KR20070060721A - Recombinant adenovirus comprising dna sequence encoding egf-like domain peptide of heregulin beta1 and pharmaceutical composition comprising the same for the differentiation and regeneration of nerve cells - Google Patents

Abstract

A recombinant adenovirus comprising a DNA sequence encoding an EGF(epidermal growth factor)-like domain peptide of heregulin beta 1 and a pharmaceutical composition for the differentiation and regeneration of nerve cells comprising the same adenovirus are provided to promote growth of neuritis and regenerate nerve cells by promoting survival and differentiation of nerve stem cells, so that the recombinant adenovirus is useful for prevention and treatment of degenerative nerve disease or nerve damage disease. The recombinant adenovirus comprises the DNA sequence encoding the EGF-like domain peptide of heregulin(HRG) beta 1 or its analogues, wherein the DNA sequence comprises the nucleotide sequence of SEQ ID NO:1 and the EGF-like domain peptide of heregulin(HRG) beta 1 comprises the amino acid sequence of SEQ ID NO:4; the analogues include GGF(glial growth factor), NDF(Neu differentiation factor), ARIA(acetylcholine receptor inducing activity) and SMDF(sensory and motor neuron derived factor); and the recombinant adenovirus has a partially deleted genes of the genomic DNA required for replication in a target cell which are selected from E1, E3, E4 and L1-L5 genes. The pharmaceutical composition for the differentiation and regeneration of nerve cells comprises 10^6 to 10^13 pfu/ml of the recombinant adenovirus, wherein the composition is injectable form.

Description

Recombinant Adenovirus Comprising DNA Sequence Encoding EGF-like domain peptide of Heregulin beta1 and Pharmaceutical comprising a recombinant adenovirus comprising DNA sequence encoding EGF-like domain peptide of hiregulin beta1 Composition Comprising the Same for the Differentiation and Regeneration of Nerve Cells}

1 is a reverse transcriptase-polymerase chain reaction (RT) using primers specific to each type of hiregulin (HRG) RNA over time in the process of regeneration after injury of the rat sciatic nerve (RT). -A picture shown by PCR). On day 5 after cleavage (5D), the expression of type I and type III hyregulin RNA is increased, and on day 25 (25D), type II expression is increased. It is shown that the expression level of hiregulin type I RNA is increased at 5 weeks (5W) when the peripheral nerve is regenerating. The amount of actin RNA that is always expressed in the cell shows that the total RNA is the same in all samples.

2 is a diagram showing a method for producing an adenovirus designed to produce and secrete EGF-like domain peptides of hiregulin beta I (type I) (HRG-β1). Figure 2a shows a vector pJM17 for producing a recombinant plasmid pHRGβE-Adenoshuttle cloned by fusing a DNA sequence encoding a secreted signal peptide and a DNA sequence encoding an EGF-like domain peptide of HRG beta1. Indicates. FIG. 2B is a schematic representation of a replication defective recombinant adenovirus genome (pHRGβE-Ad) designed to secrete the EGF-like domain peptide of HRG beta1 through the recombination process in 293 cells in FIG. 2A. Figure 2c shows an enlarged square of 2b, where the EGF-like domain peptide of HRG beta1 fused with an 8 amino acid secretion indicator peptide is cloned between the CMV promoter and the poly-adenylation site (polyA) of the SV40 virus. It is displayed. Figure 2d is agarose gel photograph confirmed by the polymerase chain reaction whether the DNA encoding the EGF- sex domain peptide of HRG beta1 in the genome of HRGβE-Ad. After the genome of HRGβE-Ad was isolated, the primers (set of arrows 1 and 2) shown in FIG. 2C were used to confirm whether the gene encoding the EGF- sex domain peptide of HRG beta1 was inserted into the viral genome.

Figure 3 is a photograph showing the staining by immunocytochemistry (immunocytochemistry) that HRGβE-Ad efficiently induces the differentiation of HiB5, a neural stem cell (X200 magnification, indicator rod; 50μm). Neuronal specificity when infected with HRGβE-Ad compared to the virus-infected HiB5 cells prior to differentiation and to recombinant adenovirus (LacZ-Ad) expressing E. coli β-galactosidase as a control The expression of the marker β-tubulin is shown to be induced. 3A to 3C show a control group not infected with a virus, 3D to 3F show cells infected with LacZ-Ad, and 3G to 3i show cells infected with HRGβE-Ad. Figures 3a, d, g is a picture showing the nucleus of the cell stained with DAPI, Figures 3b, e, h is showing the β-tubulin, Figures 3c, f, i are overlapping these two pictures.

4 is a photograph showing staining by immunocytochemistry showing that HRGβE-Ad increases the expression of neuron (NF), which is a neurospecific marker, and ErbB4, which plays an important role in inducing the growth of neurites in HiB5 cells (FIG. X200 magnification, indicator bar; 50 μm). Figures 4a-4d are cells that did not infect the virus and Figures 4e-4h show the cells infected with HRGβE-Ad.

Figure 5 is a photograph showing the staining by immunocytochemistry that HRGβE-Ad induces the expression of ErbB4 and ErbB2 in HiB5 cells (X200 magnification, indicator bar; 50μm). Expression of ErbB4 and ErbB2 is induced in HiB5 cells (g-i) infected with HRGβE-Ad compared to the virus-free (a-c) and LacZ-Ad-infected controls (d-f). .

6 shows that HRGβE-Ad infects neurons and then induces activation of ErbB protein in uninfected peripheral cells using immunoprecipitation using antibodies specific for ErbB protein and antibodies that specifically react with phosphorylated tyrosine. Shown by immunoblotting assay. HRGβE-Ad was infected with HiB5 cells, incubated at 39 ^° C., and cultured at time (4 hours, 1 day, 2 days; 4 h, 1D, 2D). And (C) the tyrosine phosphorylation of ErbB3 and ErbB4 is markedly increased compared to cultures of cells infected with LacZ-Ad. This is the same level as when treated with commercially available recombinant GGF (rGGF) and the phosphorylation of ErbB4 is more increased than when treated with recombinant GGF, but the phosphorylation of ErbB2 hardly occurs, so HRG-β1 EGF- sex produced and secreted by the virus. It can be seen that the peptide specifically binds and activates ErbB3 and ErbB4.

FIG. 7 shows immunization of HBβ cells with HRGβE-Ad to differentiate into functional specific neurons using β-tubulin, a neuron-specific marker, and doublecotin (DCX), an antibody specific for cell migration. The photograph shows staining by cytochemistry (X200 magnification, indicator bar; 50 μm). 7A-7D are uninfected cells and FIGS. 7E-7H show HiB5 cells infected with HRGβE-Ad.

FIG. 8 shows immunological expression of neuronal markers (NF) and inhibitory neurotransmitter gamma-aminobutylic acid (GABA), which are neurospecific markers and presynaptic markers, in HiB5 cells infected with HRGβE-Ad. The photo shows staining by cytochemistry. 8A-8D are uninfected cells and FIGS. 8E-8H show HiB5 cells infected with HRGβE-Ad.

9 is a photograph showing that immunohistochemistry effectively induces the proliferation of Schwann cells in the sciatic nerve of HRGβE-Ad injured white rats. 8a to 8c are saline, and FIGS. 8d to 8f are LacZ-Ad and 8g to 8i are HRGβE-Ad injected sinus nerves injected and stained 25 days after injection. Injecting HRGβE-Ad induces the expression of the neuron-specific marker pan-NF in the sciatic nerve and S100, a specific marker of Schwann cells, the neuroglial cells surrounding axons.

10 shows immune system using antibodies that react with a neuronal marker, neurosasa (NF200), and GAP43 protein, a marker specific for growing axons, to induce axon growth in the sciatic nerve of HRGβE-Ad. The picture shows by chemical method. 10A to 10C show saline as a control group, and FIGS. 10D to 10F show LacZ-Ad, and FIGS. 10G to 10F show sciatic nerves taken and stained 25 days after HRGβE-Ad injection.

