KR20060089007A - Composition for preventing and treating the xeroderma - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing and treating skin drying, and more particularly, to a pharmaceutical composition for preventing and treating diseases caused by skin drying by inhibiting the expression of ceramide degrading enzymes in the stratum corneum which contains silk protein as an active ingredient. It is about.

By inhibiting the expression of ceramide degrading enzyme that maintains skin moisturization by the dietary supply of the composition according to the present invention and at the same time contains a large amount of moisturizing serine to prevent epidermal moisture loss and skin cell overgrowth to prevent diseases caused by skin dryness There is a treatable benefit.

Skin Drying, Silk Protein

Description

Pharmaceutical composition for preventing and treating diseases caused by skin dryness {Composition for preventing and treating the xeroderma}

1 is a diagram showing the metabolic (production and degradation) pathways of ceramides.

Figure 2 is a graph showing the results of measuring the change in the total ceramide content.

Figure 3 is a graph showing the results of measuring the SPT synthesis ability, a ceramide de novo synthase.

Figure 4 is a graph showing the results of measuring the mRNA expression change of SPT.

5 is a graph showing the results of measuring the mRNA expression change of Ceramidase, a degradation enzyme of ceramide.

The present invention relates to a pharmaceutical composition for preventing and treating skin drying, and more particularly, to a pharmaceutical composition for preventing and treating diseases caused by skin drying by inhibiting the expression of ceramide degrading enzymes in the stratum corneum which contains silk protein as an active ingredient. It is about.

      Healthy skin means that the surface is glossy and has elasticity and moist feeling. The amount of moisture contained in the skin itself is an important factor in determining skin health. The stratum corneum of the healthy epidermis contains 15-20% of moisture, and when the water drops below 10%, the skin becomes dry, lustrous and elastic, and wrinkles increase.

     Psoriasis and atopic dermatitis are known as representative skin diseases in which skin dryness occurs. In particular, atopic dermatitis is a representative skin disease that occurs in about 10-20% of the total population. As the etiology of atopic dermatitis, various etiologies such as genetic aspects, allergies and immunological aspects, and pharmacological physiology are known to work. Characteristic symptoms are severe pruritus and dry skin, and the dry skin is damaged by the barrier function of the stratum corneum, so external stimulants or antigens can easily pass through the vicious skin symptoms.

       As such, the health of the skin is maintained by the moisture present in the stratum corneum of the epidermis, the outermost layer of the skin, and the moisture content of the stratum corneum is a natural moisturizing factor (NMF), a water-soluble component present in the sebaceous membrane and the stratum corneum, a lipid mixture produced and secreted from the epidermis. : Natural Moisturizing Factor.

The sebaceous membrane of the epidermis, the first line of human defense mechanism, is a lipid mixture in which the ceramide, cholesterol, and unsaturated fatty acids secreted from the stratum corneum cells, which are the outermost layers of the epidermis, form an intracellular lamellae structure in the cell. In particular, the ceramide of the sebaceous membrane of these sebaceous membranes is produced by the combination of serine and palmitoyl-CoA provided in the process of protein and phospholipid degradation (see Figure 1), sphingosine, compared to cholesterol and unsaturated fatty acids, linked to the amide It has a complex structure including amide-linked non hydroxy acid, α-hydroxy acid or ω-hydroxy acid, ester-linked fatty acid, etc., and the polarity formed by these structural factors It is important to maintain the lamella structure.

Trans epdermal water loss (TEWL) has been reported to be inversely related to changes in the content of ceramide and natural moisturizing factors.

       The natural moisturizing factor itself is hygroscopic and lowers the tension on the surface of the skin and thus directly affects the skin's moisturizing. Natural moisturizing factors include lactic acid, pyrrolidone carboxylic acid (PCA), urocanic acid (UCA), urea, amino acids (serine, glycine, glycine, proline, citrulline, arginine, etc.) produced during the decomposition of minerals and proteins. It is composed of such as to maintain the moisture holding capacity including the water holding capacity (moisture holding capacity) to keep the water retained state (hygroscopicity) to absorb moisture in the air.

Thus, in order to prevent skin drying and increase the moisture content of the stratum corneum, coating agents, moisturizers, and the like are frequently applied, but these have a problem in that they help to alleviate temporary drying symptoms.

In the present invention, while recognizing that skin health is closely related to nutrition as well as external preparations, it was noted that sericin of silk protein has high serine content while searching for various protein source foods for dietary supplementation of serine. .

Sericin is a protein that makes up 25% of the cocoon, and it binds to the surface of fibroin (about 75% of the cocoon). In addition, constituent amino acids of sericin are more than 75% of polar amino acids such as serine and threonine, and are easy to decompose, and are easy to dissolve in water. strong.

