KR20080049007A - Multiplexed polymerase chain reaction for genetic sequence analysis - Google Patents

Abstract

providing a biological sample suspected of containing one or more pathogen nucleic acids; adding a plurality of PCR primers corresponding to genes found in the pathogens; and performing a polymerase chain reaction on the sample to amplify a subset of the nucleic acids that correspond to the genes. The primers include at least one primer pair for each pathogen, and the primers contain a tail sequence that is not homologous any pathogen DNA or to any background DNA in the sample. The concentration of at least one primer in the polymerase chain reaction is no more than about 100 nM.

Description

MULTIPLEXED POLYMERASE CHAIN REACTION FOR GENETIC SEQUENCE ANALYSIS

This application is directed to US Provisional Application No. 60 / 691,768, filed June 16, 2005; 60 / 735,876, filed November 14, 2005; 60 / 735,824, filed November 14, 2005; And 60 / 743,639, filed March 22, 2006, and US Patent Application Nos. 11 / 422,425, filed June 6, 2006 and 11 / 422,431, filed June 6, 2006, with priority. Insist. This application discloses US patent application Ser. No. 11 / 177,647 filed Jul. 2, 2005; 11 / 177,646 filed Jul. 2, 2005; And 11 / 268,373, filed November 7, 2005. The formal application is US Provisional Application No. 60 / 590,931 filed on Jul. 2, 2004; 60 / 609,918, filed September 15, 2004; 60 / 626,500 filed November 5, 2004; 60 / 631,437 filed November 29, 2004; And 60 / 631,460 filed November 29, 2004.

Field of technology

The present invention generally relates to methods for amplifying a plurality of gene targets and to assaying amplified products using microarrays.

Accurate and rapid identification of infectious pathogens that cause acute respiratory infections (ARI) in humans can be an important factor in the successful treatment of respiratory diseases, the application of appropriate outbreak control measures, and the efficient use of expensive antibiotics and antiviral agents. have. However, clinical differential diagnosis of ARIs is difficult because of the similarity of symptoms caused by different pathogens and the number and biological diversity of the pathogens. Recently, the most widely used methods for identifying respiratory pathogens are culture, immunoassay, and RT-PCR / PCR assays. Culture and immunoassay techniques are usually specific to a particular pathogen and are limited to the detection of one pathogen suspected at the species and sometimes serotype levels. In contrast, nucleic acid based techniques, such as RT-PCR / PCR, are versatile, suggesting high sensitivity in the detection of all pathogens, including organisms that are fastidious or otherwise difficult to culture. Due to the versatile nature of PCR, this technique increases the chances of establishing a specific etiology by simultaneously applying to multiple pathogens (McDonough et al., "A multiplex PCR for detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila"). , and Bordetella pertussis in clinical specimens " Mol. Cell Probes , 19 , 314-322 (2005)) can accurately detect co-infection involving one or more pathogens (Grondahl et al.," Rapid identification of nine microorganisms causing acute respiratory tract infections by single-tube multiplex reverse transcription-PCR: feasibility study " J. Clin. Microbiol. , 37 , 1-7 (1999)).

Since ARI pathogens can be symptomatically nonspecific, a method of detecting multiple organisms in one reaction in multiple ways is preferred. Thus, the method of analyzing one pathogen at a time is inefficient and does not provide information on possible co-infection. Several multiple RT-PCR / PCR tests have been developed to address this (McDonough; Grondahl; Puppe et al., "Evaluation of a multiplex reverse transcriptase PCR ELISA for the detection of nine respiratory tract pathogens" J. Clin. Virol. , 30 , 165-174 (2004); Bellau-Pujol et al., "Development of three multiplex RT-PCR assays for the detection of 12 respiratory RNA viruses" J. Virol. Methods , 126 , 53-63 (2005); Miyashita et al., "Multiplex PCR for the simultaneous detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella pneumophila in community-acquired pneumonia" Respir. Med. , 98 , 542-550 (2004); Osiowy, "Direct detection of respiratory syncytial virus , parainfluenza virus, and adenovirus in clinical respiratory specimens by a multiplex reverse transcription-PCR assay " J. Clin. Microbiol. , 36 , 3149-3154 (1998); Verstrepen et al.," Rapid detection of enterovirus RNA in cerebrospinal fluid specimens with a novel single-tube real-time reverse transcr iption-PCR assay " J. Clin. Microbiol. , 39 , 4093-4096 (2001); Coiras et al., "Simultaneous detection of fourteen respiratory viruses in clinical specimens by two multiplex reverse transcription nested-PCR assays" J. Med. Virol. , 72 , 484-495 (2004); Coiras et al., "Oligonucleotide array for simultaneous detection of respiratory viruses using a reverse-line blot hybridization assay" J. Med. Virol. , 76 , 256-264 (2005); Gruteke et al., "Practical implementation of a multiplex PCR for acute respiratory tract infections in children" J. Clin. Microbiol. , 42 , 5596-5603 (2004)), the method is limited by the discriminating power of the recent amplicon detection method. Gel-based analytical methods tend to be limited to a limited number of pathogens whose product is determined only by size, while fluorescent reporter systems such as real-time PCR have a number of fluorescence peaks that can be clearly separated (3). Dogs or four or less). Accordingly, there is a need for diagnostic assays that allow for the rapid identification and identification of the causative agents for many potentially causative disease syndromes, such as ARI.

A few techniques have been developed that can detect more pathogens simultaneously by the RT-PCR / PCR method. Multiple identification of up to 22 respiratory pathogens has been realized by the MASSCODE ^™ multiple RT-PCR system (Briese et al., “Diagnostic system for rapid and sensitive differential detection of pathogens” Emerg. Infect. Dis. , 11 , 310-313 (2005)). Spot (especially long-oligonucleotide) microarrays have also been used somewhat successfully as a multiplex PCR analysis tool (Roth et al., "Use of an oligonucleotide array for laboratory diagnosis of bacteria responsible for acute upper respiratory infections" J. Clin. Microbiol. , 42 , 4268-4274 (2004); Chizhikov et al., "Microarray analysis of microbial virulence factors" Appl. Environ. Microbiol. , 67 , 3258-3263 (2001); Chizhikov et al., "Detection and genotyping of human group A rotaviruses by oligonucleotide microarray hybridization " J. Clin. Microbiol. , 40 , 2398-2407 (2002); Wang et al.," Microarray-based detection and genotyping of viral pathogens " Proc. Natl. Acad. Sci. USA , 99 , 15687-15692 (2002); Wang et al., "Viral discovery and sequence recovery using DNA microarrays" PLoS Biol. , 1 , E2 (2003); Wilson et al., "High-density microarray of small- subunit ribosomal DNA probes " Appl. Environ. Microbiol. , 68 , 2535-2541 (2002); Wilson et al.," Sequen ce-specific identification of 18 pathogenic microorganisms using microarray technology " Mol. Cell. Probes , 16 , 119-127 (2002); Call et al., "Identifying antimicrobial resistance genes with DNA microarrays" Antimicrob. Agents Chemother. , 47 , 3290-3295 (2003); Call et al., "Mixed-genome microarrays reveal multiple serotype and lineage-specific differences among strains of Listeria monocytogenes" J. Clin. Microbiol. , 41 , 632-639 (2003). A fundamental limitation of this system is that it is incapable of identifying strains closely related to the same organism since the detected hybridization events may not be affected by partial sequence differences. For example, spot microarray probes can be non-specifically hybridized with other sequences by as much as 25%-such unseen changes have sufficient information to enable high strain differentiation if polymorphism can be specifically characterized. Given the fact that the case is disadvantageous.

Identification at the strain level can be important where closely related organisms can have very different clinical outcomes and epidemiological patterns. In such cases, the strains should be identified for proper treatment and control. Clinically relevant Bordetella pertussis and its sister species, clinically unrelated B. parapertussis, provide representative examples. Another example is influenza virus, for which it is of immediate and obvious value to identify vaccine susceptible and vaccine insensitive strains, circulating human isolates and possible zoogenic strains (eg algae H5N1).

Disclosure of the Invention

The invention provides a biological sample suspected of containing one or more pathogen nucleic acids from a pre-defined set of pathogens; Adding to said sample a plurality of PCR primers corresponding to genes identified in a pre-defined set of pathogens; And performing a polymerase chain reaction on the sample to amplify the subset of nucleic acids corresponding to the gene. The primer comprises one or more primer pairs for each pathogen and includes tail sequences that are not homologous to any pathogen DNA or any background DNA in the sample. At least one primer concentration in the polymerase chain reaction is not higher than about 100 nM.

How to Perform the Invention

In the following description, for purposes of explanation and non-limiting purposes, specific details are set forth in order to provide a thorough interpretation of the present invention. However, it will be apparent to those skilled in the art that the present invention may be practiced in other specific embodiments than these specific details. In other instances, detailed descriptions of existing methods and apparatus are omitted so that the description of the present invention is not obscured by unnecessary details.

Since clinical syndromes are rarely specific to a single pathogen, it will undoubtedly be beneficial for public health efforts to analyze and test large numbers of candidate pathogens. The experiments presented herein include multiple RT-PCR / PCR, RA and automated sequence similarity investigations and resequencing of pathogen identification—a RPM v.1 system for 20 biorespiratory pathogens and 20 conventional respiratory pathogens under a wide range of conditions. The potential for clinical diagnostic and epidemiological surveillance of the array (RA) method is demonstrated. By combining the sensitivity of multiple PCR amplification with the specificity of RA, one can avoid the trade-offs between specificity and sensitivity often observed when evaluating diagnostic assays. This was demonstrated using the control sample together as a complex mixture added in extraction buffer or to clinical samples of healthy patients. The data also show that the system is based on culture and how it is based on the allowed RT-PCR / PCR for HAdV and influenza A viruses using 101 throat samples obtained from patients with influenza-type disease. It offers the same sensitivity as.

