KR20060136417A - Nucleic acid sequencing by raman monitoring of uptake of nucleotides during molecular replication - Google Patents

Abstract

The methods and apparatus disclosed herein are useful for the detection of nucleotides, nucleosides, and bases, and nucleic acid sequencing. The method includes detection of nucleotides, nucleosides or bases using surface enhanced Raman spectroscopy (SERS) or surface enhanced coherent anti-stokes Raman spectroscopy (SECARS). Detection may be part of a nucleic acid sequencing reaction to detect adsorption of deoxynucleotide triphosphate during nucleic acid polymerization reactions, such as nucleic acid sequencing reactions. The nucleic acid sequence of the initial strand synthesized, and the complementary sequence of the template strand, can be determined by tracking the order of incorporation of nucleotides during the polymerization reaction. Methods of augmenting the SERS signal of nucleotides or nucleosides by cleaving bases from sugar moieties are provided. Also provided are methods of detecting single base repeats.

Description

NUCLEIC ACID SEQUENCING BY RAMAN MONITORING OF UPTAKE OF NUCLEOTIDES DURING MOLECULAR REPLICATION

The present invention relates to the detection and analysis of biomolecules, and more particularly to the detection and sequencing of nucleic acids.

Genetic information is stored in the form of very long molecules of deoxyribonucleic acid (DNA) that are organized into chromosomes. The human genome contains approximately three billion bases of DNA sequence. This DNA sequence information determines the multiple properties of each sequence. Many common diseases are based at least in part on changes in DNA sequence.

Determination of the overall sequence of the human genome provided the basis for identifying the genetic basis of such diseases. However, considerable experiments are being conducted to identify the genetic variants associated with each disease. This experiment requires DNA sequencing of portions of the chromosome in individuals or families that exhibit the disease to identify specific changes in the DNA sequence that promote the disease. Ribonucleic acid (RNA), an intermediate molecule in genetic information processing, can also be sequenced to identify the genetic base of various diseases.

Current sequencing methods require many copies of the template nucleic acid of interest to be generated, cut into duplicate fragments, and sequenced, and after sequencing the duplicate DNA sequences are assembled into complete genes. This process is cumbersome, expensive, inefficient and time consuming. It also typically requires the use of fluorescent or radioactive labels, which can possibly pose safety and waste disposal issues. Thus, there is a need for improved nucleic acid sequencing methods that are cheaper, more efficient, and safer than current methods.

1 illustrates one exemplary device 10 (not drawn to scale) and a DNA sequencing method in which nucleic acid 13 is sequenced by monitoring the adsorption of nucleotides 17 from solution during nucleic acid synthesis.

2 shows Raman spectra of all four deoxynucleotide monophosphates (dNMPs) at 100 mM concentration using a data collection time of 10 seconds. Characteristic Raman emission peaks are shown for each different type of nucleotide. Data was collected without labeling or surface enhancement of nucleotides.

Figure 3 shows SERS detection of 1 nM guanine obtained from dGMP by acid treatment according to Nucleic Acid Chemistry, Part 1, L. B. Townsend and R. S. Tipson (ed.), Wiley-Interscience, New York, 1978.

4 shows SERS detection of 100 nM cytosine.

5 shows SERS detection of 100 nM thymine.

6 shows SERS detection of 100 pM adenine.

7 shows comparative SERS detection of a 500 nM solution of deoxyadenosine triphosphate (dATP-fluorescein) covalently labeled with fluorescein (top trace) and unlabeled dATP (bottom trace). dATP-fluorescein was obtained from Roche Applied Science (Indianapolis, Indiana). A strong increase in SERS signal was detected in fluorescein labeled dATP.

8 shows SERS detection of 0.9 nM (nanomol) solution of adenine. The detection volume was estimated to be between about 100 and 150 femtorators, including approximately 60 molecules of adenine.

9A shows using dATP 50 to determine the presence of nucleotides at target locations of a population of template nucleic acid molecules 60 immobilized on a solid substrate 70. The SERS signal detected from the pre-reaction mixture is shown in FIG. 9B, where the SERS signal of dATP is detected. 9C shows the SERS signal from the mixture after reaction, from which no signal is detected.

10 is a schematic diagram of a microfluidic chip for multiple sequencing.

11 is a schematic diagram of an alternate design of the mixing chamber 180.

12A-12D show embodiments of the methods disclosed herein for determining the presence of nucleotides at a target position of a template nucleic acid molecule. 12A shows the template strand 60 immobilized on the substrate 70 and shows the primer 90 hybridized to the template strand 60, wherein the nucleotides 3 'adjacent to the primer binding site are Target location 65. In FIG. 12B, dATP 50 and polymerase 95 are added to nucleic acid template strand 60. In FIG. 12C, dTTP 51 and polymerase 95 are added to template strand 60 together with hybridized primer 90. 12D shows thymidine (T) nucleotides added to target position 65 of template nucleic acid strand 60.

FIG. 13 shows SECARS spectra of 90 pM dAMP (corresponding to approximately six molecules).

14 shows SECARS spectra of silver / salt solution controls.

The disclosed methods and devices are useful for rapid automated detection of target molecules including purine or pyrimidine bases, such as nucleotides and nucleosides. The method and apparatus relate to the discovery that a relatively near zero number of copies of purine and pyrimidine bases, in some cases a single copy, can be detected using SERS. In addition, the methods and apparatus provide that the sensitivity of Raman detection of a target molecule comprising pyrimidine and purine bases cleaves purine or pyrimidine bases from the target molecule prior to detection, and / or in combination with SERS, particularly for the detection of pyrimidine bases. Related to the discovery that it can be increased by using coherent anti-stokes Raman spectroscopy (CARS).

The methods and apparatus disclosed herein are typically used in nucleic acid sequencing reactions that measure nucleotide adsorption. The nucleic acid sequencing reactions disclosed herein compare to conventional sequencing methods, including faster sequence data acquisition rates, reduced sequencing costs, greater efficiency in operator time required per sequence data unit, and the ability to read long nucleic acid sequences in a single sequencing operation. Provide advantages. Also provided are improved methods for detecting consecutive repeats of the same nucleotide in a nucleic acid sequencing reaction that measures nucleotide adsorption.

Thus, there is provided a method of detecting a target molecule comprising a purine or pyrimidine base, wherein the purine or pyrimidine base is separated from the remainder of the purine or pyrimidine base target molecule and the separated purine or pyrimidine base is detected using Raman spectroscopy. In certain aspects Raman spectroscopy is surface enhanced Raman spectroscopy (SERS) or SECARS.

The method may comprise isolating the target molecule prior to separating the purine base or pyrimidine base from the target molecule in certain aspects. The isolation step is included in the aspects from which the target molecule is obtained from an environment comprising, for example, another molecule that generates a Raman signal.

Methods of separating the purine base or pyrimidine base from biomolecules in which the target molecule, typically purine or pyrimidine, are bound to the sugar moiety are known in the art. In aspects where the target molecule is a nucleotide or nucleoside, the term “separating” is used to encompass all organic and enzymatic methods for removing a base from the remainder of the nucleotide or nucleoside. For example, if the target molecule is a nucleoside or nucleotide, deglucosylation with 0.2 N HCl at> 60 ° C. for 20 minutes can be used to cleave the base from the sugar backbone. Alternatively, enzymes such as DNA glycosylase, phosphorylase, or nucleoside hydrolases can also be used. Deglucosylation is performed before the base is deposited on the SERS substrate. The base need not be separated from the sugar moiety before it is deposited on the SERS substrate.

In certain aspects, the method further comprises purine base or pyrimidine on a surface enhanced Raman spectroscopy (SERS) substrate before or after separating the base from the target molecule, and before detecting the purine or pyrimidine base separated using SERS. Further comprising depositing a base. Methods of depositing nucleotides, nucleosides, and purine and pyrimidine bases on SERS substrates are discussed in more detail herein.

Target molecules for these aspects typically include an interfering moiety that interferes with Raman signal generation by the purine or pyrimidine bases of the target molecule. For example, the interference moiety can be a sugar moiety such as ribose or deoxyribose, for example 2-deoxyribose. In certain aspects of these embodiments of the invention, the target molecule is a nucleotide phosphate, nucleotide or nucleoside. Examples of target molecules that can be detected according to the method include nucleic acids such as polynucleotides or oligonucleotides, and oxy or deoxy-nucleotide mono-, di- or triphosphates. For example, the target molecule can be one or more dNTPs. In addition, the target molecule may be a nucleoside comprising a purine or pyrimidine base.

In certain aspects of embodiments including depositing a base on a SERS substrate before or after separating the target molecule, the method can be used to purine or pyrimidine bases separated using coherent anti-stokes Raman spectroscopy (CARS). It further comprises detecting. Aspects of the invention including detecting using CARS after depositing molecules on a SERS substrate are referred to herein as SECARS. Accordingly, a method of detecting a target molecule comprising a purine base or a pyrimidine base is provided which comprises depositing the target molecule on a surface enhanced Raman spectroscopy (SERS) substrate prior to detecting the target molecule by CARS. Embodiments of the invention comprising detection by both SE CARS optionally include separating the purine or pyrimidine base from the remainder of the target molecule prior to detection, as described above, to enhance the Raman signal.

As is known, CARS detects coherent anti-stokes Raman scattering, a nonlinear optical-like form of spontaneous Raman scattering. In this technique, a special Raman transition is driven coherently by two laser fields, a so-called "pump laser" and a "Stokes laser" that generates an anti-Stokes signal field (Muller et al., CARS microscopy with folded Box phasematching. J. Microsc. 197: 150-158, 2000). The coherent nature of the process allows the laser field to be efficiently coupled to a particular vibration mode, thereby increasing the signal from this mode by many classes.

In certain aspects of the method, particularly including detecting the target molecule using SECARS, the target molecule comprises a pyrimidine base. For example, the target molecule can be a nucleotide phosphate, nucleotide or nucleoside comprising a pyrimidine base such as thymine, uracil or cytosine. As described in the Examples herein, the use of SERS alone to detect pyrimidine results in reduced signal levels compared to the signal levels obtained for purine bases. Therefore, using CARS to detect molecules after deposition on SERS substrates provides a more sensitive format than using SERS alone.

In certain aspects, the target molecule is "substantially composed" of base. In these aspects, other groups may be attached to bases that are not normally bound to bases in nucleotides. For example, the base may comprise additional functional groups or labels.

In certain aspects nucleotides, nucleosides or bases are deposited on one or more silver nanoparticles, such as nanostructured SERS substrates, for example about 5 to 200 nm in diameter. In these aspects, the nucleotides, nucleosides or bases may be contacted with both alkali-metal halide salts such as lithium chloride and silver nanoparticles. Lithium chloride can be used at a concentration of, for example, about 50 to about 150 micromolar, about 80 to about 100 micromolar, or in some more specific embodiments about 90 micromolar.

In certain aspects, a single molecule of a base, for example adenine, is detected. To enhance the signal of the base, for example in embodiments where the base is pyrimidine, the base can be combined with a Raman label.

In certain aspects, methods of detecting target molecules are used in nucleic acid sequencing methods. For example, in these aspects, the target molecule is deoxynucleotide triphosphate. Thus, in these embodiments, a target molecule, such as deoxynucleotide triphosphate, is used for sequencing reactions with template nucleic acids before purine or pyrimidine bases are separated from the target molecule and deposited on the SERS surface. In these aspects, for example, the template nucleic acid or sequencing primer to be sequenced is fixed, in contact with the sequencing reaction mixture component comprising deoxynucleotide triphosphate, so that the deoxynucleotide triphosphate molecule is not incorporated into the nascent strand. Form an initial strand complementary to the target nucleic acid in the mixture after the reaction comprising a. A post-reaction mixture comprising deoxynucleotide triphosphate molecules not incorporated into the initial strand is deposited on the SERS substrate and Raman scattering is detected. In these embodiments, there is no need to isolate deoxynucleotide triphosphate (dNTP) prior to detecting isolated purine or pyrimidine bases. The reduction in the intensity of the Raman signal generated in the post-reaction mixture, as opposed to when anticipated or determined in the pre-reaction mixture comprising all reactants except the template nucleic acid, is due to the incorporation of the nucleotides of dNTP into the initial strand, thus complementing the template nucleic acid. Indicates the presence of nucleotides of.

Raman labels can be used to increase the signal generated by dNTP or other nucleotides or nucleosides. In certain aspects, the nucleotides are bound to a Raman label, such as a phosphor or a nanoparticle, before being detected by Raman spectroscopy. The purine or pyrimidine base may be bound to the Raman label before or after separation from the remainder of the target molecule.

In certain aspects of the invention, the target molecule is isolated from the biological sample before it is detected by the methods provided herein. Biological samples are, for example, urine, blood, plasma, serum, saliva, semen, feces, saliva, cerebrospinal fluid, tears, mucus and the like.

In certain aspects, the biological sample is a sample from a mammalian subject, eg, a human subject. The biological sample can be virtually any biological sample, especially a sample comprising RNA or DNA from a subject. Biological samples include, for example, 1 to 10,000,000; 1000 to 10,000,000; Or a tissue sample comprising 1,000,000 to 10,000,000 somatic cells. The sample need not include complete cells, as long as it contains sufficient RNA or DNA for the methods provided herein, which in some aspects only requires one molecule of RNA or DNA. In accordance with aspects of the invention wherein the biological sample is a sample from a mammalian subject, the biological or tissue sample can be a sample from any tissue. For example, tissue can be obtained by surgery, biopsy, swabs, feces or other collection methods.

In other aspects, the biological sample includes a pathogen, eg, a viral or bacterial pathogen. In certain aspects, the template nucleic acid is purified from the biological sample before contacting the probe. Isolated template nucleic acid can be contacted with the reaction mixture without being amplified.

