the aptamer-ligand complex is optimized for specific ligand recognition only. The reason why aptamer specifically recognizes ligand is that a large part of ligand is surrounded by nucleic acid, and aptamer-ligand binding is performed by repulsive force, structural complementarity or hydrogen bonding according to ligand type.

As long as the aptamer of the present invention can detect a protein or a microorganism, there is no limitation in the kind, and it is preferable that the aptamer is stabilized with fluorine in the middle of the aptamer for stabilization.

Attached SEQ ID NOS: 1 and 2 are examples of aptamers for detecting E. coli (provided by Genophra), and aptamers having a biotin group or an amine group bound to the 5 'end are as follows.

[SEQ ID NO: 1-1]

Biotin-5'-gggagagcggaagcgugcuggcucgcaguucgcaguuugcgcgcguuccaaguucucucaucacggaauaaucacggagcacauaacccagaccucgau-3 '

[SEQ ID NO: 1-2]

Amine-5'-gggagagcggaagcgugcuggcucgcaguucgcaguuugcgcgcguuccaaguucucucaucacggaauaaucacggagcacauaacccagaccucgau-3 '

[SEQ ID NO: 2-1]

Biotin-5'-gggagagcggaagcgugcugugucguagcuacacugcgugcuuncgacuucuggucccaucauucgaaaguucacauaacccagaccucgau-3 '

[SEQ ID NO: 2-2]

Amine-5'-gggagagcggaagcgugcugugucguagcuacacugcgugcuuncgacuucuggucccaucauucgaaaguucacauaacccagaccucgau-3 '

The substrate is preferably a glass, metal or plastic substrate whose surface is modified with amines, aldehydes, carboxylic acids, esters, maleimides or carbohydrates, and particularly preferably a glass substrate with surface modifications with amines.

On the other hand, the method for producing a polydiacetylene sensor chip of the present invention, first from the step of dissolving the diacetylene having a structure of Formula 1 in a hydrophobic solvent and mixed with water or a hydrophilic solvent, or directly mixed with water or a hydrophilic solvent Begins. At this time, after dissolving in the hydrophobic solvent, it is preferable to further include the step of removing the hydrophobic solvent by injecting nitrogen or an inert gas (inert gas) before mixing it with water or hydrophilic solvent.

The hydrophobic solvent is not limited as long as it can dissolve the diacetylene, and is generally selected from the group consisting of chloroform, DMF, DMSO, dichloromethane, hexane, cyclohexane, THF, acetone, alcohol and mixtures thereof, Chloroform is particularly preferable.

The hydrophilic solvent is 2- [4- (2-hydroxyethyl) -1-piperazinyl] ethanesulfonic acid (2- [4- (2-hydroxyethyl) -1-piperazinyl] ethansulfonic acid. ), Phosphate buffered saline (PBS), 2- (N-morpholino) ethanesulfonic acid [2- (N-Morpholino) ethanesulfonic acid. MES].

In addition, by mixing in the water or hydrophilic solvent and then heated for 10 to 30 minutes at 70 to 95 ℃ aligning the diacetylene monomers can be increased the polymerization degree during the polymerization by ultraviolet irradiation.

The mixed diacetylene mixture is then sonicated to disperse. The ultrasonically treated diacetylene dispersion is filtered and stabilized at low temperature. In this case, the dispersion may be directly irradiated with ultraviolet rays to photopolymerize, but in consideration of the polymerization efficiency, it is more preferable to perform polymerization after spotting on the substrate.

Fixing the die acetylene vesicles to the substrate is as follows.

First, when the substrate and the vesicles are connected by an avidin or streptavidin-biotin bond, a compound having a biotin group is reacted with a amine-modified substrate to expose the biotin group from the substrate, and then the exposed biotin group is avidin or Reacting with streptavidin causes the final exposure of avidin or streptavidin from the substrate. The previously prepared diacetylene dispersion is added to the substrate, and the vesicles are immobilized on the substrate by combining the biotin group of the diacetylene and avidin or streptavidin exposed from the substrate. It is particularly preferable that the compound having a biotin group is Biotin-normal-hydroxysuccinimide (Biotin-NHS).