Short-oligonucleotide resequencing arrays (RA) can simultaneously provide identification of species and strain levels of PCR amplicons derived from ARI pathogens. Strain specific information, including specific polymorphisms from previously unrecognized variants, can be found in US Pat. Appl. No. 11 / _, ProSeqs, Malanoski et al., Entitled "Computer-Implemented Biological Sequence Identifier," tiled onto an array. System and Method ”(filed on the same date as this application) and the ability of the RA to reveal sequence differences that distinguish hybridized targets. Previous studies have combined customized respiratory pathogen microarrays (RPM v.1) with microbial nucleic acid enrichment, random nucleic acid amplification, and automated sequence similarity investigations to identify broad spectrum of respiratory lineage pathogens at species and strain levels with clear statistical interpretation. Lin et al., "Broad-spectrum respiratory tract pathogen identification using resequencing DNA microarrays" Genome Res. , 16 (4), 527-535 (2006); Wang et al., "Rapid, Broad-spectrum Identification of Influenza Viruses by Resequencing Microarrays " Emerg. Infect. Dis. , 12 (4), 638-646 (2006)). However, general amplification has limited success rates when dealing with clinical samples with low titer pathogens. An improved multiplex PCR amplification strategy is disclosed that mitigates the sensitivity problem for random target amplification. Successful technical validation experiments using clinical samples obtained from patients presenting ARI directly show improved assay times (8.5 hours) with high species levels consistent with standard baseline assays (e.g., culture, American Pathological Society [CAP] accredited PCR). Sequence readings demonstrate that they can still be achieved while producing accurate species and strain level identification. The results suggest that this method can perform simple automatic manipulation and miniaturization, leading to a platform based on microarrays for diagnostic and surveillance purposes.

Polymerase chain reaction (PCR) is well known in the art. The method of the present invention uses a biological sample that can include pathogen nucleic acids. The method does not require the presence of a pathogen nucleic acid, for example because it can be performed on specimens from healthy individuals. As a preliminary preparation step, the pathogen nucleic acid can be extracted from a clinical sample, such as, but not limited to, non-cleansed, throat sclera, sputum, blood or environmental samples. Clinical samples may be obtained from any species of organism, including but not limited to humans. Any type of pathogen can be tested, including but not limited to respiratory pathogens, enteric pathogens, and biothreat pathogens such as anthrax spores. A set of pathogens can be identified, for example, at the species level or at the strain level.

The method includes PCR primers corresponding to genes that can be identified in the pathogen. PCR primers are well known in the art. There is one or more primer pairs for each pathogen. The primer used in the method has a tail sequence that is not homologous to any pathogen or any background DNA in the sample. The background DNA can be the DNA of the species from which the clinical sample was obtained. Potential tail sequences can be random or otherwise generated and can be evaluated, for example, by comparing a database of gene sequences, such as GenBank. The tail sequence can usually reduce the formation of primer dimers in PCR because the tail sequence itself does not bind to the pathogen DNA and this tail is not complementary to any other primers. Tails suitable for use in samples derived from humans include, but are not limited to, CGATACGACGGGCGTACTAGCG (primer L, SEQ ID NO: 1) and CGATACGACGGGCGTACTAGCGNNNNNNNNN (primer LN, SEQ ID NO: 2).

Primer sets of a single PCR can include, for example, at least 30, 40, 50, 60, 70, 80, 90, or 100 different primers. Primers corresponding to genes of different lengths can be used for the same PCR. For example, nucleotides of length 50, 100, or 200 or less and 3000 or 2000 or more in length of amplified nucleic acids can be prepared by a single PCR.

PCR using such primers may include other components or may employ equipment commonly known in the PCR art and disclosed herein. Low concentration primers can be used for the reaction. One to all primers may be present at a concentration no higher than about 100 nM. Lower concentrations may also be used, such as 40-50 nM.

The biological sample may be divided into a plurality of aliquots and individual PCR may use different primers performed on each aliquot. The aliquots can then be remixed after PCR. This can be done when using a large number of primers. The more primers used in PCR, the more primer dimers can be formed. PCR can be better optimized with multiple aliquots using different primer mixtures.

After PCR, pathogen identification can be performed. Contacting the sample with a microarray comprising a plurality of nucleic acid sequences complementary to at least a portion of the amplified nucleic acid, and hybridizing the amplified nucleic acid with the complementary nucleic acid. This method is described in US patent application Ser. No. 11 / 177,646. Complementary nucleic acids can be from 25 to 29 monomers, by way of non-limiting example. Using such short complementary nucleic acids reduces the likelihood that any mismatch will hybridize with the microarray. Complementary nucleic acids may comprise probes that perfectly match one or more to all of the amplified nucleic acids, and three different single nucleotide polymorphisms in the center of each perfectly corresponding probe. Such arrays can identify strains of pathogens by perfecting the sequence of genes to be determined.

After hybridization, conventional methods such as fluorescence can be used to detect which complementary nucleic acids have hybridized amplified nucleic acids. The pathogens can then be identified based on the detection of the amplified nucleic acid. This can be done by pattern recognition algorithms that identify pathogens based on the results of gene hybridization to the array. It may also be performed based on sequencing of the hybridized genes as described above.

Molecular diagnostic techniques can quickly and sensitively identify etiological agents. Recent methods, such as PCR, RT-PCR, and spot microarrays, are prone to misidentification due to false positive and false negative test results, and tend to be difficult as direct conflicts between sensitivity and specificity. The sample also consists of a large and diverse group of background organisms that may contain regions similar to the target sequence used for diagnostic PCR amplification. Genetic complexity of non-target DNA (particularly human DNA) can lead to amplification of "false positive" products due to cross reactivity. In addition, since viruses evolve through mutation and recombination reactions at a fairly rapid rate, particularly sensitive tests are constantly reconsidered or almost immediately out of date. Genetic variations are also clinically relevant because they may be associated with persistent infections and antigenic variations potentially involved in the treatment and / or vaccination response. For the study of genetic variation via recent PCR methods, additional sequencing steps are always required. The RPM v. 1 method can detect infectious pathogens at the species and strain level, as well as identify microscopic genomic differences without further experimentation. The method is also an effective means of detecting up to seven pathogens simultaneously with high sensitivity and specificity, and clearly and reproducible sequence-based strain identification for pathogens with appropriately selected circular sequences (ProSeqs) on microarrays. Turned out to be. This can be useful for improving clinical treatment and infectious disease response by allowing accurate fingerprinting of each pathogen, antibiotic resistance profiling, genetic drift / movement analysis, forensics and many other variables. This ability can be of significant importance for the rapid detection of diseases such as avian H5N1 influenza virus, and biological terrorism events.

Although the invention has been described, the following examples illustrate certain applications of the invention. This particular embodiment is not intended to limit the scope of the invention described in this application.

Example 1

RPM v.1 Chip Design -The RPM v.1 (Respiratory Pathogen Microarray) chip design includes 57 tile regions capable of resequencing 29.7 kb sequences from 27 respiratory pathogens and pre-bacterial pathogens, as detailed in previous studies. Lin et al., "Broad-spectrum respiratory tract pathogen identification using resequencing DNA microarrays" Genome Res. , 16 (4), 527-535 (2006). In short, the RPM array consists of probes that perfectly represent each base in the sequence selected from the genome of the target organism and are the center 25 contiguous. In addition, for each perfectly corresponding probe, three mismatch probes were also tiled onto the array, indicating three possible single nucleotide polymorphisms (SNPs) in the center. Thus, hybridization with a set of perfect counterparts provides redundant presence / absence information, while hybridization with mismatched probes reveals strain specific SNP data. On this chip, two pathogens, HAdV and Influenza A, presented more probe representatives than the rest. They were selected on the basis of clinical relevance in the immediate interest group (training US Defense Recruits). For HAdV, partial sequences from the E1A , hexon , and fiber genes, including the diagnostic regions of serotypes 4, 5, and 7, were tiled to detect all ARI related HAdV. Similarly, tile regions for influenza A virus detection included hemagglutinin (subtypes H1, H3, and H5), neuraminidase (subtypes N1 and N2), and partial sequences from the matrix gene. In addition to the three HAdV and three influenza A viruses, recent RPM designs have prevented Category A biological terrorism pathogens known to cause ARI, or "flu" symptoms, in the early stages of infection, six centers for disease control, and 15 Other common respiratory pathogens can be identified. All the regulatory and field strains used to test the sensitivity and specificity of RPM v.1 and its sources are listed in Table 1 below.

Note: ^@ : purified plaques; ^* : Minimum detection limit tested; ^# : Target gene was prepared and cloned into pUC119 of BlueHeron Biotechnology (Bodel, Wash.).

Example 2

Clinical Samples -Archived throat seals were collected from naval ships deployed in 1999-2005 and various military recruit training centers, and patients with ARI at the US / Mexico border. It was immediately placed in a 2 ml cryogenic bottle containing 1.5 ml of virus transfer medium (VTM), frozen and stored at −80 ° C. or lower to keep viral particles during transport. The samples were then shipped to the Naval Sanitary Research Center (NHRC, San Diego, California), thawed and dispensed, and tested for HAdV and influenza using CAP-certified diagnostic RT-PCR / PCR and culture tests. Frozen aliquots were then presented for detection based on microarrays in a blinded manner.