11 shows that axons and growth of neurons are increased in the sciatic nerve of white rats injected with HRGβE-Ad after injury. Figure shows the immunoblotting assay using antibodies.

12 is a graph showing the length of the axon that HRGβE-Ad promotes axon growth in the sciatic nerve of the damaged white rat. The axon length of the rat sciatic nerve at 25 days after saline, LacZ-Ad and HRGβE-Ad was injected into the damaged sinus nerve.

FIG. 13 is a graph showing behavioral recovery after 3 and 5 weeks when HRGβE-Ad is injected into the sciatic nerve of the cleaved white rat. FIG. 13A shows that white rats injected with HRGβE-Ad avoided heat stimulation faster in the hot plate test compared to controls injected with saline or LacZ-Ad. 13B shows that white rats injected with HRGβE-Ad show better results in neurological examination.

The present invention relates to a recombinant adenovirus comprising a DNA sequence encoding an EGF-like domain peptide and secretion indicator peptide of hiregulin (HRG) beta1. The present invention also relates to a pharmaceutical composition for differentiation and regeneration of neurons comprising the recombinant adenovirus.

Mammalian brain can perform complex functions by generating a systematic neural network through a series of processes, such as division and differentiation of neuronal stem cells, survival and death, and synapse formation. Even in adulthood, animal neurons produce many substances necessary for nerve growth, which leads to the growth of axons and dendrites, and the repetition of synaptic connections and neural networks as new learning and memories are developed. remodeling), so differentiation continues. When a neuron does not receive a target-derived survival factor such as a neuronal growth factor in the process of cell differentiation and synapse formation, apoptosis occurs and apoptosis caused by stress and cytotoxic agents is a degenerative brain. It is a major cause of disease. The animal's peripheral nervous system, when damaged, regenerates axons over time, unlike the central nervous system. The posterior axon of the nerve injury site is degenerated by a process known as Wallerian degeneration, the nerve cell body resumes the axonal regrowth, and Schwann cells divide and determine the target nerve by survival and death. It is reproduced through the generation process again, and then differentiated again.

The most likely candidate for neuroregeneration is the neurotrophic factor. In the 1940's, Hamburger and Levi-Montalcini discovered NGF (nerve growth factor) as a determinant of motor neuron survival during the differentiation of chick embryo limbs. After that, brain-derived neurotrophic factor (BDNF), NT Neurotrophins such as -3 (neurotrophic factor-3) have been found. Some transgenic animal experiments have also revealed the types of neuronal growth factors essential for the survival of differentiated neuronal populations. In recent years, many other substances, including cytokines, have been found to be involved in the survival of neurons. Nerve growth factors initiate the division of neural stem cells in the central nervous system and peripheral nervous system, control the number of dividing cells by killing process and initiate differentiation. Induced cell death kills the survival of wartime synaptic neurons, while regulating new synapse formation and reconstitution. In addition, the neuronal survival of the adult, synaptic plasticity and neuronal damage during regeneration process is expected to have a similar function.

Nerve growth factors present in the nervous system generally activate cell membrane receptors to regulate signal transduction and respond to neuronal responses. Neuroregulin is a structurally related gene and is expressed in 30 different forms by alternative splicing (Glial growth factors are alternatively spliced erbB2 ligands expressed in the nervous system (1993) Nature 362 , 312-318; Neuregulins: functions, forms, and signaling strategies (2003) Exp. Cell Res. 284, 14-30). Neuregulin is divided into three types, type I, type II, and type III. Among them, type I neuregulin is called NDF (Neu differentiation factor), Heregulin (HRG), and ARIA (Acetylcholin receptor inducing activity). (Hereinafter, type I neuregulin is collectively referred to as hiregulin). Type II neuregulin is called GGF (glial growth factor) and is expressed mainly in the late development of nervous system. Type III neuregulin is called sensory and motor neuron derived factor (SMDF) and Cytoin rich domain (CRD) neuregulin. Hiregulin, a type I neuregulin, reacts with receptor tyrosine kinase (RTK) ErbB3 and ErbB4 to regulate signaling and to regulate the phosphorylation of important intracellular signaling proteins to indicate neuronal responses. Another receptor, ErbB2, reacts after hiregulin binds ErbB3 and ErbB4 (Expression of neuregulins and their putative receptors, ErbB2 and ErbB3, is induced during wallerian regeneration (1997) J. Neurosci . 17, 1642-1659). All neuregulins have an epidermal grpwth factor (EGF) -like domain that only binds to the ErbB protein for cellular responses. Hiregulin is divided into HRG α and β by the α and β type domains next to the EGF- sex domain, and β is found in neuronal cells and α in nonneuronal cells. Hiregulin induces the death and proliferation of Schwann cells and glial cells in the central and peripheral nervous system, survival, migration and differentiation of neurons, and axon growth (Role of neuregulins in glial cell development (2000) Glia 29, 104- 111; GDNF family ligands activate multiple events during axonal growth in mature sensory neurons (2004) Mol . Cell. Neurosci . 25, 453-459)

As a method of treating neuronal growth factor for neurological diseases, it may be directly implanted into stem cells, but gene therapy for delivering a therapeutic gene using a virus as a gene transfer vector may be used. Recombinant adenovirus used in the present invention is a replication defective viral vector in which the E1B region has been deleted, and has been studied to obtain a therapeutic effect on a disease site by injecting a therapeutic gene into a real boundary disease. Viral vectors for modulating expression in neurons (1996) Curr . Opin . Neurobiol . 6, 576-583; Adenovirus vectors for gene delivery (1999) Curr . Opin . Biotech .. 10, 440-447). The advantage of adenoviruses is that they can infect various types of cells that have finally differentiated, such as neurons and muscle cells, unlike retroviruses that infect only dividing cells (Gene delivery into the brain using virus vector (1993)). Nature genetics 3, 187-189; Gene therapy for cerebral vascular disease (1997), Stroke 27, 534-539). In addition, the cytotoxicity is low compared to other viral mediators and can be purified at a high concentration. It also has a relatively large capacity of 8kb and is easy to produce. In addition, unlike retroviruses, there is a low risk of insertional mutagenesis.

Other papers previously reported confirmed that adenovirus was expressed to a high degree upon induction of expression of the E. coli β-galactosidase gene into lung epithelial cells, skin and muscle (Adenovirus-mediated in vivo gene transfer and expression in normal). rat liver (1992), Nature genetics 1, 372-378; Diversity of airway epitherial cell target for in vivo recombinant adenovirus-mediated gene transfer (1993) J. Clin . Invest. 91, 225-234; Intraperioneal in vivo gene transfer in the skin using replication-deficient receombinant adenovirus vector (1994) J. Invest Dermatol 102, 415-421;.... Immunology of gene therapy with adenoviral vectors in mouse skeletal muscle (1996) Hum Mol 5 1703-1712). We have reported that recombinant LacZ adenovirus is well infected with HiB5 neural stem cells, well infected with the nervous system of rats and expressed over 6 weeks (Effective gene transfer into regenerating sciatic nerves by adenoviral vectors: potentials for gene therapy of peripheral nerve injury (2000) Mol . cells . 10, 540-545). Therefore, the recombinant adenovirus HRGβE-Ad produced in the present invention can be directly used for infecting and transplanting stem cells or regenerating degenerative brain diseases.

