KR20080047676A - Mesonephric stem cells lines - Google Patents

Mesonephric stem cells lines Download PDF

Info

Publication number
KR20080047676A
KR20080047676A KR1020060117430A KR20060117430A KR20080047676A KR 20080047676 A KR20080047676 A KR 20080047676A KR 1020060117430 A KR1020060117430 A KR 1020060117430A KR 20060117430 A KR20060117430 A KR 20060117430A KR 20080047676 A KR20080047676 A KR 20080047676A
Authority
KR
South Korea
Prior art keywords
stem cell
cell line
cells
mesothelial
neutrophil
Prior art date
Application number
KR1020060117430A
Other languages
Korean (ko)
Other versions
KR100838707B1 (en
Inventor
이창규
손혜영
이유진
김혜선
김민구
박치훈
김정은
Original Assignee
재단법인서울대학교산학협력재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인서울대학교산학협력재단 filed Critical 재단법인서울대학교산학협력재단
Priority to KR1020060117430A priority Critical patent/KR100838707B1/en
Publication of KR20080047676A publication Critical patent/KR20080047676A/en
Application granted granted Critical
Publication of KR100838707B1 publication Critical patent/KR100838707B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/235—Leukemia inhibitory factor [LIF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1323—Adult fibroblasts

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Transplantation (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A mesonephric stem cell line is provided to be differentiated into various cells, treat various diseases or disorders through cell therapy and be used for developing a transgenic animal used for xenotransplantation. A method for preparing a mesonephric stem cell line comprises the steps of: (a) obtaining a mesonephric stem cell from mesonephros of mammal; (b) culturing the mesonephric stem cell onto a feeder cell layer to form a colony; and (c) subculturing the colony to obtain the mesonephric stem cell line, wherein the mammal is human, pig, cattle, sheep, horse, rabbit, goat, mouse, hamster or rat and the feeder cell layer is a fibroblast layer. A mesonephric stem cell line is derived from the mesonephros of the mammal and is characterized in that it show a positive reaction regarding alkaline phosphatase and has the ability of being naturally differentiated into embryonic bodies. Further, the fibroblast is derived from ICR mouse, and a number of the fibroblast is 1.8 to 2.8x10^5 cell/ml.

Description

중신 줄기세포주{Mesonephric Stem Cells Lines}Mesogenic Phric Stem Cells Lines

도 1은 돼지 중신 줄기세포(Porcine Mesonephric Stem Cells: PMSCs)의 분리 및 배양 결과를 보여주는 도면이다. 패널 (A): 26-30일째(발정 = 0일)의 돼지 태아(배아)의 중신으로부터 PMSCs를 분리하였다. ▲ 중신, ↑ 생식융기. PMSCs를 중신의 바깥쪽 부분에서 분리하였다. 패널 (B): 그라인딩된 신선한 중신 조직은 알칼린 포스파타아제(AP)에 대한 염색에서 양성반응을 나타내었다. 패널 (C): AP-양성 콜로니, 피더층에 씨딩된 후 7일째의 세포덩어리. 패널 (D): 7th 패시지의 배양된 PMSCs 콜로니는 마우스 ESCs-유사 형태를 나타내었다. 패널 (E): AP-양성 콜로니, 8th 패시지의 PMSCs. 패널 (F): 중신, PMSCs 및 난모세포(생식세포-양성 대조군)에서 VASA mRNA 발현 양상을 보여주는 RT-PCR 젤의 사진. 하우스-키핑 유전자로서의 β-액틴은 대조군으로 이용되었다(A, B, E, F): 400 x, (C): 40 x. 1 is a view showing the results of isolation and culture of porcine Mesonephric Stem Cells (PMSCs). Panel (A): PMSCs were isolated from the gestation of porcine fetuses (embryo) at day 26-30 (estrous = 0 days). ▲ Central body, ↑ Reproductive ridge. PMSCs were isolated from the outer part of the body. Panel (B): The fresh fresh necrotic tissue was positive in staining for alkaline phosphatase (AP). Panel (C): AP-positive colonies, cell mass 7 days after seeding on feeder layer. Panel (D): Cultured PMSCs colonies of 7 th passages showed mouse ESCs-like morphology. Panel (E): AP-positive colonies, PMSCs of 8 th passage. Panel (F): Pictures of RT-PCR gels showing VASA mRNA expression patterns in neutrophils, PMSCs and oocytes (germ-positive control). Β-actin as a house-keeping gene was used as a control (A, B, E, F): 400 x, (C): 40 x.

도 2는 면역조직화학 염색 결과이다. 돼지 태아로부터 얻은 중신 조직(27일째)을 Oct-4(패널 A-F) 및 SSEA-1(패널 G-L)에 대하여 염색하였다. Oct-4가 염색되었다. 패널 (A): 제1차 항체 없이 Oct-4에 대하여 염색한 네가티브 대조군. 패널 (B): 중신의 바깥쪽 부분(+) 및 생식선으로 이동 중인 생식세포(*)는 양성반응을 나타내었다. Oct-4 양성반응 세포의 확대 이미지. 패널 (C,D): 이동한 생식 세포 및 패널 (E,F): 중신 튜블. SSEA-1을 염색하였다. 패널 (G,H): 제1차 항체 없이 SSEA-1에 대하여 염색한 네가티브 대조군. 패널 (I,J,L): 중신의 튜블 세포(+)의 표면이 SSEA-1에 대하여 양성 반응을 나타내었다. 중신 조직의 확대 이미지. 패널 (I,J,K): 원시생식기-동맥 부위(*)는 SSEA-1 음성 반응을 나타내었다. 핵은 헤마톡실린(청색)으로 염색하였다. (A,B,G,I): 40 x, (C,E,J): 200 x, (D,F,H,K,L): 400 x (x40). 2 shows immunohistochemical staining results. Neutral tissue from pig fetus (day 27) was stained for Oct-4 (Panel A-F) and SSEA-1 (Panel G-L). Oct-4 was stained. Panel (A): Negative control stained for Oct-4 without primary antibody. Panel (B): Outer part of the central body (+) and germ cells (*) moving to the gonad were positive. Magnified image of Oct-4 positive cells. Panels (C, D): migrated germ cells and panels (E, F): necrotic tubules. SSEA-1 was stained. Panel (G, H): Negative control stained for SSEA-1 without primary antibody. Panel (I, J, L): The surface of neutrophil tubular cells (+) showed positive response to SSEA-1. Magnified image of a neutered organization. Panel (I, J, K): The primitive genital-arterial site (*) showed a SSEA-1 negative response. Nuclei were stained with hematoxylin (blue). (A, B, G, I): 40 x, (C, E, J): 200 x, (D, F, H, K, L): 400 x (x40).

도 3은 배양된 돼지 중신 줄기세포의 특성을 보여주는 사진이다. 패널 (A): 제1차 항체가 없는 네가티브 대조군, 패널 (B): Oct-4에 대한 강한 양성 반응, 패널 (C): SSEA-1에 대한 양성 반응, 패널 (D): SSEA-4에 대한 양성 반응, 패널 (E): Tral-60에 대한 약한 양성 반응, 패널 (F): Tral-81에 대한 양성 반응. (A-F): 400 x. Figure 3 is a photograph showing the characteristics of the cultured pig neutrophil stem cells. Panel (A): negative control without primary antibody, panel (B): strong positive response to Oct-4, panel (C): positive response to SSEA-1, panel (D): to SSEA-4 Positive for panel, panel (E): weak positive for Tral-60, panel (F): positive for Tral-81. (A-F): 400 x.

도 4는 장기간 배양된 PMSCs가 정상적인 핵형을 보유한다는 것을 보여주는 사진이다. 패널 (A): 4개월 인 비트로 배양 후에 대표적인 염색체들에 대하여 핵형 분석하였다(n=38). 패널 (B): SRY 유전자 발현에 대한 RT-PCR 분석 결과이다. 분화된 PMSCs는 SRY 유전자를 발현 하였다.4 is a photograph showing that long-term cultured PMSCs have a normal karyotype. Panel (A): Representative chromosomes were karyotyped after 4 months in vitro (n = 38). Panel (B): Results of RT-PCR analysis for SRY gene expression. Differentiated PMSCs expressed the SRY gene.

도 5는 인 비트로 분화된 돼지 중신 줄기세포(PMSCs)를 보여준다. 패널 (A): 배아유사체. PMSCs의 자연적인 분화결과, 신경필라멘트(패널 B) 및 β Ⅲ 튜블린(패널 C) 항체를 이용한 외배엽 세포에 대한 면역조직화학 염색에서 양성 반응을 나타내었고, α-페토단백질 항체를 이용한 내배엽 세포에 대한 면역조직화학 염색에서 양성 반응을 나타내었으며, 트로포닌 I 항체(패널 E)를 이용한 중배엽 세 포에 대한 면역조직화학 염색에서 양성 반응을 나타내었다.5 shows porcine neutrophil stem cells (PMSCs) differentiated in vitro. Panel (A): Embryonic analog. Spontaneous differentiation of PMSCs resulted in positive immunohistochemical staining of ectoderm cells with neurofilament (Panel B) and β III tubulin (Panel C) antibodies, and endothelial cells with α-fetoprotein antibodies. In immunohistochemical staining, the cells were positive for immunohistochemical staining for mesoderm cells using troponin I antibody (Panel E).

도 6은 유전자 발현 프로파일을 조사한 RT-PCR 결과이다. 줄기세포 마커인 Oct-4, Tert 및 Nanog, 외배엽 마커인 Nestin 및 GFAP, 중배엽 마커인 트로포닌 I 및 패스트 골결근 트로포닌 T3, 내배엽 마커인 α1-안티트립신 및 α-페토단백질의 mRNA 발현 양상을 조사하였다. 중신(MT), 분화전 PMSCs(Undi), 분화 5일(Di5) 및 분화 25일(Di25)에 대한 세포. 네가티브 대조군으로서 MEF와 WB를 이용하였다. “WB"는 cDNA 없는 PCR 결과이다. 하우스-키핑 유전자로서 β-액틴의 발현을 대조군으로 이용하였다.6 shows the results of RT-PCR investigating gene expression profiles. MRNA expression patterns of stem cell markers Oct-4, Tert and Nanog, ectoderm markers Nestin and GFAP, mesoderm markers troponin I and fast osteomycin troponin T3, endoderm markers α1-antitrypsin and α-fetoprotein Investigate. Cells for neutrophils (MT), pre-differentiation PMSCs (Undi), 5 days of differentiation (Di5) and 25 days of differentiation (Di25). MEF and WB were used as negative controls. "WB" is the result of PCR without cDNA Expression of β-actin as the house-keeping gene was used as a control.

도 7은 중신 줄기세포의 배양에 대한 피더세포의 종류와 수의 영향을 보여주는 사진이다. 패널 A-D는 각각 ICR 마우스 피더(2.5 x 105/ml), ICR 마우스 피더(1.5 x 105/ml), CF-1 마우스 피더(1.5 X 105/ml) 및 STO 피더(2.5 x 105/ml)를 사용하여 중신 줄기세포를 배양한 결과이다. Figure 7 is a photograph showing the effect of the type and number of feeder cells on the culture of neutrophil stem cells. Panel ADs are ICR mouse feeder (2.5 x 10 5 / ml), ICR mouse feeder (1.5 x 10 5 / ml), CF-1 mouse feeder (1.5 x 10 5 / ml) and STO feeder (2.5 x 10 5 / ml, respectively). ml) is the result of culturing neutrophil stem cells.