In the case where the substrate and the vesicles are directly connected by the amine substitution bond of the hydroxysuccinimide, the immobilization is directly performed by replacing the hydroxysuccinimide group of the vesicle with the amine of the substrate.

Meanwhile, the probe aptamer reacting directly with the analyte may bind to any of the dispersed diacetylene dispersions, the diacetylene vesicles immobilized on the substrate, or the polydiacetylene vesicles formed by photopolymerization by UV irradiation. It is preferable to fix the die acetylene vesicles to the substrate and then to combine with the probe aptamer in terms of providing the orientation of the probe.

The vesicle and the probe aptamer are connected by introducing an amine group at the 5'-end of the probe aptamer and then replacing the hydroxysuccinimide group of the vesicle with the amine group of the probe aptamer.

Alternatively, the probe aptamer is reacted with a biotin-containing compound such as biotin-NHS to treat the biotin group at the 5'-end of the aptamer, and the biotin group of the vesicles binds separate avidin or streptavidin, resulting in It is also possible to bind the vesicle avidin or streptavidin with the biotin of the probe. This binding method has the advantage that the reaction rate of avidin (or streptavidin) and biotin is fast, and the orientation of the probe on the vesicles can be kept constant, thereby improving reactivity with the analyte and embolization. This is more clearly expressed, resulting in higher analysis efficiency.

Figure 1 is a schematic diagram of an embodiment for the production of the polydiacetylene sensor chip and analyte detection of the present invention.

After treating a biotin group-containing compound such as biotin-NHS on a substrate coated with an amine to expose the biotin group, the biotin group was bound to avidin to prepare a substrate of the present invention, and then a diacetylene vesicle containing a biotin group at its end. Is treated on the substrate to immobilize the vesicles (step I).

Thereafter, the avidin is bound to the biotin group located at the end of the diacetylene constituting the vesicle (step II).

Separately, an aptamer having a biotin group bound to its end is bound to avidin located at the end of the diacetylene vesicle (step III).

Then, the substrate is irradiated with ultraviolet light to polymerize the die acetylene so that the vesicles develop a blue color (step IV).

When the bacteria to be analyzed are added thereto, the vesicles are embolized and fluoresced from blue to red as they bind with the aptamer, thereby enabling analysis (step V).

EMBODIMENT OF THE INVENTION Hereinafter, the Example of this invention is described.

Example

Example  1: parcel manufacture

PCDA-Biotin (YK Jung, HG Park, and JM Kim, "Polydiacetylene (PDA) -based colorimetric detection of biotinstreptavidin interactions", Biosens. Bioelectron . , 21, 1536-1544 (2006)) 0.548325 mg and PCDA-ABA (J .-M. Kim, J.-S. Lee, H. Choi, D. Sohn, and DJ Ahn, "Rational design and in-situ FTIR analyzes of colorimetrically reversible polydiacetylene supramolecules", Macromolecules , 38, 9366-9376 (2005 )) Was dissolved in 1 ml of DMSO (Junsei) at 3.79269 mg (5.5), 4.48227 mg (6.5), 5.17185 mg (7.5), and 5.86143 mg (8.5). Separately, DMPC (Sigma) was added to a Erlenmeyer flask with 1.017 mg (0.1), 2.034 mg (0.2), 3.051 mg (0.3), and 4.068 mg (0.4), respectively, and dissolved in 1 ml of chloroform. When the DMPC was completely dissolved, nitrogen was blown to form a thin film at the bottom of the Erlenmeyer flask. Distilled water was filled to a concentration of 1 mM, followed by stirring in water at 80 ° C. for 15 minutes to disperse the monomer well. At this time, the prepared PCDA-Biotin solution and PCDA-ABA solution were added little by little [PCDA-ABA: DMPC: PCDA-Biotin = 5.5: 4: 0.5, 6.5: 3: 0.5, 7.5: 2: 0.5, 8.5: 1: 0.5 , 9.5: 0.5 (PCDA: PCDA-Biotin). Molar ratios]. After the water bath was finished, the solution in which the monomer was dispersed was sonicated for 15 minutes using a microtip probe sonicator at an intensity of 10 W. After the sonication was filtered with a nylon filter of 0.8 ㎛ and refrigerated at 4 ℃ for more than 8 hours.