In another embodiment, a known number of copies of a template nucleic acid molecule, typically a single strand of template nucleic acid molecule, is contacted with a reaction mixture comprising a primer, a polymerase and an initial concentration of a known first nucleotide A template, which is used to form a mixture after the reaction, wherein the adsorption of the first nucleotide to the initial strand, as discussed in more detail herein, is used to determine whether there are multiple copies of the nucleotide at the target location. Methods of detecting the same nucleotides at consecutive target positions in a nucleic acid molecule are provided. According to this method, after incubation to allow the initial strand to be synthesized by the polymerase, after forming the post-reaction mixture, the post-reaction mixture is then deposited on a SERS substrate and the concentration of the first nucleotide in the post-reaction mixture is determined. It is then used to detect the adsorption of the first nucleotide to the initial nucleic acid strand by the detection of the SERS signal of the mixture after the reaction. The primer or template nucleic acid is immobilized on the surface of the reaction chamber and the 3 'end of the primer binds to the template nucleic acid molecule upstream of the 5' nucleotide of the continuous target position. The method can be repeated with additional nucleotides, for example, until a decrease in the SERS signal is detected.

In certain aspects, the nucleotide is dNTP. For example, dATP can be a first nucleotide and subsequent cycles of the method can be performed using, for example, dGTP, dCTP and dTTP, respectively. The reaction mixture is a nucleic acid polymerization reaction mixture as known in the art. The reaction mixture typically comprises nucleotides in dNTP form, as well as primers and polymerases in buffer, as discussed herein.

In certain aspects, the first nucleotide can be isolated from the mixture after the reaction prior to being deposited on the SERS substrate. In addition, purine or pyrimidine bases may be separated from the ribose or deoxyribose portion of dNTP, as discussed herein, before being deposited on the SERS substrate and detected by the SERS.

The copy number of the template nucleic acid molecule, and the concentration of nucleotides can be determined using methods known in the art (see, eg, Sambrook et al. (1989)). For example, nucleic acid quantification can be determined using spectrophotometric measurements at wavelengths of 260 and 280 nm, or by measuring fluorescence emitted by ethidium bromide molecules inserted into the nucleic acid. The measurement can be compared to similar measurements on a series of samples of nucleic acid of known concentration to assess the concentration and copy number of template nucleic acid molecules and nucleotides. Alternatively, the relative concentration can be determined based on the SERS signal strength measured before and after the polymerization reaction.

In certain aspects, the copy number of the template nucleic acid molecule is 1/20, 1/10, 1/5, 1/4, 1/3, 1/2 or approximately of the copy number of the first nucleotide in contact with the template nucleic acid molecule. Same (ie within 10%). For example, as shown in FIG. 9A, approximately the same number of copies of template nucleic acid molecule 60 and dNTP 50 are provided, and template nucleic acid molecule 60 is immobilized to substrate 70 in reaction chamber 80. In aspects that follow, the SERS signal in the mixture after the reaction (FIG. 9C) is much less or undetectable than the SERS signal generated for the initial concentration of dNTP (FIG. 9B).

In certain aspects, after the first nucleotide is first detected using SERS, the additional first nucleotide is contacted with the template nucleic acid molecule. This is achieved, for example, by contacting the target nucleic acid molecule with the same second reaction mixture as the first reaction mixture to form a mixture after the second reaction. The purine or pyrimidine base isolated from the second post-reaction mixture or from the second post-reaction mixture is then deposited on the SERS substrate and detected using the SERS.

Detection of the same nucleotide at consecutive target positions is facilitated by contacting the template nucleic acid molecule with an additional molecule of the first nucleotide. For example, the template nucleic acid molecule can be contacted with approximately the same number of copies of the first nucleotide, and after reaction the mixture can be deposited and detected using SERS. The template nucleic acid molecule can then be detected as an additional copy of the first nucleotide in the second reaction mixture to form the mixture product after the second reaction. The second reaction mixture is then deposited on the SERS substrate and the first nucleotide is again detected using the SERS. The decrease in sensitivity of the SERS signal relative to the expected SERS signal indicates that the template nucleic acid molecule contains identical nucleotides at consecutive target positions. In this example, a relative concentration based on Raman signal strength is sufficient, without having to determine the absolute concentration of the first nucleotide in the reaction mixture. Various variations of these aspects can be envisioned. Contacting the target nucleic acid molecule with additional nucleotides also helps to ensure that complementary strands have been incorporated into all copies of the template strand synthesized by the polymerase.

In certain aspects of this embodiment of the invention, the first nucleotide is detected using SECARS (ie, coherent anti-Stokes Raman spectroscopy (CARS) after depositing the first nucleotide on a SERS substrate). As indicated above, in certain aspects SECARS is used as a detection method in the methods provided herein.

In certain embodiments, the Raman label is bound to each nucleotide, as discussed in more detail herein, to enhance the Raman signal of the nucleotide. The Raman label may be bound to all of the nucleotides or the Raman label may be bound to only pyrimidine nucleotides, for example. These aspects of the invention relate to data provided in the Examples herein that indicate that under certain conditions more pyrimidine molecules than purine molecules are required to reach the detection limit. In certain aspects, the Raman label is a phosphor.

In another embodiment, a detectable number of template nucleic acid molecules in a reaction chamber are contacted with the reaction mixture and incubated to allow primers to bind to the template nucleic acid to form a post-reaction mixture, which is deposited on a SERS substrate and reacted. A method is provided for determining the presence of a nucleotide at a target location of a template nucleic acid molecule, typically a single strand of nucleic acid molecule, which comprises detecting the first nucleotide in the mixture using SERS. Reduction of the intensity of the Raman signal in the mixture after the reaction confirms the extension reaction product, thereby confirming the presence of nucleotides at the target position. In certain aspects, to enhance the Raman signal, a cleavage product of the first nucleotide is deposited on the surface enhanced Raman spectroscopy (SERS) surface before generating the Raman signal from the post-reaction mixture.

The reaction mixture comprises a primer, a polymerase, and an initial concentration of first nucleotides, typically deoxynucleotide triphosphate (dNTP). Primers or template nucleic acids are typically immobilized on the surface of the reaction chamber.

In certain aspects, the method is repeated using different nucleotides until nucleotide presence is confirmed. For example, dATP may be a first nucleotide and subsequent cycles of the method may be performed using, for example, dGTP, dCTP and dTTP, respectively. In these aspects, the substrate is typically washed before it is contacted with the second, third or fourth nucleotides. Optionally, once dNTPs are incorporated into the initial strand, additional copies of the incorporated dNTPs can be introduced, for example, into template nucleic acid molecules to detect nucleotide repeats as discussed herein. The method is then optionally repeated to confirm the presence of additional nucleotides in the additional target nucleotides of the template nucleic acid molecule, for example, until the entire template nucleic acid molecule is sequenced.

As disclosed herein, SECARS can be used to increase the sensitivity of the assay. In other aspects, the purine and pyrimidine bases are separated from the sugar portion of the nucleotides before the base is detected by SERS or SECARS.

In certain aspects, a sample of an initial pre-concentration concentration of nucleotides is deposited on a SERS substrate prior to nucleotides being included in the reaction mixture, or after nucleotides are included in the reaction mixture in the absence of template nucleic acid molecules. Detect. The intensity of the determined SERS spectrum from the pre-reaction concentration is compared with the post-reaction concentration. Statistically significant reductions in intensity between post-reaction and pre-reaction concentrations identify extended reaction products, thereby confirming the presence of nucleotides at the target site. This aspect of the invention can be omitted if the concentration of nucleotides, typically dNTPs, is known and well controlled.

Alternatively, a mixture of dNTPs and internal control molecules is provided in the reaction mixture. After incubation, SERS spectra of both dNTPs and internal controls can be detected. The relative intensities of dNTPs and internal controls can be measured to determine post-reaction concentrations of dNTPs. The internal control molecule may be a different type of nucleotide that is not used in the method of determining the nucleotide presence. Examples of such internal controls include, for example, 8-bromoadenine diphosphate (Altcorp, Lexington, KY). Other nucleotides with modified bases and thus different signals can also be used (eg, Glen Research, Sterling, VA.) Such compounds are incorporated into extension products and produce different Raman spectra. The signal can be enhanced by the removal of phosphate, so that the modified base can be used as an internal control in all steps of the method.

In the methods of these aspects of the invention, the incubation time for the formation of the product after the reaction is sufficient to allow the template nucleic acid to be contacted by the reaction mixture components. The rate at which the reaction mixture components contact the template nucleic acid, and thus the minimum incubation time, is affected by a number of factors. These factors include the concentration of template nucleic acid, the concentration of primers and nucleotides, the rate of movement of the reactants through the reaction chamber, and the size and shape of the reaction chamber. These factors can all be altered to assume that the incubation time is sufficient to allow the template nucleic acid molecule to contact the reaction component.

Incubation times for the formation of reaction products that depend on the factors discussed above can range from 1 millisecond to 1 hour, and typically range from 100 milliseconds to 10 minutes. For example, in certain aspects the incubation time is 100 milliseconds; 1, 2, 3, 4, 5, 10, 15, 20, 30, 45 or 60 seconds; Or 2, 3, 4, 5, 6, 7, 8, 9 or 10 minutes.

The number of template nucleic acid copies is in the range of 1 to 100,000. In aspects of the present invention in which only adenosine and guanosine moieties are detected, template copy can range from 1 to 10,000. In certain aspects of the invention, the method is carried out using only adenosine and guanosine nucleotides by performing the reaction separately from each strand of the template nucleic acid. In these aspects, only purine containing nucleotides are used, but since both strands are analyzed, the presence of any nucleotide at the template position can be detected.

Embodiments in which the nucleotides used in the method comprise purine and pyrimidine, for example dATP, dGTP, dCTP and dTTP are used, or in which only pyrimidine is included, at least 10,000 of the template nucleic acid molecule, 20,000, 30,000, 40,000, 50,000, 75,000 or 100,000 copies are typically used. In certain aspects, pyrimidine nucleotides are detected using SERS and CARS to increase the sensitivity of detection.

As indicated above, the incubation time required for the template nucleic acid molecule to contact the reaction mixture components is influenced by the rate at which the reactants move through the reaction chamber. Various forces can be used to move the reactants in the reaction chamber as shown herein. For example, hydraulic, thermal or electrical forces can be used. In addition, pressure or vacuum may be used to move the reactants through the reaction chamber.

As indicated above, the time required for the template nucleic acid molecule to contact the reaction mixture components is influenced by the shape and size of the reaction chamber. The microfluidic and nanofluidic phases that can be used as shown herein to classify and isolate template nucleic acid molecules include those of various embodiments disclosed herein, including methods for determining the presence of nucleotides at a target location of a template nucleic acid molecule. Used in the method. In these embodiments, at least one dimension is in the range of 7 nanometers to 100 millimeters. In general, these embodiments reduce the incubation time required compared to larger reaction chambers. In certain aspects, the reaction chamber is at least 100 nanometers in one or more dimensions, including, for example, 50 nm, 25 nm, 20 nm, 15 nm, 10 nm, 9 nm, 8 nm or 7 nm.

In other aspects of the invention, the method is performed using only purine residues. This method is based on the observation that purine residues under certain conditions can be detected with higher sensitivity than pyrimidine residues, as described in the Examples herein. In this aspect of the invention the method is performed twice for the target nucleotide position, using ATP and dGTP simultaneously as the first nucleotide and the second nucleotide. The method is then repeated using complementary strands of template nucleic acid molecules immobilized in the second reaction chamber and again using dATP and dGTP simultaneously as the first and second nucleotides. According to this embodiment, using only purine nucleotides, the presence of any nucleotide at the target position can be determined.

As shown in FIG. 10, the methods provided herein provide multiple devices for nucleic acid sequencing, such as microfluidic devices 300, such as microfluidic chips that themselves form another embodiment of the invention. It can be performed as an analysis. Microfluidic chips typically have a polymerase reservoir 150, a buffer reservoir 160, a series of dNTP reservoirs 110, 120, 130, 140, 150, 160, And a series of reagent reservoirs, optionally including a primer or template nucleic acid molecule reservoir 155. In some examples, primers and / or template nucleic acid molecules can be included on a chip. The apparatus further includes a mixing chamber 180 in fluid communication with the series of reagent reservoirs, where reagents from the series of reagent reservoirs are mixed in the mixing chamber 180 to form a reaction mixture. The device also includes one or more reaction chambers 190 comprising immobilized template nucleic acids or immobilized primers. One or more reaction chambers 190 are in fluid communication with the mixing chamber 180. In certain aspects the one or more reaction chambers 190 are less than 100 nanometers in one or more dimensions and / or a series of dTNP reservoirs 110, 120, 130, 140, 150, and ( 160 includes only purine dNTP reservoirs 110 and 120. The apparatus in further aspects, between the dNTP reservoirs 110, 120, 130, 140, 150, 160 and the mixing chamber 180; Primer or template nucleic acid molecule reservoir 155 and reaction chamber 190 and / or a population of valves 210 for regulating flow between mixing chamber 180 and reaction chamber 190.

The method of the present invention carried out in the device shown in FIG. 10 involves contacting a reaction mixture with a detectable number of template nucleic acid molecules in a reaction chamber 190, also referred to as an incubation chamber. The components of the reaction mixture include a series of reservoirs including optional primer reservoir, polymerase reservoir 150, and buffer reservoir 160, and dATP reservoir 110, dGTP reservoir 120, dCTP reservoir 130 and dTTP reservoir ( 140) and a series of deoxynucleotide (dNTP) reservoirs. The flow of reaction mixture components is regulated by a series of valves 210. The reaction mixture component comprising one of the four dNTPs moves to mixing chamber 180 from which it flows into one of a series of reaction chambers 190. Each reaction chamber may comprise multiple copies of different single stranded template nucleic acid molecules immobilized on the reaction chamber surface. The reaction chamber as discussed above can be a micro- or nano-sized yarn, for example a yarn that is 100 nm or less in one or more dimensions. The remaining solution chamber may have a feed line for the SERS substrate and the LiCl solution (not shown). Alternatively, there may be a detection chamber before the solution enters a waste line (not shown). In the detection chamber, the residual solution from each residual solution chamber is mixed with the SERS substrate and the LiCl solution sequentially and flows, and is detected by the laser device. Excess solution may be captured in the remaining solution chamber 200 and guided through waste line 170. 11 shows reagent from a reservoir including dNTP reservoirs 110, 120, 130 and 140 (not shown) and polymerase reservoir 150 flows through a series of valves 210, An alternative design for mixing chamber 180 is shown, which is mixed with buffer from buffer reservoir 160 before being added to mixing chamber 180. In certain aspects, dNTPs are mixed with polymerase separately in a mixing chamber.

