KR20060097143A - Vector dna expressing scfv for producing scfv antibody library - Google Patents

Abstract

The present invention relates to a ScFv expression vector for expressing a ScFv-type synthetic antibody library, by forming restriction enzyme sites in the linker gene of the antibody ScFv expression vector, each of the various heavy or light chain variable regions is individually By providing an antibody ScFv expression vector for easier construction of the antibody library by inserting it into an expression vector, it provides a quantitative antibody ScFv compared to the method of inserting the antibody ScFv itself into the expression vector, and more efficiently preparing the antibody library. Has an excellent effect.

ScFv, antibody, antibody library, pCANTAB5E, site-directed mutagenesis, silent mutation, His-tag

Description

Vector DNA expressing ScFv for producing ScFv antibody library

1 is a flowchart illustrating a process of preparing an antibody ScFv expression vector for preparing an ScFv-type antibody library of the present invention.

FIG. 2 is a genetic map of pCANTAB5E (Amersham Pharmacia Biotech, Sweden) into which the antibody ScFv (V _H -linker-V _L ) is inserted,

3 is a flowchart showing the progression of site-directed mutagenesis using the GeneEditor ^™ in vitro Site-Directed Mutagenesis System (Promega, USA),

4 is a genetic map of pKS4H in which a BspEI restriction enzyme site is formed in a linker gene of ScFv of the present invention,

FIG. 5 shows that BspEI restriction enzyme sites generated by site-directed mutagenesis in the linker gene of ScFv were selected by cleavage with BspEI restriction enzymes 1, 4, 6, 7, 10, 12, 14 , 15 is generated correctly,

Figure 6 is to confirm the integrity of the vector by estimating the size of the cleaved band by treating the restriction enzyme in order to confirm that the vector formed on the linker gene of the ScFv BspEI restriction enzyme site is correct,

7 is a vector of the present invention (pKS4H) by cutting the corresponding part in the pKS3C vector (FIG. 10: the inventors made by the inventors) in order to replace the E-tag of the identified vector system (pKS4E) with His-tag. To prepare a vector gene, insertion gene to complete,

FIG. 8 shows the final pKS4H in which the BspEI restriction site was generated in the linker gene of ScFv and the E-tag was replaced with His-tag, and was identified through the cleaved band using the related restriction enzyme.

9 is a comparison of the expression level with the existing pCANTAB5E vector by enzymatic immunoassay to introduce the tetanus antibody gene to confirm that the constructed pKS4H vector system works properly.

10 is a genetic map of the pKS3C vector used to replace E-tag with His-tag.

The present invention relates to a ScFv expression vector for expressing a ScFv type synthetic antibody library, and more particularly, by forming restriction enzyme sites in a linker gene of an antibody ScFv expression vector, various heavy chain variable region or light chain variable It relates to an antibody ScFv expression vector for easier construction of antibody libraries by inserting regions into expression vectors, respectively.

Since the introduction of cell fusion technology between tumor cells and mouse B cells by Kohler and Milstein in 1975, monoclonal antibodies have been produced (Stone MJ (2001): Monoclonal antibodies in the prehybridoma era: a brief historical perspective and personal reminiscence.Clin lymphoma, 2: 148-154). The development of such hybridoma technology has made it possible to produce monoclonal antibodies that respond to specific antigens, thereby enabling the production of monoclonal antibodies having affinity for specific antigens expressed on the surface of tumor cells for tumor targeting. The mouse monoclonal antibody has the advantage of being able to apply various target antigens and mass production, and the concept of selective drug is magic bullet. It is suggested by Ehrlich for the diagnosis reagent or basic research. Very usefully used (Reilly RM, Sandhu J, Alvarez-Diez ™, Gallinger S, Kirsh J and Stern H (1995): Problems of delivery of monoclonal antibodies.Pharmaceutical and pharmacokinetic solutions.Clin Pharmacokinet , 28: 126-142) .