Recently, neural stem cells have been identified in adults, and the process of stem cell development and regeneration in the adult brain can be called regeneration (Identification of a neural stem cell in the adult mammalian central nervous system (1999), Cell 96, 25-34). Neural stem cells are found mainly in the subventricular zone of the striatum, which contacts the lateral ventricle, and also in the subventricular zone of the hippocampus. These cells can differentiate and function (Functional neurogenesis in the adult hippocampus (2002) Nature 415, 1031-1034). Therefore, by promoting the development and differentiation of neural stem cells can promote nerve regeneration. The hippocampal neural cell line used in the present invention was cloned by retroviral infection of the ts-SV40 T antigen after the primary culture of pyramid neurons in E16, which initially initiated division (Region-specific differentiation of hippocampal stem cell line HiB5 upon implantation into the developing mammalian brain (1991) Cell 66, 713-729). Therefore, the cells continue to divide at the permissive temperature (33 ° C.), and at the body temperature (39 ° C.) of the nonpermissive temperature, many cells die as they cease division and enter differentiation fate. HiB5 cell line is designed for cell transplantation for gene therapy. When transplanted into adult brain, it migrates and differentiates into pyramidal neuron or glial cell depending on its surrounding environment. In other words, it seems that fate is determined by nerve growth factors from the surroundings. Primary culture of E16 embryos, which begin neurogenesis in the hippocampus of rats, results in nearly all cells expressing nestin, significant cell division in serum-free medium, and differentiation into neuroglial cells after 3-7 days. It is a time when primitive neurons determine fate. Therefore, a neuronal cell line such as HiB5 is a good system to study the mechanism of cell division and hyperdifferentiation and to study its function as a cell therapy product through genetic manipulation.

In today's aging society, 50% of senior citizens over the age of 85 get senile dementia, so the medical costs of such degenerative brain diseases are recorded as astronomical figures. In addition, 250,000 people in the US and 50,000 people in the spinal nerve disorder occur every year in the modern industrial society, 60% of which are caused by traffic accidents and 30% during leisure activities such as sports. In Korea, the average life expectancy is increasing rapidly, and the increase in leisure time increases the frequency of accidents that cause spinal and peripheral nerve damage caused by various leisure activities. Moreover, peripheral nerve injury caused by diabetes is increasing. In the case of humans, the central nervous system as well as the peripheral nervous system are difficult to regenerate, so as not only degenerative brain diseases but also industrial accidents, traffic accidents, and war-deficiency accumulate, they become social problems. to be.

Since the first clinical trials in humans began in 1990, about 600 clinical trials have been in progress in 3500 patients. With the completion of human genome sequence analysis in 2003, the development of new gene therapies will be accelerated by discovering various genes. However, 75% of the approved gene therapies are aimed at the treatment of monogenetic diseases such as cancer and cystic fibrosis, and the development of gene therapies for neurological diseases and nerve regeneration is not active (US NIH Recombinant DNA Advisory Report). (2002); Gene therapy clinical trials (2002) J Gene Med . Www.wiley.co.uk/genmed). However, the development of gene therapy using nerve growth factors such as NT-3 and GDNF (glial derived neuronal factor) has been attempted in the treatment of Parkin's disease and regeneration of sensory nerves (GDNF family ligands activate multiple events during axonal growth in mature sensory neurons (2004) Mol . cell. Neurosci . 25, 4453-4459). In the disease of the nervous system, the overall research of neuroscience about the study of brain function is still in a poor state, and the development of therapeutic drugs for various chronic nervous system diseases is also in trouble. In particular, the use of neural stem cells is a revolutionary new treatment of the medical community that treats diseases in a completely different perspective, and can promote differentiation into neural cell types suitable for transplantation of neural stem cells. In addition, direct injection of gene therapies that promote differentiation and regeneration of neurons may make these therapies a reality.

It is an object of the present invention to provide a recombinant adenovirus that secretes the EGF-like domain peptide of HRG beta1.

Another object of the present invention is to provide a pharmaceutical composition for differentiation, growth promotion and regeneration of neurons comprising the recombinant adenovirus.

The present invention relates to a recombinant adenovirus that generates only the EGF-like domain of HRG beta 1 and secretes it extracellularly, and to a pharmaceutical composition for differentiation, growth promotion, and regeneration of nerve cells including the same. The present invention relates to physical damage and degeneration of the nervous system. It can be very useful for the treatment of neurological diseases, ischemic cranial nerve damage, peripheral nerve damage, and neural stem cell and gene therapy.

Hereinafter, the present invention will be described in more detail.

The recombinant adenovirus of the present invention is designed to secrete the EGF-like domain peptide of HRG beta1, the structure is characterized in that it comprises a DNA sequence encoding the EGF-like domain peptide of HRG beta1 or an analog thereof.

Existing recombinant HRG-α or β EGF-peptide peptides are mainly cancer cells overexpressed by ErbB2 protein, which are used to target specific substances or fused with specific substances to express HRGβ-1 EGF-domain peptides in bacteria. Heregulin (HRG) -induced mitogenic signaling and cytotoxic activity of a HRG / PE40 ligand toxin in human breast cancer cells (1995) Cancer Grow.Differ . 6, 1567-1577; Recombinant Heregulin-Pseudomonas Exotoxin fusion proteins: Interaction with heregulin receptors and antitumor activity in vivo (1998) Clin . Cancer Res. 4, 993-1004; In vitro and in vivo behavior of NDF-expanded mpnkey Schwann cells (1998) Eur . J. Neurosci . 10, 291-300; Novel gene delivery to human breast cancer cells by targeted Ad5 penton proteins (2001), Gene Ther. 8, 1753-1761) also HRGβ-1 EGF- sex domain peptides of the commercial is purified after expression in bacterial recombinant protein simply three Or treatment in a form that can be injected as protein state (Amgen Inc., California, USA, NDG _β177-228; NeoMarker Inc., California, USA, NRG-1β). Compared to the existing trials, the present invention designed recombinant adenoviruses to synthesize only the EGF-like domain peptide of HRG-β1 and secrete it to the outside of the cell, thereby making it easier to inject into the living body and improving its sustained effect by the virus. In addition to the neurons infected with the surrounding nerve cells and to promote the differentiation and regeneration was confirmed that it can induce axon growth. It is thought that if HRGβE-Ad is administered to stem cells and transplanted into the treatment site, it will induce differentiation into appropriate neurons and promote differentiation and regeneration of peripheral cells. In addition, axon growth was promoted in the group treated with recombinant adenovirus secreting the EGF-like domain peptide of HRG-β1 through experiments with sciatic nerve injury model. The results showed the effect of promoting neuronal regeneration by the virus. Therefore, the HRGβE-Ad devised in the present invention can be directly used as a gene therapy agent by directly injecting a damaged nerve site, and in addition, it can be used as a cell therapy by infecting stem cells.

The DNA sequence encoding the EGF- sex domain peptide of HRG beta1 or an analog thereof contained in the recombinant adenovirus of the present invention has the nucleotide sequence of SEQ ID NO: 1. In addition, the EGF-genic domain peptide of HRG beta1 preferably comprises the amino acid sequence of SEQ ID NO: 4.

Analogs of the EGF-like domain peptide of HRG beta1 are understood to mean any sequence obtained by encoding and encoding a product that possesses activity capable of promoting the migration and differentiation of neural stem cells. Modifications are to be understood as meaning any mutations, substitutions, deletions, additions or modifications of genetic and / or chemical properties. These modifications may be the result of techniques known to those skilled in the art. Analogs within the meaning of the present invention can also be obtained by hybridization from nucleic acid libraries using native sequences or fragments thereof as probes. Analogs of the EGF-like domain peptide of HRG beta1 as used herein include, for example, a growth growth factor (GGF), a Neu differentiation factor (NDF), an Acetylcholin receptor inducing activity (ARIA), and a sensory and motor neuron (SMDF). derived EGF-like domain peptides of other types of rats or human HRG alpha / beta, and DNA sequences encoding such analogues have a homology of at least 90% to the nucleotide sequence of SEQ ID NO: 1 and It includes those having an activity that can promote migration and differentiation.