본 발명은 중신 줄기세포주(mesonephric stem cell line)를 제조하는 방법 및 중신 세포-유래 줄기세포주에 관한 것이다. The present invention relates to a method for producing a mesophilic stem cell line and a mesothelial cell-derived stem cell line.

돼지는 면역학적으로 그리고 생리학적으로 다른 동물 종들 보다 인간과 유사하다[1]. 돼지 줄기세포주의 구축은, 형질전환 돼지의 생산뿐만 아니라 발달 유전자 조절의 연구 및 생의학 연구에 유용하다[2, 3, 4]. 이는 줄기세포 생물학의 발전을 기여하며, 인간 임상 연구에 기여한다[5]. 설치류 및 인간의 다양한 조직으로부터 줄기세포를 분리하고 특성을 연구하는 데에는 많은 성공적인 사례가 있음에도 불구하고, 비설치류 동물의 줄기세포에 대한 연구는 거의 없는 실정이다[6]. 돼지에 있어서, 줄기세포는 배반포의 내세포괴로부터 유래된 배아줄기(ES) 세포[4, 7, 8], 원시생식기의 원시생식세포로부터 유래된 배아생식(EG) 세포[9,10,11], 태아 피부[6] 및 성체 피부[12]로부터 유래된 피부 줄기세포 및 간엽줄기세포로서의 성체 줄기세포[13]가 알려져 있다.Pigs are immunologically and physiologically more like humans than other animal species [1]. Construction of porcine stem cell lines is useful for the study of developmental gene regulation and biomedical research, as well as for the production of transgenic pigs [2, 3, 4]. This contributes to the development of stem cell biology and to human clinical research [5]. Although there have been many successful cases of isolating and characterizing stem cells from rodents and various tissues of humans, few studies have been conducted on stem cells of non-rodent animals [6]. In pigs, stem cells are embryonic stem (ES) cells [4, 7, 8] derived from the blastocyst's inner cell mass, and embryonic germ (EG) cells [9,10,11] derived from primordial germ cells of primordial genitalia. Skin stem cells derived from fetal skin [6] and adult skin [12] and adult stem cells as mesenchymal stem cells [13] are known.

중신(mesonephros)은 중간(intermediate) 중배엽으로부터 유래되는 일시적인 신장 기관으로서, 척추동물의 배아에서 배발생 동안에만 기능을 나타낸다[14]. 원시생식기 내의 원시생식세포(PGCs)로부터 유래되는 배아생식세포(EGCs)[9, 10, 11, 15, 16], 대동맥-원시생식기-중신(AGM) 부위에서의 조혈줄기세포(HSCs)[17, 18]는 줄기세포의 소스로서 인식된다. 따라서, 중신은 다양한 줄기세포의 소스로서의 영역으로 판단될 수 있다. 내부세포괴 및 원시생식세포는 전능성 줄기세포(pluripotent stem cells)의 소스이며, 상기 세포는 미분화 표현형의 공통적인 마커인 알칼린 포스파타아제(AP) 활성에 대하여 염색되며[9, 20], 돼지의 ES 세포 및 EG 세포로서의 전능성 줄기세포는 피더세포 상에서 미분화된 상태로 유지된다[7-12].Messenphros are temporary renal organs derived from intermediate mesoderm, which function only during embryonic development in vertebrates [14]. Embryonic Germ Cells (EGCs) [9, 10, 11, 15, 16] derived from primitive germ cells (PGCs) in the primitive genitalia, hematopoietic stem cells (HSCs) at the aortic-primary genital-critical (AGM) site [17 , 18 is recognized as a source of stem cells. Thus, the central body can be judged as a region as a source of various stem cells. Internal cell mass and primordial germ cells are sources of pluripotent stem cells, which are stained for alkaline phosphatase (AP) activity, a common marker of the undifferentiated phenotype [9, 20]. Almighty stem cells as ES cells and EG cells remain undifferentiated on feeder cells [7-12].

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.

본 발명자들은 새로운 줄기세포 소스(source)를 개발하기 위하여 예의 연구 노력한 결과, 중신 세포로부터 줄기세포를 구축할 수 있음을 확인함으로써, 본 발명을 완성하게 되었다.The present inventors have completed the present invention by confirming that stem cells can be constructed from mesothelial cells as a result of diligent research efforts to develop a new stem cell source.

따라서, 본 발명의 목적은 중신 줄기세포주(mesonephric stem cell line)의 제조방법을 제공하는 데 있다.Accordingly, it is an object of the present invention to provide a method for producing a messinphric stem cell line.

본 발명의 다른 목적은 중신 세포-유래 중신 줄기세포주를 제공하는 데 있다.Another object of the present invention is to provide a neutrophil cell-derived neutrophil stem cell line.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 다음의 단계를 포함하는 중신 줄기 세포주(mesonephric stem cell line)의 제조방법을 제공한다: (a) 포유동물의 중신으로부터 중신 세포를 수득하는 단계; (b) 상기 중신 세포를 피더 세포층 상에서 배양하여 콜로니를 형성시키는 단계; 및 (c) 상기 콜로니를 계대 배양하여 중신 줄기세포주를 수득하는 단계. According to one aspect of the present invention, the present invention provides a method for preparing a mesophilic stem cell line, comprising the steps of: (a) obtaining a mesothelial cell from a mammal's corpse; (b) culturing the mesophilic cells on the feeder cell layer to form colonies; And (c) passaging the colonies to obtain a neutrophil stem cell line.

본 발명의 방법을 각 단계에 따라 구체적으로 설명하면 다음과 같다:The method of the present invention is described in detail by each step as follows:

(a) 중신 세포의 준비 (a) Preparation of neutrophil cells

본 발명의 가장 큰 특징 중 하나는 줄기세포(전능성 줄기세포 또는 다능성 줄기세포, 바람직하게는 전능성 줄기세포)의 소스로서 중신(mesonephros)를 이용한는 것이다. 본 발명자들이 아는 범위에서, 중신 유래 세포를 이용하여 줄기세포를 구축하였던 종래 기술은 없다.One of the greatest features of the present invention is the use of messenphros as a source of stem cells (pluripotent stem cells or pluripotent stem cells, preferably pluripotent stem cells). To the best of the inventors' knowledge, there is no prior art in which stem cells are constructed using cells derived from neutrophils.

본 명세서에서 출발세포인 중신 세포는 중신의 조직으로부터 얻을 수 있다. 중신은 중간 중배엽으로부터 유래되는 일시적인 신장 기관으로서, 척추동물의 배아에서 배발생 동안에만 기능을 나타낸다[14].The neutrophil cells, which are starting cells in the present specification, can be obtained from tissues of the lean body. Critical bodies are transient renal organs derived from intermediate mesoderm and function only during embryonic development in vertebrate embryos [14].

본 명세서에서 용어 “중신 줄기세포주”는 중신 세포로부터 유래된 줄기세포로서, 실질적인 변화(예컨대, 유전적, 생리학적 변화 등) 없이 장시간 배양(예컨대, 1년 이상)이 가능한 줄기세포로서 안정성을 나타내는 줄기세포를 의미한다. 따라서, 용어 “중신 줄기세포주”는 용어 “중신 줄기세포”와는 다른 의미를 갖는다. 용어 “중신 세포로부터 유래된”은 중신 세포를 출발세포로 하여 이를 인 비트로 배양하여 줄기세포주를 구축한다는 의미를 갖는다. As used herein, the term “central stem cell line” refers to a stem cell derived from a central body cell, and shows stability as a stem cell capable of long-term culture (eg, over 1 year) without substantial changes (eg, genetic or physiological changes). Means stem cells. Thus, the term "central stem cell line" has a different meaning from the term "central stem cell". The term "derived from zhongxin cells" has the meaning that by the zhongxin cell culture of cells with a starting cell line for this bit construction.

중신 세포를 수득하는 방법을 요약하면 다음과 같다: 배아(또는 태아)를 얻은 다음, 이로부터 중신을 분리한다. 이어, 중신 조직을 그라인딩 하여 중신 세포를 수득한다.The method of obtaining neutrophil cells is summarized as follows: The embryo (or fetus) is obtained, and then the neutrophils are separated therefrom. The mesothelial tissue is then ground to yield mesophilic cells.

중신 세포는 다양한 포유동물의 중신으로부터 얻을 수 있으며, 바람직하게는 인간, 돼지, 소, 양, 말, 토끼, 염소, 마우스, 햄스터 및 래트로부터 얻을 수 있으며, 가장 바람직하게는 돼지로부터 얻을 수 있다.CNS cells can be obtained from the corpses of various mammals, preferably from humans, pigs, cows, sheep, horses, rabbits, goats, mice, hamsters and rats, and most preferably from pigs.

(b) 중신 세포의 배양 (b) Cultivation of mesophilic cells

상기 과정에서 수득한 중신 세포를 적합한 배지에서 배양하여 줄기세포를 포함하는 콜로니를 형성시킨다.The neutrophil cells obtained in the above process are cultured in a suitable medium to form colonies including stem cells.

콜로니를 형성시키기 위하여 중신 세포를 배양하는 경우에는, 포유동물 줄기세포를 수득하기 위하여 사용되는 통상적인 어떠한 배지도 사용할 수 있다.In the case of culturing neutrophil cells to form colonies, any conventional medium used to obtain mammalian stem cells can be used.

예를 들어, Eagles's MEM (Eagle's minimum essential medium, Eagle, H. Science 130:432(1959)), α-MEM (Stanner, C.P. et al., Nat. New Biol . 230:52(1971)), Iscove's MEM (Iscove, N. et al., J. Exp. Med. 147:923(1978)), 199 배지 (Morgan et al., Proc . Soc . Exp . Bio. Med ., 73:1(1950)), CMRL 1066, RPMI 1640 (Moore et al., J. Amer . Med . Assoc . 199:519(1967)), F12 (Ham, Proc . Natl . Acad . Sci . USA 53:288(1965)), F10 (Ham, R.G. Exp . Cell Res. 29:515(1963)), DMEM (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8:396(1959)), DMEM과 F12의 혼합물 (Barnes, D. et al., Anal. Biochem . 102:255(1980)), Way-mouth's MB752/1 (Waymouth, C. J. Natl . Cancer Inst . 22:1003(1959)), McCoy's 5A (McCoy, T.A., et al., Proc . Soc . Exp . Biol . Med . 100:115(1959)), MCDB 시리즈 (Ham, R.G. et al., In Vitro 14:11(1978)) 및 Ham's F10 등이 이용될 수 있다. 가장 바람직하게는, DMEM 및 Ham's F10의 혼합물이다. 배지에 대한 설명은, R. Ian Freshney, Culture of Animal Cells, A Manual of Basic Technique, Alan R. Liss, Inc., New York, WO 97/47734 and WO 98/30679에 상세하게 기재되어 있으며, 이 문헌은 본 명세서에 참조로서 삽입된다.See, eg, Eagles' MEM (Eagle's minimum essential medium, Eagle, H. Science 130: 432 (1959)), α-MEM (Stanner, CP et al., Nat. New Biol . 230: 52 (1971)), Iscove's MEM (Iscove, N. et al., J. Exp. Med. 147: 923 (1978)), 199 medium (Morgan et al., Proc . Soc . Exp . Bio. Med . , 73: 1 (1950)) , CMRL 1066, RPMI 1640 (Moore et al., J. Amer . Med . Assoc . 199: 519 (1967)), F12 (Ham, Proc . Natl . Acad . Sci . USA 53: 288 (1965)), F10 (Ham, RG Exp . Cell Res. 29: 515 (1963)), DMEM (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8: 396 (1959)), mixtures of DMEM and F12 (Barnes, D. et al., Anal. Biochem . 102: 255 (1980)), Way-mouth's MB752 / 1 (Waymouth, C. J. Natl . Cancer Inst . 22: 1003 (1959)), McCoy's 5A (McCoy, TA , et al., Proc . Soc . Exp . Biol . Med . 100: 115 (1959)), MCDB series (Ham, RG et al., In Vitro 14:11 (1978)), Ham's F10 and the like. have. Most preferably, it is a mixture of DMEM and Ham's F10. A description of the medium is described in detail in R. Ian Freshney, Culture of Animal Cells, A Manual of Basic Technique , Alan R. Liss, Inc., New York, WO 97/47734 and WO 98/30679. Literature is incorporated herein by reference.

