KR20060068062A - Recombinant protein expression vector containing ptsg promoter, gene coding holin protein and gene coding endolysin protein with a function of cell lysis and method of recombinant protein screening by cultivating e. coli containing the said vector thereof - Google Patents

Abstract

The present invention contains a gene sequence of the ptsG promoter as set forth in SEQ ID NO: 2 as a promoter, and a gene encoding a choline derived from T4 bacteriophage that disrupts the cell membrane of E. coli and T7 that destroys the cell wall of E. coli. A recombinant protein expression vector comprising a gene encoding an endoricin derived from bacteriophage, and a method for screening recombinant protein by culturing it in Escherichia coli, the method for screening a recombinant protein by releasing foreign protein out of the host in large quantities It can be useful for screening.

ptsG promoter, holin, endoricin, vector, recombinant protein

Description

Recombinant protein expression vector containing ptsG promoter, gene coding holin protein, and a recombinant protein expression vector containing genes encoding cholene and endoricin causing cell destruction, and cultured in Escherichia coli. and gene coding endolysin protein with a function of cell lysis and method of recombinant protein screening by cultivating E. coli containing the said vector             

1 is a schematic diagram of a vector showing an example in which the promoter of the present invention is inserted into a pRS415 vector.

Fig. 2 is a gene sequence map showing a partial sequence of the ptsG P1 promoter containing a portion (underlined portion) to which CRP-cAMP binds.

Figure 3 shows the expression level of β-galactosidase coding gene as a report gene by dividing the vector containing the promoter of the present invention into a wild-type Escherichia coli and then adding and not adding glucose to the medium. A graph showing the results.

Figure 4 shows the introduction of a vector containing the promoter of the present invention into E. coli SR754 KFCC-11244, which is characterized by overexpressing the Mlc protein, which acts as an inhibitor to the ptsG P1 promoter, It is a graph showing the result of observing the expression level of β-galactosidase coding gene as a report gene for 24 hours with different compositions.

5 is the plasmid pBlueLysis + of the present invention.

FIG. 6 is a graph showing that cells were destroyed by cholene and lysozyme inserted into the recombinant vector after 12 hours.

FIG. 7 is a graph showing that halo is formed by amylase released from the cell by holin and lysozyme and the starch is degraded.

FIG. 8 is a graph showing that E. coli cells are destroyed by holin and lysozyme.

The present invention relates to a recombinant protein expression vector containing a replication origin, a promoter, an MCS and a selection marker, and a method for screening a recombinant protein using the same. More specifically, the gene sequence of the ptsG promoter according to SEQ ID NO. And a gene encoding an erysin derived from T4 bacteriophage, which destroys the cell membrane of E. coli, and an endoricin derived from T7 bacteriophage, which destroys the cell wall of E. coli, in the downstream thereof. The present invention relates to a protein expression vector and a method for screening recombinant proteins by culturing them in Escherichia coli.

Escherichia coli is one of the most physiological, biochemical, and genetic studies to date, and is a useful strain for producing recombinant proteins and useful metabolites, especially in biotechnology. The production of recombinant protein using E. coli has many advantages, such as high production efficiency, shortening time and cost, but one of the disadvantages is that E. coli does not release most recombinant proteins out of the cell.

When E. coli accumulates proteins in a cell, it causes various problems, such as protein inactivation or protein folding due to aggregation of proteins, and when E. coli is toxic to E. coli, growth of E. coli is inhibited. Can be mentioned. In addition, in order to recover the recombinant protein produced in E. coli, E. coli cells must be disrupted by physical, chemical, and enzymatic methods.

In particular, in recent years, in order to find better enzymes or biologically useful substances, many libraries make metagenomic libraries from DNA extracted from the environment, and even if not, they make genomic libraries or cDNA libraries. In many cases. In addition, mutation techniques can be used to alter the sequence of proteins to improve the activity and properties of enzymes. In this case, a mutant library is often constructed.

