KR20060058632A - Novel compounds as agonist for ppargamma and pparalpha, method for preparation of the same, and pharmaceutical composition containing the same - Google Patents

Abstract

The present invention relates to novel compounds that enhance the activity of Peroxisome proliferator-activated receptor gamma (PPARγ) and alpha (PPARα), methods for their preparation, and pharmaceutical compositions containing them in pharmacologically effective amounts.

             (Wherein A, D, E and G are as defined in the specification)

Description

Novel Compounds as Agonist for PPARgamma and PPARalpha, Method for Preparation of the Same, and Pharmaceutical Composition Containing the Same}

1 is a view showing a construction process of a vector pZeo-GAL in Embodiment 57 (1) of the present invention;

2 is a view showing a construction process of a vector pZeo-GAL-PPARγLBD in Example 57 (2) of the present invention;

3 is a view showing a construction process of a vector pZeo-GAL-PPARαLBD in Example 57 (3) of the present invention.

The present invention provides a novel compound that enhances the activity of Peroxisome proliferator-activated receptor gamma ("PPARγ") and Peroxisome proliferator-activated receptor alpha ("PPARα"), a method for preparing the same, and a pharmaceutical composition containing the same in a pharmacologically effective amount. It is about.

Diabetes, with many complications worldwide, has many adverse effects on the health of many people. Among diabetes, type 2 diabetes accounts for over 90% of all diabetics. Representative complications of diabetes include hyperlipidemia, obesity, hypertension, retinopathy, renal failure (Paul Zimmer, et al., Nature, 2001, 414, 782). Conventional treatments for diabetes are mainly sulfonyl urea (promoting insulin secretion in pancreatic cells), biguananide (inhibition of liver glucose production), α-Glucosidase inhibitor (inhibition of glucose uptake in the intestine), and the like. In recent years, thiazolidinediones (increase in insulin sensitivity), which are PPARγ-stimulating agents, have been used as antidiabetic agents. However, these drugs have side effects due to their mechanisms. For example, hypoglycemia symptoms and weight gain symptoms are representative side effects (David E. Moller, Nature, 2001, 414, 821). These drugs may also cause hypoglycemia due to inadequate blood sugar control. Therefore, there is an urgent need for the development of anti-diabetic agents that can treat hyperlipidemia, which has fewer side effects and is a complication of weight gain and diabetes.

Recently, animal studies have shown that PPARγ agonists not only increase insulin sensitivity, but also reduce the amount of glucose and insulin, suggesting the potential as a treatment for diabetes and some complications. Ricote M., Nature 1998, 391, 79-82). In addition, the fibrate that activates PPARα is used as a drug that reduces blood triglycerides (TG) by 20-50%, reduces LDLc by 10-15%, and increases HDLc by 10-15%. It has been reported in several experiments that it occurs by activation. Isseman, I., et al, Nature 1990, 347, 645-650; Linton, MF, Curr. Atheroscler. Rep. 2000, 2, 29-35). That is, reports that the activation of PPARα activates the transcription of enzymes that break down fatty acids and reduce the de novo synthesis of fatty acids in the liver, thus reducing the production and release of TG and VLDL.

Recently, the anti-inflammatory agents of human PPARγ and PPARα have been shown to be effective in a variety of arteriosclerosis animal models, suggesting the possibility of these antitherapists to treat atherosclerosis. Li, AC, et al, J. Clin, Invest. 2000, 106 523, Collins, A., Arterioscler., Thromb., Vasc. Biol. 2002, 21, 365-367, Bernadette P. Neve, et al. Biochemical Pharmacology 2000, 60, 1245). In addition, the fact that PPARγ agonists inhibit inflammation-inducing factors has been reported, suggesting the possibility of PPARγ agonists as therapeutic agents for inflammation (Ricoti M., et al., Nature 1998, 391, 79).

Thus, it has been suggested that compounds that activate both PPARγ and PPARα can treat diabetes and hyperlipidemia caused by diabetes. Auwerx, J., Insulin Resistance, Metabolic Disease Diabetic Complications 1999, 167-172). Recently, several researchers have confirmed in animal studies that compounds that simultaneously activate PPARγ and PPARα improve glucose and lipids. Koji Murakami, et al, Diabetes, 1998, 47, 1841, Dawn A. Brooks, et al., J. Med. Chem. 2001, 44, 2061).

Due to the excellent pharmacological effects of the various fields described above, many pharmaceutical companies are trying to develop compounds that activate both PPARγ and PPARα. Among them, tesaglitazar (AZ-242) and muraglitazar (BMS-298585) as of 2004 Phase III clinical trials are underway (Brad R. Henke, J. Med. Chem. 2004, 47, 4118-4127). In particular, the results of tesaglitazar animal experiments (ob / ob rats) show excellent effects of significantly improving hyperglycemia, hyperinsulinemia and hypertriglyceridemia (B. Bjung et al., J. Lipid Res. 2002, 43, 1855-1863).