이 단계에서 사용되는 배지에는 적합한 성장인자 및 혈청이 포함된다. 예를 들어, 줄기세포 인자(SCF), 염기성 섬유아세포 성장인자(bFGF) 및 우태아혈청이 배지에 포함된다. 또한, 이 단계에서 사용되는 배지에는 적합한 분화억제인자, 예컨대, 류케미아 억제인자(LIF)가 포함된다.The medium used in this step includes suitable growth factors and serum. For example, stem cell factor (SCF), basic fibroblast growth factor (bFGF) and fetal calf serum are included in the medium. In addition, the medium used in this step includes suitable differentiation inhibitors, such as leucemia inhibitors (LIFs).

이외에도, 이 단계에서 사용되는 배지에는 L-글루타민, β-머캅토에탄올, 비필수 아미노산 및 항생제-항진균제가 포함될 수 있다.In addition, the medium used in this step may include L-glutamine, β-mercaptoethanol, non-essential amino acids and antibiotic-antifungal agents.

본 발명의 가장 바람직한 구현 예에 따르면, 이 단계에서 사용되는 배지는, 줄기세포 인자, 염기성 섬유아세포 성장인자, 우태아혈청, 류케미아 억제인자, L-글루타민, β-머캅토에탄올, 비필수 아미노산 및 항생제-항진균제가 보충된 DMEM 및 Ham's F10의 혼합물이다.According to the most preferred embodiment of the present invention, the medium used in this step is a stem cell factor, basic fibroblast growth factor, fetal bovine serum, rheumemia inhibitory factor, L-glutamine, β-mercaptoethanol, non-essential amino acids And a mixture of DMEM and Ham's F10 supplemented with antibiotic-antifungal agents.

이 과정에서 중신 세포는 피더세포층 상에서 배양된다. 본 발명의 방법에 적합한 피더층은 다양한 동물로부터 유래된 섬유아세포 및 상피세포를 포함하며, 예를 들어, 마우스 배아 섬유아세포(MEF), 인간 섬유아세포-유사 세포, 닭 섬유아 세포, 자궁상피세포, STO 및 SI-m220 피더 세포주, 그리고 BRL 세포를 포함한다. 바람직하게는, 이 단계에서 사용되는 피더세포층은 배아 섬유아세포이며, 보다 바람직하게는 마우스 섬유아세포이며, 가장 바람직하게는 ICR 마우스로부터 유래된 배아 섬유아세포이다. ICR 마우스 유래 배아 섬유아세포는, 줄기세포의 배양에서 통상적으로 이용되는 다른 피더 세포, 예컨대 CF-1 마우스 유래 배아 섬유아세포 및 STO보다 중신 줄기세포의 배양에 매우 적합하다. 한편, 적합한 피더세포의 수는 제한되지 않지만, ICR 마우스 유래 배아 섬유아세포를 이용하는 경우, 바람직하게는 1.8-2.8 x 105 세포/ml(배지의 부피), 보다 바람직하게는 2.0-2.8 x 105 세포/ml, 가장 바람직하게는 2.3-2.5 x 105 세포/ml이다.In this process, neutrophil cells are cultured on the feeder cell layer. Feeder layers suitable for the methods of the present invention include fibroblasts and epithelial cells derived from various animals, for example, mouse embryonic fibroblasts (MEF), human fibroblast-like cells, chicken fibroblasts, uterine epithelial cells , STO and SI-m220 feeder cell lines, and BRL cells. Preferably, the feeder cell layer used in this step is embryonic fibroblasts, more preferably mouse fibroblasts, most preferably embryonic fibroblasts derived from ICR mice. ICR mouse-derived embryonic fibroblasts are more suitable for culturing neutrophil stem cells than other feeder cells commonly used in the culture of stem cells, such as CF-1 mouse-derived embryonic fibroblasts and STO. On the other hand, the number of suitable feeder cells is not limited, but when using ICR mouse-derived embryonic fibroblasts, preferably 1.8-2.8 × 10 5 cells / ml (volume of medium), more preferably 2.0-2.8 × 10 5 Cells / ml, most preferably 2.3-2.5 × 10 5 cells / ml.

본 발명의 바람직한 구현 예에 따르면, 피더 세포는 유사분열 활성이 없는(mitotically inactive) 세포이다. 이러한 유사분열 비활성 세포는 마이토마이신 C와 같은 항-유사분열제를 세포에 처리하여 얻을 수 있다. 유사분열 비활성 피더 세포를 사용함으로써, 그에 의해 지지되는 세포보다 우세하여 성장하는 것을 막을 수 있다.According to a preferred embodiment of the invention, the feeder cell is a mitotically inactive cell. Such mitotic inactive cells can be obtained by treating the cells with an anti-mitotic agent such as mitomycin C. By using mitotic inactive feeder cells, it is possible to prevent them from growing predominantly over the cells supported by them.

이러한 배양 과정을 적합한 기간 동안 실시하면 중신 세포로부터 콜로니가 형성되며, 이 콜로니는 배아줄기세포의 형태를 갖는다. 배양 기간은 특별하게 제한되지 않으며, 가장 바람직하게는 6-8일이다.When this culture process is carried out for a suitable period, colonies are formed from neutrophil cells, which take the form of embryonic stem cells. The incubation period is not particularly limited, most preferably 6-8 days.

(c) 중신 줄기세포주의 구축 (c) Construction of mesothelial stem cell lines

상기 과정에서 수득한 콜로니를 계대배양(subculturing)하여 중신 줄기세포주를 구축한다.Subculture the colonies obtained in the above process (subculturing) to build a neutrophil stem cell line.

이 단계에서 콜로니의 계대 배양은 상술한 (b) 단계에서의 배양 방법이 적용된다. 예를 들어, 사용되는 배지 및 피더 세포층은 상술한 (b) 단계에서 기재된 것들이 적용된다. 계대 배양은 바람직하게는 6-8일 마다 새로운 배지를 이용하여 실시된다.Subculture of colonies in this step is applied to the culture method in step (b) described above. For example, the media and feeder cell layers used are those described in step (b) above. Passage culture is preferably carried out using fresh medium every 6-8 days.

계대 배양에 의해 줄기세포(전능성 줄기세포 또는 다능성 줄기세포) 특성을 안정되게 나타내는 중신 줄기세포주를 수득한다.By subculture, a mesothelial stem cell line stably displaying stem cell (pluripotent stem cell or pluripotent stem cell) characteristics is obtained.

줄기세포주의 구축은 다양한 방법을 통하여 확인할 수 있다. 예를 들어, 줄기세포 마커인, 알칼린 포스파타아제(AP), Oct-4, SSEA(stage-specific embryonic antigen)-1, SSEA-4, Tral-60, Tral-81, Tert 및/또는 Nanog의 발현 여부를 확인하여 줄기세포주의 구축을 확인할 수 있다.The construction of stem cell lines can be confirmed by various methods. For example, stem cell markers, alkaline phosphatase (AP), Oct-4, stage-specific embryonic antigen (SSEA) -1, SSEA-4, Tral-60, Tral-81, Tert and / or Nanog By confirming the expression of the stem cell line can be confirmed.

또한, 줄기세포주의 구축은, LIF의 부재 하에서 자연적(spontaneous) 분화를 유도하여 배아유사체(embryonic body: EB)를 형성하는 지 여부를 확인하여 할 수 있다.In addition, the construction of the stem cell line can be confirmed by inducing spontaneous differentiation in the absence of LIF to form an embryonic analog (EB).

본 발명의 바람직한 구현 예에 따르면, 본 발명의 최종 단계에서 얻는 중신 줄기세포주는 알칼린 포스파타아제, Oct-4, SSEA(stage-specific embryonic antigen)-1, SSEA-4, Tral-60 또는 Tral-81에 대한 염색반응에서 양성 반응을 나타낸다. 바람직하게는, 상기 중신 줄기세포주는 Tert 및 Nanog를 발현한다.According to a preferred embodiment of the present invention, the mesenchymal stem cell line obtained in the final step of the present invention is alkaline phosphatase, Oct-4, stage-specific embryonic antigen (SSEA) -1, SSEA-4, Tral-60 or Tral Positive staining for -81. Preferably, the mesenchymal stem cell line expresses Tert and Nanog.

본 발명의 바람직한 구현 예에 따르면, 본 발명의 최종 단계에서 얻는 중신 줄기세포주는 EB를 형성하는 능력을 갖는다.According to a preferred embodiment of the present invention, the neutrophil stem cell line obtained in the final step of the present invention has the ability to form EB.

본 발명의 바람직한 구현 예에 따르면, 상기 중신 줄기세포주는 Vasa 유전자를 발현하지 않으며, 이는 본 발명에 의해 구축된 중신 줄기세포주가 원시생식세포로부터 유래된 줄기세포와는 다른 리니지(lineage)를 갖는다는 것을 나타낸다.According to a preferred embodiment of the present invention, the mesenchymal stem cell line does not express the Vasa gene, which means that the mesenchymal stem cell line constructed by the present invention has a lineage different from that of stem cells derived from primordial germ cells. Indicates.

본 발명의 다른 양태에 따르면, 본 발명은 포유동물의 중신 세포-유래 중신 줄기세포주로서, 상기 중신 줄기세포주는 알칼린 포스파타아제에 대한 양성 반응을 나타내며, 배아유사체로 자연분화할 수 있는 능력을 가지는 것을 특징으로 하는 중신 세포-유래 중신 줄기세포주를 제공한다.According to another aspect of the present invention, the present invention provides a mammalian mesothelial cell-derived mesothelial stem cell line, which has a positive response to alkaline phosphatase and has the ability to spontaneously differentiate into an embryonic analog. It provides a neutrophil cell-derived neutrophil stem cell line characterized in that it has.

중신 줄기세포주는 본 발명자들에 의해 최초로 개발 및 제안된 것이다. 본 발명의 중신 줄기세포주에 의해, 줄기세포에 대한 또 하나의 소스(source)가 제공되는 것이다.The neutrophil stem cell line was first developed and proposed by the present inventors. By the neuter stem cell line of the present invention, another source for stem cells is provided.

본 발명의 중신 줄기세포주는 전능성(pluripotent) 특성을 나타낸다. 용어 “전능성”은 3종의 배엽(내배엽, 중배엽 및 외배엽)의 세포로 발달할 수 있는 능력을 의미한다. SCF, bFGF, LIF 및 피더세포층의 부재 하에서, 본 발명의 중신 줄기세포주를 배양하면 3종의 배엽에 대한 마커에 대하여 양성반응을 나타내는 배아유사체를 형성한다: α-페토 단백질(내배엽), 심장 트로포닌 1(중배엽) 및 βⅢ-튜블린과 신경필라멘트(외배엽).The neutrophil stem cell line of the present invention exhibits pluripotent characteristics. The term “pluripotent” refers to the ability to develop into cells of three germ layers (endoderm, mesoderm and ectoderm). In the absence of SCF, bFGF, LIF and feeder cell layers, culturing neutrophil stem cell lines of the present invention forms embryonic analogs that test positive for markers of three germ layers: α-feto protein (endoderm), heart tropo Nin 1 (mesoderm) and βIII-tubulin and neurofilament (ectoderm).