In other aspects of the invention, the dNTP reservoir contains only purine nucleotide triphosphates such as dGTP and dATP. These aspects of the microfluidic chip of the present invention can be used to perform a method of detecting nucleotide presence using only purine residues, as discussed herein.

In other aspects, the reaction chamber of the device is in fluid communication with a SERS chamber comprising a surface enhanced Raman spectroscopy (SERS) substrate. The device may also be part of a detection system comprising a Raman light source and a Raman spectrometer in optical and / or operative communication with the SERS seal substrate. In certain aspects, Raman light sources and Raman spectrometers can be designed for CARS analysis. Raman light sources and Raman spectrometers designed for CARS analysis are known in the art.

Light sources are typically laser lights known in the art and discussed in more detail herein. Light from the light source is projected onto the SERS substrate so that the detection unit in the SERS spectrometer detects the Raman signal from the post-reaction product, such as dNTP or its cleavage product, such as free purine or pyrimidine base. In certain aspects of the invention, the Raman detection unit can detect one or more nucleotides or bases such as adenosine at the single molecule level. In addition, in certain aspects, the nucleotides flow into the channel forming the SERS thread in the reaction chamber. The inner surface of the channel may comprise silver, gold, platinum, copper or aluminum mesh.

In another embodiment, the method comprises contacting one or more template nucleic acid molecules with primers, nucleotides and polymerases to form a reaction mixture, synthesizing one or more complementary strands from nucleotides, and detecting nucleotides using Raman spectroscopy. As a method of sequencing nucleic acids, a method is provided in which a decrease in the concentration of nucleotides in the reaction mixture after synthesis of the complementary strands indicates that the nucleotides have been incorporated into the complementary strands. The sequence of the template nucleic acid is determined from the nucleotides incorporated into the complementary strands.

In a method for determining the presence of nucleotides at a target position, for example, the target position can be the site of a polymorph, such as a single nucleotide polymorph (SNP). Polymorphs are allelic variants that occur in a population. The polymorph can be a single nucleotide present at one position or an insertion or deletion of one or several nucleotides. Thus, a single nucleotide polymorph (SNP) is a population of one or two, three or four nucleotides present (ie, adenosine, cytosine, guanosine or thymidine) at one particular location in the genome, such as the human genome. It is characterized by its presence within. As set forth herein, in certain aspects the methods of the present invention provide for the detection of nucleotide presence at the SNP position or detection of both genomic nucleotides at the SNP position for a diploid organism such as a mammal. In addition, the presence of nucleotides in one or more SNP positions, such as 2, 3, 4, 5, 10, 15, 20, 25, 50 or more SNP positions, may be determined in a single reaction. For example, the SNP position can be a collection of SNP positions.

In certain aspects, the nucleotide is separated from the template nucleic acid molecule before the nucleotide concentration is measured, as discussed in more detail herein. In addition, a single type of nucleotide is exposed to the template at one time, in certain instances. Alternatively, all four types of nucleotides may be exposed to the template at the same time.

In certain embodiments, the Raman label is bound to each nucleotide to enhance the Raman signal of the nucleotide, as discussed in more detail herein. The Raman label may be bound to all nucleotides or the Raman label may only be bound to pyrimidine nucleotides, for example. These aspects of the invention relate to data provided in the Examples herein that show that under certain conditions more pyrimidine molecules than the purine molecule are required to reach the limit of detection.

The method is repeated until 2, 3, 4, 5, 10, 15, 20, 25, 50, 100, 150, 250, 500, 1000, 2000, 2500, 5000 nucleotides or the nucleotide sequence of the entire template nucleic acid is determined. Can be. In certain aspects, the method includes washing the substrate prior to optionally repeating the contacting, incubation and detection steps disclosed above. In certain aspects, one or more populations of template nucleic acids are immobilized on a substrate. One or more nucleic acid molecules may be contacted with additional copies of 3 ′ nucleotides to ensure that complementary nucleotides in all initial nucleic acid molecules at the next position of the nucleic acid molecule have been added.

In certain aspects, the amount of nucleic acid immobilized on the substrate is determined and the number of first nucleotides included in the reaction mixture is determined. As discussed above, this crystal can be used to detect nucleotide repeats.

As discussed herein, in certain aspects of the invention, based on the measurement of the first nucleotide using surface enhanced Raman spectroscopy (SERS), the post-reaction concentration of the first nucleotide is determined. Also in certain aspects, the nucleotides are detected in the reaction mixture prior to contacting the template nucleic acid. SERS spectra of the reaction mixture before and after contact with the template nucleic acid molecule are used in certain aspects of the invention to determine whether nucleotides have been incorporated into the initial strand. In these aspects, the post-reaction concentration of the first nucleotide is determined by comparing the Raman signal of the nucleotides in the mixture after the reaction with the Raman signal of the nucleotides in the reaction mixture before contacting the template nucleic acid.

In certain aspects, the reaction mixture includes an internal control molecule as discussed herein. The internal control molecule generates a Raman signal that can be detectably distinguishable from the Raman signal generated by the first nucleotide. In aspects of the invention using an internal control, the post-reaction concentration of the first nucleotide is determined by comparing the Raman signal of the nucleotides in the post-reaction mixture with the Raman signal of the internal control molecule.

In other aspects, an apparatus is provided that includes a reaction chamber comprising one or more nucleic acid molecules immobilized on an immobilization surface, a channel in fluid communication with the reaction chamber, and a Raman detection unit operatively coupled to the channel. In certain aspects of the invention, the Raman detection unit can detect one or more nucleotides or bases such as dAMP or adenine at the single molecule level. In addition, in certain aspects, the nucleotides flow into the channel in the reaction chamber. In the device, in certain examples silver, gold, platinum, copper or aluminum mesh in the channel is included.

A method of sequencing nucleic acids comprising contacting one or more template nucleic acid molecules with nucleotides and a polymerase to form a reaction mixture and synthesizing one or more complementary strands from the nucleotides, wherein the concentration of nucleotides is subsequently measured by Raman spectroscopy. This is provided. The decrease in the concentration of nucleotides in the reaction mixture after synthesis of the complementary strands indicates that the nucleotides have been incorporated into the complementary strands. The sequence of the template nucleic acid is determined from the nucleotides incorporated into the complementary strands.

In certain aspects, the nucleotides are separated from the template nucleic acid molecule before the nucleotide concentration is determined, as discussed in more detail herein. In addition, a single type of nucleotide may be exposed to the template at one time. Alternatively, all four types of nucleotides may be exposed to the template at one time.

In another embodiment, an apparatus is provided that includes a reaction chamber comprising one or more nucleic acid molecules bound to an immobilization surface, a channel in fluid communication with the reaction chamber, and a Raman detection unit operatively coupled to the channel. In certain aspects, the Raman detection unit can detect one or more nucleotides at the single molecule level. In addition, in certain aspects, the nucleotides flow into the channel, which may include a silver, gold, platinum, copper or aluminum SERS substrate.

In another embodiment, the method comprises contacting one or more template nucleic acids with a reaction mixture comprising a primer, a polymerase and an initial concentration of first nucleotides, and determining the concentration of the first nucleotide in the mixture after reaction using Raman spectroscopy. A method of determining the nucleotide sequence of one or more template nucleic acids is provided, wherein a decrease in the post-reaction concentration of the first nucleotide indicates that the nucleotide has been added to the 3 'end of the one or more initial nucleic acid molecules. Typically, the template nucleic acid or primer is immobilized on a solid support, while the template nucleic acid is incubated in the reaction mixture to form one or more initial nucleic acid molecules complementary to the mixture, and at least a portion of the template nucleic acid after the reaction. The method is optionally repeated with other nucleotides until 3 'nucleotides of one or more initial nucleic acid molecules have been identified, thereby determining the nucleotide sequence of one or more nucleic acid molecules.

In certain aspects, the nucleotides are bound to a Raman label, such as a phosphor or a nanoparticle, before being detected by Raman spectroscopy. For example, Raman spectroscopy can be performed using surface enhanced Raman spectroscopy (SERS).

The template molecule is, in certain aspects, isolated from the biological sample before being detected by the methods disclosed herein. Biological samples are, for example, urine, blood, plasma, serum, saliva, semen, feces, saliva, cerebrospinal fluid, tears, mucus and the like.

In another embodiment, the template nucleic acid is contacted with a reaction mixture comprising a primer, a polymerase and an initial concentration of first nucleotides to form a post-reaction mixture, wherein the 3 'nucleotides of the primer are adjacent to the target nucleotide position To determine the concentration of the first nucleotide in the post-reaction mixture using Raman spectroscopy, where a decrease in the post-reaction concentration of the first nucleotide identifies the extension reaction product, and the nucleotide is directed to the nucleotide at the target site. Complementary to), a method is provided for determining the presence of a nucleotide at a target location of a template nucleic acid molecule, including identifying the presence of the nucleotide at the target location. Typically, the target nucleic acid molecule or primer is immobilized on the substrate. The method is optionally repeated with other nucleotides until nucleotide presence is confirmed.

In another embodiment, the nucleotides, nucleosides or bases are deposited onto metallic nanoparticles, substrates comprising metal coated nanostructures, or substrates comprising aluminum, and then deposited nucleotides, nucleosides or bases are deposited. A method of detecting nucleotides, nucleosides or bases is provided, which comprises irradiating with a laser beam and detecting the generated Raman scattering. Detection methods are useful, for example, in methods of sequencing nucleic acids disclosed herein.

Nucleotides, nucleosides or bases are deposited on one or more silver nanoparticles of about 5 to 200 nm in diameter in certain examples. For example, nucleotides, nucleosides or bases are deposited on silver nanoparticles. In these aspects, for example, nucleotides, nucleosides or bases may be contacted with alkali-metal halide salts and silver nanoparticles. Alkali-metal halide salts are, for example, lithium chloride. In these aspects, for example, lithium chloride can be used at a concentration of about 50 to about 150 micromoles, about 80 to about 100 micromoles, or about 90 micromoles.

Nucleotides, nucleosides or bases comprise adenine in certain aspects, and in certain instances a single molecule of adenine is detected. The base may be associated with a Raman label in certain embodiments.

In another embodiment, one or more template nucleic acid molecules are obtained, nucleotides and polymerases are provided to the template to allow one or more complementary strands to be synthesized using nucleotides, and to measure the concentration of nucleotides using Raman spectroscopy. There is provided a method of sequencing a nucleic acid comprising the same. The sequence of the template nucleic acid is determined from the nucleotides incorporated into the complementary strands.

In another embodiment, a reaction chamber comprising a single template nucleic acid molecule or primer bound to an immobilization surface; A channel in fluid communication with the reaction chamber; And a Raman detection unit operatively coupled to the channel.

Sequence information using the methods provided herein can be obtained during a single sequencing operation using a single nucleic acid molecule. Alternatively, multiple copies of nucleic acid molecules can be sequenced in parallel or in parallel to identify nucleic acid sequences or to obtain complete sequence data. In other alternatives, both nucleic acid molecules and their complementary strands can be sequenced to confirm the accuracy of the sequence information. The nucleic acid to be sequenced may be DNA, but other nucleic acids, including RNA or synthetic nucleotide analogues, may also be sequenced.

The nucleic acid to be sequenced may be covalently or non-covalently bound to the surface. Alternatively, the nucleic acid to be sequenced can be restricted in position by non-binding methods, such as optical capture (see, eg, Goodwin et al. , 1996, Acc. Chem. Res. 29: 607-619; US Pat. No. 4,962,037; 5,405,747; 5,776,674; 6,136,543; 6,225,068). Binding or other localization of the nucleic acid causes the nucleotide to be detected by Raman spectroscopy without background signal from the nucleic acid. For example, continuous or discontinuous flow of nucleotides can be provided for nucleic acid synthesis. The concentration of nucleotides can be determined upstream or downstream of the synthetic reaction. Differences in nucleotide concentrations represent nucleotides incorporated into newly synthesized complementary nucleic acid strands. Alternatively, nucleic acid templates, primers and polymerases may be limited to subcompartments of the reaction chamber. Raman detectors can be placed to detect nucleotide concentrations in other parts of the reaction chamber without background signals from nucleic acids, polymerases and primers. Nucleotides can be equilibrated between different parts of the reaction chamber by passive diffusion or active mixing processes.

The following detailed description includes numerous specific details in order to better understand the claimed method and apparatus. However, it will be apparent to those skilled in the art that the apparatus and / or method may be performed without these specific details. In other instances, the devices, methods, procedures, and individual components known in the art are not described in the detailed description herein.

1 shows one non-limiting example of an apparatus 10 for nucleic acid sequencing comprising a reaction chamber 11 and a Raman detection unit 12. The reaction chamber 11 comprises a nucleic acid (template) molecule 13 bound to an immobilization surface 14 with a polymerase 15, such as a DNA polymerase. Primer molecules 16 complementary to the sequence of template molecules 13 will hybridize to template molecules 13. Nucleotide 17 is present in solution in reaction chamber 11. For the synthesis of the initial DNA strand 16, the nucleotide 17 is deoxyadenosine-5'-triphosphate (dATP), deoxyguanosine-5'-triphosphate (dGTP), deoxycytosine-5'-. Triphosphate (dCTP) and / or deoxythymidine-5'-triphosphate (dTTP). Each of the four nucleotides 17 may be present simultaneously in solution. Alternatively, different types of nucleotides 17 can be added sequentially to the reaction chamber 11. In addition, other nucleotides such as uridine-5'-triphosphate (UTP) can also be used, especially if the initial strand is an RNA molecule. Non-natural nucleotides such as those used in conventional nucleic acid sequencing can also be used. These include four fluorescent dye-labeled nucleotides (eg, Cy3, Cy3.5, Cy5, Cy5.5, TAMRA, R6G (eg, Applied Biosystems), used by standard sequencing or labeling reactions. (Foster City, Calif.) Or NEN Life Science Products (available from Boston, Mass.) This dye can be detected by SERS or SECARS.