In addition, the recombinant adenovirus of the present invention may further include a DNA sequence encoding a secretory indicator peptide (SEQ ID NO: 5) together with a DNA sequence encoding the EGF-like domain peptide of the HRG beta1, At this time, the DNA sequence encoding the secretion indicator peptide preferably has a nucleotide sequence of SEQ ID NO: 2. More preferably, the recombinant adenovirus of the present invention has a nucleotide sequence in which the DNA sequence encoding the EGF-like domain peptide of the HRG beta1 and the DNA sequence encoding the secretion indicating peptide are fused. An example of such a fused DNA sequence is shown in SEQ ID NO: 3, and its amino acid sequence is shown in SEQ ID NO: 6 (six nucleotides (two amino acids) are added due to restriction sites for cloning in the middle).

In addition, the recombinant adenovirus of the present invention may further comprise a viral promoter capable of expressing the DNA sequence encoding the EGF-like domain peptide of the HRG beta 1, wherein the viral promoter is to use the CMV promoter It is good.

Recombinant adenoviruses used in the present invention are those which lack parts of the genome required for replication in target cells, which may be selected from E1, E3, E4, and L1-L5 genes, Preferably the E1B gene is deficient.

The structure of the recombinant adenovirus genome secreting the EGF-like domain peptide of HRG-β1 of the present invention is shown in Figure 2b.

In the present invention, the neuronal regeneration effect of the recombinant adenovirus of the present invention was investigated using a differentiation model of a neural stem cell line of an in vitro cultured rat and an sciatic nerve injury animal model in an in vivo experiment. For the recombinant adenovirus of the present invention, rat rat neuronal stem cells (Hib5) and rat glioma cells (rat glioma cell (C6)) are used to promote the differentiation of cells, the receptor of hyregulin-β1 and neurons. The expression and activation of ErbB receptors, which are known to play an important role in the process of dendritic growth, were measured. In addition, the peripheral nerve cutting model of white rats was used to measure neuronal repair and axon growth in response to nerve damage, and to confirm the promotion of neurological recovery through gene injection methods.

Thus, the recombinant adenovirus of the present invention may be useful for the treatment of neuronal and neurological diseases such as differentiation, growth promotion, regeneration or brain injury, ventricular disease, peripheral nerve injury, atrophic axon sclerosis, or peripheral nerve disease of neurons. It is thought to be useful for regeneration of nerve damage using stem cells and gene therapy. In particular, the recombinant adenovirus of the present invention is believed to be useful in brain or brain diseases such as dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, stroke, ischemic brain disease, or degenerative brain disease.

The recombinant adenovirus of the present invention may be provided as a pharmaceutical composition, for example in injectable form. The pharmaceutical composition may include a pharmaceutically acceptable carrier, and the like,

The pharmaceutical compositions of the present invention may be formulated for administration by topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, or transdermal routes, in particular. Preferably, the pharmaceutical composition of the present invention contains a pharmaceutically acceptable basis additive in an injectable formulation, in particular for direct injection into the patient's nervous system. These injectable combinations may in particular be sterile, isotonic solutions, or dried, in particular lyophilized, compositions which allow the preparation of injectable solutions with sterile water or physiological saline to be added to them, as the case may be.

The dose of recombinant adenovirus used for infusion can be adjusted according to other parameters, in particular the dosage form used, the lesions involved, and the duration of treatment required. In general, the recombinant adenovirus according to the invention is formulated and consists of 10 ⁶ to 10 ¹³ pfu / ml, preferably 10 ⁸ to 10 ¹² pfu / ml, more preferably 2x10 ⁸ to 6x10 ⁸ pfu / ml Administered in the form of dosage.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the scope of the present invention is not limited by these Examples.

Example

General Molecular Biology

1) Primer for measuring expression of hiregulin

RNA expression of type I, II, III hyregulin was examined using primers specific to each type. The forward primer used a glyco-domain region of type I (5'accactgggacaagccatctt3 '), a domain region of type II (5'aacctcaagaaggaggtcag3'), and an N-terminal region of type III (5'tgaagtgggtatttgtggac3 '), and reverse primers were used for all A primer having a nucleotide sequence corresponding to the EGF-like domain region (5'gcagcgatcaccagtaaactc3 ') common to gullin was used. Β-actin RNA was amplified using primers having the sequences of 5'gattactgctctggctccta3 'and 5'cagtaacagtccgcctagaa3' to determine the use of a certain amount of RNA.

2) Recombinant Adenovirus Production System

pAdenoshuttle (Microbix, Canada) was used as a plasmid for inserting cDNA encoding the EGF- sex domain peptide of HRG-β1 into adenovirus, from which the pJM17 vector of Microbix (Canada) was used to make a replication-deficient recombinant adenovirus. Was used. Two plasmids were co-transfected into 293 cells, a human embryonic cell line, to prepare a recombinant adenovirus, which was named HRGβE-Ad.

3) Proliferation and Purification of Recombinant Adenovirus

After the production of HRGβE-Ad, two plaque purifications were performed (single plaque purification) twice, followed by infection with 293 cells. After freezing and thawing 5 times in infected 293, the adenovirus was extracted, and then purified by CsCl density gradient centrifugation and stored at -80 ^° C. Purified recombinant adenovirus was used for the experiment after determining the plaque forming unit (pfu) in 293 cells.

4) Neuronal cell culture

HiB5 cells originating from the hippocampus of rat embryos were produced by infecting a temperature-sensitive SV40 T-antigen with a retrovirus, so they divide when they are cultured at 34 ^o C, but they divide when they are transferred to 39 ^o C, the normal temperature of mice. Stop Medium was used by adding 10% FBS (fetal bovine serum), penicillin / streptomycin, glutamine, sodium pyruvate (0.11 g / L) to DMEM, and serum-free medium when differentiated at 39 ^° C. Pyruvate is added to N2 (media, DMEM / F12, insulin, transferrin, Putreseine, BSA; Botten Stein & Sato., 1979).

5) Immunoprecipitation and Immunoblotting Assays

In order to verify whether the HRG-β1 EGF peptide synthesized by HRGβE-Ad is secreted extracellularly to induce the activation of other cellular ErbB proteins, a culture medium of HRGβE-Ad-infected HiB5 cells is collected over time. The cell culture solution was treated with C6 cells for 10 minutes, and then NP-40, pyrophosphate ortho-vanadate, fluoride, aprotin, peptatin, and lupeptin were added to NP-40 containing tris buffered saline (TBS). ) To extract the cells. After reaction on ice for 30 minutes, centrifuge for 10 minutes to remove nuclei. Cell extracts were immunoprecipitated using an antibody against each ErbB protein, and the immunoprecipitates were fractionated with SDS-polyacrylamide gel and then protein transferred to Immobilon-P. To determine the degree of phosphorylation of ErbB2, 3 and 4, immunoblot (Western blot) assay using anti-tyrosine phosphorylated protein antibody is performed.

6) Immunocyto-, histochemistry-double staining

In order to investigate the expression of neuronal specific target proteins (neurocytosis, acetylated tubulin, GABA, etc.), the cultured cells were fixed in 4% paraformaldehyde for 20 minutes and then permeable for 5 minutes with 0.5% NP-40. Permeablization and blocking with PBS solution containing 1% BSA for 30 minutes. After incubating at 37 ° C. for 1 hour with two primary antibodies, which are different origins, secondary antibodies conjugated with FITC or rhodamine were cultured in a dark chamber to detect each primary antibody. When staining cells, the nuclei of cells are stained with DAPI and observed using confocal microscopy.