본 발명의 줄기세포주를 만들기 위한 중신 세포는 다양한 포유동물의 중신으로부터 얻을 수 있으며, 바람직하게는 돼지, 소, 양, 말, 토끼, 염소, 마우스, 햄 스터 및 래트로부터 얻을 수 있으며, 가장 바람직하게는 돼지로부터 얻을 수 있다. The mesothelial cells for making stem cell lines of the present invention can be obtained from a variety of mammals, preferably from pigs, cattle, sheep, horses, rabbits, goats, mice, hamsters and rats, and most preferably Can be obtained from pigs.

본 발명의 바람직한 구현예에 따르면, 본 발명의 중신 줄기세포주는 Oct-4, SSEA(stage-specific embryonic antigen)-1, SSEA-4, Tral-60 또는 Tral-81에 대한 염색반응에서 양성 반응을 나타낸다. 또한, 본 발명의 바람직한 구현 예에 따르면, 본 발명의 중신 줄기세포주는 Tert 및 Nanog를 발현한다.According to a preferred embodiment of the present invention, the mesenchymal stem cell line of the present invention is positive in staining for Oct-4, stage-specific embryonic antigen (SSEA) -1, SSEA-4, Tral-60 or Tral-81 Indicates. In addition, according to a preferred embodiment of the present invention, neutrophil stem cell lines of the present invention express Tert and Nanog.

본 발명의 바람직한 구현 예에 따르면, 본 발명의 중신 줄기세포주는 EB를 형성하는 능력을 갖는다. According to a preferred embodiment of the present invention, the mesenchymal stem cell line of the present invention has the ability to form EB.

본 발명의 바람직한 구현 예에 따르면, 중신 줄기세포주는 Vasa 유전자를 발현하지 않으며, 이는 본 발명의 중신 줄기세포주가 원시생식세포로부터 유래된 줄기세포와는 다른 리니지(lineage)를 갖는다는 것을 나타낸다.According to a preferred embodiment of the present invention, the neutrophil stem cell line does not express the Vasa gene, indicating that the neutrophil stem cell line of the present invention has a lineage different from that of stem cells derived from primordial germ cells.

본 발명의 바람직한 구현 예에 따르면, 중신 줄기세포주는 상술한 본 발명의 방법에 의해 제조된 것이다.According to a preferred embodiment of the present invention, the neutrophil stem cell line is prepared by the method of the present invention described above.

본 발명의 중신 줄기세포주는 다양한 세포로 분화될 수 있다. 따라서, 본 발명의 중신 줄기세포주는 다양한 종류의 세포를 제공하는 우수한 소스(source)가 될 수 있다. 예를 들어, 본 발명의 중신 줄기세포주는 적합한 환경(조건 또는 자극)에 의해, 조혈모세포, 신경세포, 베타세포, 근세포, 간세포, 연골세포, 상피세포, 요로관세포 등으로 분화될 수 있다. 줄기세포의 분화에 적합한 배지 및 방법은 당업계에 잘 알려져 있다(Palacios, et al., PNAS. USA, 92:7530-7537(1995); Pedersen, J. Reprod. Fertil. Dev., 6:543-552(1994); and Bain et al., Dev. Biol, 168:342-357(1995)).The neutrophil stem cell line of the present invention can be differentiated into various cells. Therefore, the neutrophil stem cell line of the present invention can be an excellent source for providing various kinds of cells. For example, neutrophil stem cell lines of the present invention can be differentiated into hematopoietic stem cells, neurons, beta cells, myocytes, hepatocytes, chondrocytes, epithelial cells, urinary tract cells, and the like, under suitable circumstances (conditions or stimuli). Suitable media and methods for differentiating stem cells are well known in the art (Palacios, et al., PNAS. USA, 92: 7530-7537 (1995); Pedersen, J. Reprod. Fertil. Dev., 6: 543 -552 (1994); and Bain et al., Dev. Biol, 168: 342-357 (1995)).

본 발명의 중신 줄기세포주는 이식 치료(transplantation therapy)를 통해 많은 치료학적 용도를 갖는다. 예를 들어, 본 발명의 중신 줄기세포주는 당뇨병, 파킨슨병, 알쯔하이머병, 척수 손상, 다발성 경화증, 근위축성 측삭 경화증, 근육 이영양증, 간 질환, 콜레스테롤 과잉혈증, 심장 질환, 족부궤양, 위장관 질환, 혈관 질환, 신장 질환, 요도관 질환 및 노화 등을 치료하는 데 이용될 수 있다.The neutrophil stem cell line of the present invention has many therapeutic uses through transplantation therapy. For example, the neutrophil stem cell line of the present invention is diabetes, Parkinson's disease, Alzheimer's disease, spinal cord injury, multiple sclerosis, muscular dystrophy, muscular dystrophy, liver disease, hypercholesterolemia, heart disease, foot ulcers, gastrointestinal disease, blood vessels It can be used to treat diseases, kidney disease, urinary tract disease, aging and the like.

또한, 본 발명의 중신 줄기세포주는, 이종간장기이식(xenotransplantation)에 이용되는 형질전환 동물의 개발에 이용될 수 있다.In addition, the neutrophil stem cell line of the present invention can be used for the development of a transgenic animal used for xenotransplantation.

본 발명의 중신 줄기세포주의 기술적 달성(accomplishment) 및 이점(advantages)을 요약하면 다음과 같다:Summarizing the technical achievements and advantages of the mesenchymal stem cell line of the present invention are as follows:

(a) 중신 줄기세포주는 본 발명자들에 의해 최초로 구축된 것이다.(a) The neutrophil stem cell line was first constructed by the present inventors.

(b) 본 발명의 중신 줄기세포주는 내세포괴와 원시생식세포 이외의 새로운 줄기세포 소스를 제시한다.(b) The neutrophil stem cell line of the present invention presents a novel stem cell source other than inner cell mass and primordial germ cells.

(c) 본 발명의 중신 줄기세포주는 다양한 세포로 분화될 수 있으며, 세포이식 치료를 통하여 다양한 질병 또는 질환을 치료할 수 있다.(c) neutrophil stem cell line of the present invention can be differentiated into a variety of cells, and can treat a variety of diseases or disorders through cell transplantation treatment.

(d) 본 발명의 중신 줄기세포주는 이종간장기이식(xenotransplantation)에 이용되는 형질전환 동물의 개발에 이용될 수 있다(d) CNS stem cell lines of the present invention can be used for the development of transgenic animals used for xenotransplantation

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

실시예Example

실험재료 및 실험방법Experimental Materials and Methods

돼지 중신 세포(Porcine Porcine neutrophil cells (Porcine MesonephricMesonephric cells)의 분리 isolation of cells)

임신 26-30일째(발정 = 1일)에 자궁적출술을 이용하여 교잡종 어린 암퇘지의 돼지 태아를 수집하였다. 1% 항생제-항진균제(Gibco BRL) 및 0.4% BSA가 보충된 PBS(Antibio-PBS/BSA)에서 태아를 세척하였다. 외측 중신 표면을 따라 길게 도출된 기관(longitudinal protrusions)으로 검출되는 중신을 분리하고 Antibio-PBS/BSA에서 세척하였다. 플랫 실린지 바닥을 이용하여 중신 조직을 아래쪽으로 압착하고 갈아 돼지 중신 세포를 분리한 다음 2000 rpm에서 5분 동안 원심분리 하였다.Porcine fetuses of hybrid sows were collected using hysterectomy on day 26-30 of gestation (estrous = 1 day). Fetuses were washed in PBS (Antibio-PBS / BSA) supplemented with 1% antibiotic-antifungal (Gibco BRL) and 0.4% BSA. Detected neutrophils with longitudinal protrusions along the outer meridian surface were washed in Antibio-PBS / BSA. Using a flat syringe bottom, the mesenchymal tissue was pressed down and ground to separate pig mesothelial cells, and then centrifuged at 2000 rpm for 5 minutes.

PMSCsPMSCs (Porcine (Porcine MesonephricMesonephric stem cells)의 배양 culture of stem cells

사이토카인, 용해성 40 ng/ml 재조합 인간 줄기세포 인자(SCF; R&D systems), 20 ng/ml 재조합 인간 염기성 섬유아세포 성장인자(bFGF; R&D systems)와 10 ng/ml 인간 류케미아 억제인자(LIF; Chemicon)를 포함하며, 15% 우태아혈청(FBS, Hyclone), 2 mM L-글루타민(Gibco BRL), 0.1 mM β-머캅토에탄올(Gibco BRL), 1% MEM 비필수 아미노산(Gibco BRL) 및 1% 항생제-항진균제(Gibco BRL)가 보 충된 DMEM(low glucose, Gibco BRL) 및 함스 F10(Gibco BRL) 배지의 50:50 혼합물로 이루어진 PES 배지에서 돼지 PMSCs를 배양하였다[10]. 상기 과정에서 분리된 돼지 중신 세포를 마이토마이신-C(Roche) 처리된 ICR 마우스 배아 섬유아세포(MEF) 피더 세포(2.5 x 105 세포) 상에 플레이팅 하고, 37℃에서 5% CO2의 습윤 환경에서 배양하였다. 배지를 매일 교환하였다. 0.25% 트립신/EDTA(Gibco BRL)를 배양물에 5분 동안 처리하여, 배양 6-8일 후의 ES-유사 형태를 가지는 PMSCs-유래 콜로니를 분리하고, 새로운 피더 세포층에 옮겼다.Cytokines, soluble 40 ng / ml recombinant human stem cell factor (SCF; R & D systems), 20 ng / ml recombinant human basic fibroblast growth factor (bFGF; R & D systems) and 10 ng / ml human leucemia inhibitor (LIF; Chemicon), 15% fetal bovine serum (FBS, Hyclone), 2 mM L-glutamine (Gibco BRL), 0.1 mM β-mercaptoethanol (Gibco BRL), 1% MEM non-essential amino acid (Gibco BRL) and Porcine PMSCs were cultured in PES medium consisting of a 50:50 mixture of DMEM (low glucose, Gibco BRL) and Hams F10 (Gibco BRL) medium supplemented with 1% antibiotic-antifungal (Gibco BRL) [10]. Porcine neutrophil cells isolated in the above process were plated on mitomycin-C (Roche) treated ICR mouse embryonic fibroblast (MEF) feeder cells (2.5 × 10 5 cells), and 5% CO 2 at 37 ° C. Incubated in a wet environment. The medium was changed daily. 0.25% Trypsin / EDTA (Gibco BRL) was incubated for 5 minutes in culture to isolate PMSCs-derived colonies with ES-like morphology after 6-8 days of culture and transferred to a new feeder cell layer.

PMSCPMSC 의 기타Other

상기 과정에서 구축된 PMSCs 중에서, 하나의 세포주를 “PMSC050901m(pMS-SNU1)"이라 명명하고 국제기탁기관인, 한국세포주연구재단에 2006년 10월 30일에 기탁하고 기탁번호 KCLRF -BP-00147을 부여받았다.Among the PMSCs constructed in the above process, one cell line was named “PMSC050901m (pMS-SNU1)” and was deposited on October 30, 2006 to the Korea Cell Line Research Foundation, an international depository organization, and assigned accession number KCLRF -BP-00147 . received.