On the other hand, side effects that can occur with excellent effects include weight gain and edema. This can be clearly seen in rosiglitazone and pioglitazone, which are PPARγ-stimulating agents, with weight gain (3 to 5 kg) in most patients and edema in some patients (S. Mudaliar et al, Curr. Opin. Endocrinol. Diabetes 2002, 9, 285-302). The cause of edema can be a burden on the heart, so it is important to develop compounds without these side effects when developing anti-inflammatory drugs that activate both PPARγ and PPARα. The increase in body weight is mainly due to the increase in subcutaneous fat, which is abundant in the release of biometabolizers by the action of PPAR agonists, which, in parallel with the reduction of abdominal fat, is generally directed towards weight loss for the treatment of diabetes. Therefore, the development of a substance that does not cause weight gain is required. In this regard, there are examples of anti-inflammatory agents that activate both PPARγ and PPARα without weight gain (R. K. Virkramadithyan et al., Obesity Res. 2003, 11, 292-303).

Accordingly, it is an object of the present invention to provide a novel compound of formula 1 which activates both human PPARγ and PPARα with very good efficacy.

Another object of the present invention is to provide a method for preparing such novel compounds.

It is another object of the present invention to provide a PPARγ and PPARα anti-tussive composition comprising a pharmacologically effective amount of such a novel compound as an active ingredient.

Another object of the present invention is to provide a method for treating and preventing PPARγ and PPARα related diseases, such as diabetes mellitus, diabetes related complications, inflammation, etc. using these novel compounds as active ingredients.

Accordingly, the present invention provides a compound represented by the following formula (1), a pharmaceutically acceptable salt thereof, or an isomer thereof.

Where

A is substituted or unsubstituted alkyl, heteroalkyl, aromatic or heteroaromatic;

D is hydrogen, lower alkyl, phenyl or benzyl;

E and G are each independently hydrogen or lower alkyl;

n is 1 or 2;

Unless stated otherwise, the compound of formula 1 as an active ingredient of a therapeutic agent includes all pharmaceutically acceptable salts and isomers thereof, all of which are to be construed as being within the scope of the present invention. For convenience of description, it is simply represented by the compound of the formula (1).

The compound of Formula 1 according to the present invention has a completely different structure from the known PPARγ and PPARα agonists, and as can be seen in the following experimental examples, diabetes mellitus, hyperlipidemia, arteriosclerosis, and inflammation It exhibits an excellent anti-inflammatory effect on human PPARγ and PPARα, which are involved in the prophylaxis and treatment.

The term "pharmaceutically acceptable salt" means a formulation of a compound that does not cause severe irritation to the organism to which the compound is administered and does not impair the biological activity and properties of the compound. The pharmaceutical salts include acids that form non-toxic acid addition salts containing pharmaceutically acceptable anions, such as inorganic acids, tartaric acid, formic acid, such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, hydroiodic acid, and the like. Organic carbon acids such as citric acid, acetic acid, trichloroacetic acid, trichloroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. Acid addition salts formed by the same sulfonic acid and the like. For example, pharmaceutically acceptable carboxylic acid salts include metal salts or alkaline earth metal salts formed by lithium, sodium, potassium, calcium, magnesium, amino acid salts such as lysine, arginine, guanidine, dicyclohexylamine, N Organic salts such as -methyl-D-glucamine, tris (hydroxymethyl) methylamine, diethanolamine, choline and triethylamine and the like. The compound of formula 1 according to the invention can also be converted to its salt by conventional methods.

The term "isomer" means a compound of the present invention or a salt thereof that has the same chemical formula or molecular formula, but which is optically or stereoscopically different. The compounds according to the invention can have asymmetric carbon centers and therefore can exist as R or S isomers and also the geometric isomers of oximes (trans, cis). All these isomers and mixtures thereof are also within the scope of the present invention.

A may preferably be selected from the following substituents.

(Iii) lower alkyl unsubstituted or substituted by alkoxy, halogen or CF ₃

(Ii) phenyl or benzyl unsubstituted or substituted with lower alkyl, alkoxy, halogen or CF ₃

(Ⅲ)

,

,

,

(Ⅳ)

,

,

,

,

,

,

, (Ⅴ)

,

,

,

,

here,

X is N or C;

Each R 1 is independently one of the following substituents;

또는

or

Wherein R 2, R 3 and R 4 are each independently hydrogen, halogen, lower alkyl.

Lower alkyl in the above is preferably alkyl having 7 or less carbon atoms, more preferably C ₁ -C ₄ alkyl, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 4 alkyl.

Representative examples of the compounds of Formula 1 include the following compounds.