In order to investigate the expression of neurofilament or Schwann cell-specific target protein S100 and growing axon-specific target protein GAP43 in sciatic nerve tissue, the nerve tissue was fixed with 4% paraformaldehyde and the nerve terminal side. The cryosection was performed at 5 μm from the distal stump of. It is then permeabilized with 0.1% Triton X-100 for 15 minutes and then blocked for 1 hour using PBS containing 1% BSA and 15% normal serum. After reacting for about 16 hours at 4 ℃ using the primary antibody, the reaction was again 1 hour with a secondary antibody labeled with FITC or rhodamine (TRITC), fixed on a slide and observed by confocal microscopy.

7) RT-PCR Method

Total RNA was extracted from sciatic nerve tissue using TriZol Reagent (Invitrogen, USA), dried, and dissolved in DEPC treated distilled water. The concentration and purity were measured using a spectrophotometer at 260 nm and stored at -20 ° C. . CDNA was synthesized from 2 μg of total RNA using a Super Script III first-stranded RT-PCR kit (Invitrogen, USA). Sense and antisense primers (20 pmoles each), 1 μl of 10 mM dNTPs, 5 μl of 10 × buffer (20 mM Tris-Cl, 1.5 mM MgCl ₂ , 25 mM KCl, 0.1 mg / ml gelatin, based on 1 μl of RT product) pH 8.4), 1 unit of Taq DNA polymerase (Promega, USA) was added, and distilled water was added so that the total volume of the reaction solution was 50 μl. The polymerase chain reaction was performed using a DNA thermal cycler (Perkin Elmer 2400, USA). Was carried out. 10 μl of the amplified PCR product was electrophoresed on 2% agarose gel, and the density was measured and compared using a gel documentation system (Bio-Rad Lab, USA).

8) Injection of Recombinant Adenovirus and Its Application to Sciatic Nerve Injury Model in Rats

Male Sprague-Dawley rats (about 250-270 g) were anesthetized with pentobarbital (50 mg / kg) or Equithensin (5 ml / kg) and exposed to the left sciatic notch and sciatic nerve. Cut the nerve fibers except the arteries, or tie both sides with a # 9 suture and cut the middle with an iridectomy scissors. After 5 days of nerve injury, 2 μl (2 × 10 ⁸ pfu) of saline or each recombinant adenovirus (1 × ^{10 11} pfu / ml) was added to the sciatic nerve in the proximal part of the cell body and the distal stump of the nerve ending. On day 25 after injection, each of the sciatic nerve tissues was obtained, the length of the axon was measured, and the neurospecific marker protein was stained with the antibody. At 3 and 5 weeks after virus injection, neuronal regeneration is measured by behavioral observations before sacrificing white rats.

9) Measurement of axon length

Use a confocal laser scanning microscope (LSM 510, Carl Zeiss) to take images of the axons. Since a single axon cannot be taken at a time, it is divided into about 20 images from front to back of the axons per group. Three axon images are taken. Using the image examiner program, the axon length of each chapter is measured and summed to calculate the total length of one axon, and then the average of each group is used to determine the axon length.

10) Behavior Observation Experiment

Behavioral observation experiments were performed by hot plate test and neurological test. Each score was expressed as mean ± standard deviation, and the significance of statistical values was determined by one-way analysis of variance (ANOVA) and considered statistically significant at p <0.05.

The hot plate test, a test for avoiding response to thermal stimuli, involves placing a rat in a 20 cm diameter acrylic cylinder placed on a hot plate maintained at 52-54 ° C (seconds) until the rat moves on the hot plate. Was measured. Neurological examinations were performed with three types of tests: placing test, postural reflex test, and tactile placing test. In each test, scores were determined from 0 to 3 points, and each test was performed 20 times per mouse to calculate the condition and the number of times.

The flashing measurement measures the extent to which the hind limbs touch the ground while the mouse is moving forward in an equilibrium-free, unobstructed space (zero points if you drag your legs without touching, one point if 1/3 is reached, 2/3) 2 points if touches, 3 points if touches completely). The postural reflex test held the tail of the rat, lifted the hind legs and let the forelimbs touch the floor, releasing the tail, and when the hind legs touched the ground, observed that the hind feet were extended and extended to the floor. If it did not stretch, 0 was calculated. Tactile flashing measurements allow the mouse to sit on two-thirds of the body, including the forelimbs, at the corners of the desk, leaving only the hind legs floating in the air. Normal rats use their forelimbs and hind limbs to climb on the table, but if the sciatic nerve is damaged, they cannot climb because they cannot use their hind legs. Three points of touch and zero points of numbness were calculated. At this time, if the results of the intermediate score between 1 and 2 points, the rats were run about 20 times in each test, and the grades were determined by dividing the state and the number of times by the average.

Example 1 Identification of Neural Growth Factors Expressed in Peripheral Neuronal Regeneration

In order to develop a therapeutic agent for promoting nerve regeneration, a type of nerve growth factor whose expression is increased in the process of regeneration of damaged nerves was identified (see FIG. 1). After cutting the sinus nerve of the white rat, the sciatic nerve was harvested 5 days (5D), 25 days (25D), 5 weeks (5W), and RNA was isolated. As a result of investigation by reverse transcriptase-polymerase chain reaction (RT-PCR) using primers specific to each type of nerve growth factor, hiregulin (see <1) of <general test method of the present invention>, RNA rapidly increased 5 days after nerve injury and decreased at 25 days, but increased again after 5 weeks, when nerve regeneration occurred. Type II increased its expression level at 25 days after injury, but it was inadequate, and type III increased expression at the initial stage (5 days) after injury, but decreased after 5 weeks. Therefore, type I hyregulin is considered to be a suitable candidate as a therapeutic agent for promoting nerve regeneration.

Example 2 Preparation of Recombinant Adenovirus (HRGβE-Ad) to Produce and Secrete HRG Beta1 EGF-Stimulated Domain Peptides Extracellularly

1) Preparation of HRGβE-Ad

Based on the results of Example 1, the type I hyregulin was selected and only beta-type EGF-like domains known to be effective in neuronal differentiation and proliferation by binding to a double receptor were selected as therapeutic candidates. EFG-forming of HRG-β1 consisting of 62 amino acids by polymerase chain reaction from cDNA (NCBI accession number U02322 [gi: 408394]) encoding mRNA for HRG-beta1 (neu differentiation factor (NDF42a) in rats) CDNAs (nucleotides 1451-1646) encoding domain peptides (amino acids 172-232 and starting methionine) were amplified. At this time, it was designed to add a KpnI restriction enzyme site at the 5 'end and a BamH1 restriction enzyme site at the 3' end for cloning. 5'gctggtaccatgtccacatcaacatc3 'and 5'tcggatccttaatgcttgtagaagct3' were used as primers for amplifying the cDNA for the EFG-like domain peptide of HRG-β1. The nucleotide sequence encoding TGFβ secretion indicating peptide (msgpgtaact) includes the EcoRI restriction enzyme site at the 5 'end and the KpnI restriction site at the 3' end (5'aattc atgtcgggaccgagaactgcagca ggtac3 'and 5' ctgctgcagttcctggtcggcacat g3 '; The cDNA encoding the EFG-domain domain peptide of HRG-β1 amplified by PCR, and then fused using KpnI restriction enzyme sites, and the fusion sequences were EcoRI and BamH1. Restriction enzyme sites were used to clone between the pCMV promoter and polyadenylation of the SV40 virus in an adenoshuttle vector (see pHRGβE-adenoshuttle, hereinafter, FIGS. 2A and 2C). pHRGβE-adenoshuttle co-transfected 293 cells with pJM17 (Microbix, Canada), which contains the entire genome of adenoviruses, to induce recombination, thereby deleting the E1 site of adenovirus and secreting HRGβ-1 EGF in its place. Replication-defective recombinant adenoviruses with DNA encoding the sex domain peptides were prepared and named HRGβE-Ad (see FIG. 2B).