The present invention is to solve the above problems, in general, if the diet is fed silk protein known to contain a lot of serine to determine how it affects the diseases caused by skin drying to prevent and treat these diseases as It is to provide a pharmaceutical composition.

Other objects and advantages of the invention will be described below and will be appreciated by the practice of the invention. In addition, the objects and advantages of the present invention can be realized by means and combinations indicated in the claims.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention and treatment of diseases caused by skin drying by inhibiting the expression of ceramide degrading enzyme in the stratum corneum of the skin as an active ingredient silk protein.

The pharmaceutical compositions according to the invention can be used with other agents useful for the treatment of atopic dermatitis or dryness. The individual components of such a mixture may be administered separately at different times during the treatment, or may be administered one at a time or separately in mixed form. Accordingly, the invention is to be understood as encompassing all areas of concurrency or replacement and the term “administration” is to be interpreted accordingly. The range of mixing the pharmaceutical compositions of the present invention with other agents useful for the treatment of atopic dermatitis or dryness includes all mixing with pharmaceutical compositions useful for the treatment of atopic dermatitis or dryness.

The pharmaceutical compositions of the present invention may be administered orally in the form of tablets, capsules (each of which is a sustained release or secretory formulation after a period of time), pills, powders, particulates, elixirs, tinctures, suspensions, syrups and emulsions. Likewise, they are also well known to those skilled in the pharmaceutical arts, such as intravenous (pills or infusions), intraperitoneal, topical (eg skin creams or eye drops), subcutaneous, intramuscular, or transdermal (eg patches) forms. It can be administered by the method.

Prescription dosages using the compounds of the present invention take into account various factors such as type, species, age, weight, sex, and the patient's health condition, the severity of the condition to be treated, the route of administration, and the function of the patient's kidney or liver. Is selected. Ordinary physicians, veterinarians or clinicians can easily determine and prescribe the pharmacologically effective amount of the drug required to prevent, counter or prevent the development of the condition.

The oral dosage of the present invention used for the indicated effect is between about 0.01 mg (mg / kg / day) to about 100 mg (mg / kg / day) per kg of weight per day, preferably per kg of weight per day It is between about 0.01 mg (mg / kg / day) to about 10 mg (mg / kg / day), more preferably from 0.1 to about 5.0 mg / kg / day. For oral administration, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, and 500 mg active factors for symptomatic dose adjustments to patients to be treated. It is preferably provided in the form of a containing syrup. Drugs typically contain from about 0.01 mg to about 500 mg of active factor, and preferably from about 1 mg to about 100 mg of active factor. Intravenously, the most preferred dose is 0.1 to 10 mg / kg / min during continuous infusion. Preferably, the pharmaceutical composition of the present invention may be taken once a day or divided into two, three or four times a day to administer the daily dose. In addition, preferably, the pharmaceutical composition of the present invention may be administered in a nasal form via topical using a suitable nasal carrier, or may be administered by a transdermal route using a transdermal skin patch form well known to those skilled in the art. have.

The pharmaceutical compositions of the present invention may be in the form of an active factor and are selected from pharmaceutically suitable diluents, additives or carriers (commonly referred to herein as "carrier" substances) for dosage forms such as oral tablets, capsules, elixirs, syrups and the like. Is administered by typical pharmaceutical techniques.

For example, for oral administration in the form of tablets or capsules, the active drug ingredient may be an oral, nontoxic, pharmaceutically acceptable, lactose, starch, sucrose, glucose, methyl cellulose, magnesium stearate, diphosphate Compound with inert carriers such as calcium, calcium sulfate, mannitol, sorbitol and the like; For oral administration in liquid form, the active drug ingredient may be combined with an inert carrier such as oral, nontoxic, pharmaceutically acceptable, ethanol, glycerol, water and the like.

In addition, if necessary, suitable binders, lubricants, dispersants and coloring agents may also be added to the mixture. Suitable binders include natural sugars such as starch, gelatin, glucose or beta-lactose, natural and synthetic rubbers such as corn sweeteners, acacia, tragacanth or sodium alginate, carboxymethylcellulose, polyethylene glycols, waxes, and the like. . Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Dispersants include, without limitation, starch, methylcellulose, agar, bentonite, xant rubber and the like.

Hereinafter, exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings. Prior to this, terms or words used in the specification and claims should not be construed as having a conventional or dictionary meaning, and the inventors should properly explain the concept of terms in order to best explain their own invention. Based on the principle that can be defined, it should be interpreted as meaning and concept corresponding to the technical idea of the present invention.