Example  2: Glass slide ( Avidin ) Ready

1 mg Biotin-NHS (Pierce) was dissolved in 1 ml DMSO (Junsei) and then mixed with 3 ml PBS buffer (Pierce). The amine coated glass slide (NC-AMCS, Nuricell co.) Was immersed at room temperature for 4 hours. Separately, 0.1 mg of avidin (Sigma) was dissolved in 1 ml of a PBS solution to prepare an avidin solution, and the glass slide was immersed in an avidin solution at room temperature for 2 hours to prepare a glass slide for use in the present invention.

Example  3: Probe Aptamers  Mating and immobilization

The antifoam solution of Example 1 was added to the avidin coated glass slide of Example 2 (Nano-plotter v 1.2, GeSim, German), immobilized at 37 ° C. for 2 hours, and then washed with distilled water for 1 minute. Here, avidin (Sigma) was further treated to bind avidin to the biotin group of the diacetylene. Separately, 10 μl of an aptamer (genophra) solution having a biotin group attached to the 5′-end of SEQ ID NO: 1 was sprayed on the glass slide, covered with a cover glass, incubated at room temperature for 2 hours, and washed again with distilled water. It was irradiated with 254 nm UV of 1 mW / cm 2 for 8 minutes to polymerize the antifoam monomer.

Example  4: E. coli detection

10 ⁸ CFU / ml E. coli 7 μl of (DH5α) was dispersed on the glass slide of Example 3, then covered with cover glass, incubated at room temperature for 2, 5, and 10 hours, washed three times with distilled water, and the embolization and fluorescence microscopy Observed (HP BX51).

Comparative example  One: Probe Aptamers In case of lack

Examples 1 to 4, but the reaction process of the vesicles and aptamer solution was omitted in Example 3.

Comparative example  2: When bacteria other than Escherichia coli are used

Through Examples 1 to 4, in Example 4 Bacillus subtilis , Salmonella instead of E. coli typhimurium , and Listeria monocytogenes (10 ⁸ CFU / ml each) were used.

2 to 6 are photographs showing the results of the processes of Examples 1 to 4, and are data showing the effects of varying amounts of DMPC. 2 is PCDA-ABA: PCDA-Biotin = 9.5: 0.5, and FIGS. 3 to 6 show that the molar ratios of PCDA-ABA: DMPC: PCDA-Biotin are 8.5: 1: 0.5, 7.5: 2: 0.5, 6.5: 3: 0.5, 5.5: 4: 0.5. The time on the photo represents the exposure time of the fluorescence microscope, and the time on the left side of the photo represents the reaction time of bacteria and probe aptamers.

As can be seen from the results of FIGS. 2 to 6, as the content of the lipid DMPC increases, the red fluorescence becomes clearer, and the reaction time also increases. This is because, as mentioned above, as the lipid is added to the vesicles, the alignment of the diacetylene is disturbed and the hydrogen bonding force is weakened, which causes the vesicles to be more sensitive to external stimuli. In addition, in order to confirm the immobilization of the vesicles of the present invention, the glass slide is heated for 5 minutes and observed with a red filter, as shown in the photo below, the red fluorescence resulting from the vesicle disturbances can be observed. It was confirmed that the polydiacetylene vesicles were completely immobilized on the substrate.

Fig. 7 is a photograph showing the result of Comparative Example 1 without introducing an aptamer as a probe (PCDA-ABA: DMPC: PCDA-biotin = 6.5: 3: 0.5). As can be seen from the photograph, it can be seen that E. coli hardly reacts, and therefore, the presence of the probe is essential for the detection of the analyte. As a result of heating, red fluorescence can be observed, indicating that the vesicle itself is immobilized.

8-10 show E. coli It is a photograph showing the result of the process of Comparative Example 2 examining the result of the reaction of other bacteria. 8 is Bacillus subtilis , FIG. 9 shows Salmonella typhimurium , FIG. 10 shows Listeria Each result of reacting monocytogenes . As can be seen in the drawings it can be confirmed that there is no binding to the bacterial cells other than Escherichia coli, there is no disturbance of the vesicles, and as a result, embolism and fluorescence did not occur. The photo at the bottom shows red fluorescence as a result of heating, indicating that the vesicles themselves are immobilized.