To initiate the sequencing reaction, the polymerase 15 adds one nucleotide molecule 17 at a time to the 3 'end of the primer 16 to stretch the primer molecule 16. When the primer molecule 16 is extended, it is called the initial strand 16. For each round of stretch, a single nucleotide 17 is incorporated into the initial strand 16. Since the incorporation of nucleotides 17 is determined by Watson-Crick base pair interactions with the template strand 13, the sequence of the growing initial strand 16 is dependent upon the sequence of the template strand 13 Will be complementary to. In Watson-Crick base pairing, adenosine (A) residues on one strand are paired with thymidine (T) residues on the other strand. Likewise, guanosine (G) residues on one strand are paired with cytosine (C) residues on the other strand. Accordingly, the sequence of the template strand 13 can be determined from the sequence of the initial strand 16.

1 shows a method and apparatus 10 in which a single nucleic acid molecule 13 is included in the reaction chamber 11. Alternatively, two or more template nucleic acid molecules 13 of the same sequence may be present in a single reaction chamber 11. If more than one template nucleic acid 13 is present in the reaction chamber 11, the Raman emission signal will reflect the average of the nucleotides 17 incorporated into all the initial strands 16 in the reaction chamber 11. Those skilled in the art will be able to modify the signals obtained at any arbitrary time for the synthetic reactions that are delayed or occur before most of the reactions occurring in the reaction chamber 11 using known data analysis techniques.

The non-limiting example shown in FIG. 1 shows the nucleotide 17 detected by Raman spectroscopy in the same reaction chamber 11 as the template strand 13, primer 16 and polymerase 15. In order to reduce the interfering Raman signal, the reaction chamber 11 and the detection unit 12 can be arranged such that only nucleotides 17 are excited and detected. For example, the reaction chamber 11 may be a portion of the reaction chamber 11 by using a low molecular weight cutoff filter, by optical capture, or by fixing to the surface 14 by other methods known in the art. It can be divided into two parts together with the template 13, primer 16 and polymerase 15 defined in FIG. (See, eg, Goodwin et al. , 1996, Acc. Chem. Res. 29: 607-619; US Pat. No. 4,962,037; 5,405,747; 5,776,674; 6,136,543; 6,225,068) The detection unit 12 includes a reaction chamber 11 Only nucleotides 17 in the second portion of can be excited and arranged to emit a Raman signal. Alternatively, the reaction chamber 11 may be coupled to a flow-through system, such as a microfluidic channel, microcapillary or nanochannel. Nucleotide 17 may enter the reaction chamber 11 and be incorporated into the initial strand 16. The remaining unincorporated nucleotides 17 can exit the reaction chamber 11 and enter the second channel, where it is detected by Raman spectroscopy. The mold 13, primer 16 and polymerase 15 may be defined in the reaction chamber 11 by bonding, using a filter, optical capture or other known method. Since nucleotides 17 are detected in compartments separate from template 13, primer 16 and polymerase 15, the interfering Raman signal is minimized. Nucleotide 17 incorporated into the initial strand 16 can be identified by the difference in concentration of nucleotides 17 entering the reaction chamber 11 and exiting the reaction chamber 11. In such an alternative, the dual detection unit 12 can be located before and after the reaction chamber 11. Alternatively, if the concentration of nucleotides 17 entering the reaction chamber 11 is known, a single detection unit 12 may be located downstream of the reaction chamber 11 to exit the reaction chamber 11. ) Concentration can be measured.

Those skilled in the art will note that depending on the type of polymerase 15 used, a few percentages of mismatched bases in which the newly incorporated base strand 16 is not correctly hydrogenated with the corresponding base in the template strand 13 You will recognize that you can. At least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9% can be observed. Certain polymerases (15) have error correction activity (which is also a 3 'endonuclease or proof-reading) that acts to remove newly incorporated nucleotides 17 that are not correctly paired with the template strand 13 Also referred to as activity). Polymerase 15 with or without proof-reading activity may be used in the disclosed methods. Polymerase 15 having the lowest possible error rate can be used for certain applications. Polymerase 15 error rates are known in the art.

The detection unit 12 comprises an excitation source 18 such as a laser and Raman spectroscopy detector 19. The excitation source 18 irradiates the excitation beam 20 to the reaction chamber 11 or the channel. The excitation beam 20 interacts with the nucleotides 17 to cause the electrons to be excited in a higher energy state. When the electrons return to the lower energy state, it emits a Raman emission signal detected by the Raman detector 19. Since Raman emission signals from each of the four types of nucleotides 17 can be distinguished, the detection unit 12 can measure the amount of each type of nucleotide 17 in the reaction chamber 11 and / or the channel. Can be.

Incorporation of nucleotides 17 into the growing initial strands 16 results in the deletion of nucleotides 17 from the reaction chamber 11. In order for the synthesis reaction to continue, a circle of new nucleotides 17 may be needed. This circle is shown as molecular dispenser 21 in FIG. 1. The molecular dispenser 21 may or may not be part of the sequencing device 10.

Molecular dispenser 21 may be designed to release each of the four nucleotides 17 at the same amount corrected at the rate of synthesis of the initial strand 16. However, nucleic acid 13 does not necessarily exhibit a uniform distribution of A, T, G and C residues. In particular, certain regions of the DNA molecule 13 may be rich in AT or GC rich, depending on the species from which the DNA 13 is to be obtained, and the specific region of the DNA molecule 13 being sequenced. Release of the nucleotide 17 from the molecular dispenser 21 can be controlled so that a relatively constant concentration of each type of nucleotide 17 is maintained in the reaction chamber 11.

Data may be collected from a detector 19, such as a spectrometer or monochromator array, and provided to an information processing and conditioning system. The information processing and control system may manage a database that associates specific nucleotides 17 with specific lamin signals. The information processing and conditioning system can record the signal detected by the detector 19 and correlate the signal with a signal of known nucleotide 17. The information processing and control system may also manage the recording of nucleotide 17 adsorption that represents the sequence of the template molecule 13. The information processing and conditioning system may also perform standard procedures known in the art, such as subtraction of background signals.

If the initial strand 16 comprises DNA, the template strand 13 may be RNA or DNA. With the RNA template strand 13, the polymerase 15 may be a reverse transcriptase, examples of which are known in the art. When the template strand 13 is a molecule of DNA, the polymerase 15 may be a DNA polymerase.

Alternatively, initial strand 16 may be a molecule of RNA. This requires that the polymerase 15 be an RNA polymerase, in which case no primer 16 is required. However, the template strand 13 must contain a promoter sequence that is effective for binding to RNA polymerase 15 and initiating transcription of the RNA initial strand 16. The exact composition of the promoter sequence depends on the type of RNA polymerase 15 used. Optimization of promoter sequences to allow transcription to be initiated efficiently is within the ordinary skill in the art. The method is not limited to the type of template molecule 13 used, the type of initial strand 16 synthesized, or the type of polymerase 15 used. Virtually any template 13 and any polymerase 15 can be used that can support the synthesis of nucleic acid molecules 16 whose sequence is complementary to the template strand 13.

Nucleotide 17 may be chemically modified with a Raman label. The label can have a unique and very visual optical signal that can be distinguished from each conventional nucleotide 17. The label may also act to increase the intensity of the Raman emission signal or otherwise enhance the sensitivity or specificity of the Raman detector 19 to nucleotides 17. Non-limiting examples of tag molecules that can be used for Raman spectroscopy are disclosed below. The use of labels in Raman spectroscopy is known in the art (eg, U.S. Patent Nos. 5,306,403 and 6,174,677). Those skilled in the art will recognize that a Raman label may generate a distinguishable Raman spectrum when binding to another nucleotide 17 or that different labels may be designed to bind only one type of nucleotide 17.

The template molecules 13 may be formed on the surface 14, such as functionalized glass, silicone, PDMS (polydimethyl siloxane), silver or other metal coated surfaces, quartz, plastic, PTFE (polytetrafluoroethylene), PVP (polyvinyl p Ralidone), polystyrene, polypropylene, polyacrylamide, latex, nylon, nitrocellulose, glass beads, magnetic beads, or functional groups such as amino, carboxyl, thiol, hydroxyl, or Diels-Alder Alder) may be bound to any other material known in the art, such as reactants, incorporated into its surface.

The functional group may be covalently attached to the crosslinking agent such that the binding interaction between the template strand 13 and the polymerase 15 can occur without steric hindrance. Typical crosslinkers include ethylene glycol oligomers and diamines. The bond can be covalent or non-covalent. Various methods of binding the nucleic acid molecule 13 to the surface 14 are known in the art and may be used.

As used herein, “one” means that the item is one or more.

"Nucleic acid" means DNA, RNA, or single stranded, double stranded or triple-stranded, and any chemical modifications. Virtually any modification of the nucleic acid is envisioned. "Nucleic acid" means 10, 20, 30, 40, 50, 60, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10,000, 15,000, 20,000, 30,000, 40,000, 50,000, 75,000, 100,000, 150,000, 200,000, 500,000, 1,000,000, 1,500,000, It can be of any length from 2,000,000, 5,000,000 or more bases in length, up to full-length chromosomal DNA molecules.

Nucleosides are molecules comprising a purine or pyrimidine base covalently attached to an pentose such as deoxyribose, ribose, or a derivative or analog of the pentose. "Nucleotide" refers to a nucleoside further comprising one or more phosphate groups covalently bound to an pentose sugar. It is envisioned that various substitutions or modifications may be made to the structure of the nucleotide so long as it can be incorporated into the initial strand by the polymerase. For example, the ribose or deoxyribose moiety may be substituted with another pentose or pentose analog. Phosphate groups may be substituted by various groups such as phosphonates, sulfates or sulfonates. As long as the sequence of nucleotides incorporated into the initial strand reflects the sequence of the template strand, naturally occurring purine or pyrimidine bases may be substituted by other purines or pyrimidines, or analogs thereof.

Template molecules can be prepared by any technique known to those skilled in the art. The template molecule may be a naturally occurring DNA or RNA molecule, for example chromosomal DNA or messenger RNA (mRNA). Virtually any naturally occurring nucleic acid can be prepared and sequenced by the disclosed methods, including but not limited to chromosomal DNA, mitochondrial DNA or chloroplast DNA or ribosomal RNA, transcriptional RNA, heterologous nuclear RNA or messenger RNA. Nucleic acids to be sequenced can be obtained from prokaryotic or eukaryotic sources by standard methods known in the art.

Methods of making and isolating cellular nucleic acids of various forms are known. (See, eg, Guide to Molecular Cloning Techniques , Berger and Ibmmel, Academic Press, New York, NY, 1987; Molecular Cloning: A Laboratory Manual , 2nd edition, compilation Sambrook, Fritsch and Maniatis, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1989). In general, cells, tissues or other raw materials comprising nucleic acids to be sequenced are first homogenized, for example, by freezing in liquid nitrogen and then grinding in mortar and pestle. Certain tissues can be homogenized using a Waring blender, a Virtis homogenizer, a Dounce homogenizer or other homogenizers. Crude homogenates are detergents such as sodium dodecyl sulfate (SDS), Triton X-100, CHAPS (3-[(3-colamidopropyl) -dimethylammonio] -1-propane sulfony), It can be extracted with octylglucoside or other detergents known in the art. Alternatively or additionally, extraction may use a chaotrophic agent such as guanidinium isothiocyanate, or an organic solvent such as phenol. Protease treatment, such as treatment with proteinase K, can be used to degrade cellular proteins. Particulate contaminants can be removed by centrifugation or ultracentrifugation (eg, 10 to 30 minutes at about 5,000 to 10,000 xg, or 30 to 60 minutes at about 50,000 to 100,000 xg). Dialysis against low ionic strength aqueous buffer can be used to remove salts or other soluble contaminants. The nucleic acid may be precipitated by addition of ethanol at −20 ° C. or by addition of sodium acetate (pH 6.5, about 0.3 M) and 0.8 volume of 2-propanol. Precipitated nucleic acids can be collected by centrifugation or, in the case of chromosomal DNA, by spooling the precipitated DNA on a glass pipette or other probe.

Those skilled in the art will recognize that the procedures listed above are merely exemplary and that many modification procedures may be used depending on the particular type of nucleic acid being sequenced. For example, mitochondrial DNA is often prepared by cesium chloride density gradient centrifugation using a step gradient, while mRNA is often promega (Madison, WI) or Clontech (California, USA) Manufactured from commercial sources, such as Palo Alto). Such variations are known in the art.

Those skilled in the art will recognize that various nuclease inhibitors may be used, depending on the type of template nucleic acid to be prepared. For example, RNAase contamination in bulk solutions can be eliminated by treatment with diethyl pyrocarbonate (DEPC), while commercially available nuclease inhibitors can be prepared by Promega (Madison, Wisconsin) or BRL (USA). Standard sources, such as the city of Guyerberg, Madison. Purified nucleic acid may be dissolved in an aqueous buffer such as TE (tris-EDTA) (ethylene diamine tetraacetic acid) or stored at −20 ° C. or in liquid nitrogen prior to use.