Example 3

Nucleic Acid Extraction -Nucleic acids can be extracted from the MASTERPURE ^TM DNA purification kit (Epicentre Technologies, Madison, WI), omitting the RNase digestion step, or the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Applied Science, Indiana, IN) according to the manufacturer's recommended protocol. Extracts from clinical samples).

Example 4

Internal Controls -Two Arabidopsis genes corresponding to NAC1 and triosphosphate isomerase (TIM) were selected as internal controls for reverse transcription (RT), and PCR reactions, because they were not inherently generated in clinical samples. Because it does not. Two plasmids containing ˜500 bp of two genes, pSP64poly (A) -NAC1 and pSP64poly (A) -TIM, were legally provided by Norman H. Lee at the Genome Research Institute in Rockville, Maryland. . NAC1 was amplified by PCR using SP6 and M13R primers, and the PCR product was purified using a QIAquick PCR Purification Kit (Qiagen, Valencia, CA). to generate RNA from pSP64poly (A) -TIM, to linearize the plasmid using the EcoRI and use ^{MEGASCRIPT ® High Yield Transciption Kit (Ambion} , Texas, Austin) was transferred in vitro from the SP6 promoter. 60 fg of NAC1 and TDVI, respectively, were used as internal controls to investigate the amplification efficiency and the presence of inhibitors in the samples.

Example 5

Primer Design and Multiple RT - PCR Amplification -Divide the primer into two independent reactants and simplify and optimize the primer design. Amplify all target genes from 26 target pathogens (West Nile Virus is included in the array rather than the amplification reaction) by performing fine tuning control (exchanging poorly amplified primers for new) on both mixtures To hybridize. Gene specific primer pairs for all targets on the RPM v.1 chip (listed in Tables 2 (a) and 2 (b)) were designed to ensure good amplification efficiency of multiple PCR. All primers were designed to have similar annealing temperatures, and the BLAST program was used to ensure uniqueness using complete investigation of known sequences in the GenBank database. AU primers were checked for potential hybridization with other primers to reduce potential primer dimers. In addition, the inventors have described in Huber et al., "A simplified procedure for developing multiplex PCRs" Genome Res. , 5 , 488-493 (1995) and Brownie et al., "The elimination of primer-dimer accumulation in PCR" Nucleic Acids Res. , 25 , 3235-3241 (1997) was further adapted to further inhibit primer dimer formation by adding a 22 bp (primer L) linking sequence to the 5 'end of the primers used herein. 50 mM Tris-HCl, pH 8.3, 75 mM KC1, 3 mM MgCl ₂ , 500 μM dATP, dCTP, dGTP, dTTP, 40 U RNaseOUT ^™ , 10 mM DTT, 2 μM Primer LN, 200 U Superscript Reverse transcription (RT) in a 20 μl volume comprising III (Invitrogen Life Technologies, Carlsbad, Calif.), Two internal controls (NAC1 and TIM) each of 60 fg, and 5-8 μl of extracted clinical specimen or experimental control. ) Reaction was carried out. Reactions were performed with Peltier Thermal Cycler-PTC240 DNA Engine Tetrad 2 (MJ Research Inc., Leno, NV) using the manufacturer's recommended protocol.

The RT reaction product was divided into two 10 μl volumes to run two different multiplex PCR reactions. Primer Mixture A included 19 primer pairs and amplifies 18 gene targets from 3 different influenza A viruses, 1 influenza B virus, 3 HAdV serotypes, and 1 internal control (TIM). Primer Mixture B contained 38 primer pairs and amplified the remaining 37 gene targets and the remaining internal control (NAC1). 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2 mM MgCl ₂ , 400 μM of dATP, dCTP, dGTP, dUTP, 1 U of Uracil-DNA glycosylase, heat-labile (USB, Carls, CA Bed material), 2 μM primer L, 40 nM primers each from Mixture A or 50 nM primers each from Mixture B, 10 U Platinum Taq DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA), and PCR reactions were performed in 50 μl volumes containing 10 μl of RT product. Initial incubation at 25 ° C for 10 minutes and preliminary denaturation at 94 ° C for 3 minutes, followed by 5 cycles of 94 ° C 30 seconds, 50 ° C 90 seconds, 72 ° C 120 seconds, and 35 cycles of 94 ° C 30 seconds, 64 ° C 120 seconds , And finally stretched at 72 ° C. for 5 minutes to perform amplification with Peltier Thermal Cycler-PTC240 DNA Engine Tetrad 2 (MJ Research Inc., Reno, Nevada). The products amplified from both PCR reactions were combined in a single volume, purified and processed and hybridized to RPM v.1 chips (see below).

Example 6

Microarray Hybridization and Treatment —The fragments were amplified and hybridized to the microarray and then the two PCR product mixtures were recombined. Microarray hybridization and treatment was performed with the following modifications according to the manufacturer's recommended protocol (Affymetrix Inc., Clara, Santa C.). The purified PCR product was fragmented at 37 ° C. for 5 minutes and then labeled with Biotin-N6-ddATP at 37 ° C. for 30 minutes. Hybridization was performed in a rotissary oven at 45 ° C. and 60 rev / min for 2 hours. After scanning, GCOS software was used to reduce the raw image (.DAT) file to a simplified file format (.CEL file) of intensity transferred to each corresponding probe location. Finally, by applying an intermediate version of the ABACUS algorithm using GDAS software (Cutler et al., "High-throughput variation detection and genotyping using microarrays" Genome Res. , 11 , 1913-1925 (2001)) sense and antisense probes By comparing the respective intensities for the set, an estimate of the correct base demand was generated. In order to increase the percentage of base demand, the parameters could be adjusted to give the highest allowable base demand (shown below). Sequences derived from base demand were exported from GDAS as FASTA-format files after preparing each tile region of the resequencing array.

Filtration conditions

No signal threshold = 0.500 (default = 1.000000)

Weak Signal Fold Threshold = 20000.000 (default = 20.000000)

Strong SNR Threshold = 20.000000 (default = 20.000000)

Algorithm variables

Standard Quality Threshold = 0.000 (default = 0.000000)

Total Quality Threshold = 25.0000 (default = 75.000000)

Maximum ratio of release conjugate demand = 0.99000 (default = 0.900000)

Model type (0 = heterozygotes, 1 = homozygotes) = 0

Perfect demand quality threshold = 0.500 (default = 2.000000)

Final Reliability Rule

Minimum ratio of adjacent probes = 1.0000 (filtration damage)

Minimum ratio of sample demand = 1.0000 (filtration damage)

Example  7

Automated Pathogen Identification Algorithm (Pathogen Identification Based on NA Sequences) -Raw material production sequences resulting from microarray hybridization and scanning were processed using algorithms to identify pathogens using sequence similarity comparisons to database records. Develops to completely analyze the result by incorporating a task previously performed on the Resequencing Pathogen Identification (REPI) program, a novel software program C omputer- I mplemented B iological S equence-based I dentifier system version 2 (CIBSI 2.0) (Lin et al., "Broad-spectrum respiratory tract pathogen identification using resequencing DNA microarrays" Genome Res . , 16 (4), 527-535 (2006), and also manually performed pre-determined determinations. Extensive discussion of this protocol, including the improved REPI algorithm, is described in detail in US patent application Ser. No. 11 / 422,431, filed June 6, 2006.

Example  8

Quantification of Pathogens —The specificity of the assay was confirmed using various prototype strains and clinical samples. The results did not suggest discernible interference between targets. The analytical sensitivity of RPM v.1 was then assessed using a series of 10-fold dilutions of the nucleic acid template of the prototype strain. Table 1 shows the lowest dilutions for each pathogen that the pathogen can detect. Compared with the sensitivity of the standard multiple RT-PCR / PCR method, the results showed a sensitivity range of 10 to 10 ³ genome copies per response to prototype strains. It should be noted that the genomic copy number does not coincide with the utility count (the plaque forming unit) unless there is usually more than one genome copy number if not on a scale several times higher than the utility count for respiratory pathogens. The ability to identify and identify RPM v.1 between adjacent gene neighbors, which was first demonstrated in more specific protocols, was reproduced using this protocol. Sequences generated from 17 different serotypes of human adenovirus (HAdV) revealed that the assay could distinguish various ARI related HAdV strains and demonstrated that this assay could be used to detect a wide variety of variants (Table 3). . Cross hybridization of the targets was observed only in the HAdV hexon gene among the different serotypes, but this did not interfere with positive identification of correctly targeted pathogens.

For sensitivity evaluation, real time PCR analysis was performed on iCycler or MYIQ ^™ instruments (Bio-Rad Laboratories, Hercules, CA) to determine the adenovirus genome number of each sample. Found in the sample from the water, fiber-specific primers Ad4F-F and a set of 10-fold dilution of Ad4F-R (Table 4) using the HAdV-4, number of copies of the base of the circular genomic DNA template (10 ^{1-10 6} copies) Comparison was made with water. HAdV-4 genome copy number was calculated using DNA concentrations derived from purified viral DNA and using the following conversion factors: Single adenovirus genome of 0.384 fg = -35 kb. 2.5 μl FastStart Reaction Mix SYBR Green I (Roche Applied Science, Indianapolis, Indiana), 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl ₂ , 200 μM of dATP, dTTP, dGTP, dCTP, respectively Real time PCR reactions were performed with 25 μl reaction volume containing 200 nM primers, and adenovirus genomic DNA (1-4 μl clinical sample or DNA extract). After 10 minutes of denaturation at 94 ° C, amplification reaction was performed by circulating 40 times at 94 ° C for 20 seconds and 60 ° C for 30 seconds.