Therefore, the embodiments described in the specification and the drawings shown in the drawings are only the most preferred embodiments of the present invention and do not represent all of the technical idea of the present invention, various equivalents that may be substituted for them at the time of the present application It should be understood that there may be water and variations.

<Example>

1. Materials and reagents

       Primers and PCR premixes used for RT-PCR were obtained from Bioneer, AMV reverse transcriptase and RNasinA Ribonuleas lnh, Serine Biosciences, 6X-loading dye and PN6 from Daemyung Science, single antibody and cytokine. ID Labs Inc. (Ontario, Canada). IgE-related antibodies were also purchased from Bio-source International (Comarillo, CA, U.S.A).

       2. Experimental Animal

       Atopic dermatitis mice (NC / Nga mice) and BALB / c mice, which are normal control mice, were supplied from a central laboratory and fed with diet and water as ad libitum. The temperature and humidity of the animals were 22 ± 1 ℃ and 60, respectively. It was maintained at ± 5%, and was bred for 10 weeks in a changing animal room at 12 hour intervals. NC / Nga mice, which are atopic dermatitis mice, are normal in SPF (Specific Pathogen Free) environment, but atopic dermatitis is usually accompanied by itching in the environment (3-4 weeks later).

     3. Dietary composition

Adapted to the solid blended feed for 1 week before breeding into the experimental diet was divided into four groups by the ovary method according to the weight was fed to the NC / Nga Tnd mice for 10 weeks. The dietary composition of each experimental group is shown in Table 1, and silk proteins sericin (S) and fibroin (F) were fixed at 1% of the dietary weight. The NC / Nga Tnd mice group (Control A) and BALB / c mice group (Control B) fed the diet containing no silk protein served as atopic dermatitis and normal controls, respectively.

Table 1 Composition of diet (g / kg dry diet)

 Ingredient Group Control A (n = 10) Control B (n = 10) S (n = 10) F (n = 10) Casein 230 230 220 220 Sericin 0 0 10 0 Fibroin 0 0 0 10 L-cystine 3 3 3 3 Corn-oil 100 100 100 100 Cellulose power 50 50 50 50 Vitamin mixture 10 10 10 10 Salt mixture 35 35 35 35 Sucreose 200 200 200 200 Corn starch 372 372 372 372

4. Silk Protein Samples

1) Silk Sericin Extract

Silk sericin used in the present invention was extracted from B. mori cocoon. Extraction was performed by adding 100 ml of cocoon to 3000 ml of water, extracting hot water at 110 ° C. for 5 hours, and filtering to remove the residue. Recovery of the initial weight was about 22%. Thereafter, the silk protease (Novo, Denmark) enzyme was inactivated and then filtered (0.45㎛, Sartorims, Germany) and subjected to lyophilizer (Ilsinsa, Korea) using an average molecular weight (MW) of about 5000 Silk sericin was recovered. The mean dose was confirmed by SDS-PAGE.

      2) Silk Fibroin (F) Extraction

Dissolution of sericin-free pure silk fibroin was completely separated from fibroin and salt using an enzyme hydrolysis solution using Sephadex G-25 Gel Filtration Chromatography (Pharamacia, GradiFrac, UV-1 detection, Sweden). Thereafter, 3% (w / w) of protein urea (Nove, Denmark) was added, and hydrolysis was performed at 55 ° C. for 24 hours under nitrogen gas filling conditions. Thereafter, the residue was removed by inactivation of the enzyme at 100 ° C. for 5 minutes, and the residue was separated with a 0.45 μm filter (Sartorius, Germany). Each sample obtained thereafter was obtained by using a vacuum drying apparatus (three-way cold heat yarn, Model: Vacuum Freeze Dryer) in which the temperature in the chamber was kept around -5 ° C.

[Table 2] Amino Acid Composition of Silk Fibroin and Sericin

amino acid  Fibroin Content Serine content    Glycin 44.5 12.2    Alanine 29.3 4.6   Serine 12.1 30.4    Tyrosine 5.2 3.8    Valine 2.2 2.6    Aspartic acid 1.3 19.1    Glutamic acid 1.0 4.1    Throneine 0.9 6.0    Isoleucine 0.7 1.4    Phenylalanine 0.6 0.4    Leucine 0.5 0.6    Arginine 0.5 2.8    Lysine 0.3 10.2    Proline 0.3 0.8    Cystine 0.2 <0.05    Histidine 0.2 0.9    Tryptophan 0.2 -    Methionine 0.1 <0.05

5. Measurement of total ceramide content change

For quantitative analysis of ceramides, biopsied tissues collected from experimental animals were pulverized with polytron, and 800 μl of Tris-HCl was added to 400 μl of folch (folch: Tris-HCL = 1: 2). Centrifugation. The same amount of folch was added to the lower layer, and centrifuged at 1600 × g for 5 minutes, and the lower layer was stored overnight at -70 ° C. The lower layer was combined with the previous lower layer, dried over N ₂ gas, and then analyzed by HPLC (Waters 1525 Bianary HPLC pump, Waters 2487 Dual λ Absorbance Detector, Waters Co., USA) by adding 100 μl of folch. Co.'s Lichrosorb CN (250 × 4.60 mm; 5 μm) was used. Mobile phase was used as a mixture of hexane and 20% isopropanol (IPA), flow rate was 1ml / min, absorbance was analyzed at 230nm.