In these cases, dozens to as many as hundreds of thousands of clones are often expressed in solid medium at one time. Since E. coli does not release recombinant proteins out of the cells, they can be treated by chemical methods or cultured for a long time and then killed naturally. Wait for the produced recombinant protein to be released. The development of a system that destroys cells without additional treatment is expected to save time and money in screening large amounts of enzymes or recombinant proteins.

Until now, when the recombinant protein is produced using E. coli, a method of recovering the produced protein by physical methods such as sonication has been mainly used. Also, if the produced protein or metabolite is toxic to the large intestine, a way to improve it has been devised.

In Japan, Y. Tanji et al cloned the holin and endolysin genes of Bacillus-derived bacteriophages into a xylose-induced promoter to produce polyhydroxybutyrate in Bacillus. The expression system was developed, and the same researcher has also developed a system for cloning expression of E. coli-derived bacteriophage cholene in the T7 promoter induced by IPTG.

Although these systems have significantly disrupted Escherichia coli and release proteins accumulated in cells, these systems are also not suitable for screening large amounts of clones because they require steps to induce IPTG or xylose.

In addition, there have been examples of strains that can naturally flow intracellular proteins by modifying genes that synthesize cell wall components of Escherichia coli, but they are mainly limited to periplasmic proteins, which are produced in Escherichia coli. This is not appropriate given that most recombinant proteins accumulate in the cytoplasm.

Accordingly, an object of the present invention is to provide a vector system and a method for screening using the same, which are useful for screening recombinant proteins in large quantities by constructing a vector system capable of efficiently releasing foreign proteins to the host.

In order to achieve the above object, the present invention provides a recombinant protein expression vector containing a replication origin, a promoter, an MCS, and a selection marker, wherein the promoter contains the gene sequence of SEQ ID NO. Recombinant protein expression vector and the former vector containing a gene encoding a choline derived from T4 bacteriophage destroying the cell membrane and an endoricin derived from T7 bacteriophage destroying the cell wall of Escherichia coli. The present invention provides a method for screening foreign proteins by inserting a gene encoding a foreign protein and incubating it in Escherichia coli and spreading the same on a solid medium.

Hereinafter, the present invention will be described in more detail.

Recombinant proteins are produced by inserting a gene encoding a recombinant protein into an expression vector in a biotechnical method and then inserting and expressing the gene in a host. At this time, E. coli is widely used as a host, and vectors which can operate an expression system in E. coli are used as vectors.

To operate as an expression vector, it must contain an origin of replication, a promoter, an MCS and a selection marker. The origin of replication gives the plasmid the ability to replicate separately from the host's chromosome, the promoter acts on the transcription of the foreign gene to be inserted, and the MCS is a multiple cloning site where the foreign gene can be inserted through various restriction enzyme sites. The selection marker serves to confirm whether or not the vector enters the host properly, and the functions and functions of the above are well known in the art.

In the above expression vector, the present invention specifically contains a gene sequence of SEQ ID NO: 2 as a promoter, and encodes a choline derived from T4 bacteriophage that disrupts the cell membrane of E. coli downstream. And a gene encoding endoricin derived from T7 bacteriophage that destroys the cell wall of Escherichia coli.

The promoter used in the present invention is a film to be used for ptsG promoter for expressing EIICB ^Glc serving as a transporter, a promoter is expressed amount is high compared with the case otherwise, when the glucose present in the medium On staining body in glucose uptake in E. coli Although it is known to be cloned into the plasmid and present in multi-copy, it is known that the expression level is high when glucose is not present.

By using the characteristics of the promoter, early in cell culture, a certain amount of glucose is included to inhibit the expression of the promoter, and if the glucose is consumed in the medium according to the continuous culture, the expression level of the promoter is increased without the addition of a specific derivative.