Antibody-targeted therapy results in a therapeutic effect by the ability of the antibody to specifically bind to tumor associated antigens expressed on the surface of cancer cells. Antibodies derived from mice have an inadequate disadvantage as a therapeutic agent for the prevention and treatment of human diseases because they can cause a fatal human anti-mouse antibody response (HAMA) when administered repeatedly to the human body. The phage display method displays and expresses specific binding peptides or antibodies on the surface of insoluble filamentous bacteriophage M13. The selective reaction process, called biopanning, is repeated several times to select only phages that respond to specific antigens among phages with various specific binding substances. The phage thus selected can be produced in large quantities through proliferation. The principle of phage display is that pIII, a minor coat protein encoded by gene III of M13 bacteriophage, is expressed as a surface protein of phage, and is usually expressed in 3 to 5 molecules, and is adsorbed to bacterial pilus. When the antibody is expressed in conjunction with pIII, biopanning is used to identify phages that react with specific binding substances. This phage display method has also been used to make recombinant antibodies to tumor-specific antigens. The advantage of this technique is that it can isolate monoclonal antibodies against specific antigens in just a few months.

However, this technique has a disadvantage that it is difficult to develop high affinity antibodies unless the antibody library is very large. In order to make a practically useful recombinant antibody, using a genetic recombination method from a monoclonal antibody-producing hybridoma using the phage display method as described above, the specific binding sites of the heavy chain variable region (V _H ) and the light chain variable region (V _L ) are constant. Linking with a peptide linker of length produces a single chain variable fragment (ScFv) linked to a variable portion. The single-chain antibody thus produced has a structure similar to that of the derived monoclonal antibody (Thirion S, Motmans K, Heyligen H, Janssens J, Raus J and Vandevyver C (1996): Mono- and bispecific single-chain antibodies fragments ofr cancer therapy.Eur J Cancer Prev, 5: 507-511).

As described above, the synthetic antibody library has been completed by connecting the heavy chain variable region (V _H ) and the light chain variable region (V _L ) with a peptide linker to prepare an antibody ScFv and inserting it into an expression vector.

The present inventors have found out that the conventional method is difficult to quantitatively construct an antibody gene sufficiently, and hassles that have to go through several steps through research.

Accordingly, the present invention is to solve the problems of the prior art, in the antibody ScFv expression vector comprising a heavy chain variable region (V _H ) and a light chain variable region (V _L ) linked by a gene encoding a conventional linker peptide By forming restriction enzyme sites in the gene sequence encoding the linker peptide, various heavy chain variable regions (V _H ) and light chain variable regions (V _L ) are introduced into the vector system and expressed in the vector system to produce antibody ScFv libraries. The aim is to provide more convenient antibody ScFv expression vectors.

The antibody ScFv expression vector of the present invention has a site that is cleaved with a restriction enzyme in the linker gene of ScFv, thereby inserting a variety of V _H and V _L into the vector system individually to insert the conventional antibody ScFv itself into the expression vector. In comparison, it provides a quantitative antibody ScFv and provides an excellent effect of preparing antibody libraries more efficiently.

In order to achieve the above object, the present invention provides an antibody ScFv expression vector comprising a heavy chain variable region (V _H ) and a light chain variable region (V _L ) linked by a gene encoding a linker peptide, wherein the linker peptide The gene encoding the antibody provides an antibody ScFv expression vector comprising a site cleaved with a restriction enzyme.

In addition, the present invention provides an antibody ScFv expression vector, characterized in that the gene encoding the linker peptide comprises the nucleotide sequence of SEQ ID NO: 1 (BspEI restriction enzyme site).

The present invention also provides an antibody ScFv expression vector, wherein the linker peptide comprises the amino acid sequence of SEQ ID NO: 2.

The present invention also provides plasmid pKS4E with the antibody ScFv expression vector.

In addition, the present invention provides an antibody ScFv expression vector, characterized in that the antibody ScFv expression vector comprises his-tag.

The present invention also provides plasmid pKS4H with the ScFv expression vector.

In addition, the present invention provides a restriction enzyme by silent mutation to a linker peptide coding gene of an antibody ScFv expression vector comprising a heavy chain variable region (V _H ) and a light chain variable region (V _L ) linked by a gene encoding a linker peptide. It provides a method for producing an antibody ScFv expression vector, characterized in that to form a site. The silent mutation is preferably using a site-directed mutagenesis, the restriction site preferably comprises a nucleotide sequence of SEQ ID NO: 1 (BspEI restriction site).

Hereinafter, the present invention will be described in more detail.

Conventional synthetic antibody libraries have been completed by connecting the heavy chain variable region (V _H ) and the light chain variable region (V _L ) by peptide linker to prepare antibody ScFv and insert them into expression vectors.