(±) 3- (4- {2-[(E) -benzyloxyimino] -propoxy} -phenyl) -2-ethoxy-propionic acid

(±) 2-ethoxy-3- (4- {2-[(Z) -ethoxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid

(±) 2-ethoxy-3- (4- {2-[(Z) -benzyloxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid

(±) 2-ethoxy-3- (4- {2-[(Z) -hexyloxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid

(±) 2-ethoxy-3- (4- {2-[(Z) -ethoxyimino] -2-naphthalen-2-yl-ethoxy} -phenyl) -propionic acid

(±) 3- (4- {2-biphenyl-4-yl-2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

(±) 2-Ethoxy-3- (4- {2-[(E / Z) -ethoxyimino] -3-phenyl-propoxy} -phenyl) -propionic acid methyl ester

(±) 3- (4- {2-benzothiazol-2-yl-2-[(E / Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

3- (4- {2- (4-Chlorophenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

(±) 2-ethoxy-3- {4- [2-[(Z) -ethoxyimino] -2- (4-trifluoromethyl-phenyl) -ethoxy] -phenyl} -propionic acid

(±) 3- (4- {2- (3,4-Dimethyl-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

(±) 3- (4- {2- (2,4-Dichloro-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

(±) 3- (4- {2- (3-methyl-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

(±) 3- (4- {2- (2-methoxy-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid

(±) 2-ethoxy-3- {4- [2-[(Z) -ethoxyimino] -2- (4-methanesulfonyloxy-phenyl) -ethoxy] -phenyl} -propionic acid

(±) 2-Ethoxy-3- {4- [2-[(E) -ethoxyimino] -2- (3-phenyl-isoxazol-5-yl) -ethoxy] -phenyl} -propionic acid

(±) 2-ethoxy-3- {4- [2-[(Z) -ethoxyimino] -2- (5-methyl-2-thiophen-2-yl-oxazol-4-yl)- Ethoxy] -phenyl} -propionic acid

(±) 2-ethoxy-3- {4- [2-[(Z) -methoxyimino] -2- (5-methyl-2-thiophen-2-yl-oxazol-4-yl)- Ethoxy] -phenyl} -propionic acid

(±) 2-ethoxy-3- {4- [2-[(E) -ethoxyimino] -2- (5-phenyl- [1,3,4] oxadiazol-2-yl)- Methoxy] -phenyl} -propionic acid

(±) 2-ethoxy-3- (4- {3-[(E) -benzyloxyimino] -butoxy} -phenyl) -prolic acid

(±) 2-ethoxy-3- (4- {3-[(E) -phenoxyimino] -butoxy} -phenyl) -prolic acid

2-Ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino) -ethoxy} -phenyl) -propionic acid

2-Ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino) -ethoxy} -phenyl) -propionic acid

2-Ethoxy-3- (3- {2- (ethoxyimino) -2-phenyl-ethoxy} -phenyl) -propionic acid

3- (3- {2- (benzyloxyimino) -propoxy} -phenyl) -2-ethoxy-propionic acid

3- (4- {2- (benzyloxyimino) -propoxy} -phenyl) -2- (2-propoxy) -propionic acid

2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid

2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid

2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid

2-ethoxy-3- (3- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- Methoxy-phenyl] -propionic acid

2-ethoxy-3- (4- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- Methoxy-phenyl] -propionic acid

2-ethoxy-3- (3- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e Methoxy} -phenyl) -propionic acid

2-ethoxy-3- (4- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino)- Ethoxy} -phenyl) -propionic acid

2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid

2-ethoxy-3- (4- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid ethyl ester

2-ethoxy-3- (3- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid ethyl ester

(±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (propoxyimino) ethyl ] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (4-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethyl ] Oxy} phenyl) -2-ethoxypropionic acid

(±) 3- (3-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethyl ] Oxy} phenyl) -2-ethoxypropionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (propoxyimino) ethyl] oxy Phenyl) propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy Phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy Phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl Propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl Propionic acid

The present invention also provides a method of preparing a compound of formula (I). Those skilled in the art to which the present invention pertains (“an expert”) will be able to prepare compounds by various methods based on the structure of Formula 1, all of which are construed to include the scope of the present invention. Should be. That is, within the scope of the present invention, it is possible to prepare the compound of formula 1 by arbitrarily combining various synthesis methods described herein or disclosed in the prior art. Therefore, the scope of the present invention is not limited only to these.

As one exemplary method, the compound of Formula 1 may be prepared by a method comprising reacting a compound of Formula 2 with a compound of Formula 3 in the presence of a base, as in Scheme 1 below.

In the above scheme, A, D, E, G, and n are the same as in the general formula (1), and X represents Cl, Br, I or OMs (methanesulfonyloxy group).

The reaction may be carried out in an organic solvent such as dimethylformamide, dimethylacetamide, acetonitrile and the like, and in some cases, a mixture of two or more organic solvents may be used. Examples of the base to be used for the reaction include sodium hydride, potassium potassium t-butoxide, cesium carbonate, potassium potassium carbonate, sodium carbonite, and potassium bis (trimethyl silyl) amide. This may be used together. The condensed compound can be hydrolyzed to afford the desired compound 1.

인 화합물의 제조방법으로 하기 반응식 2를 참조할 수 있다.Formula 3 may be prepared by a known method (Ansersson, Kjell: WO 99/62872). In addition, Formula 2 may be prepared by various methods, A is

As a method of preparing a phosphorus compound, Scheme 2 may be referred to.