Similar analysis was performed to determine the genome copy number of other pathogens using specific primers (Table 4) and RT-PCR / PCR conditions as previously described (Stone et al., “Rapid detection and simultaneous subtype differentiation of influenza A viruses by real time PCR " J. Virol . Methods , 117 , 103-112 (2004); Hardegger et al.," Rapid detection of Mycoplasma pneumoniae in clinical samples by real-time PCR " J. Microbiol..Methods , 41 , 45-51 (2000); Corless et al., "Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using realtime PCR" J. Clin. Microbiol. , 39 , 1553- 1558 (2001);. Molling et al, "Direct and rapid identification and genogrouping of meningococci andporA amplification by LightCycler PCR" J. Clin Microbiol, 40, 4531-4535 (2002);... Vabret et al, "Direct diagnosis of human respiratory coronaviruses 229E and OC43 by the polymerase chain rea ction " J. Virol . Methods , 91 , 59-66 (2001)).

RSV: respiratory syncytial virus, ^φ : fluorescent reporter dye at 5 'end, and double labeled probe as Black Hole Quencher at 3' end contains 6-carboxy-fluorescein (FAM).

Registration Number Reference:

Stone et al., "Rapid detection and simultaneous subtype differentiation of influenza A viruses by real time PCR" J. Virol . Methods , 117 , 103-112 (2004).

Vabret et al., "Direct diagnosis of human respiratory coronaviruses 229E and OC43 by the polymerase chain reaction" J. Virol . Methods , 97 , 59-66 (2001).

Hardegger et al., "Rapid detection of Mycoplasma pneumoniae in clinical samples by real-time PCR" J. Microbiol. Methods , 41 , 45-51 (2000).

Corless et al., "Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR" J. Clin . Microbiol . , 39 , 1553-1558 (2001).

Mentel et al., "Real-time PCR to improve the diagnosis of respiratory syncytial virus infection" J. Med . Microbiol . , 52 , 893-896 (2003).

Moiling et al., "Direct and rapid identification and genogrouping of meningococci and porA amplification by LightCycler PCR" J. Clin . Microbiol . , 40 , 4531-4535 (2002).

Example  9

Simultaneous Detection and Identification of Respiratory Pathogens —Previous studies, in addition to correctly identifying single pathogen species, one of the significant advantages of using RPM v.1 analysis for pathogen detection was the ability to detect co-infection. . In this study, the ability of the RPM v.1 assay to identify multiple pathogens simultaneously was further assessed by formulating various combinations of pathogen templates (Tables 5 and 6). Serial dilutions of the template were used to assess the detection sensitivity and specificity of multiple pathogens. Nucleic acid templates containing 10 ^{6-10 3} genome copies per reaction of each pathogen, HAdV-4, S. pyogenes , M. pneumoniae , and Y. pestis were mixed together and tested using RPM v.1 analysis. These results demonstrated that the assay can be identified based on the reproducible sequence of all four pathogens, even at the lowest concentration of 10 ³ genome copies per target per reactant (Table 5). The fact that there is no discernible disturbance in the complex mixture also supported the robustness and ancillary identification algorithm of RA's ability to demand nucleotide bases.

In order to assess further the effectiveness of the method for a plurality of pathogens, detection of complex mixtures, recovered from the applicants in 3-7 different and the cultured organism activity (10 ² ~10 ⁵ (cfu or pfu) / ㎖) ratio 150 μl of the prepared sample was added to the wash pool and used for testing. Initial results indicate that the seven pathogens HAdV-4, HAdV-7, B. anthracis , Influenza A-H1N1, Parainfluenza Virus 1, RSV-A, M. pneumoniae , and S at the same time at the lowest titer of 100 cfu (pfu) / ml. . it has been found by being able to clearly detect the pyogenes (Table 6). Further evaluation using a different set of seven pathogens suggested that the RPM v.1 assay can detect six of these simultaneously. Among them, HAdV-4, B. anthracis , Influenza A-H1N1, RSV-A, and M. pneumoniae were detected at the lowest titer of 100 cfu (pfu) / ml and S. pyogenes at 1000 cfu / ml ( Table 6). Y. pestis could not be detected even at the highest concentration. This is due to the uncertainty of the nucleic acid extraction protocol for unknown Y. pestis pathogens, since 1000 genome copies of Y. pestis can be detected using purified nucleic acid templates (Tables 1 and 5). ). For further confirmation, RPM v. 1 was tested using organisms cultured on the same set of four pathogens that were tested using the purified nucleic acid template (Table 5). Without failure, the results indicate that HAdV-4 and M. pneumoniae can be detected reproducibly at 100 cfu (pfu) / ml with less sensitivity of S. pyogenes (1000 cfu / ml) except Y. pestis . Presented. When testing three pathogens, namely B. anthracis , influenza A-H1N1, and HCoV-229E or RSV-A, the assay detected all three pathogens at titers as low as 100 cfu (pfu) / ml. (Table 6). These results suggest that RA-based methods are an effective means of detecting and classifying various pathogens directly from unwashed samples with the advantages of high sensitivity and specificity in detecting co-infection of seven or more pathogens. The method will be useful for routine diagnosis and infectious investigation of such pathogens in a population by providing new information on the occurrence of multiple pathogens.

Note: Samples were generated by mixing purified nucleic acid templates in TE buffer to prepare 10 ⁶ genomic copy / μl stock solutions. Starting from this concentration a 10-fold serial dilution in TE buffer was prepared.

Note: Samples were generated by mixing culture samples with non-clean pools recovered from normal volunteers to produce 10 ⁵ cfu (pfu) / ml. Starting from this concentration, a 10-fold serial dilution was prepared using the collection ratio wash recovered from normal volunteers. For each dilution, 150 μl of sample was used for RPM v.1 method. BA- B. anthracis (Sterne), H1N1--influenza A H1N1, HCoV229E- Human coronavirus 229E, Human adenovirus HAdV-, GAS- S. pyogenes (group A Streptococcus ), MP- M. pneumoniae, PIV1: Parainfluenza Virus 1, RSV-respiratory syncytial virus, YP- Y. pestis . +: Detected,-: not detected.

Example  10

Evaluation of Clinical Specimens- RPM v.1 for pathogen detection was used to predict and retrospectively diagnose ARI-induced infections after successfully demonstrating analytical power. Clinical specimens recovered primarily from military recruits presented with ARI were used to compare the utility of microarray-based diagnostics with more established respiratory pathogen detection methods. Samples (n = 101) consisted of throat seals in viral transfer media with clinically proven respiratory disease. Samples were randomly selected from the sets that were tested positive for HAdV or influenza virus using CAP authentication diagnostics (cell culture and / or PCR) in NHRC. They were blinded (randomly renumbered and separated from the relevant clinical record) and sent to the Naval Research Laboratory (NRL) for the RPM v.1 test. The compared experiments were conducted by two independent laboratories and found the same agreement after finishing the results. For influenza A virus, the RPM v.1 method showed 87% detection sensitivity and 96% specificity, and 92% overall identity for the initial diagnostic results (Table 7). For adenovirus, RPM v.1 detection sensitivity was 97%, specificity 97%, overall 97% identity (Table 7). For further comparison of RPM v.1 results using culture and PCR methods, the data suggested similar detection sensitivity and specificity of culture or PCR analysis (Table 8). The data indicate that RPM v.1 is better sensitive and specific than culture versus PCR because the molecular method is more sensitive than normal culture and the sequenceability of the RPM v.1 method is expected to provide higher specificity than PCR. (Table 9). The data further demonstrates the diagnostic ability based on microarrays to correctly identify clinically relevant influenza A virus strains in samples of uncultured patients.

^@ CAP certification PCR; ^* CAP authentication PCR and culture for influenza A virus in one of the audio samples, RPM v.1 is HAdV-4, and influenza A and presents a co-infection, to determine the amount of speech samples to gajyeoteum a low HAdV-4 activity; ^φ 3 Influenza A culture positive samples were not detected by quantitative real time PCR, suggesting that the template was degraded.

This study validated this assay by identifying subtypes of influenza virus and tracking genetic changes in influenza strains. Antigenic drift is particularly dangerous for influenza epidemiology because the influenza virus is a mechanism by which it escapes previous natural exposure and immune compression induced by the vaccine. The hemagglutinin resulting from RPM v.1 (HA) and neuramindase (NA) sequencing repeated existing lineage changes that occurred in 1999-2005 via antigenic drift (Table 10). Seven influenza A / H3N2 clinical specimens recovered before the 2003-2004 influenza season were identified because they belong to the A / Panama / 2007/99 strain, while nine influenza A / H3N2 samples recovered during the 2003-2004 influenza season. Clearly performed the symbol A / Fujian / 411/2002 lineage nucleotide replacement in the HA gene. The drift from the A / Fujian / 411/2002 strain to the A / California / 7/2004 strain was evident in the 18 influenza A / H3N2 samples recovered during the 2004-2005 influenza season. Three samples were identified as strains of type A / Fujian / 411/2002 while the rest presented a symbolic California-type nucleic acid replacement in the HA gene. Two samples recovered during the same period can only be identified as influenza A / H3N2. This resulted in insufficient sequence information in strain level identification by poor amplification and / or hybridization of the target. Two influenza A / H1N1 samples recovered from 2000-2001 were identified as closely related to A / New Caledonia / 20/99.