The present inventors have found out that the conventional method is difficult to quantitatively construct an antibody gene sufficiently, and hassles that have to go through several steps through research.

Thus, the present inventors have made new attempts to produce antibody libraries more efficiently. That is, a restriction enzyme site is formed by silent mutation of a linker peptide coding gene of an antibody ScFv expression vector comprising a heavy chain variable region (V _H ) and a light chain variable region (V _L ) linked by a gene encoding a linker peptide. By inserting the heavy chain variable region (V _H ) and the light chain variable region (V _L ) into the restriction enzyme region, more quantitative, diverse and easy antibody libraries could be prepared.

In particular, in the present invention, it is preferable to form a BspEI restriction enzyme site as a restriction enzyme region, and when using pCANTAB5E as the original vector of the antibody library, it is preferable to remove the BspEI restriction enzyme site of the E-tag. tag to His-tag to remove BspEI restriction enzyme present in E-tag)

Hereinafter, the configuration of the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited only to the following examples.

Experimental Materials

Original vector DNA was used pCANTAB5E. In this experiment, XLI-Blue competent cells were used to obtain plasmid DNA. QIAGEN plasmid mini prep kit and midi prep kit were used to isolate plasmid DNA. Original vector DNA was used pCANTAB5E. GeneEditor ^™ in vitro Site-Directed Mutagenesis System was purchased from Promega, USA for site-directed mutagenesis. Restriction enzymes were purchased from New England Biolabs. Isopropyl β-D-1'-thiogalactopyranoside (IPTG) was purchased from SIGMA to induce antibody expression, HRP / anti-His tag conjugate was purchased from QIAGEN to measure antibody expression, and TPL peroxidase substrate was KPL. It was purchased from the company.

Example 1: Site-directed mutagenesis (SDM) of pCANTAB5E with tetanus antibody ScFv

1) pCANTAB5E with tetanus antibody ScFv

The tetanus monoclonal antibody established in this laboratory was cloned into the pCANTAB5E vector in ScFv form using the Mouse ScFVv Module / Recombinant Phage Antibody System (Amersham Pharmacia Biotech).

1 is a flowchart illustrating a process of preparing an antibody ScFv expression vector for preparing an ScFv-type antibody library of the present invention.

2 is a genetic map of pCANTAB5E with ScFv (V _H -linker-V _L ) inserted.

2) Heat denaturation and annealing of oligonucleotides

Figure 3 is a flow chart showing the progress of the site-directed mutagenesis using GeneEditor ^TM in vitro Site-Directed Mutagenesis System (Promega).

The plasmid vector pCANTAB5E (double strand DNA, dsDNA) 165 ng (10 μl, 0.05 mmol / μl) into which the tetanus antibody ScFv was introduced was heated to 94 ° C. using a DNA mutagenesis template and separated into single strand DNA (ssDNA) ( Heat denaturation), 1 μl (0.25 mmol / μl) of a selection oligonucleotide (phosphorylated top or bottom primer) shown in Table 1, 1 μl (1.25 mmol / μl) of mutagenic oligonucleotide (phosphorlylated), 2 μl of Annealing 10X Buffer, and 6 μl of sterile deionized water was added to make 20 μl of the reaction solution, which was then heated to 75 ° C. for 5 minutes, quenched for 5 minutes on ice, and then reacted at room temperature for 30 minutes. (Oligonucleotide Annealing Step)

Oligonucleotide Type Size Primer sequence (5 '→ 3') Selection Oligonucleotide, Phosphorylated (Top Strand) 35mer 5'd (pGATAAATCTGGAGCCTCCAAGGGTGGGTCTCGCGG) -3 ' Selection Oligonucleotide, Phosphorylated (Bottom Strand) 35mer 5'd (pCCGCGAGACCCACCCTTGGAGGCTCCAGATTTATC) -3 ' mutagenic oligonucleotide, phosphorlylated 60mer 5'd (pGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCCGGAGGTGGCGGATCG) -3 '

As shown in FIG. 3, the Selection Oligonucleotide is annealed to the Amp ^r site and bound, and the Mutagenic oligonucleotide is annealed to the linker gene site of the antibody ScFv.

3) Mutant strand synthesis and ligation

5 μl of Sterile deionized water, 3 μl of synthesis 10X buffer, 1 μl of T4 DNA ligase, and 1 μl of T4 DNA polymerase were added to the annealed antibody ScFv introduction plasmid vector pCANTAB5E mixture to a total solution of 30 μl, followed by 90 minutes at 37 ° C. Reacted.