In the above scheme, A, D, R1 and n are the same as in formula 1, and X represents Cl, Br, I or OMs (methanesulfonyloxy group).

The oxime reaction a may be performed in an organic solvent such as methanol, ethanol, propanol, or water together with a desired oxime, and in some cases, a mixture of two or more organic solvents may be used. Examples of the base used in the reaction include sodium hydride, potassium potassium carbonate, sodium carbonene, sodium bicarbonate, and the like. In some cases, two or more kinds thereof may be used together.

The reaction b may be carried out in an organic solvent such as dimethylformamide, dichloromethane, acetonitrile, dimethyl sulfoxide together with the desired hydrazide 6, and in some cases, two or more kinds of organic solvent mixtures may be used. Compound 8 can be obtained via compound 7 using -1,3-dimethylimidazolium chloride. Examples of the base used for the reaction include triethylamine, diisopropylethylamine, potassium carbonate and the like, and in some cases, two or more kinds thereof may be used together.

The compounds of formula 8 may also be prepared by a variety of methods within the scope of the present invention, based on its structure.

인 화합물의 제조방법으로 하기 반응식 3을 참조할 수 있다. Also, A

As a method for preparing a phosphorus compound, Scheme 3 may be referred to.

In the above scheme, D, X and R1 are the same as in the formula (8), PG is any functional group that can be used as a protecting group of ordinary alcohols such as TBS (t-butyldimethylsilyl), TBDPS (t-butyldiphenylsilyl), Tr (triphenylmethyl), benzyl Indicates.

The reaction a may be performed in an organic solvent such as methanol, ethanol, propanol or water together with a desired oxime, and in some cases, a mixture of two or more organic solvents may be used. Examples of the base used in the reaction include sodium hydride, potassium potassium carbonate, sodium carbonene, sodium bicarbonate, and the like. In some cases, two or more kinds thereof may be used together.

The reaction b may be obtained by using 1,1-carbonyldiimidide in an organic solvent such as dimethylformamide, dichloromethane, acetonitrile, and dimethyl sulfoxide together with compound 11.

After deprotecting the PG of the compound of Formula 12, a compound of Formula 13 is synthesized by performing a bromination reaction, an iodo reaction, or a reaction using methanesulfonyl chloride.

The compounds of formula 13 may also be prepared by a variety of methods within the scope of the present invention, based on the structure thereof.

In addition, the compound of Formula 1 according to the present invention, as shown in Scheme 4, to a method comprising the step of reacting the compound of Formula 14 and the compound of Formula 3 to prepare a compound of Formula 15, the oxime reaction It may also be prepared by.

In the above scheme, A, D, E, G and n are the same as in formula 1, and X represents Cl, Br, I or OMs (methanesulfonyloxy group).

The reaction a may be performed in an organic solvent such as dimethylformamide, dimethylacetamide, acetonitrile, and the like, and in some cases, a mixture of two or more organic solvents may be used. Examples of the base to be used for the reaction include sodium hydride, potassium potassium t-butoxide, cesium carbonate, potassium potassium carbonate, sodium carbonite, and potassium bis (trimethyl silyl) amide. This may be used together.

The oxime reaction b may be performed in an organic solvent such as methanol, ethanol, propanol or water together with a desired oxime, and in some cases, a mixture of two or more kinds of organic solvents may be used. Examples of the base used in the reaction include sodium hydride, potassium potassium carbonate, sodium carbonene, sodium bicarbonate, and the like. In some cases, two or more kinds thereof may be used together.

Compounds of Formula 15 may also be prepared by a variety of methods within the scope of the present invention, based on its structure.

Those skilled in the art to which the present invention pertains can check the specific reaction conditions for the preparation of the compound according to the present invention through the preparation examples and examples which will be described later, and thus the detailed description thereof will be omitted. .

The present invention also provides a pharmaceutical composition comprising (a) a pharmacologically effective amount of a compound of formula 1; And (b) a pharmaceutically acceptable carrier, diluent, or excipient, or combinations thereof.

The term "pharmaceutical composition" means a mixture of a compound of the invention with other chemical components such as diluents or carriers. The pharmaceutical composition facilitates administration of the compound into the organism. There are a variety of techniques for administering compounds, including but not limited to oral, injection, aerosol, parenteral, and topical administration. Pharmaceutical compositions may also be obtained by reacting acid compounds such as hydrochloric acid, bromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.

The term “therapeutically effective amount” is used to reduce or reduce to some extent one or more symptoms of the disorder being treated, or to delay the onset of a clinical marker or symptom of a disease that requires prevention. Means the amount of active ingredient. Thus, a pharmacologically effective amount may be defined as (1) the effect of reversing the rate of progression of the disease, (2) the effect of inhibiting further progression of the disease to some extent, and / or (3) one or more symptoms associated with the disease. It means the quantity which has the effect of reducing a grade (preferably, removing it). Pharmacologically effective amounts can be determined empirically by testing the compounds in known in vivo and in vitro model systems for diseases in need of treatment.