      6. De novo Ceramide Synthesis (SPT Activity) Comparison

The epidermis (thickness: 0.2 mm, size: 4 cm ² ) is isolated from the biopsy tissue collected from the animals and incubated with ¹⁴ C-serine for the synthesis of ceramide de novo for 16 hours. Grinded with polytron and the lipid was extracted using chloroform / methanol (2: 1, v / v), dried with N ₂ gas and dissolved in 100μl of chloroform. Dropped onto a thin layer using silica gel 60G, and the primary developer (chloroform / methanol / acetic acid / H 2 O = 90: 7: 1: 0.7, v / v / v / v) and the secondary developer (chloroform / methanol / 25% ammonia = 90: 13: 1.5, v / v / v / v) to fractionate the lipid component of ceramide of the epidermis by secondary TLC. The 14C-radioactivity incorporated into the ceramides was measured with a scintillation counter. Protein quantification of the tissue used was expressed as ¹⁴ C-serine cpm / μg protein.

    7. Changes in the expression of ceramide de novo synthase SPT (Serine Palmitoyl Transferase) and Ceramidase

(1) Reverse transcription (RT)

Skin tissue isolated from experimental animals was isolated RNA using Trizol reagent (Gibco 15596-026) and quantified using a spectrometer. For cDNA synthesis from the isolated total RNA, 10 μl of total RNA was heated at 65 ° C. for 10 minutes, then left at 4 ° C. for 10 minutes, and then 1 μl oligo (dT) 15 primer (0.5 μg / μl), 1 μl M-MLV RT (10 units / μl; promega, USA), 1 μl RNase inhibitor (20-40 units / μl; promega, USA), 10 μl 5X RT buffer (250 mM Tris-HCl, pH8.3, 375 mM KCl, 15 mM MgCl ₂ ), 5 μl 2.5 mmol / L dNTP mixed solution was added, 0.1% diethylpyrocarbonate (DEPC) was added thereto, mixed with distilled water, and heated in a 37 ° C. water bath for 1 hour to synthesize cDNA.

(2) Polymerase Chain Reaction (PCR)

2μl cDNA for PCR and SPT were used as primers. 1μl of sense primer (10 pmole/μl) and antisense primer (10 pmole/μl) were added, and 16μL of 0.1% DEPC-Water was added. NOTE) The final volume was adjusted to 20 μl. Denaturation was performed at 94 ° C for 1 minute, annealing at 65 ° C for 1 minute and 30 seconds, and extention at 72 ° C for 1 minute at 35 cycles. The murine serine Palmitoyl Transeferase used in the experiment was 5'primer; GAC TGA GCC TTT CTG GTG CT 3 ';3'primer; AAT GCC ATT TGG AGT GAA GG-3 '(UniSTS D19271) and a cut piece size of 159 bp. murine ceramidase is 5'primer; TGTGGAGCAGAAAATCAAGC 3 ';3'primer; CAACATCATGGGGCACTTAG 3 '(UniSTS AI662009), and the size of the cut piece was 103 bp. PCR products were electrophoresed on 3.0% agarose gel, and gels were stained with EtBr to determine the amount of PCR products using an imaging densitometer (model GS-700, BIO-RAD, USA). The levels of SPT and ceramidase were normalized based on GAPDH expression and compared between groups.

8. Trans-Epidermic Water Loss (TEWL) Measurement

After shaving the back part of the experimental animal and leaving it for 30 minutes in a space where constant temperature and humidity were maintained, the numerical value that appeared by lightly pressing the hydrometer's probe in close contact with the skin surface of the left and right parts of the back was recorded.

      9. Measurement of epidermal proliferation (Thymidine incorporation)

Since the increase in DNA is an indicator of cell proliferation, the extent of epidermal proliferation was measured by the incorporation of [ ³ H] Thymidine, a DNA construct. Epidermal tissue was harvested with a 6 mm ² biopsy punch, incubated with [ ³ H] Thymidine (0.1 μ Ci / ml; 4 μl) in 1 × DMEM at 37 ° C. for 3 hours and stored in liquid nitrogen to inhibit DNA synthesis. It was. 1 ml of 0.5 M NaOH was added to the thawed epidermal tissue and heated at 95 ° C. for 30 minutes to release DNA from the tissue, 200 μl of which was added to a cellulose filter treated with 1% trichloroacetic acid (TCA) and spun on a scintillation counter. Activity was measured.