4) BMH71-18 mut Transform into S competent cells

In order to increase mutegenesis efficiency, transformation was performed using E. coli BMH 71-18 mutS as competent cells.

E. coli BMH71-18 mutS is reduced in the repair capacity of DNA missmatch in mutS (repair minus) cells. When site-directed mutagenesis is used, the BMH71-18 mutS is used as a host cell. Since the repair is suppressed, it is easy to fix the mutation to be introduced and the mutation introduction efficiency is increased.

5 μl of the mutated plasmid mixture (SDM mixture) and 100 μl of E. coli BMH71-18 mutS Competent cell were added to a 1.5 ml tube, followed by incubation for 10 minutes on ice, followed by reaction at 42 ° C. for 45 seconds (Heat -shock), quenched in ice for 2 minutes and added to 1 ml of SB, and then incubated at 250 rpm for 1 hour at 37 ° C. SB 4 ml, GeneEditor Antibiotic Selection mix. 100 μl was added and incubated at 37 ° C. and 250 rpm for 16-18 hours.

As shown in FIG. 3, E. coli BMH71-18 mutS competent cells without selection oligonucleotide were killed by GeneEditor Antibiotic Selection mix, and only E. coli BMH71-18 mutS competent cells with selection Oligonucleotide were introduced to form colonies. Mutagenic oligonucleotides are not repaired and mutations are fixed.

5) Transformation with JM109 competent cells

E. coli JM109 was used as competent cells to select the mutagenesis of the recombinant plasmid.

E. coli JM109 transforms pUC-based plasmid vectors and transduces M13 phage vector DNA, and lacZα peptide (αfragment) expressed from vector DNA and lacZΔM15 (omega fragment) coded by JM109 F ′. By using the activity recovery of β-galactosidase (α-complementarity) is a strain that is easy to select the recombinant. Because of its F'plasmid, it can be used for the production of ssDNA as a host of M13 vector DNA in addition to the construction of gene libraries or subcloning.

After plasmid mini prep was transformed into cells transformed with the E. coli BMH 71-18 mutS competent cells, 100 μl of DNA and JM109 competent cells were added in about 5-10 ng, incubated for 30 minutes on ice, and then at 42 ° C. After reacting for 45 seconds, the mixture was quenched in ice for 2 minutes and added to SB 1ml, and then incubated at 250 rpm for 1 hour at 37 ° C. SB / carbencillin, GeneEditor Antibiotic Selection mix. 100 μl plate was plated.

As shown in FIG. 3, only mutegenized recombinant plasmids form colonies.

4 is a genetic map of pKS4H in which a BspEI restriction enzyme site was formed in a linker gene of ScFv of the present invention.

Example 2 Colony Selection and Enzyme Mapping

FIG. 5 shows that BspEI restriction enzyme sites generated by site-directed mutagenesis in the linker gene of ScFv were selected by cleavage with BspEI restriction enzymes 1, 4, 6, 7, 10, 12, 14 , 15 is generated correctly.

Plasmid mini prep was carried out by colonization of the plate in 2 ml culture, and then the BspEI restriction site of the E-tag of the scFv-introduced plasmid vector pCANTAB5E was removed, and the linker (site-directed mutagenesis (SDM)) was used. linker) was confirmed that the BspEI restriction enzyme site was properly formed by treatment with BspEI (Fig. 5).

And, Figure 6 is to confirm the integrity of the vector by estimating the size of the cleaved band by treating the restriction enzyme to confirm that the vector is formed in the linker gene of ScFv BspEI restriction enzyme site is correct.

Example 3 Introduction of His-tag

The E-tag of the plasmid vector (pKS4E) into which the BspEI restriction enzyme was introduced into the linker of the tetanus antibody ScFv has the same restriction enzyme as that of the BspEI restriction enzyme formed on the linker of ScFv. After cutting the E-tag at the position, the His-tag fragment of pKS3C (FIG. 10) was cut with NotI, EcoRI restriction enzyme, prepared by insert, and inserted into pKS4E to remove the BspEI restriction site. (PKS4H)

7 is a vector of the present invention (pKS4H) by cutting the corresponding part in the pKS3C vector (FIG. 10: the inventors made by the inventors) in order to replace the E-tag of the identified vector system (pKS4E) with His-tag. A vector gene and insertion gene were prepared for completion. The result was electrophoresis after pKS4E and pKS3C were cut with NotI and EcoRI restriction enzymes.