PMSCsPMSCs 의 분화Eruption

컨플루언시 상태로 성장된 PMSCs을 트립신 처리하고, 세포를 "행잉 드랍(hanging drops)(30 ㎕/드랍, 2 x 106 세포/ml)" 방식으로 5일 동안 배양하여 배아유사체(embryoid bodies: EBs)를 형성시켰다. 사이토카인이 없는 15% 우태아혈청(FBS, Hyclone), 2 mM L-글루타민(Gibco BRL) 및 1% 항생제-항진균제가 보충된 DMEM(low glucose, Gibco BRL)에서 EBs를 배양하였다. 5일 후, EBs를 페트리 디 쉬에 옮기고 5일 동안 배양하였다. 그 후, EBs를 0.25% 트립신-EDTA로 해리시키고, 12-웰 플레이트에 다시 플레이팅 하였다. 배지를 2일에 한번씩 교체하였다.Trypsinized PMSCs grown in confluency and cells were cultured for 5 days in "hanging drops (30 μl / drop, 2 × 10 6 cells / ml)” embryonic bodies. : EBs) were formed. EBs were cultured in DMEM (low glucose, Gibco BRL) supplemented with 15% fetal calf serum (FBS, Hyclone), 2 mM L-glutamine (Gibco BRL) and 1% antibiotic-antifungal without cytokine. After 5 days, EBs were transferred to Petri dishes and incubated for 5 days. The EBs were then dissociated with 0.25% trypsin-EDTA and plated back in 12-well plates. The medium was changed every two days.

PMSCsPMSCs 의 특성 연구Characteristic study of

PMSCs를 계대 후 6-7일 동안 배양하였다. 이어, 배양 플레이트를 PBS로 두 번 세척하고, PMSCs를 PBS 내의 4% 포름알데하이드로 실온에서 15분 동안 고정화 하였다.PMSCs were incubated for 6-7 days after passage. The culture plates were then washed twice with PBS and PMSCs were immobilized with 4% formaldehyde in PBS for 15 minutes at room temperature.

알칼린 포스파타아제(AP) 염색Alkaline phosphatase (AP) staining

PMSCs의 AP 활성을 모두 패시지에서 분석하였다. 세척한 다음, 고정된 세포를, 완충액(0.1 M Tris-HCl, pH 9.5 및 0.1 M NaCl)이 있는 NBT(nitro blue tetrazolium chloride)/BCIP(5-bromo-4-chloro-3-indolylphosphate, toluidine salt) 스톡 용액(Roche)을 이용하여 30분 동안 실온에서 염색 하였다.AP activity of PMSCs was analyzed in passage. After washing, the immobilized cells were nitro blue tetrazolium chloride (NBT) / BCIP (5-bromo-4-chloro-3-indolylphosphate, toluidine salt) with buffer (0.1 M Tris-HCl, pH 9.5 and 0.1 M NaCl). ) Was stained at room temperature for 30 minutes using a stock solution (Roche).

면역조직화학 또는 면역세포화학 염색Immunohistochemistry or Immunocytochemical Staining

염색을 위하여 파라핀 섹션 및 배양 세포를 준비하였다. 파라핀 섹션에서, 27일째의 생식융기(genital ridge) 및 중식의 조직을 PBS내 4% 파라포름알데하이드에서 고정하고, 파라핀에 임베딩 하였다. 각각의 섹션(5 ㎛)을 슬라이드에 놓고 면역조직화학 염색을 실시하였다. 섹션로부터 파라핀을 제거하고 수화시켰다. 고정된 세포 또는 조직 섹션을 BSA(1 mg/ml)/PBS로 두 번 세척하였다. 내인성 퍼 옥시다아제 활성을 없애기 위하여 0.3% 과산화수소로 15분 동안 처리하였다. 세포를 BSA/PBS에서 두 번 세척하였다. BSA/PBS with 10% 염소 혈청(Sigma)가 있는 BSA/PBS 블록킹 용액을 30분 동안 적용시켰다. 이어, SSEA1 (Chemicon MAB4301), SSEA4 (Chemicon MAB4304), Tra 1-60 (Chemicon MAB4360), Tra 1-81 (Chemicon MAB4381), Oct-3/4 (Santacruze sc-9081), 신경필라멘트(Chemicon MAB1615), βⅢ 튜불린(MAB1637), 심장 트로포닌 1(MAB3152) 및 α 페토단백질에 대한 일차항체와 세포를 반응시켰다. 일차항체를 2 ㎍/ml의 BSA/PBS (SSEA1, Tra 1-60 및 Tra 1-81) 또는 1 ㎍/ml의 BSA/PBS(SSEA4 및 Oct-4)에서 희석하여 사용하였다. 일차항체를 시료 적용한 다음 4℃에서 하룻밤 동안 보관하였다. 그 다음날, 시료를 BSA/PBS로 세 번 세척하였다. 이차항체를 시료에 적용한 다음 실온에서 1시간 동안 보관하였다. 모든 시료에 대하여, 이차항체로서 DakoCytomation LSAB 2 System-HRP code K0675(DakoCytomation)를 이용하였다. 시료를 BSA/PBS로 세 번 세척하였다. DAB(갈색, 3,3’-diminobenzidine, Vector Laboratories) 또는 AEC(적색, 3-amino-9-ethylcarbazole, Zymed Laboratories Inc.)에 의한 발색 반응 분석을 하였다.Paraffin sections and cultured cells were prepared for staining. In the paraffin section, the genital ridges and the tissues of the diet on day 27 were fixed in 4% paraformaldehyde in PBS and embedded in paraffin. Each section (5 μm) was placed on a slide and subjected to immunohistochemical staining. Paraffin was removed from the section and hydrated. Fixed cells or tissue sections were washed twice with BSA (1 mg / ml) / PBS. Treatment with 0.3% hydrogen peroxide for 15 minutes to eliminate endogenous peroxidase activity. Cells were washed twice in BSA / PBS. BSA / PBS blocking solution with BSA / PBS with 10% goat serum (Sigma) was applied for 30 minutes. Then, SSEA1 (Chemicon MAB4301), SSEA4 (Chemicon MAB4304), Tra 1-60 (Chemicon MAB4360), Tra 1-81 (Chemicon MAB4381), Oct-3 / 4 (Santacruze sc-9081), Neurofilament (Chemicon MAB1615) Cells were reacted with primary antibodies against βIII tubulin (MAB1637), cardiac troponin 1 (MAB3152), and α-fetoprotein. Primary antibodies were used diluted in 2 μg / ml BSA / PBS (SSEA1, Tra 1-60 and Tra 1-81) or 1 μg / ml BSA / PBS (SSEA4 and Oct-4). The primary antibody was sampled and then stored at 4 ° C. overnight. The next day, the samples were washed three times with BSA / PBS. Secondary antibodies were applied to the samples and then stored at room temperature for 1 hour. For all samples, DakoCytomation LSAB 2 System-HRP code K0675 (DakoCytomation) was used as the secondary antibody. Samples were washed three times with BSA / PBS. Color reaction was analyzed by DAB (brown, 3,3'-diminobenzidine, Vector Laboratories) or AEC (red, 3-amino-9-ethylcarbazole, Zymed Laboratories Inc.).

핵형 분석Karyotyping

커버 글래스가 있는 4-웰 플레이트 상의 PMSCs를 24시간 동안 배양하고 150 ㎕의 colcemid (KARYO MAXTM COLCEMIDTM Solution, Gibco)로 1시간 동안 37℃에서 5% CO2 습윤 환경에서 처리하였다. PBS로 세척한 다음, 세포를 0.75 M KCl을 포함하는 저장성 용액으로 처리하고 메탄올-아세트산으로 고정 및 염색체 염색을 실시하였다. Incubate PMSCs on 4-well plates with cover glass for 24 hours and 150 μl of colcemid (KARYO MAX ™ COLCEMID TM Solution, Gibco) was treated for 1 hour at 37 ℃ in 5% CO 2 wet environment. After washing with PBS, the cells were treated with a stock solution containing 0.75 M KCl and subjected to fixation and chromosome staining with methanol-acetic acid.

RT-RT- PCRPCR (reverse (reverse transcriptasetranscriptase -polymerase chain reaction) 분석-polymerase chain reaction analysis

총 RNA를 TRizolTM 시약(Invitrogen)을 이용하여 제조사의 프로토콜에 따라 세포로부터 분리하였다. M-MLV 역전사효소 키트(Invitrogen)를 이용하여, 20 ㎕ 반응 혼합물에 대하여 1 ㎍ RNA를 cDNAs로 전환하였다. 증폭된 유전자, 프라이머 및 어닐링 온도는 표 1에 정리되어 있다.TRizol TM total RNA Reagents (Invitrogen) were used to separate from cells according to the manufacturer's protocol. Using the M-MLV reverse transcriptase kit (Invitrogen), 1 μg RNA was converted to cDNAs for 20 μl reaction mixture. Amplified genes, primers and annealing temperatures are summarized in Table 1.

유전자gene 5‘ 프라이머5 ’primer 3‘ 프라이머3 ’primer 어닐링 온도 (℃)Annealing Temperature (℃) 증폭물 크기 (bp)Amplification size (bp) Oct-4Oct-4 AGGTGTTCAGCCAAACGACCAGGTGTTCAGCCAAACGACC TGATCGTTTGCCCTTCTGGCTGATCGTTTGCCCTTCTGGC 5555 316316 NanogNanog AATCTTCACCAATGCCTGAGAATCTTCACCAATGCCTGAG GGCTGTCCTGAATAAGCAGAGGCTGTCCTGAATAAGCAGA 5555 141141 TERTTERT TGTTTGCTGTGCTGAACTACTGTTTGCTGTGCTGAACTAC GTCCACCTTGACAAAGTACAGGTCCACCTTGACAAAGTACAG 5353 161161 네스틴Nestin GGCTTCTCTCAGCATCTTGGGGCTTCTCTCAGCATCTTGG AGGCTGGCATAGGTGTGTCAGGCTGGCATAGGTGTGTC 5555 150150 GFAPGFAP ACATCGAGATCGCCACCTACACATCGAGATCGCCACCTAC ACATCACATCCTTGTGCTCCACATCACATCCTTGTGCTCC 5555 219219 트로포닌 ITroponin I GTAGTGGATGAGGAGAGATATGACGTAGTGGATGAGGAGAGATATGAC ATGGACACCTTGTGTTTAGAGATGGACACCTTGTGTTTAGAG 4848 194194 패스트 골격근 트로포닌 T3Fast Skeletal Muscle Troponin T3 CAGACGGCCCGGGAAATGACAGACGGCCCGGGAAATGA TCGTATTTCTGGCGCTTCATCGTATTTCTGGCGCTTCA 4848 165165 α-1-암티트립신α-1-amtitrypsin CACCGTATTTGCTCTGGTGAACCACCGTATTTGCTCTGGTGAAC TCACAGTGGTGGAGGTCGAATCACAGTGGTGGAGGTCGAA 4848 161161 α-페토단백질α-fetoprotein GGAGCTGCGGCCTCTTCGGAGCTGCGGCCTCTTC GCTCCTGTGGTCGCCATTGCTCCTGTGGTCGCCATT 5353 700700 SRYSRY CGTGAAACTAGAGGAAGTGGCGTGAAACTAGAGGAAGTGG ATAGCCCGGGTATTTATCTCATAGCCCGGGTATTTATCTC 5050 246246 VASAVASA TTGCAGGACGAGATTTGATGTTGCAGGACGAGATTTGATG CCAATTCTCGAGTTGGTGTCCAATTCTCGAGTTGGTGT 5353 165165 β-액틴β-actin CCTGGAGAAGAGCTACGAGCCTGGAGAAGAGCTACGAG TTCATGATGGAGTTGAAGGTTTCATGATGGAGTTGAAGGT 5555 153153