2) Identification of Recombinant Adenovirus (HRGβE-Ad)

Recombinant adenovirus HRGE-Ad isolated the viral genome from the virus plaque and confirmed that the EGF-peptide peptide of HRGβ was inserted using a polymerase chain reaction (see FIGS. 2C and 2D). In the PCR reaction using the primers (set1) corresponding to the sequences of the CMV promoter and the SV40 viral poly (A) signal, 600 bp of DNA was amplified and the primers (set2) corresponding to the inside of the EGF-like domain peptide of HRG-β1. 200bp of DNA expected in the PCR reaction was amplified. The primers of set1 were 5'gtgtacggtgggaggtcta3 '(CMV) and 5'ttgtaaccattattataagctgc3' (SV40), and the primers of set2 were 5'ggtaccatgtccacgact3 '(HRG-β1 EGF domain 1451-1468) and 5'ttaatgcttgtagaagct1' (HRG-G) Domains 1629-1646).

Example 3. Confirmation of HRGβE-Ad Promoting Effect from Neural Stem Cells to Functional Neurons

In this example, the neuronal progenitor cells HiB5 originating from the hippocampus of rat embryos were used to measure the effect of HRGβE-Ad on neuronal differentiation. HiB5 cells were made by retroviral infection of temperature sensitive SV40 T-antigens, so they split when cultured in DMEM medium with 10% serum at 34 ^o C, but transferred to 39 ^o C, the normal temperature of rats. Incubation in N2 medium, a serum-free medium, stops division. In the present invention, the recombinant virus was infected at 34 ^o C, which is a cell division condition, and replaced with N2 medium after 24 hours, and then cultured at 39 ^o C.

1) Promoting Differentiation of Neural Stem Cells by Infection of HRGβE-Ad

To confirm that neural stem cells differentiate into neurons by HRGβE-Ad, recombinant adenoviruses were infected with HiB5 cells at 100moi (multiplicity of infeciton) and cultured in serum-free medium. Fluorescent staining was performed using a secondary antibody attached with rhodamine, which was detected and fluoresced using an antibody against the red marker β-tubulin (see FIG. 3). To measure the effect of cells not infected with the virus used as a control or (a, b, c) simple recombinant adenoviruses, the recombinant adenovirus (LacZ-Ad) producing E. coli β-galactosidase was converted to 100moi. In infected cells (d, e, f), β-tubulin expression was low, whereas in HRGβE-Ad infected cells (g, h, I), β-tubulin expression was increased. The nucleus of the cell was double-stained with a blue fluorescent DAPI dye (a, d, g) and β-tubulin (b, e, h), and photographed to show HiB5 cells stained (c, f , i).

To investigate whether HRGβE-Ad promotes differentiation into neurons by inducing the expression of ErbB4, which is known to play an important role in neurite outgrowth, HRGβE-Ad is infected with HiB5 cells at 10 moi. Staining was performed using antibodies to Sesa (NF) and ErbB4 (see FIG. 4). HRGβE-Ad (e ~ h) showed more complex neurites than cells uninfected with virus (a ~ d), which stimulated the differentiation of neurons and promoted ErbB4 expression in these cells. The nucleus of the cell was stained with blue-colored DAPI (a, e) and the synthetase, which shows differentiation into neurons, was used with secondary antibody attached with rhodamine (b, f), and ErbB4 was secondary with FITC. (C, f) fluorescent staining using the antibody. Figures d and h overlap them in triplicates.

ErbB4 forms a heterodimer with ErbB2 and participates in signal transduction of the neuronal regeneration process. Therefore, to confirm whether HRGβE-Ad induces the expression of ErbB2 as well as ErbB4, HRGβE-Ad was infected with HiB5 cells at 10 moi and stained using antibodies to neuronal cells ErbB4 and ErbB2 (see FIG. 5). Increased expression of ErbB4 and ErbB2 was observed in cells infected with HRGβE-Ad (e-h) compared to cells not infected with virus (a-c) or cells infected with the same moi LacZ-Ad (d-f). Observed. ErbB4 was fluorescently stained with (b, e, h) using secondary antibodies with FITC (a, d, g) and ErbB2 with secondary antibodies with rhodamine. Figures c, f, and i overlap these two times.

Therefore, HRGβE-Ad differentiates adult neural stem cells into neural cells and significantly increases the expression of ErbB4, which plays an important role in neurogenesis, but also induces the expression of ErbB2, thus forming ErbB4 / ErbB2 heterodimers to grow neurites. It is expected to participate in signal transduction.

2) Effect of ErbB Receptor Activity on Peripheral Cells by HRGβE-Ad

EGF-like domain peptides of HRG-β1 produced by HRGβE-Ad could be secreted extracellularly and affected by surrounding cells using C6 cell lines derived from HiB5 cells and glioma (see FIG. 6). ). After 24 hours of HRGβE-Ad infection with HiB5 cells at 32 ^o C at 100 moi, the cells were transferred to 39 ^o C for differentiation conditions, followed by culture at 4 h (4 h), 1 day (1D), and 2 day (2D). Was taken. The culture medium of cells not infected with the virus (C) and the culture medium of cells infected with LacZ-Ad with 100 moi (LacZ-Ad) as a negative control group were commercially available recombinant GGF (rGGF) (product of Neomarker, Recombinant Human Heregulin β1). Protein Cat. # RP-318-P0A, USA) was used as a positive control. C6 cells were treated with culture medium or rGGF for 10 minutes, and C6 cells were eluted to obtain cell fluids. Cell extracts were immunoprecipitated by adding respective antibodies against ErbB2, 3, and 4 proteins, fractionated with SDS-polyacrylamide gel and transferred to Immobilon-P. In order to confirm the degree of phosphorylation of ErbB2, 3 and 4, immunoblot (Western blot) assay using anti-tyrosine phosphorylated protein antibody showed that HRGβE-Ad could phosphorylate ErbB3 from 4 hours after incubation at 39 ^o C. It can be seen that the degree of activity lasts until 2 days. This is similar to the activity of commercially available rGGF. Two days after infection with HRGβE-Ad, the culture medium of the cells (2D) efficiently induced ErbB4 phosphorylation, which was higher than that of rGGF but did not induce ErbB2 activity. It can be seen that it is activated. Therefore, HRGβE-Ad not only induces differentiation into neurons by infecting cells, but also secretes extracellularly, thereby promoting the differentiation of peripheral cells into neurons by binding and activating ErbB3 and ErbB4.

3) Differentiation of functional neurons into HRGβE-Ad and cell migration promoting effect

To investigate whether HRGβE-Ad promotes neuronal migration as well as to promote differentiation, such as increased neurites of infected or peripheral cells, double-cotin (DCX, a cell migration marker) in HRGβE-Ad-infected cells. expression of doublecortin) and gamma-aminobutylic acid (GABA) were examined by immunocytochemistry (see FIGS. 7 and 8).

FIG. 7 is a photograph of HiB5 cells stained with an antibody against β-tubulin as a neuronal marker and DCX as a cell migration marker (X200 magnification, indicator rod; 50 μm) to investigate the effect of HRGβE-Ad. It can be seen that the expression of β-tubulin and double-cotin is induced in cells infected with HRGβE-Ad with 10 moi (e ~ h) compared to cells not infected with virus (a ~ d). The nuclei of the cells were stained with blue DAPI (a, e), and β-tubulin, which represents differentiation into neurons, was used for secondary antibody with FITC (b, f), and double-cotin was used for rhodamine. (C, f) was fluorescent stained using the attached secondary antibody. Figures d and h overlap them in triplicates.

FIG. 8 is a photograph of HiB5 cells stained with an antibody to neurofibroblast (NF), a neuronal specific marker, and an inhibitory neurotransmitter GABA, a presynaptic marker, to investigate the effect of HRGβE-Ad. (X200 magnification, indicator bar; 50μm). It can be seen that the expression of NF and GABA is induced in the cells infected with HRGβE-Ad at 10 moi (e ~ h) compared to the cells not infected with the virus (a ~ d). The nucleus of the cell was stained with blue DAPI (a, e), and NF, which represents differentiation into neurons, was used for secondary antibody with FITC (b, f), and GABA was for secondary antibody with rhodamine. (C, f) was fluorescent stained using. Figures d and h overlap them in triplicates.