The term "carrier" is defined as a compound that facilitates the addition of a compound into a cell or tissue. For example, dimethyl sulfoxide (DMSO) is a commonly used carrier that facilitates the incorporation of many organic compounds into organisms' cells or tissues.

The term "diluent" is defined as a compound that not only stabilizes the biologically active form of the compound of interest, but also is diluted in water to dissolve the compound. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline, because it mimics the salt state of human solutions. Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely modify the biological activity of a compound.

The compounds used herein may be administered to human patients as such or as pharmaceutical compositions in combination with other active ingredients or with a suitable carrier or excipient, such as in a combination therapy. Techniques for formulation and administration of compounds in this application can be found in "Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 18th edition, 1990".

Pharmaceutical compositions of the invention can be prepared in a known manner, for example, by means of conventional mixing, dissolving, granulating, sugar-making, powdering, emulsifying, encapsulating, trapping and or lyophilizing processes. .

Thus, pharmaceutical compositions for use according to the present invention comprise one or more pharmacologically acceptable compositions comprising excipients or auxiliaries which facilitate the treatment of the active compounds into formulations which can be used pharmaceutically. It may also be prepared by conventional methods using a carrier. Proper formulation is dependent upon the route of administration chosen. Any of the known techniques, carriers and excipients can be used suitably and as understood in the art, for example in Remingston's Pharmaceutical Sciences described above. In the present invention, the compound of Formula 1 may be formulated into an injectable preparation, an oral preparation, and the like as desired.

For injection, the components of the invention may be formulated in liquid solutions, preferably in pharmacologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffalo. For mucosal permeation administration, noninvasive agents suitable for the barrier to pass through are used in the formulation. Such non-invasive agents are generally known in the art.

For oral administration, the compounds can be formulated readily by combining the active compounds with pharmacologically acceptable carriers known in the art. Such carriers allow the compounds of the invention to be formulated into tablets, pills, powders, granules, sugars, capsules, liquids, gels, syrups, slurries, suspensions and the like. Preferably capsules, tablets, pills, powders and granules are possible, and in particular capsules and tablets are useful. Tablets and pills are preferably prepared with enteric agents. Pharmaceutical preparations for oral use may be achieved by mixing one or more compounds of the invention with one or more excipients, optionally grinding such mixtures and, if necessary, treating the mixture of granules after permeation of appropriate adjuvants. A tablet or sugar core can be obtained. Suitable excipients include fillers such as lactose, sucrose, mannitol, or sorbitol; Corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragakens, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl cellulose, and / or polyvinylpyrrolidone ( Cellulose-based materials such as PVP). If desired, carriers such as disintergrating agents such as crosslinked polyvinyl pyrrolidone, urticaria, or salts thereof such as alginic acid or sodium alginate and lubricants such as magnesium stearate, binders and the like may be added.

Pharmaceutical preparations that can be used orally may include soft sealing capsules made of gelatin and plasticizers such as glycol or sorbitol, as well as tightly held capsules made of gelatin. The push-fix capsule may contain the active ingredients, as a mixture with a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate. In soft capsules, the active compounds may be dissolved or dispersed in suitable solvents such as fatty acids, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be included. All preparations for oral administration should be in amounts suitable for such administration.

The compounds may be formulated for parenteral administration by injection, eg, by large pill injection or continuous infusion. Injectable formulations may be presented in unit dose form, for example, as ampoules or multi-dos containers, with preservatives added. The compositions may take the form of suspensions, solutions, emulsions on oily or liquid vehicles, and may include components for formulation such as suspensions, stabilizers and / or dispersants.

The active ingredient may also be in powder form for constitution with a suitable vehicle, such as sterile pyrogen-free water, before use.

The compounds may also be formulated in rectal dosage compositions, such as suppositories or retention enemas, including, for example, conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in the present invention include compositions in which the active ingredients are contained in an amount effective to achieve their intended purpose. More specifically, a therapeutically effective amount means an amount of a compound effective to prolong the survival of the subject to be treated or to prevent, alleviate or alleviate the symptoms of a disease. Determination of a therapeutically effective amount is within the capabilities of those skilled in the art, in particular in terms of the detailed disclosure provided herein.

When formulated in unit dose form, the compound of formula 1 as the active ingredient is preferably contained in a unit dose of about 0.1 to 1,000 mg. The dosage of the compound of formula 1 depends on the doctor's prescription depending on factors such as the patient's weight, age and the particular nature and severity of the disease. However, the dosage required for adult treatment typically ranges from about 1 to 1000 mg per day, depending on the frequency and intensity of administration. A total dosage of about 1 to 500 mg per day, usually separated by a single dose for intramuscular or intravenous administration to adults, will be sufficient, but for some patients a higher daily dosage may be desirable.