1 ㎕ cDNA, 1 ㎕(10 picomol) 프라이머, 10 ㎕ i-StarTaq 2x PCR 마스터 믹스 용액(iNtRON BIOTECHNOLOGY) 및 7 ㎕ 증류수를 포함하는 증폭 반응용액을 이용하였다. 온도 사이클은 94℃에서 2분 동안 반응시킨 다음, 94℃ 20초, 어닐링온도 10초 및 74℃ 20초의 총 35사이클을 포함한다. PCR 후, 5 ㎕ 반응물을 EtBr (ethidium bromide)이 있는 1.2% 아가로스 젤에서 전기영동 하고, UV 조사 하에서 가시화 하였다. 프라이머 서열은 다음의 GenBank 데이터 및 문헌을 참조하여 디자인 하였다: Oct-4 (316bp, [12]), TERT (161bp, AY785158), Nanog (141bp, DQ447201), 네스틴 (150bp, [6]), GFAP (219bp, [21]), 트로포닌 I (194bp, NM_213912), 패스트 골격근 트로포닌 T3 (165bp, AJ301278, [22]), VASA (165bp, AY626785, [23]), SRY (246bp, U49860) 및 β-액틴 (153bp, AY550069).An amplification reaction solution containing 1 μl cDNA, 1 μl (10 picomol) primer, 10 μl i-StarTaq 2 × PCR master mix solution (iNtRON BIOTECHNOLOGY) and 7 μl distilled water was used. The temperature cycle includes a total of 35 cycles of reaction at 94 ° C. for 2 minutes and then 94 ° C. 20 seconds, annealing temperature 10 seconds and 74 ° C. 20 seconds. After PCR, 5 μl of the reaction was electrophoresed in 1.2% agarose gel with EtBr (ethidium bromide) and visualized under UV irradiation. Primer sequences were designed with reference to the following GenBank data and literature: Oct-4 (316bp, [12]), TERT (161bp, AY785158), Nanog (141bp, DQ447201), Nestin (150bp, [6]), GFAP (219 bp, [21]), Troponin I (194 bp, NM_213912), Fast skeletal muscle Troponin T3 (165 bp, AJ301278, [22]), VASA (165 bp, AY626785, [23]), SRY (246 bp, U49860) And β-actin (153 bp, AY550069).

Vasa는 생식 세포에서 발현되는 것으로 알려져 있다[23-25]. 본 발명자들은 Vasa 양성 대조군으로써 난모세포를 이용하였다. 난소를 성성숙전(prepubertal)의 어린 암퇘지로부터 회수하고 30-35℃ 생리식염수에 넣어서 실험실로 이송하였다. 직경 3-6 mm의 난포로부터 난포액 및 포-난자 복합체(cumulus-oocyte complexes: COCs)를 18-게이지 바늘로 흡입하였다. 조밀한 COCs를 선별하였다.Vasa is known to be expressed in germ cells [23-25]. We used oocytes as the Vasa positive control. The ovaries were recovered from young sows of prepubertal and transferred to the laboratory in 30-35 ° C. saline. Follicle fluid and cumulus-oocyte complexes (COCs) were aspirated with 18-gauge needles from follicles 3-6 mm in diameter. Dense COCs were selected.

실험 결과Experiment result

PMSCsPMSCs 의 분리 및 검출Separation and detection

PMSCs를 분리하기 위하여, 태아를 개별적으로 절개 분리 하여 중신에 대동맥-원시생식기 부위와 같은 다른 조직이 결합하지 않도록 중신을 분리하고, 중신의 외부 표면 조직을 그라인딩 하였다. 중신 조직 세포의 일부를 그라인딩 하고, 즉시 고정한 다음 AP에 대하여 염색하였다(도 1, 패널 A-B). 많은 중신 조직 세포들이 AP에 대한 강하게 염색되었다. 세포들을 피더 세포인 마이토마이신 C-처리 MEF에 플레이팅 하고 배양하였으며, 배지는 매일 교체 하였다. 배양 3일 후부터, 일차 PMSCs 콜로니들이 성장하기 시작하였고, 이들 콜로니들은 AP에 대하여 강하게 염색되었다(도 1, 패널 C). 배양 6-8일 후, 일차 콜로니들을 0.25% 트립신-EDTA로 분리시키고, 새로운 피더 세포에 플레이팅 하였다. 마우스 ES 세포-유사 또는 돼지 EG 세포-유사 형태를 가지는 다수의 콜로니들을 피더층과의 배양 과정에서 관찰할 수 있었다(도 1, 패널 D). PMSCs를 7일에 한번씩 패시지시켰고, 각각의 패시지는 AP에 대하여 염색 되었다(도 1, 패널 E). Vasa 발현은 후-마이그레이션 단계에서 시작되며 배발생 동안의 원시생식세포 및 생식자발생 과정의 생식 세포에 한정적으로 발생하며, 후-유사분열 단계까지 발현된다[23-25]. 본 실험에 따르면, Vasa는 중신 및 PMSCs에서 검출되지 않았고(도 1, 패널 F), 따라서 본 발명에서 얻은 세포는 원시생식세포가 아니라는 것을 알 수 있었다. In order to separate PMSCs, fetuses were individually dissected to separate the central bodies so that other tissues such as aortic-primary genital sites did not bind to the central bodies, and the outer surface tissues of the central bodies were ground. Some of the neural tissue cells were ground, fixed immediately and stained for AP (FIG. 1, Panels A-B). Many mesothelial tissue cells were strongly stained for AP. Cells were plated and cultured in feeder cells, mitomycin C-treated MEF, and medium was changed daily. After 3 days of culture, primary PMSCs colonies began to grow, and these colonies were strongly stained for AP (FIG. 1, Panel C). After 6-8 days of culture, primary colonies were separated with 0.25% trypsin-EDTA and plated on new feeder cells. Multiple colonies with mouse ES cell-like or porcine EG cell-like morphology could be observed during incubation with the feeder layer (FIG. 1, Panel D). PMSCs were passaged once every 7 days and each passage was stained for AP (FIG. 1, Panel E). Vasa expression begins in the post-migration stage and is limited to primordial germ cells during germ development and germ cells during the germ development process, and is expressed until the post-mitotic stage [23-25]. According to the present experiment, Vasa was not detected in the neutrophils and PMSCs (FIG. 1, Panel F), and thus it was found that the cells obtained in the present invention were not primordial germ cells.

임신 후 27일째에 대동맥-원시생식기-중신(AGM) 부위에서, Oct-4 및 SSEA-1가 파라핀 조직 섹션에서 관찰되었다(도 2). Oct-4는 원시생식기 부위에 있는 각각의 크고 둥근 세포들에서 염색되었고(도 2, 패널 C-D), 이들 세포는 마우스에서 발견되는 이동된 원시생식세포와 유사하였다[26]. 또한, 중신 조직의 외부 튜블에서도 Oct-4 양성이 관찰되었다. Oct-4 양성 세포들에서 주로 세포질이 염색되었고, 몇몇의 핵도 염색되었으며(도 2, 패널 E-F), 이는 원시생식세포에서의 Oct-4 염색과는 다른 양상이다. SSEA-1은 중신 튜블의의 세포 표면에 존재하였으나(도 2, 패널 I, J 및 L), SSEA-1-양성 세포들은 대동맥-원시생식기 부위에서는 관찰되지 않았다(도 2, 패널 I-K). 이차항체 단독으로는 염색되는 파라핀 섹션이 없었다(도 2, 패널 A, G 및 H).At day 27 post gestation, at the aortic-raw genital-gravity (AGM) site, Oct-4 and SSEA-1 were observed in paraffin tissue sections (FIG. 2). Oct-4 was stained in each large round cell at the primordial genome site (FIG. 2, Panel C-D), and these cells were similar to the migrated primordial germ cells found in mice [26]. In addition, Oct-4 positive was observed in the external tubule of the mesothelial tissue. The cytoplasm was stained mainly in Oct-4 positive cells and several nuclei were also stained (FIG. 2, Panel E-F), which is different from Oct-4 staining in primordial germ cells. SSEA-1 was present on the cell surface of the mesothelial tubule (FIG. 2, Panels I, J and L), but SSEA-1-positive cells were not observed at the aortic-primary genital region (FIG. 2, Panel I-K). Secondary antibodies alone did not have paraffin sections to be stained (FIG. 2, Panels A, G and H).

한편, 중신 줄기세포의 구축 및 유지는 피더의 종류와 수에 대하여 대체적으로 민감하게 반응하였다. 도 7의 패널 A-D는 각각 ICR 마우스 피더(2.5 x 105/ml), ICR 마우스 피더(1.5 x 105/ml), CF-1 마우스 피더(1.5 X 105/ml) 및 STO 피더(2.5 x 105/ml)를 사용하여 중신 줄기세포를 배양한 결과이다. A와 B를 비교하였을 때, ICR 마우스 피더 수가 많을 때가 적을 때보다 미분화 중신 줄기세포 콜로니를 더 유지시켜주는 것을 볼 수 있다. B와 C를 비교하였을 때 마우스 피더의 종류에 따라 ICR이 CF-1 마우스보다 미분화 중신 줄기세포 콜로니를 더 강하게 지탱해 주는 것을 볼 수 있다. D의 STO 피더를 사용할 때는 수적으로 많아도 ICR 마우스 피더나 CF-1마우스 피더를 사용하는 것보다 확연하게 미분화 중신 줄기세포를 지탱해 줄 수 없는 것을 알 수 있다.On the other hand, the construction and maintenance of neutrophil stem cells were generally sensitive to the type and number of feeders. Panel AD of FIG. 7 shows ICR mouse feeder (2.5 x 10 5 / ml), ICR mouse feeder (1.5 x 10 5 / ml), CF-1 mouse feeder (1.5 x 10 5 / ml) and STO feeder (2.5 x 10 5 / ml) was used to culture neutrophil stem cells. Comparing A and B, it can be seen that more undifferentiated mesenchymal stem cell colonies are maintained than when the number of ICR mouse feeders is small. Comparing B and C, ICR can support the undifferentiated mesenchymal stem cell colonies more strongly than CF-1 mice depending on the type of mouse feeder. When using the STO feeder of D, it can be seen that even if it is a large number, it cannot support the undifferentiated mesenchymal stem cells more clearly than using an ICR mouse feeder or a CF-1 mouse feeder.