In the present invention, by giving a point mutation to the CRP-cAMP binding site of the promoter to reduce the binding of CRP-cAMP by using a promoter modified to maintain the expression level of this promoter at a low level. The sequence is set forth in SEQ ID NO: 2.

Holin and endolysin are proteins that act when bacteriophages cause lysis in E. coli. Holin acts on the cell membrane of Escherichia coli to form a region, and endoricin is a lysozyme that breaks down the peptidoglycan layer of the cell wall. Eventually, when two proteins are produced in E. coli, both the cell wall and the cell membrane are destroyed, and the protein produced in the cell can go out of the cell, and E. coli is killed.

Using such a system, a system that automatically generates cell-lysis after a certain time after Escherichia coli is cultured can be constructed, so that a large number of libraries made using E. coli can be screened.

On the other hand, the gene encoding the holin and the gene encoding endoricin may be located downstream of the promoter, regardless of the order of the gene encoding the holin, preferably, the gene encoding the holin encodes endoricin It is better to be located in front of the gene.

Meanwhile, in the present invention, the MCS may use various types of MCSs that are commonly used, but it is preferable to use LacZ ′ derived from pUC19.

In addition, the vector of the present invention is characterized in that the effect of the present invention can be achieved even when a recombinant vector is produced in various forms by inserting a gene encoding the promoter and the choline of the present invention and an endoricin into a conventional vector. Although there is no obstacle, preferably a recombinant protein expression vector, which has a gene sequence of SEQ ID NO: 1 prepared using pACYC184 as a parent vector.

On the other hand, the present invention provides a method for screening foreign proteins by inserting a gene encoding a foreign protein in the vector of the present invention and incubating it in Escherichia coli and plating it on a solid medium.

At this time, the solid medium may be prepared in various forms to screen for foreign proteins encoded from the gene to be inserted. For example, if the foreign protein is amylase, the medium may be used to form starch in which halo is formed by being degraded by amalase. have.

Hereinafter, the configuration and operation of the present invention will be described in more detail with reference to the following Examples and Experimental Examples, but the scope of the present invention is not limited to the following Examples and Experimental Examples.

Example 1 Preparation of Promoter

E. coli's sugar phosphotransferase system (phosphoenolpyruvate: carbohydrate phosphotransferase system (PTS)) is a system that catalyzes the absorption of various sugars into cells and simultaneously phosphorylation of sugars. In addition, PTS plays an important role in regulating the absorption and metabolism of various sugars absorbed without PTS and the activity of adenylate cyclase.

The ptsG gene, which encodes a glucose transport protein in the pts operon, is expressed by the P1 promoter of two promoters constituting the pts operon. In the present invention, a novel promoter (SEQ ID NO: 1) having strong control ability is developed using this P1 promoter. It was.

Introducing a vector system containing the ptsG P1 promoter into the strain, and then adding glucose at the beginning of the culture inhibits the expression of the ptsG P1 promoter and results in the late stage of culture, ie, the consumption of glucose in the medium, which continues to grow bacteria. In the expression of the ptsG P1 promoter is induced to induce the expression of foreign proteins.

However, in the present invention, in order to control the expression intensity of the PtsG P1 promoter, point mutations are performed by using PCR at the binding position (underlined portion of FIG. 2) of the CRP-cAMP complex, which is a transcriptional promoter of the promoter. Gave.

Are commercially available, there is a possibility that the default plasmid (plasmid Backbone), was used to pRS415 to use β- galactosidase as a reporter (reporter) which by expression of lacZYA, and in the front to lacZYA to as the ptsG P1 promoter portion The strain was cloned as well (FIG. 1).

The vector cloned with the non-mutated promoter was pSW00, the vector with the promoter G modified to A was pSW01, the vector with the rear C modified with T pSW02, and the vector system with both parts modified was named pSW03. It was.

Hosts used in this example were Escherichia coli MC4100 ( E. coli wild type) and Escherichia coli SR754 KFCC-11244 overexpressing Mlc.