Note: ^* indicates only a single strain was identified.

In addition to detecting a single pathogen in a clinical sample, a variety of co-infection, such as HAdV-4 / influenza A virus, HAdV-4 / S. pyogenes, and influenza A virus / M. pneumoniae may be detected in a clinical sample (data Is not shown). Such co-infection is described by published et al., “Rapid detection and simultaneous subtype differentiation of influenza A viruses by real time PCR” J. Virol . Methods , 117 , 103-112 (2004); Hardegger et al., “Rapid detection of Mycoplasma pneumoniae in clinical samples by real-time PCR” J. Microbiol . Methods , 41 , 45-5 (2000)) and further in-house PCR primers (Table 4) Data not shown). The assay also detected 26% S. pneumoniae and 16% N. meningitidis in clinical samples. The presence of S. pneumoniae , and N. meningitidis was demonstrated by published species specific quantitative real time PCR analysis in a subset of 40 clinical samples (limitation due to available volume of samples) (data not shown). . It is not surprising that S. pneumoniae , and N. meningitidis are symbiotic bacteria in the oral and upper respiratory tracts, which were commonly found in clinical samples. However, quantitative real-time PCR data showed that most of S. pneumoniae and N. meningitidis present in clinical samples had low titers (≥10 ³ genome copies / μl) and 32% of influenza positive samples were S. pneumoniae (7/25). Or N. meningitidis (1/25) (≧ 10 ⁵ genome copies / μl) with high titers (data not shown). High titers of bacteria presented in such clinical samples may be due to virally induced bacterial duplication.

Example  11

Multiplex PCR Protocol with Primers L and LN —The following is a detailed protocol of the Example procedure.

Pharmacy

1. Preparation of TIM RNA from pSP64poly (A) -TIM -MEGASCRIPT ^® SP6 kit (Ambion, Cat # 1330)

a) Linearize 1 μg of pSP64poly (A) -TIM using EcoRI enzyme

x μl pSP64poly (A) -TM

2 μl 10x EcoRI buffer

2 μl EcoRI (NEB, Cat # R0101S)

(16-x) μl H ₂ O

20 μ total volume

Incubate the reaction at 37 ° C. for 5 hours.

b) End restriction enzyme digestion by adding:

0.5 M EDTA 1/20 times volume (1 μl)

3 M Na acetate 1 / 1O-fold volume (2 μl)

2-fold volume of ethanol (40 μl)

c) Mix well and cool at -20 minutes for 20 minutes. The DNA is then pelleted for 15 minutes in the fastest microcentrifuge.

d) Remove the supernatant, reswivel the tube for a few seconds and remove residual fluid using a pipette with a fairly fine tip. Resuspend in 20 μl of nuclease free water.

e) Place the RNA polymerase mixture on ice.

f) Vortex 1OX reaction buffer and 4 ribonucleotide solution.

g) Vortex until they are complete in solution (ATP, CTP, GTP, and UTP).

h) Once dissolved, store the ribonucleotides on ice, but keep the 1OX reaction buffer at room temperature until the reactions are combined at room temperature.

i) Simple microcentrifuge before opening all reagents to prevent loss and / or contamination of materials that may be present around the rim of the tube.

j) The following transfer reactions are combined at room temperature.

16 μl linearized pSP64poly (A) -TIM

16 μl NTP (ATP, GTP, CTP, UTP-4 μl each)

4 μl 1OX reaction buffer

4 μl enzyme mixture

40 μl total volume

Incubate the reaction at 37 ° C. for 6 hours.

k) Purify the RNA product using ProbeQuant ^™ G-50 Micro Column (Amersham, Cat # 27533501).

l) A 60 fg / μl stock is produced by measuring O.D values of recovered RNA and dilution.

2. Preparation of NAC1 DNA Fragment from pSP64poly (A) -NAC1- PCR using Platinum Taq DNA Polymerase (Invitrogen, Cat # 10966-034)

1 μl pSP64poly (A) -NAC1 (1 ng / μl)

5 μl 10x PCR buffer

2 μl 50 mM MgCl ₂

1 μl 10 mM dNTP mixture

1 μl SP6 (10 μM)

     5 '-ATT TAG GTG ACA CTA TAG AAT-3'

1 μl SP6 (10 μM)

     5 '-CAG GAA ACA GCT ATG ACC ATG-3'

0.5 μl Platinum Taq Polymerase

38.5 μl H ₂ O

 50 μl total volume

Start the following PCR program:

94 ℃-3 minutes

40 cycles:

94 ℃-30 seconds

50 ° C-30 seconds

72 ℃-40 seconds

72 ℃-5 minutes

4 ℃-Holding

PCR product purification-QIAquick® PCR purification kit (Qiagen, Cat # 28106)

a) 250 μl of buffer PB is added to 50 μl of PCR sample.

b) Place the QIAquick rotary column in the provided 2 ml recovery tube.

c) Apply the sample to a QIAquick column to bind DNA and centrifuge for 30-60 seconds.

d) Remove the eluate. Again place the QIAquick column in the same tube.

e) For washing, 0.75 ml buffer PE is added to the QIAquick column and centrifuged for 30-60 seconds.

f) Remove the eluate and place the QIAquick column back in the same tube.

g) Centrifuge the column for another 1 minute.

h) Place the QIAquick column in a clean 1.5 ml microcentrifuge tube.

i) To elute DNA, add 50 μL buffer EB (10 mM Tris-Cl, pH 8.5) or H ₂ O to the center of the QIAquick membrane, allow the column to stand for 1 minute, then centrifuge the column for 1 minute.

j) A 60 fg / μl stock is prepared by measuring the O.D values of the PCR product and dilution.

3. Mix 10 μl of 100 μM oligo stock (Table 2 (a)) to prepare 1 mL of 1 μM primer mixture A stock and add 1 mL of water. Mix well and divide into 100 μl aliquots.

4. Mix 10 μl of 100 μM oligo stock (Table 2 (b)) to prepare 1 ml of 1 μM primer mixture B stock and add 1 ml of water. After mixing well, divide into 100 μl aliquots.

Multiplex PCR

1.Nucleic Acid Extraction -MASTERPURE ^TM DNA purification kit (Epicentre, Cat # MC89010).

a) Add 100 μl 1 × PBS to 50 μl non-wash.

b) 150 μl 2X T & C lysis solution with 1 μl protease K is added.

c) Incubate at 65 ° C. for 15 minutes and vortex every 5 minutes.

d) allowed to stand on ice or 4 ° C. for 3-5 minutes.

e) 150 μL MPC solution is added to the sample and vortexed for 10 seconds.

f) Rotate at full speed for 10 minutes.

g) Transfer the supernatant to a fresh 1.5 ml tube, then add 500 μl isopropanol and mix well.

h) Rotate at 4 ° C. at full speed for 10 minutes. Remove the supernatant and wash twice with 80% alcohol.

i) The pellet is dried and resuspended in 8 μl nuclease free water.

2. Reverse Transcription with Primer LN-Invitrogen Superscript III (Invitrogen, Cat. # 18080-093)

8 μl NA from step 1

1 μl primer LN (40 μM)

5 '-CGA TAC GAC GGG CGT ACT AGC GNN NNN NNN N-3'

1 μl 10 mM dNTP

1 μl TIM (60 fg / μl)

1 μl NAC1 (60 fg / μl)

12 μl total volume

Incubate at 65 ° C. for 5 min and leave on ice for> 1 min.

The following reaction mixture is added to the tube and mixed by slow pipetting:

4 μl 5X First-Strand Buffer

0.1 μl DTT 2 μl

1 μl RNaseOUT

Superscript III 1 μl

8 μl total volume

Run the following program on the PCR device:

25 ℃-10 minutes

50 ° C-50 minutes

85 ° C-5 minutes

3. Segmentation of Multiplex PCR with Primer L

a. Reactant A:

5 μl of 1OX PCR buffer

50 mM MgC1 ₂ 4 μl

2 μl 50X dNTP

1 μl primer L (100 μM)

5'-CGA TAC GAC GGG CGT ACT AGC G-3 '

2 μl of primer A mixture (1 μM)

5 μl 5x Q-solution

10 μl of RT template (step 2)

2 μl platinum taq

18 μl of nuclease-free water

1 μl UDG

50 μl total volume

b. Reactant B:

5 μl of 1OX PCR buffer

50 mM MgC1 ₂ 4 μl

2 μl 50X dNTP

1 μl primer L (100 μM)

5'-CGA TAC GAC GGG CGT ACT AGC G-3 '

2.5 μl of primer B mixture (1 μM)

5 μl 5x Q-solution

10 μl RT Template

2 μl platinum taq

17.5 μl of nuclease-free water

1 μl UDG

50 μl total volume

Start the following PCR program:

94 ℃-3 minutes

5 cycles:

94 ℃-30 seconds

50 ℃-90 seconds

72 ℃-2 minutes

35 cycles:

94 ℃-30 seconds

64 ℃-2 minutes

72 ℃-5 minutes

4 ℃-Holding

Array manufacturing

Tag IQ-EXPCR -1.0 kb Tag IQ-EX or 7.5 kb Tag IQ-EX

1.0 kb Tag IQ-EX PCR

3 μl forward primer (1 kb)

3 μl reverse primer

Tag IQ-EX 5 μl

5 μl MgCl ₂ (50 mM)

2 μl dNTP (10 mM)

10 μl of 1OX PCR buffer

1 μl Platinum Taq DNA Polymerase

71 μl of water

100 μl total volume

94 ° C, 3 '