Therefore, HRGβE-Ad promotes the differentiation and migration of neural progenitor cells and is capable of differentiating into neurons with exhibited synaptic function. Therefore, HRGβE-Ad is a method of neuronal regeneration in the process of cell and gene therapy through transplantation of stem cells such as neural progenitor cells. You will be able to enhance your effectiveness.

Example 4. Confirmation of regeneration promoting effect of damaged peripheral nervous system by HRGβE-Ad

In humans, the central nervous system as well as the peripheral nervous system is difficult to regenerate. Schwann cells play an important role in the development and regeneration of the peripheral nervous system. During embryonic development, Schwann cells originating from the neural crest divide in advance along where the axon will occupy, so the axon of the peripheral nervous system grows dependent on the Schwann cell. Schwann cells, in particular, produce trophic factors that regulate neuronal survival and neurite growth. In addition, nerves secrete several types of heregulin from axons to enhance the survival of Schwann cells, control the ratio of axons to Schwann cells, and kill Schwann cells unaffected by axons. In the late stage of development, Schwann cells produce myelin sheaths and wrap the axons to complete the differentiation of Schwann cells.

In adult neurogenesis, when the peripheral nerves are injured, the distal stump at the nerve end at the site of injury gradually degenerates through a process known as Wallerian degeneration. At this point, the proximal stump from the injury site begins to regrow. Axons in the nerve endings of the injured area remove degenerated axons and myelin material, and axons in the cell body from the injured area create a new environment for axons to grow (Kwon, Y. Kim, Bhattacharyya, WV, Cheon). , K., Stiles, CD, and Pomeroy, SL (1997) Activation of ErbB2 during Wallerian degeneration of sciatic nerve, J. Neurosci . 17, 8293-8299).

Schwann cells immediately divide rapidly after nerve injury, which is thought to be promoted by loss of contact with axons or growth factors secreted by axons. If Schwann cells come into contact with axons during axon regrowth, they differentiate and regenerate myelin. In addition to interactions at the cell surface, Schwann cells can affect regenerating axons from a distance. The axon regenerates toward the axon side of the nerve endings, even 1 cm away from the nerve. At this time, the axon's crust movement occurs when the living Schwann cells exist in the axon portion of the nerve terminal side.

In the regeneration process of the peripheral nervous system, Schwann cells are first separated from the cut axons, and then dedifferentiation process is obtained, and the axons of nerve cells are regrown from the wound site, and the axons are regrown. The process of redifferentiation, which is wrapped in a myelin sheath, and the process of axon growth up to the muscle, and then the creation of neuromuscular junctions in the muscle cells can be divided into two types.

In the present invention, by cutting the sciatic nerve that passes the most nerve fibers in the peripheral nervous system to make a peripheral nerve damage model and then in the process of regeneration injecting HRGβE-Ad directly into the peripheral nerve was performed to apply to the gene therapy. After 5 days of sciatic nerve injury in rats, saline, LacZ-Ad, and HRGβE-Ad were injected into the axon of the cell body of the sciatic nerve and the axon of the nerve endings, respectively. Recombinant virus used was 2-6 × ^{10 8} pfu / ml. After injection, the sciatic nerve tissue was obtained at the indicated time to determine the effect of HRGβE-Ad on nerve regeneration.

1) Proliferation of Schwann Cells by HRGβE-Ad in the Injured Sciatic Nerve

To investigate the induction of Schwann cell proliferation during dedifferentiation after sciatic nerve injury, HRGβE-Ad was injected with virus after sciatic nerve and the expression of Schwann cell in sciatic nerve tissue on day 25 by immunohistochemistry. (See FIG. 9). Nerveofilament and Schwann, which are nerve-specific markers, compared to nerve tissues (d ~ f) injected with saline (a ~ c) or LacZ-Ad injected with HRGβE-Ad injection (a ~ c) It was found that the expression of S100, a specific marker of cells, was increased. The neurologist uses a primary antibody against pan-neurofilament (pan-NF) and a secondary antibody combined with FITC (a, d, g), and Schwann cells use a primary antibody against S100 and a secondary antibody bound with rhodamine. (B, e, h) staining and Figures c, f, i are superimposed. Therefore, the proliferation of Schwann cells in the sciatic nerve injected with HRGβE-Ad increases the dedifferentiation process after nerve injury by HRGβE-Ad.

2) HRGβE-Ad-induced axon growth effect on damaged sinus nerve

To investigate the effect of HRGβE-Ad on the induction of axon growth after sciatic nerve injury, the virus was injected after sciatic nerve cutting and the expression of GAP43, a specific marker of axon growth in sciatic nerve tissue on day 25, was detected. It was investigated by chemistry (see FIG. 10). Neurosa, which is a neuron-specific marker, compared to nerve tissue injected with HRGβE-Ad (Fig. 10 g-i) or saline injection (Fig. 10a-c) or LacZ-Ad-injected nerve tissue (Fig. 10d-f). NF-200) and GAP43 expression was increased. The neurologist uses primary antibodies against pan-200 and secondary antibodies bound to FITC (a, d, g), and axons use primary antibodies against GAP43 and secondary antibodies bound to rhodamine (b, e , h) staining and Figures c, f, i are superimposed.

Growth of axons by HRGβE-Ad in injured sciatic nerves was again demonstrated using immunoblotting (see FIG. 11). In the sciatic nerve injected with HRGβE-Ad after sciatic nerve cutting, 46 kD β-tubulin and 180 kD and 200 kD neuronal cell markers were compared with saline or LacZ-Ad, a control adenovirus. It can be seen that the expression of significantly increased. In addition, it was also found that GAP43, which shows axon growth, was significantly expressed in the sciatic nerve of rats injected with HRGβE-Ad compared to the control group. Since the amount of the structural protein actin (actin) was constant in the driving sample, it can be seen that the increased expression of β-tubulin, NF, and GAP43 indicating nerve growth is an effect of HRGβE-Ad.

In order to confirm the growth promotion of the nerve by HRGβE-Ad again, the length of the axon in the sciatic nerve tissue 25 days after virus injection was measured under a microscope (see Fig. 12, Table 1). When HRGβE-Ad was injected, the axon length was 14508.4 μm, which was increased by about 20% compared to the control group, and the P value was less than 0.05, which was statistically significant.

Table 1

Saline LacZ-Ad HRGβE-Ad Average length (μm) 12029.0 12725.6 14508.4 Standard Deviation (STDE) 477.69 34.71 104.65 Number of individuals (n) 3 3 3 p value <0.005

Therefore, injecting HRGβE-Ad into the damaged sciatic nerve promotes the proliferation of Schwann cells during neuronal dedifferentiation and subsequently promotes axon growth from neurons.

3) HRGβE-Ad Enhancement of Neuronal Recovery after Sciatic Nerve Injury

In the process of regeneration of damaged peripheral nerves, we investigated whether axons grew to muscle by HRGβE-Ad to increase the rate of nerve recovery. After 3 weeks and 5 weeks of HRGβE-Ad injection into the sciatic nerve of the cleaved white rats, hot plate test showed that rats injected with HRGβE-Ad avoided heat stimulation faster than the control group. (See FIG. 13, Table 2). At the 5th week, the time taken to avoid the stimulus was reduced to 84% in the LacZ-Ad group and 50% in the HRGβE-Ad group when the rats injected with saline were 100%. The group injected with HRGβE-Ad was found to be much improved compared to the control group.