8 shows the final pKS4H in which the BspEI restriction site was generated in the linker gene of ScFv and the E-tag was replaced with His-tag, and was identified through the cleaved band using the related restriction enzyme.

Example 4 IPTG induction and ELISA screening

pKS4H DNA was electroporated in XLI-Blue competent cell, spread on SB / carbencillin plate, incubation at 37 ℃ overnight, 2ml culture after colonies, shaking incubation at 250 ℃ at OD ₆₀₀ to 0.8 ~ 1.0, IPTG 1 The solution was treated with mM, and overnight induction was performed at 30 ° C. and 250 rpm. After centrifugation of this reaction at 3000 rpm for 5 minutes, each supernatant was added to an ELISA plate coated with Tetanus antigen, and then reacted at room temperature for 2 hours. After washing 5 times with PBST (1XPBS, 0.05% tween 20), HRP After diluting / anti-his tag conjugate to 1/500 with 1% BSA / PBS, reacted at room temperature for 1 hour 30 minutes, washed 5 times with PBST again, and then TMB peroxidase substrate solution A & B 1: 1. After incubation for 5-10 minutes after the reaction mixture was added, the value was read at 405nm wavelength using TECAN sunrise.

9 is a comparison of the expression level with the existing pCANTAB5E vector by enzymatic immunoassay to introduce the tetanus antibody gene to confirm that the constructed pKS4H vector system works properly.

Samples were expressed in pKS4H and pCANTAB5E containing the ScFv tetanus antibody gene and measured as antibodies against His-tag & E-tag, respectively, and PBS and hybridoma cultures were used as controls.

As shown in Figure 9, it can be seen that the same degree of OD value obtained by detecting the antibody expressed in the origianl vector pCANTAB5E.

The antibody ScFv expression vector of the present invention has a site that is cut by restriction enzymes in the linker gene of ScFv, so that various V _Hs and V _Ls are introduced into the vector system individually, compared to the method of inserting the antibody ScFv itself into the expression vector. It provides a quantitative antibody ScFv and provides an excellent effect of making antibody libraries more efficiently.

<110> GREEN CROSS HOLDINGS <120> Vector DNA expressing ScFv for producing ScFc antibody library <130> sp-240107 <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> BspEI <400> 1 tccgga 6 <210> 2 <211> 2 <212> PRT <213> Artificial Sequence <220> <223> protein <400> 2 Ser gly   One

Claims (10)

In an antibody ScFv expression vector comprising a heavy chain variable region (V _H ) and a light chain variable region (V _L ) linked by a gene encoding a linker peptide, The gene encoding the linker peptide is an antibody ScFv expression vector, characterized in that it comprises a site cleaved by a restriction enzyme. The antibody ScFv expression vector of claim 1, wherein the gene encoding the linker peptide comprises the nucleotide sequence of SEQ ID NO: 1 (BspEI restriction site). The antibody ScFv expression vector of claim 1 or 2, wherein the linker peptide comprises the amino acid sequence of SEQ ID NO: 2. The ScFv expression vector of claim 2, wherein the antibody ScFv expression vector is pKS4E. The antibody ScFv expression vector of claim 1 or 2, wherein the tag gene of the antibody ScFv expression vector has no nucleotide sequence of SEQ ID NO: 1 (BspEI restriction site). The antibody ScFv expression vector of claim 5, wherein the tag gene of the antibody ScFv expression vector is a his-tag gene. The antibody ScFv expression vector of claim 6, wherein the antibody ScFv expression vector is pKS4H. Forming a restriction enzyme site by silent mutation of a linker peptide coding gene of an antibody ScFv expression vector comprising a heavy chain variable region (V _H ) and a light chain variable region (V _L ) linked by a gene encoding a linker peptide. Method for producing an antibody ScFv expression vector characterized in. The method of claim 8, wherein the silent mutation is a method for producing an antibody ScFv expression vector, characterized in that using a site-directed mutagenesis. The method of claim 8 or 9, wherein the restriction enzyme site comprises a base sequence of SEQ ID NO: 1 (BspEI restriction enzyme site), characterized in that the antibody ScFv expression vector production method.

Images