If single stranded DNA (ssDNA) is sequenced, ssDNA can be prepared from double stranded DNA (dsDNA) by standard methods. Most simply, the dsDNA can be heated above its annealing temperature, at which point it spontaneously separates into ssDNA. Representative conditions may include heating at 92-95 ° C. for at least 5 minutes. Methods for determining the conditions for separating dsDNA based on, for example, GC content and the length of the molecule are known in the art. Alternatively, single stranded DNA can be prepared from double stranded DNA by standard amplification techniques known in the art, using primers that only bind to one of the double stranded DNA. Other methods of preparing single stranded DNA are known in the art, for example, by inserting a double stranded nucleic acid to be sequenced into a phage, such as M13 in a replicative form, and allowing the phage to produce a single strand of copy of the template. have.

Virtually any type of nucleic acid can potentially be sequenced which can serve as a template for RNA or DNA polymerase. For example, nucleic acids produced by various amplification techniques, such as polymerase chain reaction (PCR) amplification, can be sequenced. (See U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159). The nucleic acid to be sequenced can alternatively be cloned in standard vectors such as plasmids, cosmids, BACs (bacterial chromosomes) or YACs (yeast artificial chromosomes). (See, eg, Berger and Kimmel, 1987; Sambrook et al., 1989). Nucleic acid inserts are vectored by, for example, cleavage with appropriate restriction endonucleases, followed by agarose gel electrophoresis and ethidium bromide staining. It can be isolated from DNA. The selected size fractionated nucleic acid can be removed from the gel, for example by use of low melting agarose, or by electroelute from the gel slice. Insert isolation methods are known to those skilled in the art.

In certain aspects, the nucleic acid to be sequenced may be a single molecule of ssDNA or ssRNA. In aspects involving a small number of nucleic acid templates (eg 1000 molecules or less), procedures may be included to minimize the binding of nucleic acid to the surface and the substrate of the reaction vessel by adding negative charges to the surface (eg, [ Braslavsky et al . , Proc. Natl. Acad. Sci. , 100: 3960-3964, 2003).

Various methods for the selection and manipulation of a single ssDNA or ssRNA molecule can be used, such as hydraulic focusing, micro-operator coupling, optical capture, or a combination thereof, and similar methods (eg, Goodwin et al. , 1996, Acc. Chem. Res. 29: 607-619; US Pat. Nos. 4,962,037; 5,405,747; 5,776,674; 6,136,543; 6,225,068.)

In particular embodiments of the present invention, the methods and apparatus are more than 1,000, more than 2,000, more than 5,000, more than 10,000, more than 20,000, more than 50,000, more than 100,000, or more bases in length It is suitable for obtaining sequences of very long nucleic acid molecules. However, in certain embodiments, the methods and apparatus are 500, 400, 300, 200, 150, 100, 50, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, Or shorter nucleic acid molecules having a length of one nucleotide. These shorter nucleic acid molecules can be isolated directly from the sample or obtained from treatment of longer nucleic acid molecules.

Microfluidic or nanofluidic phases can be used to classify and isolate template nucleic acids. Using hydraulics, nucleic acids can be manipulated and inserted into microchannels, microcapillaries or micropores. Hydrodynamic forces can be used to move nucleic acid molecules across the comb structure to separate single nucleic acid molecules. Once the nucleic acid molecule is isolated, hydrodynamic focus can be used to position the molecule. Thermal or electrical potential, pressure or vacuum may also be used to provide a motif force for manipulation of the nucleic acid. Manipulation of template nucleic acids for sequencing is described in U.S. Patent No. As disclosed in 5,867,266 and 6,214,246, it may include channel block designs incorporating microfabricated channels, and using integrated gel materials.

Alternatively, the sample containing the nucleic acid template may be diluted before binding to the immobilization surface. The immobilization surface may be in the form of magnetic or nonmagnetic beads or other discrete structural units. At one suitable dilution, each bead will have a statistical probability of binding to zero or one nucleic acid molecule. For example, fluorescent dyes and flow analyzer sorting or magnetic sorting can be used to identify beads with one bound nucleic acid molecule. Depending on the relative size and uniformity of the beads and nucleic acids, magnetic filters and mass separation can be used to separate the beads comprising single binding nucleic acid molecules. In other alternatives, multiple nucleic acids bound to a single bead or other immobilization surface can be sequenced.

In other alternatives, coated fiber tips can be used to generate single molecule nucleic acid templates for sequencing (eg, U.S. Patent No. 6,225,068). Immobilized surfaces comprising single molecules of avidin or other crosslinking agents can be prepared. Such a surface can attach a single biotinylated primer, which can in turn hybridize with a single template nucleic acid and sequenced. It is not limited to avidin-biotin binding system, but can be adapted to any coupling system known in the art.

In other alternatives, optical traps can be used to engineer single molecule nucleic acid templates for sequencing (eg, U.S. Patent No. 5,776,674). Exemplary optical capture systems include Cell Robotics, Inc. (Albuquerque, NM), S + L GmbH (Heidelberg, Germany) and P.A.L.M. Commercially available from Gmbh (Wolfstraßen, Germany).

The nucleic acid molecules that are sequenced can be bound (or immobilized) to a solid surface. Fixation of nucleic acid molecules can be accomplished by a variety of methods, including noncovalent or covalent linkages between nucleic acid molecules and surfaces. For example, fixation can be achieved by coating the surface with streptavidin or avidin and subsequently binding the biotinylated polynucleotides (Holmstrom et al. , Anal. Biochem. 209: 278-283, 1993). Immobilization can also occur by coating silicone, glass or other surfaces with poly-L-Lys (lysine) and then covalently linking amino- or sulfhydryl-modified nucleic acids using bifunctional crosslinking reagents ( Running et al., BioTechniques 8: 276-277, 1990; Newton et al., Nucleic Acids Res. 21: 1155-62, 1993). Amine residues may be introduced to the surface by using aminosilanes for crosslinking.

Fixation can occur by directly covalently binding a 5'-phosphorylated nucleic acid to a chemically modified surface (Rasmussen et al. , Anal. Biochem. 198: 138-142, 1991). Covalent bonds between nucleic acids and surfaces are formed by condensation with water soluble carbodiimides. This method promotes major 5'-binding of the nucleic acid through its 5'-phosphate.

DNA is usually bound to the glass by first silaning the glass surface and then activating carbodiimide or glutaraldehyde. Alternative procedures include reagents such as 3-glycidoxypropyltrimethoxysilane (GOP) or aminopropyltrimethoxysilane (APTS) with DNA linked through an amino linker incorporated at the 3 'or 5' end of the molecule. Can be used. DNA can be bound directly to the membrane surface using ultraviolet radiation. Other non-limiting examples of fixation techniques for nucleic acids are described in U.S. Patent No. 5,610,287, 5,776,674 and 6,225,068.

The type of surface used for fixation of the nucleic acid is not limited. The immobilization surface may be a magnetic bead, a nonmagnetic bead, a planar surface, a sharp surface, or any other form of solid surface including almost any material as long as it is durable and inert enough to cause the material to undergo a nucleic acid sequencing reaction. Can be. Non-limiting examples of surfaces that can be used include glass, silica, silicate, PDMS, silver or other metal coated surfaces, nitrocellulose, nylon, activated quartz, activated glass, polyvinylidene difluoride (PVDF), polystyrene, polyacrylamide , Other polymers such as poly (vinyl chloride), poly (methyl methacrylate) or poly (dimethyl siloxane), and photoactive species such as ketyl radicals, nitrene and carbene that can form covalent bonds with nucleic acid molecules Photopolymers, see US Pat. Nos. 5,405,766 and 5,986,076.

Bifunctional crosslinking reagents can be used to bind nucleic acid molecules to a surface. Bifunctional crosslinking reagents may be classified according to the specificity of their functional groups, such as the specific groups of amino, guanidino, indole or carboxyl. Among these, reagents for free amino groups are universal because they are commercially available, easy to synthesize, and their application reaction conditions are mild. Exemplary methods for crosslinking molecules are described in U.S. Pat. Patent No. 5,603,872 and 5,401,511. Crosslinking reagents include glutaraldehyde (GAD), bifunctional oxirane (OXR), ethylene glycol diglycidyl ether (EGDE) and carbodiimides such as 1-ethyl-3- (3-dimethylaminopropyl) carbodii Meade (EDC) is included.

In certain methods, the sequencing reaction may comprise binding a polymerase, such as a DNA polymerase, to a primer molecule and catalytically adding nucleotides to the 3 'end of the primer. Non-limiting examples of polymerases that can be used include DNA polymerases, RNA polymerases, reverse transcriptases and RNA-dependent RNA polymerases. Differences between these polymerases in terms of "propriding" activity and requirements, as well as a lack of requirements for primer and promoter sequences, are discussed herein and known in the art. If RNA polymerase is used, the template molecule to be sequenced may be double stranded DNA. Errors due to incorporation of mismatched nucleotides can be corrected, for example, by sequencing both strands of the original template, or by sequencing multiple copies of the same strand.

Non-limiting examples of polymerases that may be used include thermato gamaritima DNA polymerase, AmplitaqFS3 DNA polymerase, Takenase3 DNA polymerase, Thermosequenase3, Taq DNA polymer. Lase, Qbeta3 replicaase, T4 DNA polymerase, Thermos thermophilus DNA polymerase, RNA-dependent RNA polymerase and SP6 RNA polymerase.

Pwo DNA polymerase from Boehringer Mannheim Biochemicals (Indianapolis, Tennessee, USA); Bst Polymerase from Bio-Rad Laboratories (Hercules, CA); IsoTherm3 DNA polymerase from Epicentre Technologies (Madison, Wisconsin); Moroni rat leukemia virus reverse transcriptase, Pfu DNA polymerase, avian myeloblastosis virus reverse transcriptase, Thermos flavus ( Tfl ) DNA polymerase and thermo from Promega (Madison, WI ) Thermococcus litoralis ( Tli ) DNA polymerase; RAV2 reverse transcriptase, HIV-1 reverse transcriptase, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, RNA polymerase E from Amersham Pharmacia Biotech (Piscataway, NJ). E. coli, Thermus aquaticus DNA polymerase, T7 DNA polymerase +/- 3 '→ 3 5' exonuclease, cleno fragment of DNA polymerase I, Thermos ubiquitous A number of polymerases are commercially available, including DNA polymerase, and DNA polymerase I. However, any polymerase known in the art for template dependent polymerization of nucleotides can be used. (See, eg, Goodman and Tippin, Nat. Rev. Mol. Cell Biol. 1 (2): 101-9, 2000; US Pat. No. 6,090,389).

Those skilled in the art will appreciate that the rate of polymerase activity can be engineered to match the optimal assay rate of nucleotides by the detection unit. Various methods are known for adjusting the rate of polymerase activity, including adjusting temperature, pressure, pH, salt concentration, divalent cation concentration or concentration of nucleotides in the reaction chamber. Methods of optimizing polymerase activity are known to those skilled in the art.

Primers can be obtained by any method known in the art. In general, primers have a length of 10 to 20 bases, although longer primers may be used. Primers can be designed so that the sequence is exactly complementary to the known portion of the template nucleic acid molecule, which may be close to the binding site of the template to the immobilization surface. Methods of synthesizing primers of any sequence are known, for example using automated nucleic acid synthesizers using phosphoramidite chemistry, and such instruments are standard sources such as Applied Biosystems (Foster City, CA, USA). ).

Other methods include sequencing nucleic acids in the absence of known primer binding sites. In such cases, polymerization of the initial strand using random primers such as random hexamers or random oligomers of lengths of 7, 8, 9, 10, 11, 12, 13, 14, 15 bases or more bases in length May be initiated. Unhybridized primers may be removed prior to commencement of the synthesis reaction.

Dehybridized primer removal can be achieved, for example, by using an immobilized surface coated with a binder such as streptavidin. Complementary binders such as biotin can be bound to the 5 'end of the template molecule and the template molecule can be immobilized on the immobilization surface. After allowing hybridization to occur between the primer and the template, those primer molecules that are not bound to the immobilization surface can be removed. Only those primers hybridized to the template strand will act as primers for template dependent DNA synthesis. In other alternative embodiments, multiple primer molecules can be bound to the immobilization surface. Template molecules can be added to hydrogen bond to the complementary primers. The template dependent polymerase may then act to initiate initial strand synthesis.

Other types of crosslinks may be used that selectively retain only one primer per template strand, such as a photoactive crosslinker. As discussed above, numerous crosslinkers are known in the art and may be used. The crosslinker can also be bound to the immobilization surface via a linker arm, thereby avoiding the possibility of steric hindrance with the immobilization surface that interferes with hydrogen bonding between the primer and the template.

Certain methods may include incorporating a label into nucleotides to facilitate its measurement by a detection unit. Raman labels include synthetic molecules, dyes, naturally occurring pigments such as phycoerythrins, organic nanostructures such as C ₆₀ , buckyball and carbon nanotubes, metal nanostructures such as gold or silver nanoparticles or nanoprisms and It can be any organic or inorganic molecule, atom, complex or structure capable of generating a detectable Raman signal, including but not limited to nanoscale semiconductors such as quantum dots. Numerous examples of Raman markers are discussed below. Those skilled in the art will recognize that such examples are not limiting and that the Raman label may encompass any organic or inorganic atom, molecule, compound or structure known in the art that can be detected by Raman spectroscopy.

Non-limiting examples of labels that can be used for Raman spectroscopy include TRIT (tetramethyl rhodamine isothiol), NBD (7-nitrobenz-2-oxa-1,3-diazole), Texas Red dyes, Phthalic acid, terephthalic acid, isophthalic acid, cresyl fast violet, cresyl blue violet, brilliant cresyl blue, para-aminobenzoic acid, erythrosin, biotin, digoxigenin, 5-carboxy-4 ', 5'-dichloro-2' , 7'-dimethoxyfluorescein, 5-carboxy-2 ', 4', 5 ', 7'-tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrodamine, 6-carboxyrodamine , 6-carboxytetramethyl amino phthalocyanine, azomethine, cyanine, xanthine, succinyl fluorescein and aminoacridine. As is known in the art, polycyclic aromatic compounds can generally function as Raman labels. These Raman labels and other Raman labels can be obtained from commercial sources such as Molecular Probes (Jugen, Oregon, USA).