According to the results of the examples and the comparative examples, the embolization and fluorescence expression of the vesicles can be caused only by the specific binding of the aptamer and the microorganism, so that the polydiacetylene sensor chip of the microarray type of the present invention is aptamer-protein It can be seen that it can be used as a biosensor for detecting aptamer-microbial level response. In particular, anthrax is easy to obtain and resistant to disinfectants or environmental changes, so there is a high risk of being converted into biochemical weapons. Therefore, the sensor chip of the present invention has been strongly demanded. It seems to be able to satisfy.

In the present invention, but experimented with aptamers and bacteria, Proper aptamers, if properly selected cholera toxic substances, phospholipases, HIV protease, MAP kinases, MEK kinases ), Phosphoinositide 3-kinases, Factor X, PDGF, FGF, ICAM, VCAM, E-selectin, thrombin, bradykinin ), Proteins such as PGF2, E. coli and anthrax, Bacillus, Salmonella, Listeria, Mycobacterium tuberculosis, Brucellella, Legionella, Vibrio, etc. Viruses and the like can be detected in the same manner.

Although the above has been illustrated and described with respect to the preferred embodiments of the present invention, the present invention is not limited to the specific embodiments described above, those skilled in the art without departing from the gist of the present invention various modifications Of course, implementation is possible. Therefore, the scope of the present invention should not be construed as being limited to the above embodiments, but should be defined by the claims below and equivalents thereof.

According to the present invention, a sensor chip may be manufactured by combining aptamer, polydiacetylene vesicle, and a substrate as a probe for protein or cell detection, and the sensor chip may be used for specific binding of aptamer and protein or aptamer and cell. Only by causing embolization and fluorescence expression of the vesicles, the microarray-type polydiacetylene sensor chip of the present invention can be analyzed without a separate label for the analyte, and much less polydiacetylene and analysis than the conventional liquid phase reaction. As a subject, one may detect aptamer-protein or aptamer-cell level responses. Furthermore, it also has the advantage of being portable while achieving miniaturization while showing high sensitivity. In particular, because it is easy to obtain and has strong resistance to disinfectants and environmental changes, it is possible to accurately analyze anthrax, which is highly applicable to biochemical weapons, within a short time.

<110> Korea University Industry and Academy Cooperation Foundation <120> POLYDIACETYLENE SENSOR CHIP COMPRISING APTAMER AND MANUFACTURING          PROCESS THEREOF <130> M04-5857-FD-Sequence <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 99 <212> RNA <213> Artificial Sequence <220> EA2234P-aptamer detecting E.coli <400> 1 gggagagcgg aagcgugcug gcucgcaguu cgcaguuugc gcgcguucca aguucucuca 60 ucacggaaua aucacggagc acauaaccca gaccucgau 99 <210> 2 <211> 92 <212> RNA <213> Artificial Sequence <220> EA952P-aptamer detecting E.coli <400> 2 gggagagcgg aagcgugcug ugucguagcu acacugcgug cuuncgacuu cuggucccau 60 cauucgaaag uucacauaac ccagaccucg au 92  

Claims (17)