       10. Determination of the Natural Moisturizing Factor (Amino Acid) Content in Plasma and Epidermis

Blood collected using a heparin-containing syringe was centrifuged at 3000xg for 10 minutes to separate plasma and stored at -20 ° C until amino acid analysis. To the stored plasma and epidermis, 0.05M potassium phosphate buffer was added at a 1: 1 ratio and the tissues were ground. After centrifugation at 3000xg for 10 minutes, 50% trichloroacetic acid (TCA) was added to the lower layer so that the final concentration was 15%, and the protein was precipitated and then overnight at 4 ° C. After centrifugation at 3000 xg for 10 minutes, the upper layer was discarded, and 200 µl of 6N HCl was transferred to a glass tube with a lid, and then hydrolyzed at 120 ° C. for 12 hours or more. The hydrolyzed amino acid derivative was dissolved in 300 [mu] l of distilled water and then filtered by HPLC (Column-Zorbax XDB-C ₁₈ ; Mobilphase-A (40 mM phosphate buffer), B (ACN: MeOH: water = 45: 45: 10)); flow rate-2.0 ml / min) to qualitatively / quantitatively analyze amino acids.

11. Statistical Processing

All experimental results were analyzed using the program (SPSS, Ver 12.0), and the results were expressed as mean ± standard error (SE). The difference in the mean of each experimental group was verified at p <0.05 using Duncan's multiple range test (Duncan 1955).

[Experiment result]

1. Total Content Change of Ceramide

The total content of ceramide was 4491.2 ± 2769.8, 8601.2 ± 1133.3, 11238.0 ± 3425.4, 5183.4 ± 2146.9 (mAu / 20ul) in CA, CB, S, and F groups, respectively. It was significantly higher, but significantly lower in F group and CA group, atopic dermatitis group (see Table 3, Figure 2).

Dietary intake of silk protein S was thought to influence the total ceramide content. However, in group F, the amount of serine in the diet was insufficient to raise the total ceramide content to the normal level.

Table 3 Total ceramide content in the epidermis of experimental groups (mAu / 20ul)

Group Mean ± SD CA (Atopic Control) 4491.2 ± 2769.8 CB (normal control) 8601.2 ± 1133.3 S 11238.0 ± 3425.4 F 5183.4 ± 2146.9

2. De novo Ceramide Synthesis (SPT Activity) Comparison

The enzyme activity of SPT was 194.30 ± 104.04, 233.80 ± 205.64, 86.49 ± 50.63, 78.53 ± 34.92 (cpm / mg protein) in CA, CB, S, and F groups, respectively. S and F groups were significantly lower. (See Table 4, Figure 3)

Ceramide is de novo synthesized through the intermediate of 3-ketosphinganine, sphignanine and sphingosine by combining serine and palmitoyl CoA. SPT is a major enzyme in this de novo synthesis process.

The result of SPT activity was significantly lower in both S and F groups because of the sufficient level of ceramide obtained from dietary intake.

[Table 4] SPT activity of De novo ceramide synthesis ( ¹⁴ C cpm / mg protein)

Group Mean ± SD CA (Atopic Control) 194.30 ± 104.04 CB (normal control) 233.80 ± 205.64 S 86.49 ± 50.63 F 78.53 ± 34.92

3. Comparison of mRNA Expression of SPT, a de novo synthase of ceramide

MRNA expression of SPT enzyme was 8.25 ± in CA, CB, S, and F groups, respectively. 1.06 , 5.69 ± 1.35, 0.57 ± 0.31, 1.34 ± 0.44 (O / D), which was significantly higher in CA group, atopic dermatitis group than in normal control group, and significantly lower in silk protein group S and F (Table 5). 4).

As with the results of SPT activity, mRNA expression was also significantly lower in S and F groups. It is believed that the increase in skin ceramide content by dietary supplementation of silk protein S was achieved through inhibition of degradation rather than increase in ceramide synthesis.

Table 5 mRNA expreesion of SPT (O / D)

Group Mean ± SD CA 8.25 ± 1.06 CB 5.69 ± 1.35 S 0.57 ± 0.31 F 1.34 ± 0.44

4. Comparison of mRNA Expression of ceramidase, a Ceramide Degrading Enzyme

The mRNA expression of Ceramidase enzyme was 2.49 ± 0.39, 1.18 ± 0.05, 1.03 ± 0.54, 1.33 ± 0.03 (O / D) in CA, CB, S, and F groups, respectively. , S and F group were significantly lower than the normal control group CB group (Table 6, Figure 5).