Other labels that may be used include cyanide, thiols, chlorine, bromine, methyl, phosphorus and sulfur. Carbon nanotubes can also be used as Raman labels. The use of labels in Raman spectroscopy is known (eg, U.S. Patent Nos. 5,306,403 and 6,174,677). Those skilled in the art will recognize that Raman labels generate distinct Raman spectra when bound to other types of nucleotides.

The label can be linked directly to nucleotides or through various linker compounds. Alternatively, nucleotide precursors covalently bound to the Raman label can be prepared from standard commercial sources (eg, Roche Molecular Biochemicals, Indianapolis, Indiana); Promega Corp. (Wisconsin, USA). Madison, Inc .; Ambion, Inc. (Austin, TX); Amersham Pharmacia Biotech (Piscatway, NJ). Raman labels with reactors designed to covalently react with molecules such as nucleotides are commercially available (eg, Molecular Probes, Jugen, Ore.) Methods of preparing labeled nucleotides and incorporating them into nucleic acids are known. (Eg, US Pat. No. 4,962,037; 5,405,747; 6,136,543; 6,210,896) In certain aspects, the Raman label is blood It is coupled to a pyrimidine nucleotide.

The device provided herein includes a channel. In certain aspects, the concentration of nucleotides is measured by Raman spectroscopy as it flows through the channel. The channel comprises silver, gold, platinum, copper or aluminum mesh in certain aspects. Channels are, for example, microfluidic channels, microchannels, microcapillaries or nanochannels. In addition, the reaction chamber and channel are incorporated into a single chip in certain examples.

The device further includes metal nanoparticles in the channel in certain examples. Nanoparticles flow through channels in certain aspects of the invention. The channel diameter is about 5, 10, 20, 25, 30, 40, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275 and 300 micrometers in certain aspects. For example, the channel diameter is about 100 to about 200 micrometers in diameter. In other aspects, the channel is round.

The apparatus provided herein typically includes a reaction chamber. The reaction chamber may be designed to retain the immobilized surface, nucleic acid template, primers, polymerases and / or nucleotides in an aqueous environment. The reaction chamber can be designed to be temperature controlled, for example, by incorporation of Peletier elements or by other methods known in the art. Temperature control methods for low volume liquids used in nucleic acid polymerizations are known in the art. (See, eg, U.S. Patent Nos. 5,038,853, 5,919,622, 6,054,263, and 6,180,372.)

For example, reaction chambers and any binding fluid channels that provide connections to molecular dispensers, detection units, waste ports, loading ports, or sources of nucleotides are batch fabrication processes as known in the field of computer chip manufacturing or microcapillary chip manufacturing. It can be prepared from. The reaction chamber and other components of the device can be made into a single integrated chip. Such chips can be prepared by methods known in the art, such as photolithography and etching, laser ablation, injection molding, casting, molecular beam growth, dip-pen nanolithography, chemical vapor deposition (CVD) fabrication, electron beams or focused ion beams. It can be prepared by technology or imprinting technique. Non-limiting examples include conventional molding using flowable, optically transparent materials such as plastic or glass; Photolithography and dry etching of silicon dioxide; After patterning the aluminum mask on the silicon dioxide substrate, electron beam lithography using polymethylmethacrylate resist for reactive ion etching is included. Microfluidic channels can be prepared by molding polydimethylsiloxane (PDMS) according to Anderson et al. ("Fabrication of topologically complex three-dimensional microfluidic systems in PDMS by rapidprototyping", Anal. Chem. 72: 3158-3164, 2000). have. Methods of making nanoelectromechanical systems can be used. (See, eg, Craigig, Science 290: 1532-36, 2000.) The microfabricated chips are Caliper Technologies Inc. (Mountain View, CA) and Clara Bio. Commercially available from CLARA BioSciences Inc. (Mountain View, Calif.) And the like.

Any material known to be used in integrated chips can be used, including silicon, silicon dioxide, silicon nitride, polydimethyl siloxane (PDMS), polymethylmethacrylate (PMMA), plastics, glass, quartz, and the like. Part or all of the transparent device may be selected for electromagnetic radiation at the excitation and emission frequencies used in Raman spectroscopy, such as glass, silicon, quartz and other optically transparent materials. In fluid filling compartments such as reaction chambers, microfluidic channels, nanochannels or microchannels that may be exposed to nucleic acids and / or nucleotides, the surface exposed to such molecules may transform the surface from a hydrophobic surface to a hydrophilic surface and / or Or to reduce the adsorption of molecules to the surface, for example by coating. Surface modifications of conventional chip materials such as glass, silicon and / or quartz are known in the art (eg U.S. Patent No. 6,263,286). Such modifications include commercially available capillary coatings (Supelco (Belafont, Pa.), Silanes with various functional groups such as polyethylene oxide or acrylamide, or any other coating known in the art. It may include without limitation.

The detected nucleotides can be migrated under microfluidic channels, nanochannels or microchannels. The microchannels or nanochannels may have a diameter of about 3 nm to about 1 μm. The diameter of the channel slightly smaller in size than the excitation laser beam can be selected. The channel may be, for example, a microcapillary tube from Alcrara Biosciences Incorporated (Mountain View, CA) or a liquid integrated circuit (eg, Caliper Technologies Incorporated (Mountain View, CA)). It may include. Such microfluidic platforms only require samples of nanoliter volume. Nucleotides can be moved down the microfluidic channel by bulk flow of solvent, electro-infiltration, or any other technique known in the art.

Alternatively, microcapillary electrophoresis can be used to transport nucleotides. Microcapillary electrophoresis generally involves the use of thin capillaries or channels that can be filled or unfilled with a special separation medium. Electrophoresis of suitably charged molecular sieves, such as negatively charged nucleotides, takes place in response to an imposed magnetic field. Electrophoresis is often used for size separation of a mixture of components co-added to a microcapillary tube, but can also be used to transport nucleotides of similar size that are subsequently dissociated from nucleic acid molecules. Since the purine nucleotides are larger than the pyrimidine nucleotides and will therefore move more slowly, the lengths of the various channels and the corresponding transition time course detectors can be kept to a minimum to prevent parallax shifts from shuffling the sequence of nucleotides. Alternatively, the separation medium filled in the microcapillary can be selected so that the migration rate of the purine and pyrimidine nucleotides are similar or identical. See, for example, Woolley and Mathies' Proc. Natl. Acad. Sci. USA 91: 11348-352, 1994) discloses a method of microcapillary electrophoresis.

Microfabrication of microfluidic devices, including microcapillary electrophoresis devices, is described, for example, in Jacobsen et al . ( Anal. Biochem, 209: 278-283, 1994); Effenhauser et al. (Anal. Chem. 66: 2949-2953, 1994); Harrison et al. ( Science 261: 895-897, 1993) and US Pat. 5,904,824. Typically, these methods include photolithographic etching of micron-sized channels on silica, silicon or other crystalline substrates or chips, and can be readily adapted for use in the disclosed methods and apparatus. Smaller diameter channels, such as nanochannels, can be prepared by known methods such as coating the interior of the microchannels to reduce the diameter, or by using nanolithography, focused electron beams, focused ion beams, focused atomic laser techniques.

Nanochannels can be prepared, for example, using high yield electron beam lithography systems. Electron beam lithography can be used to write features as small as 5 nm on silicon chips. Sensitive resists coated on the silicon surface, such as polymethyl-methacrylate, can be patterned without using a mask. Electron beam arrays can combine field emitter clusters with microchannel amplifiers to increase the stability of the electron beam, allowing operation at low currents. Using a SoftMask3 computer control system, electron beam lithography of nanoscale features can be controlled on silicon or other chips.

Alternatively, a focused atomic laser can be used to make nanochannels. (See, eg, Broch et al., "Optics with an atomic laser beam," Phys. Rev. Lett. 87: 123-321, 2001.) A focused atomic laser such as a standard laser or a focused electron beam can be used for lithography. . Such techniques can produce micron size or nano size structures on a chip. Dip-pen nanolithography can also be used to form nanochannels. (See, eg, Ivanisevic et al., “'Dip-pen' Nanolithography on Semiconductor Surfaces', J. Am. Chem. Soc. , 123: 7887-7889, 2001.) Dip-pen nanolithography is an atomic force microscopy technique. Is used to deposit the molecule onto a surface such as a silicon chip. Features as small as 15 nm in size may be formed with a spatial resolution of 10 nm. Nano-sized channels can be formed by using dip-pen nanolithography in combination with regular photolithography techniques. For example, micron-sized lines in the layer of resist can be formed by standard photolithography. Using dip-pen nanolithography, the width of the line (and the corresponding diameter of the channel after etching) can be narrowed by depositing additional resist compounds on the edge of the resist. After etching the thinner lines, nano-sized channels can be formed. Alternatively, atomic force microscopy techniques can be used to form nanometer sized features by removing the photoresist.

Ion beam lithography can also be used to create nanochannels on a chip. (Eg, Siegel, "Ion Beam Lithography", VLSI Electronics, Microstructure Science, Vol. 16, edited by Einspruch and Watts, Academic Press, New York, 1987). Using a finely focused ion beam, resist without the use of a mask It is possible to write features, such as nanochannels, directly onto a layer of. Alternatively, a wide ion beam can be used in combination with the mask to form features as small as 100 nm in size. For example, chemical etching with hydrofluoric acid can be used to remove exposed silicon that is not protected by the resist. Those skilled in the art will appreciate that the techniques disclosed above are not limiting and that the nanochannels may be formed by any method known in the art.

In a non-limiting example, Borofloat glass wafer (Precision Glass & Optics, Santa Ana, Calif.) Was preconcentrated in concentrated HF (fluorofluoric acid) for a short time, and plasma An enhanced chemical vapor deposition (PECVD) system (PEII-A, Technics West, San Jose, Calif.) Can be cleaned prior to deposition of the amorphous silicon sacrificial layer.The wafer is hexamethyldisilazane (HMDS). Primed and spin-coated with a photoresist (Shipley 1818 (Marlboro, Mass.)) To soft-bak the contact mask array (Quintel Corp, California, USA). San Jose Material), exposing the photoresist layer with one or more mask designs, and exposing the exposed photoresist with a microposit developer. The mixture can be removed using a mixture of axle and water The developed wafer can be hard-baked and the exposed amorphous silicon can be removed using a CF4 (carbon tetrafluoride) plasma in a PECVD reactor. By chemically etching with HF, the reaction chamber and any channels can be prepared, stripping the remaining photoresist and removing amorphous silicon.

The access hole can be drilled into the etched wafer using a diamond drill bit (Crystalite, Westerville, Ohio). Finished chips can be fabricated by thermally bonding the etched and perforated plates to flat wafers of the same size in a programmable vacuum furnace (Centurion VPM, J. M. Ney, Yukaipa, Calif.). Alternatively, chips can be made by joining two etched chip plates together. Other alternative exemplary methods for making a reaction chamber chip are described in U.S. Pat. Patent No. 5,867,266 and 6,214,246.

In certain aspects, the device disclosed herein comprises a molecular dispenser. Molecular dispensers can be designed to release nucleotides into the reaction chamber. Molecular dispensers can release the same amount of each type of nucleotide. Using a single molecule dispenser, all four nucleotides can be released to the reaction chamber. Alternatively, the release rate of the four types of nucleotides can be independently controlled, for example, by using multiple molecular dispensers that each release a single type of nucleotide. In certain methods, a single type of nucleotide can be released to the thread at one time. Alternatively, all four types of nucleotides may be present in the reaction chamber at the same time.

The molecular dispenser may be in the form of a pumping device. Pumping devices that can be used include various micromachined pumps known in the art. For example, a bulging diagram run by a piezoelectric stack, and a pump with two check valves is described in U.S. Pat. Patent No. 5,277,556, 5,271,724 and 5,171,132. The pump operated by the thermopneumatic element is U.S. Patent No. 5,126,022. Piezoelectric tube driven pumps using multiple membranes in series, or tube driven pumps operated by an applied voltage, are described in U.S. Pat. Patent No. 5,705,018. Public PCT Application No. WO 94/05414 discloses the use of lamb-wave pumps for fluid transport in micron size channels. Those skilled in the art will appreciate that molecular dispensers are not limited to the pumps disclosed herein, but may include any design for the measured payment of very small volumes of fluids known in the art.

The molecular dispenser may take the form of an electrohydraulic pump. (See, eg, Richter et al., Sensors and Actuators 29: 159-165, 1991; U.S. Patent No. 5,126,022). Typically such pumps utilize series electrodes disposed across one surface of a channel or reaction chamber / pumping chamber. Application of an electric field across the electrode results in electrophoretic movement of charged species in the sample. Indium-tin oxide films may be particularly suitable for patterning electrodes on substrate surfaces, such as glass or silicon substrates. This method can also be used to draw nucleotides into the reaction chamber. For example, the electrode can be patterned on the surface of the molecular dispenser and modified with suitable functionalities for binding nucleotides to the surface of the electrode. The application of current between the electrode on the surface of the molecular dispenser and the opposite electrode causes electrophoretic transfer of nucleotides into the reaction chamber.

The detection unit can be designed to detect and / or quantify nucleotides by Raman spectroscopy. Various methods for detecting nucleotides by Raman spectroscopy are known in the art. (See, eg, US Patent No. 5,306,403; 6,002,471; 6,174,677). Modifications to surface enhanced Raman spectroscopy (SERS) or surface enhanced resonance Raman spectroscopy (SERRS) have been disclosed. In SERS and SERRS, the sensitivity of Raman detection is enhanced by a factor of at least 10 ⁶ for molecules adsorbed on the surface of the roughened metal, such as silver, gold, platinum, copper or aluminum, or the surface of the nanostructures.