30 cycles 94 ° C., 30 ″; 68 ° C., 30 ″; 72 ℃, 40 "

72 ° C, 10 '

7.5 kb Tag IQ-EX PCR

3 μl forward primer (7.5 kb)

3 μl reverse primer

Tag IQ-EX 5 μl

dNTP (LA PCR kit) 16 μl

10 μl of 1OX PCR buffer (LA PCR kit)

TaKaRa Taq 1 μl

62 μl of water

100 μl total volume

94 ° C, 3 '

30 cycles 94 ° C, 30 "; 68 ° C, 7'30"

68 ° C, 10 '

Purified PCR product (Tag IQ-EX and multiplex PCR) -QIAquick® PCR purification kit (Qiagen, Cat # 28106)

a) 500 μl of buffer PB is added to 100 μl of PCR sample (combining reactants A and B).

b) Place the QIAquick rotary column in the provided 2 ml recovery tube.

c) To bind the DNA, apply the sample to a QIAquick column and centrifuge for 30-60 seconds.

d) Remove the eluate. Place the QIAquick column back in the same tube.

e) For washing, 0.75 ml of buffer PE is added to the QIAquick column and centrifuged for 30-60 seconds.

f) Remove the eluate and place the QIAquick column back in the same tube.

g) Centrifuge the column for an additional 1 minute.

h) Place the QIAquick column in a clean 1.5 ml microcentrifuge tube.

i) To elute DNA, add 40 μl add buffer EB (10 mM Tris-Cl, pH 8.5) or H ₂ O to the center of the QIAquick membrane, allow the column to stand for 1 minute, then centrifuge the column for 1 minute. .

j) Measure the O.D. value of the PCR product.

Fragments and Covers

1. Prepare one tube per sample for fragment and add EB buffer to 35 μl final volume for each reaction. Treat Tag IQ-EX as a sample.

Line 1 Total μg of product to add to the array 1.4 μg Line 2 Number of fragmentation reagents required for fragment DNA U Line 1 x 0.15 = 0.21 U Line 3 Activity of Fragmentation Reagent (U / μl) 3 U / μl Line 4 Volume of Fragmentation Reagent Required for Each Reaction (μl) Line 2 ÷ line 3 = 0.07 μl Line 5 Volume of water required for each reactant (μl) 3.3-line 4 = 3.23 μl

2. Make a fragmented cocktail on ice.

4.3 μl 1OX Fragmentation Buffer

3.23 μl of water

0.07 μl fragmentation reagent

7.6 μl total volume

3. After cooling the fragmentation cocktail on ice, add 7.6 μl to each DNA prepared in steps 1 & 2.

4. Start the following program.

37 ° C, 5 '

95 ° C, 10 '

4 ° C, holding

5. Prepare a labeled cocktail (per reaction).

12 μl Tdt buffer (5X)

2 μl GeneChip DNA Labeling Reagent (5 mM)

3.4 μl TdT (30U / μl)

17.4 μl total

6. Add 17.4 μL of labeled cocktail to each reaction and fragmented control PCR product.

7. Run the following program.

37 ° C, 30 '

95 ° C, 5 '

4 ° C, holding

Hybridization

1. Operate the hybridization oven set at 45 ° C. and warm the chip at room temperature.

2. Prepare the prehybridization solution.

2 μl of 1% Tween-20

1 M Tris, pH 7.8 2 μl

196 μl of water

200 μl total volume (per chip)

3. Prehybridize the chips with prehybridization buffer at 45 ° C.

4. Combine the hybridization master mixture.

Tag IQ-EX * (fragmented 0.26 μg) 1.9 μl

132 μl 5 M TMAC

1 M Tris, pH 7.8 2.2 μl

2.2 μl 1% Tween-20

2.2 μl Herring sperm DNA (10 mg / mL)

2.2 μl of acetylated BSA

3.4 μl of control oligo B2

13.9 μl of water

160 μl final volume (per chip)

* The following calculations were used to determine the degree of fragmentation of Tag IQ-EX for hybridization master mixtures.

Purified PCR product concentration. (E.g. 100 ng / μl) x 35 μl = 3500 ng

Final volume after fragmentation and labeling is 60 μl.

Final concentration of fragmented Tag IQ-EX = 58.3 ng / μl

260 / 58.3 = 4.4658.3 μl will be required.

5. Add 160 μl to 60 μl labeled sample. Start the following program.

95 ° C, 5 '

45 ° C, 5 '

6. Remove prehybridization buffer from the chip and fill with hybridization mixture.

7. Hybridize at 45 ° C., 60 rpm overnight.

Washing and coloring

1. Prepare Wash Buffers A & B.

Wash A

2OX SSPE 300ml

1 ml of 10% Tween-20

699 ml of water

Filter through a 0.2 μm filter and store capped at room temperature.

Wash B

2OX SSPE 30 ml

1 ml of 10% Tween-20

969 ml of water

Filter through a 0.2 μm filter and store capped at room temperature.

2. (Each Chip) Prepare SAPE staining solution.

2OX SSPE 360 μl

12 μl of 1% Tween-20

50 μl 50 mg / ml acetylated BSA

SAPE 12 μl

766 μl DI water

Mix well and divide into two 600 μl aliquots (color 1 & color 3).

3. Prepare each antibody solution (each chip).

180 μl 2OX SSPE

6 μl of 1% Tween-20

25 μl 50 mg / ml acetylated BSA

10 mg / ml normal goat IgG 6 μl

3.6 μl 0.5 mg / ml biotinylated antibody

379.4 μl DI water

600 μl final volume

4. Wash Protocol-Activate DNAARRAY WS4.

Unlike conventional methods, optimized RPM v.1 assays not only identify pathogens, but large amounts of pathogens can be detected and phylogenetically categorized within the same assay. The sequence information is a powerful tool for analyzing genetic variation of circulating viruses (ie influenza) and has demonstrated the ability of RPM v.1 for a wide variety of variants (eg HAdV). It is also useful for tracking the movement of known variants. This utility is from the A / A / Panama / 2007/99 strain (before the 2003 influenza season) to the A / Fujian / 411/2002 strain (2003-2004 influenza season) and then to the A / California / 7/2004 Clearly demonstrated in influenza A positive clinical samples suggesting lineage changes to strain (2004-2005 influenza season). Only one relatively conserved M gene (H1N1) sequence in influenza A virus was tiled on RPM v.1. However, the M gene ProSeq can still detect homologous regions of heterologous subtypes and can correctly distinguish them (Table 10). This M gene ProSeq should be able to theoretically detect any other type of influenza virus against antigenic HA and NA sequences that are not tiled on the array.

This study suggests that the system can provide excellent clinical sensitivity and specificity, the ability of which to address complex co-infections without loss of sensitivity, and the sensitivity is similar to all 26 target pathogens and potential pre-bacterial pathogens. Prove that. In contrast to the culture and PCR assays, this assay platform presented similar detection sensitivity and specificity for both HAdV and influenza A viruses (Table 7). This data supports the feasibility of using the RPM v.1 system as a diagnostic tool to directly correct clinically relevant adenovirus and influenza A virus strains in direct (uncultivated) clinical specimens in a manner correlated with conventional detection methods. I identify and classify.

Obviously, many modifications and variations of the present invention are possible in light of the above. Accordingly, it is intended that the present invention as claimed may be practiced otherwise than as specifically described. Any reference that claims a substance as singular, for example using "a," "an," "the," or "above" in the text, is not limited to the singular material and is not manufactured.