The ceramidase is an enzyme that is involved in the breakdown of ceramides into fatty acids and sphingosines. The dietary intake of silk proteins S and F was lower in ceramidase expression in the S and F groups than in the CB group, which is a normal control group.

Table 6 mRNA expression of ceramidase (O / D)

Group Mean ± SD CA 2.49 ± 0.39 a CB 1.18 ± 0.05 S 1.03 ± 0.54 F 1.33 ± 0.03

5. Effect of Dietary Supply of Silk Proteins S and F on TEWL

The measurement of TEWL immediately before slaughter of animals was shown in Table 7. The CA, CB, S, and F groups were 8.08 ± 1.58, 5.94 ± 0.80, 7.75 ± 1.10, and 7.57 ± 1.02 (g / m2 / hr), respectively. The values were lower than those of the group and were higher than those of the normal control group, but there was no significant difference between the groups (Table 7).

Silk protein S and F group showed a lower tendency when compared with the CA group which is atopy control group, it can be seen that silk proteins S and F prevent the loss of water in the epidermis.

Table 7 Trans-epidermal water loss of 4 experiment group

Group TEWL (g / m ² / hr) CA 8.08 ± 1.58 CB 5.94 ± 0.80 S 7.75 ± 1.10 F 7.57 ± 1.02

     6. Effect of Dietary Supply of Silk Proteins S and F on Epidermal Proliferation

In order to determine the degree of hyperproliferation of epidermal cells, one of the symptoms of atopic dermatitis, the results measured using [ ³ H] Thymidine are as follows (Table 8).

The CA, CB, S, and F groups were 466.5 ± 23.8, 365.7 ± 32.0, 444.8 ± 35.3, and 393.0 ± 29.6 (CPM [ ³ H] thymidine / mgDNA), respectively. It was significantly lower in the CB group. Silk protein soldiers S and F group showed the median level between the atopy control group CA and CB group. The S and F groups fed with silk protein showed lower epidermal proliferation than the CA group without silk protein, which was effective in inhibiting epidermal cell hyperproliferation.

Table 8 ³ H] Thymidine incorporation into epidermal DNA

Group [ ³ H] Thymidine incorporation (CPM [ ³ H] thymidine / mgDNA) CA 466.51 ± 23.81 CB 365.77 ± 32.02 S 444.82 ± 35.35 F 393.08 ± 29.63

7. Effect of Dietary Supply of Silk Proteins S and F on Serum Amino Acid Content

The contents of amino acids Asp, Glu, Tyr, His, Ser, Gly, Ala, Arg, and Pro, which act as natural moisturizing factors in serum, are shown in Table 9.

The contents of Asp were 38.2 ± 3.0, 21.9 ± 10.4, 44.8 ± 6.8, and 37.2 ± 11.0 (nmol / 20μl) in CA, CB, S, and F groups, respectively. The content of glu was 30.8 ± 4.2, 50.3 ± 8.6, 51.5 ± 5.8, 68.3 ± 4.1 (nmol / 20μl) in CA, CB, S, and F groups, respectively. The CA group showed significantly lower values, but there was no significant difference between the CB and S groups. Tyr content was significantly higher in the F group (22.8 ± 2.1, 25.1 ± 2.1, 21.9 ± 2.7, 33.2 ± 1.6 (nmol / 20μl) in CA, CB, S, and F groups, respectively. There was no significant difference between the CA, CB and S groups. His content was 5.5 ± 0.5, 18.0 ± 4.0, 25.5 ± 2.1, 35.0 ± 0.9 (nmol / 20μl) in CA, CB, S, and F groups, respectively. , S group, CB group showed the highest value in the order of CA group.

Ser content was significantly higher in F group (22.1 ± 1.4, 36.6 ± 1.4, 35.5 ± 3.7, 44.3 ± 2.4 (nmol / 20μl) in CA, CB, S, and F groups, respectively. Significantly lower. Gly content was 35.9 ± 2.1, 37.2 ± 6.3, 45.2 ± 3.3, 48.2 ± 7.0 (nmol / 20μl) in CA, CB, S, and F groups, respectively. The content of Ala was 70.4 ± 4.7, 71.1 ± 4.2, 59.6 ± 6.1, and 48.2 ± 13.8 (nmol / 20μl) in CA, CB, S, and F groups, respectively. Arg content was significantly higher in F group (119 ± 2.9, 22.8 ± 1.1, 20.4 ± 2.7, 30.4 ± 2.2 (nmol / 20μl) in CA, CB, S, and F groups, respectively). Although significantly lower, there was no significant difference between CB and S groups. Pro content was 25.9 ± 5.0, 63.2 ± 14.4, 49.8 ± 15.2, 58.0 ± 24.9 (nmol / 20μl) in CA, CB, S, and F groups, respectively.