Non-limiting examples of detection units are U.S. Patent No. 6,002,471. In this embodiment, the excitation beam is generated by either a YAG laser of Nd: 532 nm wavelength or a sapphire laser of frequency doubling Ti: 365 nm wavelength. However, the excitation wavelength can vary considerably without limiting the method of the present invention. For example, as shown in embodiments herein, in certain aspects the excitation beam is transmitted at a wavelength of about 750 to about 950 nm. Pulsed laser beams or continuous laser beams may be used. The excitation beam passes through the confocal optical lens and the microscope objective lens and is concentrated in the reaction chamber. Raman emitting light from nucleotides is collected by microscope objectives and confocal optical lenses and coupled to the monochromator for spectral resolution. Confocal optical lenses include dichroic filters, barrier filters, confocal pinholes, lenses, and combinations of mirrors to reduce background signals. In addition to confocal optical lenses, standard full-length optical lenses can be used. Raman emission signals are detected by Raman detectors. The detector includes an avalanche photodiode interfaced with a computer for counting and digitizing the signal. In certain embodiments, a mesh comprising silver, gold, platinum, copper or aluminum may be included in the reaction chamber or channel to provide an increased signal due to surface enhanced Raman or surface enhanced Raman resonance. Alternatively, nanoparticles comprising a Raman-active metal may be included.

Of the detection unit, including the Spex model 1403 dual-lattice spectrophotometer with gallium-arsenide photoelectron amplifier (RCA model C31034 or Burle Industries model C3103402) operating in single photon counting mode Alternative embodiments are for example US Patent No. 5,306,403. The excitation source is a 644.5 nm line of 514.5 nm line argon-ion laser (Spectrum Physics, Model 166), and a krypton-ion laser (Innova 70, Coherent).

Alternative excitation sources include a 337 nm nitrogen laser (Laser Science Inc.) and a 325 nm helium-cadmium laser (Liconox) (U.S. Patent No. 6,174,677). The excitation beam can be spectrally purified with a bandpass filter (Corion) and concentrated in the reaction chamber using a 6X target lens (Newport, model L6X). Using an objective lens to excite nucleotides and simultaneously collect Raman signals using a holographic beam splitter (Optical Systems, Inc., Model HB 647-26N18) And orthogonal geometric shapes for emitted Raman signals. Holographic notch filters (Kaiser Optical Systems, Inc.) can be used to reduce Rayleigh scattering radiation. Alternative Raman detectors include ISAHR-320 spectroscopy equipped with a red-enhanced enhanced charge-coupled device (RE-ICCD) detection system (Princeton Instruments). Other types of detectors may be used, such as charged injection devices, photodiode arrays or phototransistor arrays.

Normal Raman Scattering, Resonance Raman Scattering, Surface Enhanced Raman Scattering, Surface Enhanced Resonant Raman Scattering, Coherent Anti-Stokes Raman Spectroscopy (CARS), Stimulated Raman Scattering, Inverse Raman Spectroscopy, Gain Raman Spectroscopy, Hyper-Raman Scattering, Molecular Optics Laser irradiator (MOLE) or Raman microprobe or Raman microscopy or confocal Raman microscopy, three-dimensional or scanning Raman, Raman saturation spectroscopy, time resolved resonance Raman, Raman decombination spectroscopy or UV-Raman microscopy Nucleotides can be detected using Raman spectroscopy in any suitable form or configuration or related techniques known in the art.

In the embodiments provided herein, different numbers of molecules can be detected, depending on the particular nucleotide, nucleoside or base to be detected. Typically, fewer molecules can be detected for purines as opposed to pyrimidines and bases can be detected for nucleotides. For example, if the nucleotides, nucleosides or bases comprise adenine, up to 10, up to 5, or 1 molecule of nucleotides, nucleosides or bases can be detected.

In examples where the nucleotide, nucleoside or base comprises guanine, for example, about 50 to about 100 molecules, such as about 60 molecules of guanine base, are detected. In examples where the nucleotide, nucleoside or base comprises cytosine, about 1000 to 10,000 molecules, for example 5000 to 7000, may be detected. In examples where the nucleotide, nucleoside or base comprises thymine, about 1000 to 10000, more particularly about 5000 to about 7000 molecules can be detected.

In certain embodiments, kits are provided that include the necessary probes, nucleotides, nucleosides, target molecules, enzymes, and / or other molecules and reagents for carrying out the methods disclosed herein.

The following examples are intended to illustrate the invention and are not intended to limit the invention.

Example 1

Raman detection of nucleotides

Method and device

In a non-limiting example, the excitation beam of the Raman detection unit is a titanium: sapphire laser (Mira of coherent) of near infrared wavelength (750-950 nm) or gallium aluminum arsenide diode laser (process of 785 nm or 830 nm). The PI-ECL family of Process Instruments). Pulsed laser beams or continuous beams were used. The excitation beam is passed through a dichroic mirror (Kaiser Optical or dichroic interference filter (holographic notch filter by Chroma or Omega Optical) to collect the collinear geometry along with the beam collected. The transmitted beam passed through a microscope objective (Nikon LU series) and focused on the Raman active substrate where the target analyte (nucleotide or purine or pyrimidine base) was located.

Raman scattered light from the analyte was collected by the same microscope objective lens and passed through a dichroic mirror to a Raman detector. Raman detectors included focusing lenses, spectrograms and array detectors. The focusing lens focuses Raman scattered light through the inlet slit of the spectrogram. Spectrograms (Acton Research) included gratings that disperse light by their wavelength. The scattered light was imaged on an array detector (a deep-depletion CCD camera with a backlit by Roperscientific). The array detector was connected to a regulator circuit connected to a computer for data transfer and adjustment of the detector function.

In surface-enhanced Raman spectroscopy (SERS), Raman active substrates consisted of metallic nanoparticles or metal coated nanostructures. Silver nanoparticles ranging in size from 5 to 200 nm were prepared by Lee and Meisel's method ( J. Phys. Chem. , 86: 3391, 1982). Alternatively, the sample was placed on an aluminum substrate under a microscope objective. The figures discussed below were collected as stationary samples on aluminum substrates. The number of molecules detected was determined by the optical collection volume of the illuminated sample. Detection sensitivity down to the single molecule level has been demonstrated.

Single nucleotides can be detected by SERS using 100 μm or 200 μm microfluidic channels. Nucleotides can be delivered to the Raman active substrate via microfluidic channels (about 5-200 μm wide). The microfluidic channel was prepared using polydimethylsiloxane (PDMS) using a technique disclosed in Anderson et al. ("Fabrication of topologically complex three-dimensional microfluidic systems in PDMS by rapid phototyping", Anal. Chem. 72: 3158-3164, 2000). It can be produced by molding.

When SERS was performed in the presence of silver nanoparticles, nucleotide, purine or pyrimidine analytes were mixed with LiCl (90 μM final concentration) and nanoparticles (0.25 M final concentration silver atom). SERS data was collected using a room temperature analyte solution.

Nucleoside monophosphate, purine base and pyrimidine bases were analyzed by SERS using the system disclosed above. Table 1 shows the present detection limits for various analytes of interest.

SERS detection of nucleoside monophosphate, purine and pyrimidine Analytes Final concentration Number of molecules detected dAMP 9 picomolar (pM) ~ 1 mole Adenine 9 pM ~ 1 mole dGMP 90 μM 6 × 10 ⁶ Mall Guanine 909 pM 60 malls dCMP 909 μM 6 × 10 ⁷ Mall Cytosine 90 nM 6 × 10 ³ Mall dTMP 90 μM 6 × 10 ⁶ Mall Thymine 90 nM 6 × 10 ³ Mall

Conditions were optimized only for adenine nucleotides. LiCL (90 μM final concentration) was determined to provide optimal SERS detection of adenine nucleotides. Detection of other nucleotides can be facilitated by using other alkali-metal halide salts such as NaCl, KCl, RbCl or CsCl. The claimed method is not limited by the electrolyte solution used, and it is envisioned that other types of electrolyte solutions such as MgCl ₂ , CaCl ₂ , NaF, KBr, LiI and the like can be used. Those skilled in the art will appreciate that electrolyte solutions that do not exhibit a strong Raman signal will minimally interfere with SERS detection of nucleotides. The results demonstrated that the Raman detection system and method disclosed above can detect and identify single molecules of nucleotides and purine bases.

Example 2

Raman emission spectra of nucleotides, purines and pyrimidines

Using the protocol of Example 1 using the modifications shown, Raman emission spectra of the various analytes of interest were obtained. 2 shows Raman emission spectra of each 100 mM solution of four nucleoside monophosphates, also in the absence of surface enhancement and without Raman labeling. LiCl was not added to the solution. A data collection time of 10 seconds was used. Excitation took place at 514 nm. With longer detection times, added electrolytes and / or surface enhancement, lower concentrations of nucleotides can be detected. In each of the following figures, a 785 nm excitation wavelength was used. As shown in FIG. 2, the unenhanced Raman spectra showed characteristic emission peaks for each of the four unlabeled nucleoside monophosphates.

3 shows the SERS spectrum of a 1 nm solution of guanine in the presence of LiCl and silver nanoparticles. Guanine was obtained from dGMP by acid treatment as discussed in Nucleic Acid Chemistry , Part 1, LB Townsend and RS Tipson (ed.), Wiley-Interscience, New York, 1978. SERS spectra were obtained using 100 msec data collection time.

4 shows the SERS spectrum of 100 nM cytosine solution. Data was collected using a collection time of 1 second.

5 shows the SERS spectrum of 100 nM thymine solution. Data was collected using a collection time of 100 msec.

6 shows the SERS spectrum of 100 pM adenine solution. Data was collected for 1 second.

7 shows SERS spectra of 500 nM solutions of dATP (bottom trace) and fluorescein-labeled dATP (top trace). DATP-Fluorescein was purchased from Roche Applied Sciences, Indianapolis, Indiana. The figure shows a strong increase in SERS signal due to labeling with fluorescein. Data was collected for 100 msec.

8 shows SERS of 0.9 nM solution of adenine. Detection volumes ranged from 100 to 150 femtorators, including 60 molecules of adenine evaluated. Data was collected for 100 msec.

Example 3

SERS detection of nucleotides

Silver Nanoparticle Formulations

According to Lee and Meisel (1982), silver nanoparticles were prepared for SERS detection. 18 milligrams of AgN0 ₃ was dissolved in 100 mL (milliliters) of distilled water and heated to boiling. 10 mL of 1% sodium citrate solution was added dropwise to AgN0 ₃ solution for 10 minutes. The solution was continued to boil for another hour. The resulting silver colloidal solution was cooled and stored.

SERS detection of adenine

Raman detection system was as described in Example 1. 1 mL of silver colloidal solution was diluted with 2 mL of distilled water. Diluted silver colloidal solution (160 μL) (microliters) was mixed with 20 μL of 10 nM (nanomol) adenine solution and 40 μL of LiCl (0.5 mole) in an aluminum tray. LiCl served as a Raman enhancer for adenine. The final concentration of adenine in the sample was 0.9 nM at a detection volume of about 100 to 150 femtorators, including 60 molecules of adenine evaluated. 785 nm Here excitation source was used and Raman emission spectra were collected with a 100 millisecond collection time. As shown in FIG. 8, this procedure demonstrated the detection of 60 molecules of adenine and strong emission peaks were detected at about 833 nm and 877 nm. As discussed in Example 1, single molecule detection of adenine was demonstrated using the disclosed methods and apparatus.

Nucleic Acid Sequencing

I1 파지미드 벡터(스트라겐 인코포레이티드)(Stratagene, Inc.)(미국 캘리포니아주 라 졸라 소재))의 다중 클로닝 부위에 삽입하고, E. 콜라이에서 복제한다. 암피실린 함유의 아가로스 플레이트에 도말한 후, 단일 콜로니를 선택하여, 시퀀싱을 위해 성장시킨다. 게놈 DNA 삽입체의 단일 가닥의 DNA 복사체를 헬퍼 파지로 동시 감염함으로써 구출한다. 프로테이나제 K: 나트륨 도데실 술페이트(SDS)의 용액에서 절단한 후, DNA을 페놀 추출한 후, 아세트산나트륨(pH 6.5, 약 0.3 M) 및 0.8 부피의 2-프로판올을 첨가함으로써 석출한다. DNA 함유 펠렛을 트리스-EDTA 완충액에 재현탁시키고, 사용할 때까지 -20℃에서 저장한다. 아가로스 겔 전기영동은 정제된 DNA의 단일 밴드를 나타낸다.Human chromosomal DNA is purified according to Sambrook et al. (1989). After cleavage with Bam H1, the genomic DNA fragments were pBluescript

Insert into multiple cloning sites of the I1 phagemid vector (Stratagene, Inc., La Jolla, Calif.) And replicate in E. coli. After plating on agarose plates containing ampicillin, a single colony is selected and grown for sequencing. Single strands of DNA copies of genomic DNA inserts are rescued by co-infection with helper phage. Proteinase K: After cleavage in a solution of sodium dodecyl sulfate (SDS), the DNA is phenol extracted and then precipitated by addition of sodium acetate (pH 6.5, about 0.3 M) and 0.8 volume of 2-propanol. DNA containing pellets are resuspended in Tris-EDTA buffer and stored at -20 ° C until use. Agarose gel electrophoresis represents a single band of purified DNA.