To confirm the expression of foreign proteins, β-galactosidase assay was performed using the β-galactosidase coding gene as a reporter gene in the following manner. (1) The strain to be used for the experiment was inoculated in 3 ml broth medium and incubated at 37 ° C. for 14 hours. (2) The cultured strains were reinoculated in a sterile flask with fresh broth medium at a ratio of 1: 100 and main culture was performed at 37 ° C. (3) 1 ml of the cultured sample was separated and centrifuged. (4) The supernatant was discarded and the precipitate was released with 1 ml Z buffer. (5) After placing the sample in ice for 20 minutes, the cell density was measured at OD ₆₀₀ . (6) The same sample was changed in volume and a new Z buffer was added. At this time, the final volume was not more than 1ml. (7) 30μl of chloroform and 15μl of 0.1% SDS were added and mixed well. (8) This mixed solution was left at room temperature for 5 minutes. (9) 0.2 ml of ONPG (4 mg / ml) was added to each test tube, mixed well, and reacted. (10) The time when the color was sufficiently yellow was recorded, and 0.5 ml of 1 M Na ₂ CO ₃ solution was added to stop the reaction. Then, the values were measured at OD ₄₂₀ and OD ₅₅₀ and the activity was calculated.

First, each of the above vectors was introduced into E. coli MC4100, a wild-type strain, and then cultured in the presence or absence of glucose in the medium, and the expression of ß-galactosidase after a specific time. It was confirmed. As a result, it was confirmed that the expression is more made when there is no glucose than when there is glucose (Fig. 3).

Next, E. coli SR754 KFCC-11244 overexpressing Mlc, which acts as an inhibitor to the ptsG P1 promoter, is further used as a host to further suppress early expression of the vector system. The change in the amount of expression during 24 hours was observed by changing the composition of glucose in the medium, and the result as shown in FIG. 4 was obtained.

From the above results, pSW03 with E. coli SR754 KFCC-11244 (Mlc overexpressing strain) as a host and the promoter of the present invention was inserted into a vector system, and initially expressed in TB medium and glucose at 2% conditions This suppression and over time it was confirmed that the development of a vector system is gradually induced expression (Fig. 4).

Therefore, the promoter described in SEQ ID NO: 2 was used as a promoter to be used in Example 2 below.

Example 2: Vector Construction of the Invention

PACYC184, which is commercially available as a parent vector, was used to construct the vector system of the present invention. The ptsG promoter portion was amplified using pptsG-F and PptsG-R primers (Table 1) as a template of pSW03 of Example 1 above. Holin (gene t , derived from T4 bacteriophage) and endoricin ( lys , derived from T7 bacteriophage) are vectors in which the holin and endoricin genes are inserted using pLyss, a commercial vector using pLysT (the commercial vector, pACYC184); , M. et. Al. 2001, Programmed Escherichia coli cell lysis by expression of cloned T4 phage Lysis Genes, Biotechno.Prog. 17: 573-576). PGly was generated by cloning in turn by treating the DNA amplified with pACYC184 and above using the restriction enzymes shown in Table 1 below.

In order to enable more efficient cloning, the amplified clone was lacZ 'in the commercial vector pUC19. This enabled us to secure multicloning sites and distinguish blue-white in the presence of X-gal, where pUC19 was replaced with Lac-F0 and Lac-R0, to convert BamHI sites into BglII sites. After amplification with Lac-F0 and Lac-R1, respectively, AvaI was treated, mixed and ligated (Table 1). This was again amplified by Lac-F0 and Lac-R0, and only 572bp DNA fragments were separated and treated with EcoRV (Table 1 below). This DNA fragment was ligated to pGlys treated with PvuII to name the plasmid pBlueLysis + (SEQ ID NO: 1) (Fig. 5).