PMSCsPMSCs 의 특성 연구Characteristic study of

인간 재조합 염기성 FGF, SCF 및 LIF와 같은 사이토카인을 포함하는 PES 배지에서 AP 양성-둥근 모양의 콜로니들이 20 패시지 이상에서도 계속적으로 만들어졌다. Oct-4, SSEA-1, SSEA-4, Tra1-60 및 Tra1-81에 대한 항체로 면역세포화학 염색을 실시한 경우, 모든 PMSCs는 양성으로 염색되었다. Oct-4 (도 3, 패널 B) 및 SSEA-1(도 3, 패널 C)에 대한 항체를 이용한 반응의 세기는 다른 항체들(도 3, 패널 D-F)보다 강하였다. 더욱이, Tra1-60은 약하게 염색되었다(도 3, 패널E). 모든 항체에 대한 특이성을 일차항체 없이 시험 하였다(도 3, 패널 A). 돼지 EG 세포와 거의 동일한 형태 및 항원 발현 양상이, PMSCs에서 관찰되었다. PMSCs에서 Oct-4, SSEA-1 및 SSEA-4 항원이 존재하는 것은, 돼지 EG 세포와 유사한 특성이다 [11]. AP positive-round colonies in PES medium containing cytokines such as human recombinant basic FGF, SCF and LIF were continuously made over 20 passages. When immunocytochemical staining with antibodies to Oct-4, SSEA-1, SSEA-4, Tra1-60 and Tra1-81, all PMSCs stained positive. The intensity of the reaction with antibodies against Oct-4 (FIG. 3, Panel B) and SSEA-1 (FIG. 3, Panel C) was stronger than other antibodies (FIG. 3, Panel D-F). Moreover, Tra1-60 was weakly stained (FIG. 3, Panel E). Specificity for all antibodies was tested without primary antibody (FIG. 3, Panel A). Almost the same morphology and antigen expression pattern as that of porcine EG cells was observed in PMSCs. The presence of Oct-4, SSEA-1 and SSEA-4 antigens in PMSCs is similar to porcine EG cells [11].

배양 4개월 후에 핵형 분석을 실시하였다. 염색체의 수는 정상적인 핵형을 나타내었다(도 4). 한편, SRY 유전자가 발현된다는 것을 RT-PCR로 확인하였다(도 4). SRY(성-결정 부위 Y 유전자를 의미한다)는 Y 염색체에 존재하기 때문에, 본 실험에서 얻은 PMSCs는 웅성이다.Karyotyping was performed 4 months after the culture. The number of chromosomes showed normal karyotype (FIG. 4). On the other hand, it was confirmed by RT-PCR that the SRY gene is expressed (Fig. 4). Since SRY (meaning sex-determining site Y gene) is present on the Y chromosome, the PMSCs obtained in this experiment are male.

인 비트로 분화Eruption by bit

컨플루언시 상태로 성장된 PMSCs를 트립신 처리하고, 사이토카인과 피더층 없이 FBS-함유 배지에서 행잉 드랍 방식으로 세포를 배양하였다. 배양 5일 후, PMSCs로부터 배아유사체(EB)를 형성시키고, 페트리 디쉬로 옮겼다. PMSCs의 EB는 추가적으로 더 분화되어 시스틱 EB (도 5, 패널 A)를 형성하였다. EBs는 3개의 배엽으로부터 유래된 조직을 포함한다: 내배엽, 중배엽 및 외배엽[27]. 5일 후, EBs를 트립신-EDTA로 처리한 다음, 배양 디쉬에 다시 플레이팅 하였다. 자연적으로 분화된 PMSCs를 15일 이상 배양하였고, βⅢ-튜블린(외배엽, 도 5 패널 B), 신경필라멘트(외배엽, 도 5, 패널 C), α-페토 단백질(내배엽, 도 5, 패널 D) 및 심장 트로포닌 1(중배엽, 도 5 패널 E)에 대한 항체로 면역조직화학 염색을 하여 3개의 배엽의 존재를 확인하였다. 내배엽 마커로서의 α-페토 단백질은 25일 이상 배양된 분화된 PMSCs에서 관찰되었다.PMSCs grown in confluency were trypsinized and cells were cultured in a hanging drop fashion in FBS-containing medium without cytokine and feeder layers. After 5 days of culture, embryonic analogs (EBs) were formed from PMSCs and transferred to Petri dishes. The EBs of PMSCs were further differentiated to form sticky EBs (FIG. 5, Panel A). EBs include tissue derived from three germ layers: endoderm, mesoderm and ectoderm [27]. After 5 days, EBs were treated with trypsin-EDTA and then plated back into culture dishes. Naturally differentiated PMSCs were cultured for at least 15 days and βIII-tubulin (ectoderm, FIG. 5 panel B), neurofilament (ectoderm, FIG. 5, panel C), α-fetoprotein (endoderm, FIG. 5, panel D) And immunohistochemical staining with antibodies to cardiac troponin 1 (mesoderm, FIG. 5 panel E) to confirm the presence of three germ layers. Α-feto protein as an endoderm marker was observed in differentiated PMSCs cultured for at least 25 days.

PMSCsPMSCs 의 유전자 발현 프로파일Expression profile

본 발명의 PMSCs의 줄기세포 특성을 평가하기 위하여, 줄기세포 마커로서의 Oct-4, Tert 및 Nanog, 외배엽 마커로서의 Nestin 및 GFAP, 중배엽 마커로서의 트로포닌 I 및 패스트 골격근 트로포닌 T3, 내배엽 마커로서의 α1-안티트립신 및 α-페토단백질에 대한 mRNA 발현 양상을 RT-PCR로 분석하였고, 중신 조직, 미분화 PMSCs, 분화 초기 PMSCs 및 분화 말기 PMSCs에 대하여 실험을 하였다(도 6). 중신 조직은 줄기세포 및 3개 배엽 세포들의 혼합 세포를 가지고 있었다. 그러나, 미분화 PMSCs는 내배엽 세포를 가지고 있지 않았고, 감소된 중배엽 세포를 가지고 있었다. Oct 4 mRNA는 미분화 PMSCs에서는 발현되었으나, 분화 초기 세포에서는 발현되지 않았고, 분화 후기 세포에서 다시 발현 되었다. PMSCs의 분화가 진행될수록 Tert 발현이 중신보다 증가하는 양상을 나타내었다. Nanog의 발현은, 중신, 미분화 PMSCs 및 분화된 PMSCs에서 관찰되었다. 중배엽 마커는 mRNA 수준에서 검출되지 않았으나, 분화된 PMSCs의 배양 세포에서 면역세포화학염색에 의해서는 검출되었다. In order to evaluate the stem cell characteristics of PMSCs of the present invention, Oct-4, Tert and Nanog as stem cell markers, Nestin and GFAP as ectoderm markers, Troponin I as mesoderm markers, and fast skeletal muscle troponin T3, α1-as endoderm markers The mRNA expression patterns of antitrypsin and α-fetoprotein were analyzed by RT-PCR, and experiments were carried out on neutrophil tissues, undifferentiated PMSCs, early differentiation PMs and late differentiation PMSCs (FIG. 6). The necrotic tissue had a mixed cell of stem cells and three germ cells. However, undifferentiated PMSCs did not have endoderm cells and had reduced mesoderm cells. Oct 4 mRNA was expressed in undifferentiated PMSCs, but not in early differentiating cells, but again in late differentiating cells. As PMSCs differentiated, Tert expression increased more than gestation. Expression of Nanog was observed in neutrophils, undifferentiated PMSCs and differentiated PMSCs. Mesoderm markers were not detected at the mRNA level, but were detected by immunocytochemical staining in cultured cells of differentiated PMSCs.

실험결과에 대한 논의 사항Discussion of the Experiment Results

돼지의 중신은 중간 중배엽으로부터 유래되는 일시적인 신장 기관으로서, 돼지의 발생 동안에만 기능을 나타낸다. 마우스에서, 제한적인 조혈은 대동맥-원시생식기-중신(AGM) 부위에서 시작되며[17, 18], 원시생식세포는 생식융기로 이동하여 이곳에 집중된다[28]. 마우스에서 중신 조직은 AP에 대하여 염색되지 않았지만(데이터 미제시), 돼지 중신 조직은 강한 AP-양성 세포를 가지고 있었다. 또한, 줄기세포 마커로서의 Oct-4 및 SSEA-1이 돼지 중신 조직에 존재하였고, 생식세포 마커로서의 Vasa 유전자는 검출되지 않았다. 따라서, 중신은 다른 줄기세포 리니지를 가지고 있음을 알 수 있다.Swine's corpse is a transient renal organ derived from the mesoderm, which functions only during the development of the pig. In mice, restrictive hematopoiesis begins at the aortic-primary genital-central (AGM) site [17, 18] and primordial germ cells migrate to and become concentrated in the genital ridge [28]. In necrotic tissues in mice were not stained for AP (data not shown), pig necrotic tissues had strong AP-positive cells. In addition, Oct-4 and SSEA-1 as stem cell markers were present in porcine neutrophil tissue, and the Vasa gene as germ cell marker was not detected. Thus, it can be seen that the central body has a different stem cell lineage.

PMSCs에 대하여 형태 및 줄기세포 마커(Oct-4, SSEA-1, SSEA-3, Tra1-60 및 Tra1-81) 분석을 하였다. 염색된 Oct-4, SSEA-1 및 SSEA-3는 돼지 EG 세포주에 유사하였다[11]. PMSCs 형태 및 항원 발현은 EG 세포와 유사하였는데, 그 이유는 상기 두 세포 모두 마우스 세포를 피더층으로 이용하고 공통된 사이토카인(재조합 인간 bFGF, SCF 및 LIF)를 이용하여 배양되기 때문이다. PMSCs는, 돼지 EG 세포와 같이[29], 피더 세포의 조건 및 수에 민감하였다(데이터 미제시). Oct-4는 전능성 줄기세포에서 주로 발현되는 것으로 알려져 있으며, 성숙한 동물에서는 생식세포에서만 발현된다[30]. Oct-4 mRNA는 중신과 PMSCs에서 발현되었고, 이 발현은 PMSCs의 분화 초기 단계에서 상실되었다가 분화 후기 단계에서 재개되었다. Oct-4는 PMSCs에서 강력한 줄기세포 마커로서 기능을 하였고, 그 이유는 Oct-4가 모든 조직 섹션 및 미분화 세포에서 염색 되었고, mRNA 발현이 확인 되었기 때문이다. 전능성 줄기세포의 마커로서의 Tert 및 Nanog는 분화된 PMSCs에서 발현되었다. 따라서, 분화된 PMSCs는 줄기세포 파퓰레이션을 가지거나 생식된 줄기세포를 가지고 있음을 알 수 있다. 외배엽 마커로서의 Nestin 및 GFAP는 중신, PMSCs, 태아 섬유아세포(데이터 미제시) 및 귀 섬유아세포(데이터 미제시), 모두에서 발현되었다. 분화가 일어나는 경우 PMSCs는 세포 타입이 변화되며, 3개의 배엽이 검출되었다. PMSCs were analyzed for morphology and stem cell markers (Oct-4, SSEA-1, SSEA-3, Tra1-60 and Tra1-81). Stained Oct-4, SSEA-1 and SSEA-3 were similar to porcine EG cell lines [11]. PMSCs morphology and antigen expression were similar to EG cells because both cells were cultured using mouse cells as feeder layers and common cytokines (recombinant human bFGF, SCF and LIF). PMSCs, like pig EG cells [29], were sensitive to the condition and number of feeder cells (data not shown). Oct-4 is known to be expressed predominantly in pluripotent stem cells and only in germ cells in mature animals [30]. Oct-4 mRNA was expressed in neutrophils and PMSCs, which was lost in the early stages of differentiation of PMSCs and resumed in late stages of differentiation. Oct-4 served as a powerful stem cell marker in PMSCs because Oct-4 was stained in all tissue sections and undifferentiated cells and mRNA expression was confirmed. Tert and Nanog as markers of pluripotent stem cells were expressed in differentiated PMSCs. Thus, it can be seen that differentiated PMSCs have stem cell populations or have reproductive stem cells. Nestin and GFAP as ectoderm markers were expressed in neutrophils, PMSCs, fetal fibroblasts (data not shown) and ear fibroblasts (data not shown). When differentiation occurs, PMSCs change cell types and three germ layers are detected.