서열에 상보적인 M13 포워드(forward) 프라이머를 미들랜드 앤드 서치파이드 리에이전트 컴퍼니(Midland Certified Reagent Company)(미국 텍사스주 미들랜드 소재)로부터 구매한다. 프라이머는 올리고뉴클레오티드의 5' 말단에 결합된 비오틴 부분을 포함하도록 공유 변형된다. 비오틴기는 (CH₂)₆ 스페이서를 통해 프라이머의 5'-인산염에 공유결합된다. 비오틴-표지 프라이머를 pBluescript

벡터로부터 제조된 ssDNA 주형 분자에 혼성화하도록 한다. 이어서, 프라이머-주형 착체를 Dorre 등(Bioimaging 5:139-152, 1997)에 따라 스트렙타비딘-코팅 비이드에 결합시킨다. 적당한 DNA 희석으로, 단일 프라이머-주형 착체를 단일 비이드에 결합시킨다. 단일 프라이머- 주형 착체를 함유하는 비이드를 시퀀싱 장치의 반응실에 삽입시킨다.Known pBluescript, located after genomic DNA insert

M13 forward primers complementary to the sequence are purchased from Midland Certified Reagent Company (Midland, Texas, USA). The primer is covalently modified to include a biotin moiety bound to the 5 'end of the oligonucleotide. The biotin group is covalently bound to the 5'-phosphate of the primer via the (CH ₂ ) ₆ spacer. PBluescript Biotin-labeled Primer

Hybridization to the ssDNA template molecule prepared from the vector. The primer-template complex is then bound to streptavidin-coated beads according to Dorre et al. (Bioimaging 5: 139-152, 1997). With appropriate DNA dilution, a single primer-template complex is bound to a single bead. Beads containing a single primer-template complex are inserted into the reaction chamber of the sequencing apparatus.

Primer-templates are incubated with modified T7 DNA polymerase (United States Biochemical Corp., Cleveland, Ohio). Polymerase is confined in the reaction chamber by optical capture (Goodwin et al., 1996, Acc. Chem. Res. 29: 607-619). The reaction mixture was unlabeled deoxyadenosine-5'-triphosphate (dATP) and deoxyguanosine-5'-triphosphate (dGTP), digoxigenin-labeled deoxyuridine-5'-triphosphate (digog) Sigenin-dUTP) and rhodamine-labeled deoxycytidine-5'-triphosphate (rhodamine-dCTP). Allow the polymerization reaction to proceed at 37 ° C.

A continuous flow of all four nucleotides passes through the reaction chamber. The nucleotide concentration is measured before and after the reaction chamber by SERS. Incorporation of nucleotides into the complementary strands is determined by decreasing the concentration of nucleotides leaving the reaction chamber. Time dependent adsorption of nucleotides is used to derive the sequence of the template strand.

In one alternative method, only a single type of nucleotide is provided to the reaction chamber at a time. Each of the four types of nucleotides is added sequentially to the reaction chamber. The amount of nucleotides provided is proportional to the amount of template nucleic acid in the reaction chamber. When nucleotides are complementary to the next base in the template strand, a large deletion in nucleotide concentration is observed in the flow passage channel exiting the reaction chamber. When any other three types of nucleotides are added, little change in nucleotide concentration is observed. The nucleic acid sequence is determined by repeating the process for each base in the template strand.

Example 4

Determination of the presence of nucleotides at the target position of the template nucleic acid molecule

This example illustrates a method for determining the presence of a nucleotide at a target position of a template nucleic acid molecule, as shown in FIGS. 12A-D. A detectable number of copies of the template nucleic acid molecule 60, ie, a single strand of nucleic acid molecule having the sequence 5 'ATGCTATGCAGATGTACATATGTCT 3' (SEQ ID NO: 1), is contacted with the reaction mixture in the reaction chamber. The reaction mixture comprises a primer 90 having the sequence 5 'AGACATA 3' (SEQ ID NO: 2), a polymerase 95 and an initial concentration of first nucleotide (dATP 50). The template nucleic acid 50 is fixed to the surface 70 of the reaction chamber. The reaction mixture is incubated to allow the primers to hybridize to the template nucleic acid molecule as shown in FIG. 12A and to form a post-reaction mixture comprising the template-primer complex. Since dATP 50 is not complementary to nucleotides at target location 65, dATP 50 remains in solution. The first reaction mixture is then collected, deposited onto a surface enhanced Raman spectroscopy (SERS) substrate, and detected using SERS (not shown). Since dATP 50 was not incorporated into the complementary strand (ie, the initial strand), no decrease in the intensity of the Raman signal of dATP 50 (ie, the first nucleotide) in the mixture after reaction was observed. Since the Raman signal of dATP 50 does not decrease, it is concluded that no thymidine residue is present at the target site and the template-primer complex is washed with buffer solution.

Template nucleic acid molecules are optionally washed with buffer at this point to remove residual dATP. The buffer conditions of this wash step allow the primer to remain bound to the template nucleic acid molecule, for example.

As shown in FIG. 12C, since no decrease in the dATP 50 signal is observed, a second nucleotide (eg, dTTP 51) is subsequently introduced with the polymerase 95 and optionally more primers 90, To form a second reaction mixture. After incubation for a sufficient time, dTTP and polymerase are contacted with the template to form a post-reaction mixture comprising the extension product as well as the template-primer complex. That is, since the second nucleotide is complementary to the nucleotide at the target position of the template nucleic acid molecule 60, at the position where the thymidine residue hybridizes to the target position 65, immediately at the 3 'end of the initial strand, the hybridized primer. Incorporated at 3 '. The second reaction mixture is then collected, deposited onto a surface enhanced Raman spectroscopy (SERS) substrate, and detected using SERS (not shown). Since dTTP 51 was incorporated into the complementary strand (ie, the initial strand), a decrease in the intensity of the Raman signal of dTTP 50 (ie, the second nucleotide) in the mixture is observed after the reaction. Since the Raman signal of dTTP 50 is reduced, it is concluded that the presence of nucleotides at the target position is an adenosine residue.

At this point, additional dTTP 51 is optionally introduced to ensure that all the initial nucleic acid molecules are incorporated with thymidine. Also, in the second reaction mixture, when the amount of dTTP 51 added in an optional additional step is known, and also when the number of template nucleic acid molecules immobilized in the reaction chamber is known, continuous A residues are adjacent to the target nucleotide and 3 '. To determine whether nucleotides are found in the template nucleic acid molecule, additional dTTPs in optional additional steps can be deposited on the SERS substrate and detected using the SERS.

The process can then be repeated using dATP, dTTP, and dCTP and dGTP, if necessary, at a time, and sequencing can be continued to confirm the presence of nucleotides in the next nucleotide. This process can be repeated until the entire nucleotide sequence of the template nucleic acid molecule is obtained.

Example 5

SERS and CARS analysis of dAMP

This example shows the optical analysis of dAMP using SECARS. According to Lee and Meisel (1982), silver nanoparticles were prepared for SECARS detection as described above. The silver colloidal solution was diluted with dAMP and LiCI and mixed to obtain a final sample of 90 pM dAMP, 24 mM Ag and 90 mM LiCl. Raman spectra were collected for 100 milliseconds. The pump and Stokes laser were wavered at -2 picoseconds. The average power of the pump laser was ˜500 mW and the average power of the Stokes laser was ˜300 mW. Raman emission spectra were collected using an excitation source here at 785 nm and a 100 millisecond collection time.

As shown in FIG. 13, this procedure demonstrated the detection of dAMP with a strong Raman shift peak at about 737 cm ⁻¹ . As shown in FIG. 14, the results obtained with a control sample identical to the dAMP sample but without the addition of dAMP support the observed Raman shift release peak from dAMP. In addition, under this condition 90 pM dAMP could not be detected using only SERS or CARS alone.

While the invention has been described with reference to the above embodiments, it will be understood that variations and changes are also encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.

                         SEQUENCE LISTING <110> INTEL CORPORATION       BERLIN, Andrew       SU, Xing       CHAN, Selena       KOO, Tae-Woong       SUN, Lei       SUNDARARAJAN, Narayan <120> NUCLEIC ACID SEQUENCING BY RAMAN MONITORING OF UPTAKE       OF NUCLEOTIDES DURING MOLECULAR REPLICATION <130> INTEL1190WO (P18024PCT) <140> PCT / US2004 / 043633 <141> 2004-12-28 <150> US 10 / 749,527 <151> 2003-12-30 <160> 3 <170> PatentIn version 3.1 <210> 1 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Template sequence <400> 1 atgctatgca gatgtacata tgtct 25 <210> 2 <211> 7 <212> DNA <213> Artificial sequence <220> <223> Primer sequence <400> 2 agacata 7 <210> 3 <211> 8 <212> DNA <213> Artificial sequence <220> <223> Primer sequence <400> 3 agacatat 8

Claims (44)

a) separating a purine or pyrimidine base from the ribose or deoxyribose portion of the nucleotide or nucleoside; b) depositing the isolated purine base or pyrimidine base on a surface enhanced Raman spectroscopy (SERS) substrate; c) detecting isolated purine or pyrimidine bases using SERS Including, the detection method of nucleotides or nucleosides. The method of claim 1, wherein the deoxynucleotide triphosphate is detected. The method of claim 2, further comprising including deoxynucleotide triphosphate in the nucleic acid sequencing reaction mixture prior to separating the purine or pyrimidine base from the purine or pyrimidine moiety. The method of claim 1, wherein the purine or pyrimidine base is associated with a Raman label prior to detection by SERS. The method of claim 1 wherein the nucleotide or nucleoside comprises a purine base. The method of claim 5, wherein the base consists essentially of adenine. The method of claim 5, wherein the base consists essentially of guanine. The method of claim 1, wherein the surface enhanced Raman spectroscopy is surface enhanced coherent anti-stokes Raman spectroscopy (SECARS). The method of claim 8, wherein the nucleotide or nucleoside comprises a pyrimidine base. The method of claim 9, wherein the nucleotide or nucleoside comprises thymine. The method of claim 9, wherein the nucleotide or nucleoside comprises uracil. The method of claim 9, wherein the nucleotide or nucleoside comprises cytosine. The method of claim 1, wherein the target molecule is deposited on silver nanoparticles. The method of claim 13, wherein the target molecule is contacted with an alkali-metal halide salt. The method of claim 14, wherein the alkali-metal halide salt is lithium chloride. a) isolating the target molecule; b) depositing a target molecule on a surface enhanced Raman spectroscopy (SERS) substrate; c) detecting the target molecule by detecting Raman scattering from the irradiated target molecule using surface enhanced coherent anti-stokes Raman spectroscopy (SECARS) Method for detecting a target molecule comprising a purine base or a pyrimidine base, comprising. The method of claim 16, wherein the target molecule is isolated from the biological sample. The method of claim 16, wherein the target molecule is a nucleotide, nucleoside or base. The method of claim 18, wherein the target molecule consists essentially of pyrimidine bases. The method of claim 19, wherein the base consists essentially of thymine. The method of claim 19, wherein the base consists substantially of uracil. The method of claim 19, wherein the base consists essentially of cytidine. The method of claim 16, wherein the target molecule is nucleotide triphosphate. a) contacting a known number of copies of the template nucleic acid molecule with a reaction mixture comprising a primer, a polymerase, and a known initial concentration of first nucleotide to form a post-reaction mixture (primer or template The nucleic acid is immobilized on the surface of the reaction chamber, wherein the 3 'end of the primer binds to a template nucleic acid molecule upstream of the 5' nucleotide of the continuous target position); b) post reaction reacting the mixture on a surface enhanced Raman spectroscopy (SERS) substrate; c) detecting the first nucleotide using SERS; d) determining whether one or more first nucleotides are added to consecutive target positions A method for detecting identical nucleotides at consecutive target positions in a template nucleic acid molecule comprising a. The method of claim 24, wherein the known number of copies of the template nucleic acid molecule is approximately equal to the known number of first nucleotide molecules in the reaction mixture. The method of claim 24, wherein the known number of copies of the template nucleic acid molecule is approximately one half of the known number of first nucleotide molecules in the reaction mixture. The method of claim 24, further comprising adding an additional first nucleotide to the reaction mixture after detecting the first nucleotide. The method of claim 24, further comprising cleaving the base from the nucleotides and detecting the base using SERS. The method of claim 24, wherein the SERS detection is surface enhanced coherent anti-stokes Raman spectroscopy (SECARS). The method of claim 24, further comprising repeating steps a to d using another nucleotide. The method of claim 24, wherein the nucleotides are attached to the Raman label prior to detection by SERS. The method of claim 24, wherein the internal control is included in the reaction mixture and detected using SERS. 33. The method of claim 32, wherein the SERS signals of the internal control and the nucleotides are compared to determine whether one or more nucleotides have been added to consecutive target positions. a) contacting a detectable number of template nucleic acids with a reaction mixture in a reaction chamber (the reaction mixture comprises a primer, a polymerase and an initial concentration of first nucleotide triphosphate, the primer or template nucleic acid being on the surface of the reaction chamber) Fixation); b) incubating the reaction mixture to allow primers to bind to the template nucleic acid and to form a mixture after the reaction; c) depositing the mixture or components thereof on a surface enhanced Raman spectroscopy (SERS) substrate after the reaction; d) detecting the Raman signal from the first nucleotide using SERS, wherein a reduction in the intensity of the Raman signal of the first nucleotide in the mixture after the reaction confirms the extension reaction product, thereby indicating the presence of the nucleotide at the target position. Confirm) A method for determining the presence of a nucleotide at a target position of a template nucleic acid molecule, comprising. 35. The method of claim 34, further comprising repeating steps a through d with other nucleotides until nucleotide presence is confirmed. 36. The method of claim 35, further comprising washing the substrate prior to optionally repeating steps a through d. The method of claim 34, wherein the incubation time is between about 1 second and 10 minutes. The method of claim 34, wherein the reaction chamber is less than 100 nm in at least one dimension. The method of claim 34, wherein the pre-reaction SERS analysis is performed on the first nucleotide before contacting the first nucleotide with the template nucleic acid molecule. The method of claim 39, wherein the reduction in the intensity of the SERS signal of the first nucleotide in the post-reaction mixture relative to the pre-reaction mixture identifies the extended reaction product. The method of claim 34, wherein the method is performed twice for the target nucleotide position using dATP and dGTP at once as the first and second nucleotides. 42. The method of claim 41, wherein the complementary strand of template nucleic acid molecule is immobilized in a second reaction chamber and additionally performed twice additionally with dATP and dGTP at once as the first and second nucleotides. Way. The method of claim 34, wherein the internal control is included in the reaction mixture and detected using SERS. The method of claim 43, wherein the SERS signals of the internal control and the nucleotides are compared to confirm the presence of nucleotides at the target position.

Images