[Table 2]

Saline LacZ-Ad HRGβE-Ad 3 weeks (2nd) 29.47 25.20 16.12 Standard Deviation (STDE) 2.3243243 4.7924528 1.9803921 Number of individuals (n) 15 15 15 5 weeks (2nd) 30.00 25.00 14.00 Standard Deviation (STDE) 2.889369 3.476892 1.357119 Number of individuals (n) 15 15 15 p value = 0.04938

In the neurological test (neurological test), the HRGβE-Ad injection group was better than the control group injected with saline or LacZ-Ad (Fig. 13, Table 3).

Table 3

Saline LacZ-Ad HRGβE-Ad 3 weeks 3 3.5 4.7 Standard Deviation (STDE) 0.457 0.475 0.255 Number of individuals (n) 15 15 15 5 Weeks 3.8095 4.5417 5.5429 Standard Deviation (STDE) 0.298 0.269 0.240 Number of individuals (n) 15 15 15 p value = 0.003329

The neurological examination consists of three types: placing test, postural reflex test, and tactile placing test, all designed to measure the recovery of the damaged sciatic nerve. The flashing test is a test that measures the number of hind limbs that touch the ground while the rat is moving forward, placing the rat in an equilibrium-free, unobstructed space. Postural reflex measurement is a test that measures whether the hind limbs can be touched by holding the hind legs, holding the hind legs and letting the forelimbs touch the floor. However, when the sciatic nerve is damaged, it does not feel so it does not change. Tactile flashing measurements place the mouse on the edge of the table so that only two-thirds of the body, including the forelimbs, is left in the air. Normal rats use the forelimbs and hind legs to climb on the table, but if the sciatic nerve is damaged, they cannot climb because they cannot use the hind legs. Therefore, HRGβE-A group showed good results on neurological examination, indicating that the recovery of damaged sciatic nerve is faster than the control group.

The above experiment suggests that HRGβE-Ad administration after a peripheral nerve injury promotes axon growth during neuronal regeneration, and the axon grows to the muscles, which in turn creates neuromuscular junctions in muscle cells, thereby improving the response to stimulation in the neurological examination. can do. Therefore, HRGβE-Ad has a function as a gene therapy agent for the purpose of nerve recovery after peripheral nerve injury.

Recombinant adenovirus according to the present invention secretes the EGF-like domain peptide of HRG beta 1 to promote the survival and differentiation of neural stem cells, thereby promoting neurite growth and neuronal regeneration. Therefore, the recombinant adenovirus of the present invention and the composition comprising the same are effective in the treatment of various kinds of degenerative neurological diseases or neuroinjury diseases, in particular, prevention of dementia, Parkinson's disease, Alzheimer's disease, epilepsy, stroke, peripheral nerve damage and the like. It is very useful for treatment and treatment with gene therapy.

<110> Industry Academic Cooperation Foundation of KyungHee University <120> Recombinant Adenovirus Comprising DNA sequence Encoding EGF-like          domain peptide of Heregulin beta1 and Pharmaceutical Composition          Comprising the Same for the Differentiation and Regeneration of          Nerve cells <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 189 <212> DNA <213> EGF-like domain peptide of Heregulin beta1 <400> 1 atgtccacga ctgggaccag ccatctcata aagtgtgcgg agaaggagaa aactttctgt 60 gtgaatgggg gcgagtgctt cacggtgaag gacctgtcaa acccgtcaag atacttgtgc 120 aagtgcccaa atgagtttac tggtgatcgt tgccaaaact acgtaatggc cagcttctac 180 aagcattaa 189 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> signal peptide <400> 2 atgtcgggac caggaactgc agca 24 <210> 3 <211> 219 <212> DNA <213> fusion of EGF-like domain peptide of Heregulin beta1 and signal peptide <400> 3 atgtcgggac caggaactgc agcaggtacc atgtccacga ctgggaccag ccatctcata 60 aagtgtgcgg agaaggagaa aactttctgt gtgaatgggg gcgagtgctt cacggtgaag 120 gacctgtcaa acccgtcaag atacttgtgc aagtgcccaa atgagtttac tggtgatcgt 180 tgccaaaact acgtaatggc cagcttctac aagcattaa 219 <210> 4 <211> 62 <212> PRT <213> EGF-like domain peptide of Heregulin beta1 <400> 4 Met Ser Thr Thr Gly Thr Ser His Leu Ile Lys Cys Ala Glu Lys Glu   1 5 10 15 Lys Thr Phe Cys Val Asn Gly Gly Glu Cys Phe Thr Val Lys Asp Leu              20 25 30 Ser Asn Pro Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly          35 40 45 Asp Arg Cys Gln Asn Tyr Val Met Ala Ser Phe Tyr Lys His      50 55 60 <210> 5 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> signal peptide <400> 5 Met Ser Gly Pro Gly Thr Ala Ala   1 5 <210> 6 <211> 72 <212> PRT <213> Fusion of EGF-like domain peptide of Heregulin beta1 and signal peptide <400> 6 Met Ser Gly Pro Gly Thr Ala Ala Cys Thr Met Ser Thr Thr Gly Thr   1 5 10 15 Ser His Leu Ile Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val Asn              20 25 30 Gly Gly Glu Cys Phe Thr Val Lys Asp Leu Ser Asn Pro Ser Arg Tyr          35 40 45 Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys Gln Asn Tyr      50 55 60 Val Met Ala Ser Phe Tyr Lys His  65 70

Claims (16)

A defective recombinant adenovirus comprising a DNA sequence encoding an EGF-like domain peptide of HRG (hyregulin) beta1 or an analog thereof. The adenovirus according to claim 1, wherein the DNA sequence comprises the nucleotide sequence of SEQ ID NO: 1. The adenovirus according to claim 1, wherein the EGF-domain domain peptide of HRG beta1 comprises the amino acid sequence of SEQ ID NO: 4. The method of claim 1, wherein the analog is a different type of rat selected from the group consisting of GGF (Nual differentiation factor), NIF (Acetylcholin receptor inducing activity), and sensory and motor neuron derived factor (SMDF). Adenovirus characterized in that the human HRG alpha / beta EGF- sex domain peptide. The adenovirus according to claim 1, wherein the analogue has a DNA sequence encoding the same or more than 90% homology with the nucleotide sequence of SEQ ID NO: 1, and has the activity of promoting the migration and differentiation of neural stem cells. The adenovirus according to claim 1, wherein the DNA sequence further comprises a DNA sequence encoding a secretory indication peptide together with a sequence encoding an EGF- Sexual domain peptide of HRG beta1. 7. The adenovirus according to claim 6, wherein the DNA sequence encoding the secretion indicator peptide comprises the nucleotide sequence of SEQ ID NO: 2. The adenovirus according to claim 1, further comprising a viral promoter capable of expressing the DNA sequence. 9. The adenovirus of claim 8, wherein the viral promoter is a CMV promoter. The method of claim 1, characterized by a lack of a portion of the genome required for replication in the target cell, characterized in that the deficient portion is selected from E1, E3, E4, and L1-L5 genes. Adenovirus, 11. A pharmaceutical composition for the treatment and differentiation of nerve cells comprising one or more defective recombinant adenoviruses according to any one of claims 1 to 10, neurite growth promotion, regeneration or nerve damage, and neurological diseases. 12. The composition according to claim 11, wherein the neurons are neural stem cells. The composition of claim 11, wherein the nerve injury, nerve disease is brain injury, brain disease, peripheral nerve injury, atrophic axon sclerosis, or peripheral neurological disease. The composition of claim 13, wherein the brain injury or brain disease is dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, stroke, ischemic brain disease, or degenerative brain disease. 12. The composition of claim 11, wherein said composition is in injectable form. 12. The composition of claim 11, wherein said defective recombinant adenovirus is comprised between 10 ⁶ and 10 ¹³ pfu / ml.

Images