Premier Name Nucleic acid sequence Remarks PptsG -F (ScaI) 5TGT AGTACT TCTCCAATGATCTGAA3 for amplifying the ptsG promoter PptsG -R (NcoI) 5ATGCATTCTTAA CCATGG TTGAGAGTGCTC3 Lys-F (Nco I) 5GAAGGAGATATA CCATGG CACCTAGAATATCA3 For gene amplification of holin and T7 lysozyme Lys-R (EcoR I) 5TGCGAACAAAGG GAATTC GCTGTGGTCTCC3 Lac-F0 (EcoR V) 5CCTCTGACACATG GATATC CGG3 for amplification of P lac , LacZ and MCS from pUC19 Lac-R0 (EcoR V) 5GCACGGACA GATATC CCGACTGG3 Lac-R1 (BglII) 5ACTCTAGA AGATCT CCGGGTACCG3 For replacing BamH I site with Bgl II site in MCS

Experimental Example 1: Evaluation of the utility of the vector pBlueLysis + of the present invention

 1) Negative control construction

The pBlueLysis + prepared in Example 1 was treated with BalI and NcoI, treated with Klenow fragment, and then self-ligation to prepare a negative control from which the ptsG promoter of the present invention was removed. It was named pBlueLysis-.

2) GFPuv emission

The gfpuv gene was amplified with the commercial vector pGFPuv as a template with GFP-F and GFP-R primers (Table 2), followed by pBR322 (commercial vector) cloned with SmaI and PstI and treated with SspI and PstI.

Primer Name Nucleic acid sequence Remarks GFP-F (Sma I) 5GGATC CCCGGG TACAAGGAGAAAAAATGAG3 for amplifying gfpuv from gfpuv from pGFPuv GFP-R (Pst I) 5CCTATTATTTTTGA CTGCAG ACAAGTTGG3 Amy-F (SspI) 5GTCGCTT AATATT CCTGCGAAGGAGAGCCTATGCCGG3 for amplifying amyM from amyM from p29amyM Amy-R (PstI) 5GTTCCTCCCTGCAGCAAAAAACCCC3

Here, the expression of GFPuv is affected by the bla promoter of beta-lactamase, which is expressed regardless of external conditions. This plasmid was then cloned into EcoBlue and Pst treated DNA fragments (P bla-gfpuv ) into pBlueLysis + and pBlueLysis- treated with PvuII and PstI to determine whether GFPuv is released by a vector system constructed. GFP) and control (pBL-GFP).

Assays for released GFPuv were measured in the following manner. 1) Inoculate pBL + GFP and pBL-GFP in LB medium and incubate overnight. 2) After adding final concentration 0.1% glucose and 30 ug / ml tetracycline to 100 ml TB (1% tryptone, 0.8% NaCl), inoculate 1 ml of the spawn culture solution prepared in 1). 3) Sampling 1ml at each time, centrifugation (12000 × g, 10min) to separate the cells, and then take only the supernatant and measure the degree of fluorescence on a fluorospectrophotometer (Hitachi, F4500).

As a result of measuring the GFPuv according to the above method, it was seen that the extracellular released GFPuv increased when inoculated with pBL + GFPuv compared to negative control (pBL-GFPuv) from 12 hours after inoculation (FIG. 6). That is, after 12 hours it was found that the cells were destroyed by holin and lysozyme.

3) release of amalase

The amyM gene was amplified with p29AmyM (a vector with the gene bank Accession No. AY383543 amlylase inserted into the commercial vector pET29) as a template with AmyM-F and AmyM-R primers, digested with SspI and PstI, and treated with SspI and PstI. Cloned to pBR322. Here, amyM expression is affected by the beta-lactamase promoter, bla , which is expressed regardless of external conditions. This plasmid was then cloned into EcoBlue and PstI treated DNA fragments (P bla-amyM ) into pBlueLysis + and pBlueLysis- treated with PvuII and PstI to determine whether AmyM was released by a vector system constructed. AmyM) and control (pBL-AmyM) were constructed.