                         SEQUENCE LISTING <110> Lin, Bauchuan        Blaney, Kate M        Malanoski, Anthony P        Schnur, Joel M        Stenger, David A   <120> MULTIPLEXED POLYMERASE CHAIN REACTION FOR GENETIC SEQUENCE ANALYSIS <130> 97439US2 <150> 60 / 691,768 <151> 2005-06-16 <150> 60 / 735,876 <151> 2005-11-14 <150> 60 / 735,824 <151> 2005-11-14 <150> 60 / 743,977 <151> 2006-03-30 <150> 11 / 177,647 <151> 2005-07-02 <150> 11 / 177,646 <151> 2005-07-02 <150> 11 / 268,373 <151> 2005-11-07 <150> 11 / 422,425 <151> 2006-06-06 <150> 11 / 422,431 <151> 2006-06-06 <160> 147 <170> PatentIn version 3.3 <210> 1 <211> 22 <212> DNA <213> Artificial <220> <223> Primer tail sequence <400> 1 cgatacgacg ggcgtactag cg 22 <210> 2 <211> 31 <212> DNA <213> Artificial <220> <223> Primer tail sequence <220> <221> misc_feature (222) (23) .. (31) N is a, t, c, or g <400> 2 cgatacgacg ggcgtactag cgnnnnnnnn n 31 <210> 3 <211> 42 <212> DNA <213> Artificial <220> <223> Primer <400> 3 cgatacgacg ggcgtactag cggccaacaa ctcaaccgac ac 42 <210> 4 <211> 44 <212> DNA <213> Artificial <220> <223> Primer <400> 4 cgatacgacg ggcgtactag cgacacttcg catcacattc atcc 44 <210> 5 <211> 42 <212> DNA <213> Artificial <220> <223> Primer <400> 5 cgatacgacg ggcgtactag cgacttcccg gaaatgacaa ca 42 <210> 6 <211> 42 <212> DNA <213> Artificial <220> <223> Primer <400> 6 cgatacgacg ggcgtactag cgggtttgtc attgggaatg ct 42 <210> 7 <211> 42 <212> DNA <213> Artificial <220> <223> Primer <400> 7 cgatacgacg ggcgtactag cggccattcc acaacataca cc 42 <210> 8 <211> 42 <212> DNA <213> Artificial <220> <223> Primer <400> 8 cgatacgacg ggcgtactag cgagctacca tgattgccag tg 42 <210> 9 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 9 cgatacgacg ggcgtactag cgacgttgtt gctggaaagg ac 42 <210> 10 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 10 cgatacgacg ggcgtactag cgaaacttcc gctgtaccct ga 42 <210> 11 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 11 cgatacgacg ggcgtactag cgggaaatat gccccaaact agc 43 <210> 12 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 12 cgatacgacg ggcgtactag cgatgcagct tttgccttca ac 42 <210> 13 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 13 cgatacgacg ggcgtactag cgttctaacc gaggtcgaaa cg 42 <210> 14 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 14 cgatacgacg ggcgtactag cgctctggca ctccttccgt ag 42 <210> 15 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 15 cgatacgacg ggcgtactag cggggaggtc aatgtgactg gt 42 <210> 16 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 16 cgatacgacg ggcgtactag cggggcaatt tcctatggct tt 42 <210> 17 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 17 cgatacgacg ggcgtactag cggtgaaccg ttctgcaaca aa 42 <210> 18 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 18 cgatacgacg ggcgtactag cgccaatctt ggatgccatt ct 42 <210> 19 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 19 cgatacgacg ggcgtactag cgcattgaca gaagatggag aagg 44 <210> 20 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 20 cgatacgacg ggcgtactag cgaagcacag agcgttccta g 41 <210> 21 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 21 cgatacgacg ggcgtactag cgctgtggac cgtgaggata ct 42 <210> 22 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 22 cgatacgacg ggcgtactag cgttggcggg tatagggtag agc 43 <210> 23 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 23 cgatacgacg ggcgtactag cgttattcag cagcacctcc ttg 43 <210> 24 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 24 cgatacgacg ggcgtactag cgggtggcag gttgaatact ag 42 <210> 25 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 25 cgatacgacg ggcgtactag cgggctgata atcttccacc tcc 43 <210> 26 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 26 cgatacgacg ggcgtactag cgctctcacg gcaactggtt taa 43 <210> 27 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 27 cgatacgacg ggcgtactag cggacaggac gcttcggagt ac 42 <210> 28 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 28 cgatacgacg ggcgtactag cgggcaacat tggcatagag gaag 44 <210> 29 <211> 40 <212> DNA <213> Artificial <220> <223> primer <400> 29 cgatacgacg ggcgtactag cgggtggagt gatggcttcg 40 <210> 30 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 30 cgatacgacg ggcgtactag cgagtgccat ctatgctatc tcc 43 <210> 31 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 31 cgatacgacg ggcgtactag cggccgtgga gtaaatggct aa 42 <210> 32 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 32 cgatacgacg ggcgtactag cgagtcttcc aagaccgtcc aa 42 <210> 33 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 33 cgatacgacg ggcgtactag cgatgtgacc accgaccgta g 41 <210> 34 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 34 cgatacgacg ggcgtactag cggttgctgg agaacggtat g 41 <210> 35 <211> 45 <212> DNA <213> Artificial <220> <223> primer <400> 35 cgatacgacg ggcgtactag cgtctacccc tatgaagatg aaagc 45 <210> 36 <211> 45 <212> DNA <213> Artificial <220> <223> primer <400> 36 cgatacgacg ggcgtactag cgggataggc agttgtgctg ggcat 45 <210> 37 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 37 cgatacgacg ggcgtactag cgtgagtgcc agcgagaaga g 41 <210> 38 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 38 cgatacgacg ggcgtactag cgcaggaggt gaggtagttg aatc 44 <210> 39 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 39 cgatacgacg ggcgtactag cgtcaaatcc tcgttgacag ac 42 <210> 40 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 40 cgatacgacg ggcgtactag cgtgcactgt tgcctccatt ga 42 <210> 41 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 41 cgatacgacg ggcgtactag cgacaggaat tggctcagat atg 43 <210> 42 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 42 cgatacgacg ggcgtactag cgacatgatc tcctgttgtc gt 42 <210> 43 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 43 cgatacgacg ggcgtactag cgtcgaggtt gccaggatat agg 43 <210> 44 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 44 cgatacgacg ggcgtactag cgggactatg agatgcctga ttgc 44 <210> 45 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 45 cgatacgacg ggcgtactag cgcaactatt agcagtcaca ctcg 44 <210> 46 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 46 cgatacgacg ggcgtactag cgaagttggc attgtgttca gtg 43 <210> 47 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 47 cgatacgacg ggcgtactag cgtcatccag actgtcaaag g 41 <210> 48 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 48 cgatacgacg ggcgtactag cgaaacagga aacacggaca cc 42 <210> 49 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 49 cgatacgacg ggcgtactag cgctctatca tcacagatct cagc 44 <210> 50 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 50 cgatacgacg ggcgtactag cgcatgagtc tgactggttt gc 42 <210> 51 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 51 cgatacgacg ggcgtactag cgacaaagat ggctcttagc aaag 44 <210> 52 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 52 cgatacgacg ggcgtactag cgacccagtg aatttatgat tagc 44 <210> 53 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 53 cgatacgacg ggcgtactag cgaaaaccaa cccaaccaaa cc 42 <210> 54 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 54 cgatacgacg ggcgtactag cggcacatca taattgggag tgtc 44 <210> 55 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 55 cgatacgacg ggcgtactag cggctctctt ggcgttcttc ag 42 <210> 56 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 56 cgatacgacg ggcgtactag cgtcattacc agccgacagc ac 42 <210> 57 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 57 cgatacgacg ggcgtactag cgccgtcagc gatctctcca c 41 <210> 58 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 58 cgatacgacg ggcgtactag cgcctgtcca ccactccttg tc 42 <210> 59 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 59 cgatacgacg ggcgtactag cggcttgaaa gggcagttct gg 42 <210> 60 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 60 cgatacgacg ggcgtactag cgcaggtctc cgattgtgat tgc 43 <210> 61 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 61 cgatacgacg ggcgtactag cgctctggtg tgtggtgctt ata 43 <210> 62 <211> 40 <212> DNA <213> Artificial <220> <223> primer <400> 62 cgatacgacg ggcgtactag cgctcggcac ggcaactgtc 40 <210> 63 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 63 cgatacgacg ggcgtactag cgatgtggat gacgtttagg ta 42 <210> 64 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 64 cgatacgacg ggcgtactag cgggttgatg gcagtcggta a 41 <210> 65 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 65 cgatacgacg ggcgtactag cgaagaagag ttcatgacgg ac 42 <210> 66 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 66 cgatacgacg ggcgtactag cgtggttgtt tggttggtta ttcg 44 <210> 67 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 67 cgatacgacg ggcgtactag cgccgatgac ttatagtatt ga 42 <210> 68 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 68 cgatacgacg ggcgtactag cgataatctt gatgccactt agc 43 <210> 69 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 69 cgatacgacg ggcgtactag cggttcttca ggctcaggtc aatc 44 <210> 70 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 70 cgatacgacg ggcgtactag cgacagcggt atgtactggt cata 44 <210> 71 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 71 cgatacgacg ggcgtactag cgtgggaata gtgtgcgtat gc 42 <210> 72 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 72 cgatacgacg ggcgtactag cgacatcacc gcgacgcagc aa 42 <210> 73 <211> 40 <212> DNA <213> Artificial <220> <223> primer <400> 73 cgatacgacg ggcgtactag cggattccgc gatgccgatg 40 <210> 74 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 74 cgatacgacg ggcgtactag cgcgcccatg tatttagaga accg 44 <210> 75 <211> 40 <212> DNA <213> Artificial <220> <223> primer <400> 75 cgatacgacg ggcgtactag cgccggcgtc gtgcgcgaaa 40 <210> 76 <211> 40 <212> DNA <213> Artificial <220> <223> primer <400> 76 cgatacgacg ggcgtactag cgcagccacg tcagccagcc 40 <210> 77 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 77 cgatacgacg ggcgtactag cggagcgaat atctggcaca cc 42 <210> 78 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 78 cgatacgacg ggcgtactag cggggccagg tctagaacga at 42 <210> 79 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 79 cgatacgacg ggcgtactag cgtggagtac aatggtctcg agc 43 <210> 80 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 80 cgatacgacg ggcgtactag cgtttgcatg aagtctgaga acga 44 <210> 81 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 81 cgatacgacg ggcgtactag cgacggcatt acaacggcta g 41 <210> 82 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 82 cgatacgacg ggcgtactag cgcatcttct ggtaatccct gttc 44 <210> 83 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 83 cgatacgacg ggcgtactag cgacagcgtt caatctcgtt gg 42 <210> 84 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 84 cgatacgacg ggcgtactag cgagagaatt gcgatacgtt acag 44 <210> 85 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 85 cgatacgacg ggcgtactag cgccttacaa cctattgaca cctg 44 <210> 86 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 86 cgatacgacg ggcgtactag cgacacgaga gctacctgca ga 42 <210> 87 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 87 cgatacgacg ggcgtactag cgtttataca atatgggcag gg 42 <210> 88 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 88 cgatacgacg ggcgtactag cgtcgtaagc tgttcttctg gtac 44 <210> 89 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 89 cgatacgacg ggcgtactag cgtcattgct tgatgaaact gat 43 <210> 90 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 90 cgatacgacg ggcgtactag cgttggatat tcaccgaaca ctag 44 <210> 91 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 91 cgatacgacg ggcgtactag cgcttgtgga aatgagtcaa cgg 43 <210> 92 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 92 cgatacgacg ggcgtactag cgaggtagct atatttcgct tgac 44 <210> 93 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 93 cgatacgacg ggcgtactag cggagcgtct acgtcctggt ga 42 <210> 94 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 94 cgatacgacg ggcgtactag cgcattggtt tcgctgtttt ga 42 <210> 95 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 95 cgatacgacg ggcgtactag cgtggaagag tgagggtgga tac 43 <210> 96 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 96 cgatacgacg ggcgtactag cgaataatcc ctctgttgac gaa 43 <210> 97 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 97 cgatacgacg ggcgtactag cgaggagcaa tgagaattac acg 43 <210> 98 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 98 cgatacgacg ggcgtactag cgctaagttc caatactctt gc 42 <210> 99 <211> 45 <212> DNA <213> Artificial <220> <223> primer <400> 99 cgatacgacg ggcgtactag cggccggtac ttatgtatgt gcatt 45 <210> 100 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 100 cgatacgacg ggcgtactag cgcatcattg gcggttgatt ta 42 <210> 101 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 101 cgatacgacg ggcgtactag cggggaacat acgcttccag at 42 <210> 102 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 102 cgatacgacg ggcgtactag cgttccacat tttgtttggg aaa 43 <210> 103 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 103 cgatacgacg ggcgtactag cgccttatcc gactcgcaat gt 42 <210> 104 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 104 cgatacgacg ggcgtactag cgcagtgtga ggttatgtgg tgga 44 <210> 105 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 105 cgatacgacg ggcgtactag cgttggttgc gcaattcaag t 41 <210> 106 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 106 cgatacgacg ggcgtactag cgtgttgttc tttgtgcagg aga 43 <210> 107 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 107 cgatacgacg ggcgtactag cgtcgtaatg ttagctgtat catc 44 <210> 108 <211> 44 <212> DNA <213> Artificial <220> <223> primer <400> 108 cgatacgacg ggcgtactag cgtacattag ctgtccactt accg 44 <210> 109 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 109 cgatacgacg ggcgtactag cggtgggtgg tggtcttaag ttt 43 <210> 110 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 110 cgatacgacg ggcgtactag cgctggatat taccagtgtc att 43 <210> 111 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 111 cgatacgacg ggcgtactag cgactgataa aggggagtgg ata 43 <210> 112 <211> 41 <212> DNA <213> Artificial <220> <223> primer <400> 112 cgatacgacg ggcgtactag cgctcgcctt gctctttgag c 41 <210> 113 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 113 cgatacgacg ggcgtactag cgggacacaa gccctctcta cg 42 <210> 114 <211> 43 <212> DNA <213> Artificial <220> <223> primer <400> 114 cgatacgacg ggcgtactag cgtagatacg gttacggtta cag 43 <210> 115 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 115 cgatacgacg ggcgtactag cgcatgggaa gctgttttga tg 42 <210> 116 <211> 42 <212> DNA <213> Artificial <220> <223> primer <400> 116 cgatacgacg ggcgtactag cgcccgaaga attgttccaa tc 42 <210> 117 <211> 21 <212> DNA <213> Artificial <220> <223> Primer <400> 117 gaccaatcct gtcacctctg a 21 <210> 118 <211> 21 <212> DNA <213> Artificial <220> <223> Primer <400> 118 gtatatgagk cccatrcaac t 21 <210> 119 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 119 tcggtgggaa agaatttgac 20 <210> 120 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 120 ttcctgatag gggctctgtg 20 <210> 121 <211> 24 <212> DNA <213> Artificial <220> <223> Primer <400> 121 acaagcaagg agatagcata gatg 24 <210> 122 <211> 24 <212> DNA <213> Artificial <220> <223> Primer <400> 122 gtaggagaag gtgtatgagt tagc 24 <210> 123 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 123 acctgggcta attgggattc 20 <210> 124 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 124 aatgcctgtt ggagcttgtt 20 <210> 125 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 125 ggcttatgtg gccccttact 20 <210> 126 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 126 aagatggccg cgtattattg 20 <210> 127 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 127 ggctcagata tgcgagaaca 20 <210> 128 <211> 21 <212> DNA <213> Artificial <220> <223> Primer <400> 128 ttggtccggg taataatgag a 21 <210> 129 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 129 ccatatgcgg cattataccc 20 <210> 130 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 130 gcagtctctc tgcgttttcc 20 <210> 131 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 131 tgctttaccc aaggcaaaaa 20 <210> 132 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 132 agcctcatct gccaggtcta 20 <210> 133 <211> 23 <212> DNA <213> Artificial <220> <223> Primer <133> 133 aagatggctc ttagcaaagt caa 23 <210> 134 <211> 22 <212> DNA <213> Artificial <220> <223> Primer <400> 134 tactatctcc tgtgctccgt tg 22 <210> 135 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 135 tggggcaaat acaaagatgg 20 <210> 136 <211> 23 <212> DNA <213> Artificial <220> <223> Primer <400> 136 cacatcataa ttgggagtgt caa 23 <210> 137 <211> 21 <212> DNA <213> Artificial <220> <223> Primer <400> 137 ccaaccaaac aacaacgttc a 21 <210> 138 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 138 accttgactg gaggccgtta 20 <139> <211> 32 <212> DNA <213> Artificial <220> <223> Primer <400> 139 tcaactcgaa taacggtgac ttcttaccac tg 32 <210> 140 <211> 22 <212> DNA <213> Artificial <220> <223> Primer <400> 140 tgcagagcgt cctttggtct at 22 <210> 141 <211> 25 <212> DNA <213> Artificial <220> <223> Primer <400> 141 ctcttactcg tggtttccaa cttga 25 <210> 142 <211> 24 <212> DNA <213> Artificial <220> <223> Primer <400> 142 tggcgcccat aagcaacact cgaa 24 <210> 143 <211> 25 <212> DNA <213> Artificial <220> <223> Primer <400> 143 aacagatgta agcagctccg ttatc 25 <210> 144 <211> 26 <212> DNA <213> Artificial <220> <223> Primer <400> 144 cgatttttat tggatgctgt acattt 26 <210> 145 <211> 26 <212> DNA <213> Artificial <220> <223> Primer <400> 145 tgccatagca tgacacaatg gctcct 26 <210> 146 <211> 21 <212> DNA <213> Artificial <220> <223> Primer <400> 146 cggcagcgtc tcaattcgtt c 21 <210> 147 <211> 20 <212> DNA <213> Artificial <220> <223> Primer <400> 147 caagccgcct tcctcatagc 20  