The invention also provides a method of using the compound of formula 1 in the manufacture of a medicament for the treatment or prevention of human PPARγ and PPARα related diseases. "Human PPARγ and PPARα related diseases" are diseases which can be treated or prevented by activating human PPARγ and PPARα, and examples thereof include diabetes, diabetes-related complications, and inflammation, but are not limited thereto. Examples of the diabetes-related complications include hyperlipidemia, arteriosclerosis, obesity, hypertension, retinopathy, renal failure, and the like. The term "treatment" means stopping or delaying the progression of the disease when used in a subject exhibiting symptoms, and the "preventing" means stopping or delaying the manifestation of a disease when used in a subject who does not exhibit symptoms but is at high risk. It means to let.

The present invention will be described in detail below with reference to Preparation Examples and Examples, but the scope of the present invention is not limited thereto. In the following, the preparation example describes the method of synthesizing the intermediate for making the final compound, and the examples describe the preparation method of the final compound using the compound of the preparation example.

[ Production Example  One] Hydroxypropane 2-one O- Benzyl oxime

Acetone (0.5 g, 6.7 mmol), O-benzylhydroxyamine hydrochloride (1.2 g, 7.4 mmol) and sodium acetate (1.2 g, 15 mmol) are dissolved in 20 mL of methanol and the solvent is removed after stirring at room temperature for 3 hours. After adding ethyl acetate and washing with water, the organic layer was dried over anhydrous magnesium sulfate and column chromatography was used to obtain 0.3 g of the title compound in 25% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.36-7.26 (5H, m), 5.11 (2H, s), 4.16 (2H, d, J = 8 Hz), 1.87 (3H, s)

Mass (EI) 180 (M ⁺ +1)

[Production Example 2] (±) 3- (4- {2-[(E) -Benzyloxyimino] -propoxy} -phenyl) -2-ethoxy-propionic acid Ethyl ester

Hydroxypropan-2-one O-benzyloxime (0.3 g, 1.7 mmol) was dissolved in 5 mL of dichloromethane and triethylamine (0.46 ml, 3.3 mmol) was added. Mesyl chloride (0.19 ml, 2.5 mmol) was added to the reaction solution and reacted for 1 hour. After the reaction, 10 mL of ethyl acetate was added, and the organic layer was washed twice with 5 mL of water. The organic layer is dried over anhydrous magnesium sulfate and filtered to remove the solvent. To reaction (13 mg, 0.050 mmol) 2 mL of acetonitrile, cesium carbonate (21 mg, 0.063 mmol), (±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid ethyl ester (WO 99/62872 K (10 mg, 0.042 mmol) was added and reacted under reflux for 3 hours. After the reaction, 10 mL of ethyl acetate was added, and the organic layer was washed with a saturated ammonium chloride solution. The organic layer was dried over anhydrous sodium sulfate, filtered and the solvent was removed, and then column chromatography (eluent: ethyl acetate / hexane = 1/3) gave 15 mg of the title compound in 89% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.38 ~ 7.30 (5H, m), 7.14 ~ 7.05 (2H, m), 6.83 ~ 6.81 (2H, m), 5.13 (2H, s), 4.51 (2H, s ), 4.16 (2H, q, J = 8 Hz), 3.96 (1H, t, J = 6 Hz), 3.62-3.58 (1H, m), 3.37-3.33 (1H, m), 2.95 (2H, d, J = 6 Hz), 1.98 (3H, s), 1.22 (3H, t, J = 6 Hz), 1.16 (3H, t, J = 8 Hz)

Mass (EI) 400 (M ⁺ +1)

[ Example  One] (±) 3- (4- {2-[(E)- Benzyloxyimino ]- Propoxy }- Phenyl )-2- Ethoxy - PROFI Onsan

12 mg (0.030 mmol) of the compound of Preparation Example 2 was dissolved in 2 mL of tetrahydrofuran / methanol (1/1, v / v) solution, and then 1 mL of 1 N NaOH was added to react for 3 hours. After the reaction, 5 mL of saturated ammonium chloride and 5 mL of ethyl acetate were added to separate an organic layer. The organic layer was dried over anhydrous magnesium sulfate, filtered and the solvent was removed to give 8 mg of the desired title compound in 72% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.38 ~ 7.30 (5H, m), 7.14 ~ 7.11 (2H, m), 6.85 ~ 6.78 (2H, m), 5.13 (2H, s), 4.51 (2H, s ), 4.05 (1H, dd, J = 6 Hz, 4 Hz), 3.61-3.57 (1H, m), 3.48-3.44 (1H, m), 3.08 (1H, dd, J = 16 Hz, 4 Hz), 2.94 (1H, dd, J = 16 Hz, 6 Hz), 1.98 (3H, s), 1.18 (3H, t, J = 6 Hz)

Mass (EI) 372 (M ⁺ +1)

[ Production Example  3] (±)  2- Ethoxy -3- [4- (2-oxo-2- Phenyl - Ethoxy )- Phenyl ] -Propionic acid ethyl ester