Released AmyM was measured on agar plates. Amylase screening medium was prepared by adding 1.5% agar, 0.1% glucose and 2% soluble starch to TB medium (1% tryptone, 0.8% NaCl), and then inoculated with 10 μl of pBL + AmyM and pBL-AmyM seed cultures. After 24 hours, 10 ml of iodine solution (0.203 g I2, 5.2 g KI in 100 ml solution) was poured, and halo was observed in the presence of fluorescence.

As a result of the above experiment, the negative control (pBL-AmyM) did not show halo caused by starch decomposition, but in the case of pBL + AmyM, amylase was released, resulting in halo (FIG. 7). )

As a result, it was also observed that amylase was released into the cells by the destruction of cells by cholene and lysozyme under 0.1% (w / v) glucose conditions.

4) Viable cell count

In order to observe the destruction of Escherichia coli cells directly by holoin and lysozyme, inoculated with pBlueLysis + and pBlueLysis- (negative control) to LB to make a spawn saline solution, and time after main culture in TB + 0,1% glucose medium, respectively. Sampling was performed according to the plate count assay. The number of viable cells according to each time is shown in FIG. 8.

This result also shows that cell lysis occurs after about 12 hours by holin and lysozyme.

As described above, the vector of the present invention is very useful in the biological industry because it is useful for screening a large amount of recombinant protein by releasing foreign proteins out of the host.