Claims (22)

Providing a biological sample suspected of containing one or more pathogen nucleic acids from a pre-defined set of pathogens; Adding to said sample a plurality of PCR primers corresponding to genes identified in a pre-defined set of pathogens, Wherein the primer comprises one or more primer pairs for each pathogen and comprises a tail sequence that is not homologous to the DNA or any background DNA of any predefined pathogen set in the sample; And Performing a polymerase chain reaction on a sample to amplify a subset of nucleic acids corresponding to said gene, At least one primer concentration in the polymerase chain reaction is not higher than about 100 nM How to include. The method of claim 1, wherein the concentration of each primer in the polymerase chain reaction is no higher than about 100 nM. The method of claim 1, wherein the tail sequence is CGATACGACGGGCGTACTAGCG (SEQ ID NO: 1). The method of claim 1, wherein the tail sequence is CGATACGACGGGCGTACTAGCGNNNNNNNNN (SEQ ID NO: 2). The method of claim 1, further comprising extracting the nucleic acid from the clinical sample to prepare a biological sample. The method of claim 5, wherein the clinical sample comprises a non-wash, throat sputum, sputum, blood or an environmental sample. The method of claim 5, wherein the clinical sample is from an organism; Wherein the tail sequence is not homologous to the DNA of the organism species. 8. The method of claim 7, wherein said organism is a human. The method of claim 1, wherein the pathogen is a respiratory pathogen. The method of claim 1, wherein the pathogen is an enteric pathogen or a biothreat pathogen. The method of claim 1, wherein the amplified nucleic acid comprises a sequence of 200 nucleotides or less and a sequence of 2000 nucleotides or more. The method of claim 1, wherein the tail sequence reduces the formation of primer dimers. The method of claim 1, wherein the PCR primers comprise at least 50 different primers. The method of claim 1, Adding a plurality of PCR primers and performing a polymerase chain reaction, respectively, on a plurality of aliquots of a biological sample; Using a plurality of different PCR primers for each aliquot; Method of mixing the aliquots after the PCR reaction. The method of claim 1, Contacting the sample with a microarray comprising a plurality of nucleic acid sequences complementary to at least a portion of the amplified nucleic acid; And Hybridizing the amplified nucleic acid with a complementary nucleic acid How to include more. The method of claim 15, wherein the complementary nucleic acid is from 25 to 29 monomers. The method of claim 15, wherein the complementary nucleic acid comprises a probe that perfectly matches one or more of the amplified nucleic acids, and three different single nucleotide polymorphisms in the center of each perfectly corresponding probe. The method of claim 15, further comprising detecting the amplified nucleic acid hybridized with the complementary nucleic acid. 19. The method of claim 18, further comprising identifying a pathogen based on the results of detecting the amplified nucleic acid. The method of claim 19, wherein the identification is based on pattern recognition. The method of claim 19, wherein the method is identified based on sequencing results of the amplified nucleic acid. The method of claim 18, wherein the method comprises identifying strains of the pathogen.