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid ethyl ester (synthesized according to WO 99/62872 K. Andersson) (53 mg, 0.22 mmol), 2'-bromoacetophenone (49 mg, 0.24 mmol) and cesium carbonate (110 mg, 0.33 mmol) were added to 10 mL of acetonitrile and reacted under reflux for 1 hour. After the reaction, 10 mL of ethyl acetate was added, and the organic layer was washed with a saturated ammonium chloride solution. The organic layer was dried over anhydrous sodium sulfate, filtered and the solvent was removed, and then column chromatography (eluent: ethyl acetate / hexane = 1/3) gave 70 mg of the title compound in 89% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.01 to 7.99 (2H, m), 7.64 to 7.60 (1H, m), 7.52 to 7.48 (2H, m), 7.17 to 7.15 (2H, m), 6.88 to 6.85 (2H, m), 5.25 (2H, s), 4.16 (2H, q, J = 6 Hz), 3.96 (1H, t, J = 8 Hz), 3.62-3.58 (1H, m), 3.36-3.32 (1H, m), 2.95-2.94 (2H, m ), 1.23 (3H, t, J = 6 Hz), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 357 (M ⁺ +1)

[Production Example 4] (±) 2-Ethoxy-3- (4- {2-[(Z) -ethoxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid Ethyl ester

(±) 2-ethoxy-3- [4- (2-oxo-2-phenyl-ethoxy) -phenyl] -propionic acid ethyl ester (14 mg, 0.039 mmol), ethoxyamine hydrochloride (42 mg, 0.043 mmol ) And sodium acetate (7.1 g, 0.086 mmol) were dissolved in 2 mL of methanol, stirred at room temperature for 12 hours, the solvent was removed, ethyl acetate was added, the mixture was washed with water, the organic layer was dried over anhydrous magnesium sulfate, 13 mg was obtained in 83% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.68 ~ 7.65 (2H, m), 7.34 ~ 7.31 (3H, m), 7.13 ~ 7.11 (2H, m), 6.84 ~ 6.82 (2H, m), 5.18 (2H, s), 4.32 (2H, q, J = 8Hz), 4.16 (2H, q, J = 6Hz), 3.95 (1H, t, J = 8Hz), 3.61 ~ 3.57 (1H, m), 3.36 ~ 3.32 (1H, m), 2.95 ~ 2.92 (2H , m), 1.36 (3H, t, 8 Hz), 1.23 (3H, t, J = 6 Hz), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 400 (M ⁺ +1)

[ Example  2] (±) 2- Ethoxy -3- (4- {2-[(Z)- Ethoxyimino ]-2- Phenyl - Ethoxy }- Phenyl ) -Propionic acid

10 mg of the title compound was obtained in 83% yield from the same method as Example 1 from 13 mg of the compound of Preparation Example 4.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.68 ~ 7.65 (2H, m), 7.34 ~ 7.31 (3H, m), 7.13 ~ 7.11 (2H, m), 6.85 ~ 6.83 (2H, m), 5.19 (2H, s), 4.32 (2H, q, J = 8Hz), 3.95 (1H, dd, J = 6Hz, 4Hz), 3.60 ~ 3.56 (1H, m), 3.45 ~ 3.41 (1H, m), 3.07 (1H, dd, J = 14Hz, 4Hz), 2.95 (1H, dd, J = 14 Hz, 6 Hz), 1.36 (3H, t, 8 Hz), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 372 (M ⁺ +1)

Production Example 5 (±) 2-Ethoxy-3- (4- {2-[(Z) -benzyloxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid Methyl ester

Using the compound of Preparation 3 (9 mg, 0.025 mmol), O-benzylhydroxyamine hydrochloride (6 mg, 0.038 mmol) and sodium acetate (6 mg, 0.076 mmol) in the same manner as in Preparation 4, the title compound 8 mg was obtained in 69% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.64 (2H, m), 7.44 ~ 7.32 (8H, m), 7.08 ~ 7.06 (2H, m), 6.79 ~ 6.77 (2H, m), 5.29 (2H , s), 5.21 (2H, s), 4.14 (2H, q, J = 8 Hz), 3.93 (1H, t, J = 6 Hz), 3.60-3.56 (1H, m), 3.35-3.31 (1H, m) , 2.93 to 2.91 (2H, m), 1.21 (3H, t, J = 6 Hz), 1.15 (3H, t, J = 8 Hz)

Mass (EI) 462 (M ⁺ +1)

[ Example  3] (±) 2- Ethoxy -3- (4- {2-[(Z)- Benzyloxyimino ]-2- Phenyl - Ethoxy }- Phenyl ) -Propionic acid

From the compound of Preparation 5 (8 mg, 0.017 mmol) in the same manner as in Example 1 6 mg of the title compound was obtained in 80% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.64 (2H, m), 7.44 ~ 7.32 (8H, m), 7.08 ~ 7.05 (2H, m), 6.79 ~ 6.77 (2H, m), 5.29 (2H , s), 5.21 (2H, s), 4.03 (1H, dd, J = 8 Hz, 4 Hz), 3.57-3.53 (1H, m), 3.46-3.43 (1H, m), 3.07 (1H, dd, J = 14 Hz, 4 Hz), 2.93 (1H, dd, J = 14 Hz, 6 Hz), 1.16 (3H, t, J = 8 Hz)