<110> Seoul National University Industry Foundation <120> Recombinant protein expression vector containing ptsG promoter,          gene coding holin protein and gene coding endolysin protein with          a function of cell lysis and method of recombinant protein          screening by cultivating E. coli containing the said vector          about <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 5443 <212> DNA <213> Artificial Sequence <220> <223> Recombinant pBlueLysis + vector <220> <221> gene (259) .. (576) <223> LacZ ' <220> <221> promoter (222) (3994) .. (4069) <223> Novel ptsG promoter <220> <221> gene (222) (4171) .. (4824) <223> gene t <220> <221> gene (222) (4958) .. (5413) <223> lysozyme <400> 1 gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt 60 gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagatccc gactggaaag 120 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt 180 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca 240 caggaaacag ctatgaccat gattacgcca agcttgcatg cctgcaggtc gactctagaa 300 gatctccggg taccgagctc gaattcactg gccgtcgttt tacaacgtcg tgactgggaa 360 aaccctggcg ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt 420 aatagcgaag aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa 480 tggcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcatatgg 540 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagccccg acacccgcca 600 acacccgctg acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct 660 gtgaccgtct ccgggatctg tccctcctgt tcagctactg acggggtggt gcgtaacggc 720 aaaagcaccg ccggacatca gcgctagcgg agtgtatact ggcttactat gttggcactg 780 atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa aaggctgcac cggtgcgtca 840 gcagaatatg tgatacagga tatattccgc ttcctcgctc actgactcgc tacgctcggt 900 cgttcgactg cggcgagcgg aaatggctta cgaacggggc ggagatttcc tggaagatgc 960 caggaagata cttaacaggg aagtgagagg gccgcggcaa agccgttttt ccataggctc 1020 cgcccccctg acaagcatca cgaaatctga cgctcaaatc agtggtggcg aaacccgaca 1080 ggactataaa gataccaggc gtttccccct ggcggctccc tcgtgcgctc tcctgttcct 1140 gcctttcggt ttaccggtgt cattccgctg ttatggccgc gtttgtctca ttccacgcct 1200 gacactcagt tccgggtagg cagttcgctc caagctggac tgtatgcacg aaccccccgt 1260 tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggaaagaca 1320 tgcaaaagca ccactggcag cagccactgg taattgattt agaggagtta gtcttgaagt 1380 catgcgccgg ttaaggctaa actgaaagga caagttttgg tgactgcgct cctccaagcc 1440 agttacctcg gttcaaagag ttggtagctc agagaacctt cgaaaaaccg ccctgcaagg 1500 cggttttttc gttttcagag caagagatta cgcgcagacc aaaacgatct caagaagatc 1560 atcttattaa tcagataaaa tatttctaga tttcagtgca atttatctct tcaaatgtag 1620 cacctgaagt cagccccata cgatataagt tgtaattctc atgtttgaca gcttatcatc 1680 gataagcttt aatgcggtag tttatcacag ttaaattgct aacgcagtca ggcaccgtgt 1740 atgaaatcta acaatgcgct catcgtcatc ctcggcaccg tcaccctgga tgctgtaggc 1800 ataggcttgg ttatgccggt actgccgggc ctcttgcggg atatcgtcca ttccgacagc 1860 atcgccagtc actatggcgt gctgctagcg ctatatgcgt tgatgcaatt tctatgcgca 1920 cccgttctcg gagcactgtc cgaccgcttt ggccgccgcc cagtcctgct cgcttcgcta 1980 cttggagcca ctatcgacta cgcgatcatg gcgaccacac ccgtcctgtg gatcctctac 2040 gccggacgca tcgtggccgg catcaccggc gccacaggtg cggttgctgg cgcctatatc 2100 gccgacatca ccgatgggga agatcgggct cgccacttcg ggctcatgag cgcttgtttc 2160 ggcgtgggta tggtggcagg ccccgtggcc gggggactgt tgggcgccat ctccttgcat 2220 gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc tactactggg ctgcttccta 2280 atgcaggagt cgcataaggg agagcgtcga ccgatgccct tgagagcctt caacccagtc 2340 agctccttcc ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt 2400 atcatgcaac tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc 2460 tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc 2520 ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt 2580 atcgccggca tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc 2640 tggatggcct tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg 2700 caggccatgc tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc 2760 gcggctctta ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc 2820 gcctcggcga gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc 2880 tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg aatggaagcc 2940 ggcggcacct cgctaacgga ttcaccactc caagaattgg agccaatcaa ttcttgcgga 