  In this experiment, the plasma content of Ser and Gly among the amino acids in the plasma increased as the skin of the atopy was dried, and the dietary supply of S and F containing Ser was reflected in the blood.

Table 9 Free amino acid in mice serum

amino acid Asp Glu Tyr His Ser Gly Ala Arg Pro CA 38.2 ± 3.0 30.8 ± 4.2 22.8 ± 2.1 5.5 ± 0.5 22.1 ± 1.4 35.9 ± 2.1 70.4 ± 4.7 11.9 ± 2.9 25.9 ± 5.0 CB 21.9 ± 10.4 50.3 ± 8.6 25.1 ± 1.0 18.0 ± 4.0 36.6 ± 1.4 37.2 ± 6.3 71.1 ± 4.2 22.8 ± 1.1 63.2 ± 14.4 S 44.8 ± 6.8 51.5 ± 5.8 21.9 ± 2.7 25.5 ± 2.1 35.5 ± 3.7 45.2 ± 3.3 59.6 ± 6.1 20.4 ± 2.7 49.8 ± 15.2 F 37.2 ± 11.0 68.3 ± 4.1 33.2 ± 1.6 35.0 ± 0.9 44.3 ± 2.4 48.2 ± 7.0 60.5 ± 13.8 30.4 ± 2.2 58.0 ± 24.9

8. Effect of Dietary Supply of Silk Proteins S and F on Amino Acid Content in Skin Tissue

The contents of amino acids Asp, Glu, Tyr, His, Ser, Gly, Ala, and Arg, which act as natural moisturizing factors in skin tissue, are shown in Table 10.

The contents of Asp were 32.4 ± 10.8, 27.2 ± 8.0, 26.2 ± 8.17, 0 (nmol / 20μl) in CA, CB, S, and F groups, respectively. The content of glu was 8.5 ± 3.2, 1383.3 ± 456.4, 487.9 ± 408.2 and 29.6 ± 11.1 (nmol / 20μl) in CA, CB, S, and F groups, respectively. CA and F groups showed significantly lower values. Tyr content was significantly higher in group F, 8.5 ± 1.0, 5.9 ± 1.8, 11.79 ± 2.4, and 1308.2 ± 160.7 (nmol / 20μl) in CA, CB, S, and F groups, respectively. However, there was no significant difference between CA group, CB group and S group. His content was 59.8 ± 7.9, 35.4 ± 11.3, 88.8 ± 31.4, and 37.1 ± 9.0 (nmol / 20μl) in CA, CB, S, and F groups, respectively.

 Ser content was significantly higher in S group (714.6 ± 203.4, 857.0 ± 270.6, 1167.1 ± 391.5, 52.13 ± 8.3 (nmol / 20μl) in CA, CB, S, and F groups, respectively) Significantly lower. However, there was no significant difference between CA and CB groups. Gly content of CA group, CB group, S group, F group was 44.5 ± 9.9, 49.0 ± 16.4, 152.5 ± 52.8, 0 (nmol / 20μl), respectively. The content of Ala was 40.4 ± 11.4, 18.8 ± 5.7, 63.6 ± 42.4, 21.2 ± 21.2 (nmol / 20μl) in CA, CB, S, and F groups, respectively. There was no significant difference. The content of Arg was 12.2 ± 5.2, 10.0 ± 2.4, 164.4 ± 35.7, 21.8 ± 10.8 (nmol / 20μl) in CA, CB, S, and F groups, respectively. There was no significant difference between CB and F groups.

As in the plasma, the protein content of Ser, which contains Ser, Gly and Arg, increased in the skin tissue of Ser, Gly, Arg among the decreasing amino acids in the skin tissues due to the drying of atopic animals. It can be seen that the dietary supply is reflected in the skin tissue. In addition, the amount of serine in the skin tissue is higher than that in the blood, indicating that the protein ingested as a dietary supply accumulates in the skin tissue and is effective in the role of amino acids as a natural moisturizing factor.