결론적으로, 본 실험은 중신 조직의 익스플랜트는 전능성 줄기세포의 서브파퓰레이션을 포함한다는 것을 보여준다. 돼지 중신은 생식융기보다 크기가 크며 세포수도 많이 포함한다. 따라서, 본 발명의 돼지 줄기세포 기술은, 유전자 타겟팅 기술과 함께, 이종간장기이식(xenotransplantation)에 이용되는 형질전환 동물의 개발을 가능하게 한다.In conclusion, this experiment shows that implants of mesophilic tissues include subpopulations of omnipotent stem cells. Porcine mesothelioma is larger than the genital ridge and contains many cell numbers. Therefore, the pig stem cell technology of the present invention, together with the gene targeting technology, enables the development of transgenic animals used for xenotransplantation.

위에서 상세히 설명한 바와 같이, 본 발명은 중신 줄기세포주(mesonephric stem cell line)를 제조하는 방법 및 중신 세포-유래 줄기세포주를 제공한다. 본 발명의 중신 줄기세포주는 본 발명자들에 의해 최초로 구축된 것이며, 이에 내세포괴와 원시생식세포 이외의 새로운 줄기세포 소스를 제시한다. 또한, 본 발명의 중신 줄기세포주는 다양한 세포로 분화될 수 있으며, 세포이식 치료를 통하여 다양한 질병 또는 질환을 치료할 수 있으며, 이종간장기이식(xenotransplantation)에 이용되는 형질전환 동물의 개발에 이용될 수 있다.As described in detail above, the present invention provides a method for producing a mesophilic stem cell line and a mesothelial cell-derived stem cell line. The neutrophil stem cell line of the present invention was first constructed by the present inventors, thereby suggesting new stem cell sources other than inner cell mass and primordial germ cells. In addition, the neutrophil stem cell line of the present invention can be differentiated into a variety of cells, can treat a variety of diseases or disorders through cell transplantation treatment, it can be used in the development of transgenic animals used for xenotransplantation (xenotransplantation). .

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims (16)

다음의 단계를 포함하는 중신 줄기세포주(mesonephric stem cell line)의 제조방법: Method for producing a mesinephric stem cell line comprising the following steps: (a) 포유동물의 중신으로부터 중신 세포를 수득하는 단계;(a) obtaining neutrophil cells from the mammary body of the mammal; (b) 상기 중신 세포를 피더 세포층 상에서 배양하여 콜로니를 형성시키는 단계; 및 (b) culturing the mesophilic cells on the feeder cell layer to form colonies; And (c) 상기 콜로니를 계대 배양하여 중신 줄기세포주를 수득하는 단계. (c) passaging the colonies to obtain a neutrophil stem cell line. 제 1 항에 있어서, 상기 포유동물은 인간, 돼지, 소, 양, 말, 토끼, 염소, 마우스, 햄스터 또는 래트인 것을 특징으로 하는 방법.The method of claim 1, wherein the mammal is human, pig, cow, sheep, horse, rabbit, goat, mouse, hamster or rat. 제 2 항에 있어서, 상기 포유동물은 돼지인 것을 특징으로 하는 방법.The method of claim 2, wherein the mammal is a pig. 제 1 항에 있어서, 상기 피더 세포층은 섬유아세포의 층인 것을 특징으로 하는 방법.The method of claim 1, wherein the feeder cell layer is a layer of fibroblasts. 제 4 항에 있어서, 상기 섬유아세포는 ICR 마우스로부터 유래된 것을 특징으로 하는 방법.The method of claim 4, wherein the fibroblasts are derived from ICR mice. 제 4 항에 있어서, 상기 섬유아세포는 유사분열 활성이 없는 것을 특징으로 하는 방법.5. The method of claim 4, wherein the fibroblasts do not have mitotic activity. 제 5 항에 있어서, 상기 섬유아세포의 수는 1.8-2.8 x 105 세포/ml인 것을 특징으로 하는 방법.6. The method of claim 5, wherein the number of fibroblasts is 1.8-2.8 x 10 5 cells / ml. 제 1 항에 있어서, 상기 단계 (b)는 류케미아 억제 인자(leukemia inhibitory factor) 및 bFGF(basic fibroblast growth factor)의 존재 하에서 실시하는 것을 특징으로 하는 방법.The method of claim 1, wherein step (b) is carried out in the presence of a leukemia inhibitory factor and a basic fibroblast growth factor (bFGF). 제 1 항에서, 상기 중신 줄기세포주는 알칼린 포스파타아제, Oct-4, SSEA(stage-specific embryonic antigen)-1, SSEA-4, Tral-60 또는 Tral-81에 대한 염색반응에서 양성 반응을 나타내는 것을 특징으로 하는 방법.The method of claim 1, wherein the mesenchymal stem cell line is positive in staining with alkaline phosphatase, Oct-4, stage-specific embryonic antigen (SSEA) -1, SSEA-4, Tral-60 or Tral-81 Characterized in that the method. 제 1 항에 있어서, 상기 중신 줄기세포주는 Vasa 유전자를 발현하지 않는 것을 특징으로 하는 방법.The method of claim 1, wherein the neutrophil stem cell line does not express the Vasa gene. 포유동물의 중신 세포-유래 중신 줄기세포주로서, 상기 중신 줄기세포주는 알칼린 포스파타아제에 대한 양성 반응을 나타내며, 배아유사체로 자연분화할 수 있는 능력을 가지는 것을 특징으로 하는 중신 세포-유래 중신 줄기세포주.As a mammalian mesothelial cell-derived mesothelial stem cell line, the mesothelial stem cell line shows a positive response to alkaline phosphatase and has the ability to spontaneously differentiate into embryonic analogs. Cell line. 제 11 항에 있어서, 상기 포유동물은 돼지, 소, 양, 말, 토끼, 염소, 마우스, 햄스터 또는 래트인 것을 특징으로 하는 중신 줄기세포주.12. The mesothelial stem cell line according to claim 11, wherein the mammal is a pig, a cow, a sheep, a horse, a rabbit, a goat, a mouse, a hamster or a rat. 제 12 항에 있어서, 상기 포유동물은 돼지인 것을 특징으로 하는 중신 줄기세포주.13. The mesothelial stem cell line according to claim 12, wherein the mammal is a pig. 제 11 항에 있어서, 상기 중신 줄기세포주는 Oct-4, SSEA(stage-specific embryonic antigen)-1, SSEA-4, Tral-60 또는 Tral-81에 대한 염색반응에서 양성 반응을 나타내는 것을 특징으로 하는 중신 줄기세포주.12. The method of claim 11, wherein the mesenchymal stem cell line is characterized in that the positive reaction in staining for Oct-4, stage-specific embryonic antigen (SSEA-1), SSEA-4, Tral-60 or Tral-81 Mesothelial stem cell line. 제 11 항에 있어서, 상기 중신 줄기세포주는 Vasa 유전자를 발현하지 않는 것을 특징으로 하는 중신 줄기세포주.12. The mesothelial stem cell line according to claim 11, wherein the mesothelial stem cell line does not express the Vasa gene. 제 11 항에 있어서, 상기 중신 줄기세포주는 상기 제1항 내지 제8항 중 어느 한 항의 방법에 의해 제조된 것을 특징으로 하는 중신 줄기세포주.12. The mesothelial stem cell line according to claim 11, wherein the mesothelial stem cell line is prepared by the method of any one of claims 1 to 8.
KR1020060117430A 2006-11-27 2006-11-27 Mesonephric Stem Cells Lines KR100838707B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060117430A KR100838707B1 (en) 2006-11-27 2006-11-27 Mesonephric Stem Cells Lines

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060117430A KR100838707B1 (en) 2006-11-27 2006-11-27 Mesonephric Stem Cells Lines

Publications (2)

Publication Number Publication Date
KR20080047676A true KR20080047676A (en) 2008-05-30
KR100838707B1 KR100838707B1 (en) 2008-06-16

Family

ID=39664015

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060117430A KR100838707B1 (en) 2006-11-27 2006-11-27 Mesonephric Stem Cells Lines

Country Status (1)

Country Link
KR (1) KR100838707B1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH11103856A (en) 1997-10-06 1999-04-20 Atsushi Miyajima Hematopoietic stem cell proliferation promoter
US20030100107A1 (en) 1998-05-29 2003-05-29 Thomas Jefferson University Compositions and methods for generating differentiated human cells
EP1726640B1 (en) * 2004-03-04 2016-01-13 Sumitomo Dainippon Pharma Co., Ltd. Rat embryonic stem cell

Also Published As

Publication number Publication date
KR100838707B1 (en) 2008-06-16

Similar Documents

Publication Publication Date Title
Virant-Klun et al. Parthenogenetic embryo-like structures in the human ovarian surface epithelium cell culture in postmenopausal women with no naturally present follicles and oocytes
US7432104B2 (en) Methods for the culture of human embryonic stem cells on human feeder cells
US20050095703A1 (en) Method for the establishment of a pluripotent human blastocyst - derived stem cell line
US20030175954A1 (en) Human embryoid body-derived cells
JP2001521380A (en) Human embryonic germ cell lines and methods of use
WO2008015418A2 (en) Pluripotent cells from rat and other species
CA2434362A1 (en) Pluripotent adult stem cells derived from regenerative tissue
US20050239201A1 (en) Methods of inducing differentiation of stem cells into a specific cell lineage
US8916380B2 (en) Embryonic stem cell-like cells
US20070298496A1 (en) Method of deriving pluripotent stem cells from a single blastomere
KR101680269B1 (en) Embryonic stem cell line and method for preparing the same
Cha et al. Generation of embryonic stem‐like cells from in vivo‐derived porcine blastocysts at a low concentration of basic fibroblast growth factor
KR100838707B1 (en) Mesonephric Stem Cells Lines
WO2002031123A1 (en) Stem cells
Akutsu et al. Maintenance of pluripotency and self-renewal ability of mouse embryonic stem cells in the absence of tetraspanin CD9
KR20060089774A (en) Human embryonic stem cell from an oocyte and a somatic cell derived from a different individual from each other and a cell differentiated from the human embryonic stem cell
KR102140149B1 (en) Mouse embryonic stem cell line derived from outbred mouse and preparing method thereof
Hu et al. Establishment and characterization of a sheep endometrial epithelial cell line
TWI392736B (en) Method of deriving pluripotent stem cells from a single blastomere
Liu et al. Activation of embryonic/germ cell-like axis links poor outcomes of gliomas
KR20070030774A (en) In vitro method for isolating, proliferating and differentiating germ-line stem cells
KR20060007460A (en) Culture method for human embryonic stem cells by using amniotic fluid cells
Jung-Jin et al. Establishment of a simple and effective method for isolating male germline stem cells (GSCs) from testicular cells of neonatal and adult mice
KR20040071259A (en) A method for the establishment of a pluripotent human blastocyst-derived stem cell line
AU2003209830A1 (en) Methods of inducing differentiation of stem cells into a specific cell lineage

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20130531

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20140609

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20150601

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20160204

Year of fee payment: 9

FPAY Annual fee payment

Payment date: 20170524

Year of fee payment: 10

FPAY Annual fee payment

Payment date: 20180521

Year of fee payment: 11

FPAY Annual fee payment

Payment date: 20190520

Year of fee payment: 12