Board; Vesicles bonded to the substrate and polymerized with diacetylene having a structure of Formula 1; And Probe aptamers bound to the vesicles Polydiacetylene sensor chip comprising: [Formula 1] A- (L ₁ ) _d- (CH ₂ ) _e -C≡CC≡C- (CH ₂ ) _f- (L ₂ ) _g -B (1) In the above formula d + g is 0, 1 or 2, e + f is an integer from 2 to 50, e and f are integers greater than 1, A and B are the same or different from each other and are a methyl group, an amine group, a carboxyl group, a hydroxyl group, a maleimide group, a biotin group, a hydroxysuccinimide group, a benzoic acid group or an ester group, L ₁ and L ₂ are the same as or different from each other and are an alkyl group having 2 or more carbon atoms, at least one ethylene oxide group, an amine group, an amide group, an ester group or a carbonyl group. The method of claim 1, Part of the diacetylene is a polydiacetylene sensor chip, characterized in that A or B is a biotin group or hydroxysuccinimide group. The method of claim 1, Between the substrate and the vesicle, between the vesicle and the probe aptamer, or between the substrate and the vesicle and between the vesicle and the probe aptamer, an avidin-biotin bond, a streptavidin-biotin bond, or hydride Polydiacetylene sensor chip, characterized in that the amine substituted bond by oxysuccinimide. The method of claim 1, The diacetylene is a polydiacetylene sensor chip, characterized in that a mixture of PCDA-aminobutyric acid (PCDA-ABA), and PCDA-biotin. The method of claim 4, wherein The molar ratio of PCDA-ABA: PCDA-biotin is 100: 5 to 25, characterized in that the poly acetylene sensor chip. The method of claim 1, Polydiacetylene sensor chip, characterized in that the lipid (lipid) is added to the diacetylene. The method of claim 6, Wherein said lipid is 1,2-dimyristoyl-lac-glycero-3-phosphocholine (1,2-dimyristoyl- rac -glycero-3-phosphocholine. DMPC). The method of claim 6, The lipid is poly acetylene sensor chip, characterized in that the addition of a mole ratio of diacetylene: lipid = 100: 0.001 to 70. The method of claim 1, The probe aptamer is a poly acetylene sensor chip, characterized in that the fluorine stabilization treatment. The method of claim 1, The substrate is a polydiacetylene sensor chip, characterized in that the substrate is a glass, metal or plastic material surface is modified with amine, aldehyde, carboxylic acid, ester, maleimide or carbohydrate. (A) dissolving diacetylene having a structure of Formula 1 in a hydrophobic solvent and mixing it with water or a hydrophilic solvent, or directly mixing with water or a hydrophilic solvent: [Formula 1] A- (L ₁ ) _d- (CH ₂ ) _e -C≡CC≡C- (CH ₂ ) _f- (L ₂ ) _g -B (1) In the above formula d + g is 0, 1 or 2, e + f is an integer from 2 to 50, e and f are integers greater than 1, A and B are the same or different from each other and are a methyl group, an amine group, a carboxyl group, a hydroxy group, a maleimide group, a biotin group, a hydroxysuccinimide group, a benzoic acid group or an activated ester group, L ₁ and L ₂ are the same as or different from each other and are an alkyl group having 2 or more carbon atoms, at least one ethylene oxide group, an amine group, an amide group, an ester group or a carbonyl group; (B) sonicating and dispersing the mixed diacetylene mixture; (C) spotting the dispersed diacetylene dispersion onto a substrate; And (D) immobilizing the instilled diacetylene dispersion Comprising, after the step (B), (E) reacting probe aptamer with the diacetylene; And (F) polymerizing the diacetylene by exposing ultraviolet light to the dispersed diacetylene dispersion or to the substrate dipped with the diacetylene dispersion. Method for producing a polydiacetylene sensor chip further comprising. The method of claim 11, The substrate of step (C) is a method for producing a polydiacetylene sensor chip characterized in that the surface is treated with a biotin group-containing compound, and then avidin or streptavidin combined with the biotin group. The method of claim 11, The probe aptamer of step (E) is treated with a biotin group, and the biotin group of the diacetylene is bound with avidin or streptavidin to react the probe aptamer with the diacetylene. Method for manufacturing acetylene sensor chip. The method of claim 11, After dissolving in the hydrophobic solvent in step (A), before mixing it in water or hydrophilic solvent, Removing the hydrophobic solvent by injecting nitrogen or inert gas Method for producing a poly acetylene sensor chip, characterized in that it further comprises. The method of claim 11, The hydrophilic solvent is a method for producing a polydiacetylene sensor chip, characterized in that it comprises a buffer. The method of claim 11, Mixing with water or hydrophilic solvent of step (A) and then heating at 70-95 ° C. for 10-30 minutes Method for producing a poly acetylene sensor chip, characterized in that it further comprises. A polydiacetylene sensor chip manufactured by the method of any one of claims 11 to 16.

Images