Table 10-Free amino acid in mice skin

amino acid Asp Glu Tyr His Ser Gly Ala Arg CA 32.4 ± 10.8 8.5 ± 3.2b, 2) 8.5 ± 1.0 59.8 ± 7.9 714.6 ± 203.4 44.5 ± 9.9 40.4 ± 11.4 12.2 ± 5.2 CB 27.2 ± 8.0 1383.3 ± 456.4a 5.9 ± 1.8 35.4 ± 11.3 857.0 ± 270.6 49.0 ± 16.4 18.8 ± 5.7 10.0 ± 2.4 S 26.2 ± 8.17 487.9 ± 408.2 11.79 ± 2.4 88.8 ± 31.4 1167.1 ± 391.5 152.5 ± 52.8 63.6 ± 42.4 164.4 ± 35.7 F 0 29.6 ± 11.1 1308.2 ± 160.7 37.1 ± 9.0 52.1 ± 8.3 0 21.2 ± 21.2 21.8 ± 10.8

[Summary of Experiment Results]

1. The ceramide content analyzed by HPLC after lipid extraction was the highest in silk protein S group compared to normal control group in atopic dermatitis group (73.5%), silk protein S group (116.3%) and silk protein F group (70.7%). It was high in the atopic dermatitis group and the silk protein F group.

2. The mRNA expression of SPT enzyme by RT-PCR was higher in the atopic dermatitis group than in the normal control group, but significantly lower in both the silk protein S and F groups, especially in the silk protein S group.

3. SPT enzyme activity measured after incubating the skin biopsy tissue with ¹⁴ C-serine was not significantly different in the atopic dermatitis group compared to the control group, but was significantly lower in the silk protein S and F groups.

4. The mRNA expression of ceramidase enzyme by RT-PCR was significantly lower in the SB and F groups than in the normal control CB group, whereas the CA group, which was the atopy control group, was significantly higher.

5. As a result of measuring the TEWL immediately before the slaughter of animals, the TEWL values in the S and F groups were lower than those of the atopy control CA and higher than the normal control CB group, but there was no significant difference between the groups.

6. The results of epidermal hyperproliferation were significantly higher in the CA group and significantly lower in the CB group than the normal control group. In the S and F groups fed the silk protein diet, the median values of the CA and CB groups, which were atopy controls, were shown.

7. As a result of measuring amino acid content in plasma, there was no significant difference in Asp content between groups. Glu content was significantly higher in the F group and the CA group was significantly lower, but there was no significant difference between the CB and S groups. Tyr content was significantly higher in group F, but there was no significant difference between CA, CB and S groups. His content was significantly different between the groups, and showed the highest values in the order of F group, S group, CB group CA group.

Ser content was significantly higher in the F group and lower in the CA group. The contents of Gly, Ala, and Pro were not significantly different among the groups. Arg content was significantly higher in the F group and lower in the CA group, but there was no significant difference between the CB and S groups.

8. As a result of measuring amino acid content in skin tissue, there was no significant difference between Asp and His contents between groups. Glu content was significantly higher in the CB group and significantly lower in the CA and F groups. Tyr content was significantly higher in group F, but there was no significant difference between CA, CB and S groups. His content was not significantly different between groups.

Ser content was significantly higher in S group and lower in F group. However, there was no significant difference between CA and CB groups. Gly content was significantly higher in S group. The content of Ala was high in the S group, but there was no significant difference between the groups. Arg content was significantly higher in S group, but there was no significant difference between CA, CB and S groups.

9. The results showed that despite the increased expression of SPT mRNA in the skin of NC / Nga mice animal model of atopic dermatitis, the reduced ceramide content with low SPT activity and high ceramidase degrading enzyme expression was increased by dietary supply of silk protein S. Showed an increase. Silk protein S and F group showed lower SPT mRNA expression and activity than normal control group. The increase in ceramide content of the skin was caused by inhibition of degradation rather than an increase in ceramide synthesis, and the concentration of serine contained in silk protein F was found to be lower than that of silk protein S in terms of increasing the ceramide content of atopic skin.

In addition, silk protein S supplied in the diet significantly increases the amount of serine, a natural moisturizing factor in the blood and skin tissues, and has been shown to play a role in reducing skin dryness and hyperproliferation in atopic dermatitis.

By inhibiting the expression of ceramide degrading enzyme that maintains skin moisturization by the dietary supply of the composition according to the present invention and at the same time contains a large amount of moisturizing serine to prevent epidermal moisture loss and skin cell overgrowth to prevent diseases caused by skin dryness There is a treatable benefit.

Claims (4)

Pharmaceutical composition for the prevention and treatment of diseases caused by skin dryness by inhibiting the expression of ceramide degrading enzyme in the stratum corneum of the skin as an active ingredient. The method of claim 1, The silk protein is sericin pharmaceutical composition. The method according to claim 1 or 2, The disease is a pharmaceutical composition, characterized in that atopic dermatitis or psoriasis. The method according to claim 1 or 2, The composition is a pharmaceutical composition, characterized in that in oral administration formulation.

Images