3000 gaactgtgaa tgcgcaaacc aacccttggc agaacatatc catcgcgtcc gccatctcca 3060 gcagccgcac gcggcgcatc tcgggcagcg ttgggtcctg gccacgggtg cgcatgatcg 3120 tgctcctgtc gttgaggacc cggctaggct ggcggggttg ccttactggt tagcagaatg 3180 aatcaccgat acgcgagcga acgtgaagcg actgctgctg caaaacgtct gcgacctgag 3240 caacaacatg aatggtcttc ggtttccgtg tttcgtaaag tctggaaacg cggaagtccc 3300 ctacgtgctg ctgaagttgc ccgcaacaga gagtggaacc aaccggtgat accacgatac 3360 tatgactgag agtcaacgcc atgagcggcc tcatttctta ttctgagtta caacagtccg 3420 caccgctgtc cggtagctcc ttccggtggg cgcggggcat gactatcgtc gccgcactta 3480 tgactgtctt ctttatcatg caactcgtag gacaggtgcc ggcagcgccc aacagtcccc 3540 cggccacggg gcctgccacc atacccacgc cgaaacaagc gccctgcacc attatgttcc 3600 ggatctgcat cgcaggatgc tgctggctac cctgtggaac acctacatct gtattaacga 3660 agcgctaacc gtttttatca ggctctggga ggcagaataa atgatcatat cgtcaattat 3720 tacctccacg gggagagcct gagcaaactg gcctcaggca tttgagaagc acacggtcac 3780 actgcttccg gtagtcaata aaccggtaaa ccagcaatag acataagcgg ctatttaacg 3840 accctgccct gaaccgacga ccgggtcgaa tttgctttcg aatttctgcc attcatccgc 3900 ttattatcac ttattcaggc gtagcaccag gcgtttaagg gcaccaataa ctgccttaaa 3960 aaaattacgc cccgccctgc cactcatcgc agtacttctc caatgatctg aagttgaaac 4020 atgatagccg ttaaacaaat tggcactgaa ttattttact ctgtgtaata aataaagggc 4080 gcttagatgc cctgtacacg gcgaggctct ccccccttgc cacgcgtgag aacgtaaaaa 4140 aagcacccat actcaggagc actctcaacc atggcaccta gaatatcatt ttcgccctct 4200 gatattctat ttggtgttct agatcgcttg ttcaaagata acgctaccgg gaaggttctt 4260 gcttcccggg tagctgtcgt aattcttttg tttataatgg cgattgtttg gtatagggga 4320 gatagtttct ttgagtacta taagcaatca aagtatgaaa catacagtga aattattgaa 4380 aaggaaagaa ctgcacgctt tgaatctgtc gccctggaac aactccagat agttcatata 4440 tcatctgagg cagactttag tgcggtgtat tctttccgcc ctaaaaactt aaactatttt 4500 gttgatatta tagcatacga aggaaaatta ccttcaacaa taagtgaaaa atcacttgga 4560 ggatatcctg ttgataaaac tatggatgaa tatacagttc atttaaatgg acgtcattat 4620 tattccaact caaaatttgc ttttttacca actaaaaagc ctactcccga aataaactac 4680 atgtacagtt gtccatattt taatttggat aatatctatg ctggaacgat aaccatgtac 4740 tggtatagaa atgatcatat aagtaatgac cgccttgaat caatatgtgc tcaggcggcc 4800 agaatattag gaagggctaa ataattactc gagcaccacc accaccacca ctgagatccg 4860 gctgctaaca aagcccgaaa ggaagctgag tggctgctgc caccgctgag atccgggtcc 4920 cctttgatag attaaaaagg aaaggaggaa agaaataatg gctcgtgtac agtttaaaca 4980 acgtgaatct actgacgcaa tctttgttca ctgctcggct accaagccaa gtcagaatgt 5040 tggtgtccgt gagattcgcc agtggcacaa agagcagggt tggctcgatg tgggatacca 5100 ctttatcatc aagcgagacg gtactgtgga ggcaggacga gatgagatgg ctgtaggctc 5160 tcacgctaag ggttacaacc acaactctat cggcgtctgc cttgttggtg gtatcgacga 5220 taaaggtaag ttcgacgcta actttacgcc agcccaaatg caatcccttc gctcactgct 5280 tgtcacactg ctggctaagt acgaaggcgc tggtcttcgc gcccatcatg aggtggcgcc 5340 gaaggcttgc ccttcgttcg accttaagcg ttggtgggag aagaacgaac tggtcacttc 5400 tgaccgtgga taattaattg aactcactaa agggagacca cag 5443 <210> 2 <211> 116 <212> DNA <213> Artificial Sequence <220> <223> Novel ptsG promoter <400> 2 ccttaaaaaa attacgcccc gccctgccac tcatcgcagt acttctccaa tgatctgaag 60 ttgaaacatg atagccgtta aacaaattgg cactgaatta ttttactctg tgtaat 116  

Claims (5)

In a vector for recombinant protein expression using Escherichia coli as a host and containing a replication origin, a promoter, an MCS and a selection marker, Endorcin derived from T7 bacteriophage which contains the gene sequence of SEQ ID NO. Recombinant protein expression vector comprising a gene encoding. The method of claim 1, The recombinant protein expression vector is a recombinant protein expression vector, characterized in that using LacZ 'derived from pUC19 as MCS. The method of claim 1, The gene encoding the holin and the gene encoding endoricin are vectors for recombinant protein expression, characterized in that the gene encoding the holin is located in front of the gene encoding endoricin. The method of claim 1, The recombinant protein expression vector is a recombinant protein expression vector, characterized in that it has a gene sequence of SEQ ID NO: 1. A method of screening foreign proteins by inserting a gene encoding a foreign protein into the vector of claim 1 and incubating the same in Escherichia coli and spreading the same on a solid medium.

Images