Mass (EI) 434 (M ⁺ +1)

[Manufacture example 6] (±) 2-Ethoxy-3- (4- {2-[(Z) -hexyloxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid Methyl ester

The compound of Preparation Example 3 (20 mg, 0.056 mmol) and O-hexyl-hydroxyamine (13 mg, 0.11 mmol) were reacted for 5 hours under reflux in 5 mL of ethanol, and then the solvent was removed to remove the solvent using column chromatography. 18 mg of the title compound were obtained in 71% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.67 ~ 7.64 (2H, m), 7.37 ~ 7.32 (3H, m), 7.14 ~ 7.11 (2H, m), 6.87 ~ 6.81 (2H, m), 5.18 (2H , s), 4.24 (2H, t, J = 8 Hz), 3.95 (1H, q, J = 6 Hz), 3.61-3.55 (1H, m), 3.38-3.29 (1H, m), 2.94-2.92 (2H, m), 1.78 to 1.73 (2H, m), 1.42 to 1.38 (2H, m), 1.35 to 1.30 (4H, m), 1.21 (3H, t, J = 6 Hz), 1.16 (3H, t, J = 8 Hz ) 0.92-0.88 (3H, m)

Mass (EI) 456 (M ⁺ +1)

[ Example  4] (±) 2- Ethoxy -3- (4- {2-[(Z)- Hexyloxyimino ]-2- Phenyl - Ethoxy }- Phenyl ) -Propionic acid

12 mg of the title compound was obtained in 71% yield by the same method as Example 1 from compound (15 mg, 0.033 mmol) in Preparation Example 6.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.67 ~ 7.64 (2H, m), 7.37 ~ 7.32 (3H, m), 7.15 ~ 7.11 (2H, m), 6.87 ~ 6.81 (2H, m), 5.18 (2H , s), 4.24 (2H, t, J = 8 Hz), 4.01 (1H, dd, J = 8 Hz, 6 Hz), 3.57-3.53 (1H, m), 3.46-3.43 (1H, m), 3.07 (1H, dd, J = 14 Hz, 6 Hz), 2.92 (1H, dd, J = 14 Hz, 8 Hz), 1.77-1.73 (2H, m), 1.42-1.38 (2H, m), 1.35-1.30 (4H, m), 1.16 (3H, t, J = 8 Hz) 0.92-0.88 (3H, m)

Mass (EI) 428 (M ⁺ +1)

[ Example  5] (±) 2- Ethoxy -3- (4- {2-[(Z)- Ethoxyimino ] -2-naphthalen-2-yl- Ethoxy } -Phenyl) -propionic acid

14 mg of the title compound was obtained in 85% yield by the method of Preparation 3, Preparation 4 and Example 2 from 2-bromo-1-naphthalen-2-yl ethanone (6 mg, 0.015 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.11 (1H, s), 7.87 ~ 7.77 (4H, m), 7.48 ~ 7.45 (2H, m), 7.14 ~ 7.11 (2H, m), 6.89 ~ 6.86 (2H, m), 5.30 (2H, s) , 4.35 (2H, q, J = 8 Hz), 4.03 (1H, dd, J = 6 Hz, 4 Hz), 3.58-3.52 (1H, m), 3.44-3.40 (1H, m), 3.07 (1H, dd, J = 14 Hz, 4 Hz), 2.92 (1H, dd, J = 14 Hz, 6 Hz), 1.39 (3H, t, J = 8 Hz) 1.14 (3H, t, J = 8 Hz)

Mass (EI) 422 (M ⁺ +1)

[ Example  6] (±) 3- (4- {2- Biphenyl -4-yl-2-[(Z)- Ethoxyimino ]- Ethoxy }- Phenyl ) -2-ethoxy-propionic acid

Preparation Example 3 from (±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (50 mg, 0.22 mmol) and 4-phenyl-2'-bromo acetophenone (61 mg, 0.22 mmol) 68 mg yield of the title compound was obtained by the method of Preparation Example 4 and Example 2 in 69% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.77 ~ 7.74 (2H, m), 7.63 ~ 7.56 (4H, m), 7.45 ~ 7.42 (2H, m), 7.36 ~ 7.33 (1H, m), 7.14 ~ 7.11 (2H, m), 6.89 to 6.66 (2H, m), 5.22 (2H, s), 4.33 (2H, q, J = 8 Hz), 4.05 (1H, dd, J = 6 Hz, 4 Hz), 3.59 to 3.54 ( 1H, m), 3.48-3.44 (1H, m), 3.08 (1H, dd, J = 14 Hz, 4 Hz), 2.94 (1H, dd, J = 14 Hz, 6 Hz), 1.37 (3H, t, J = 8 Hz) , 1.16 (3H, t, J = 8 Hz)

Mass (EI) 448 (M ⁺ +1)

[Manufacture example 7] 1-hydroxy-3-phenyl-propan-2-one O-ethyl-oxime

(One) One- Trityloxy -3- Phenyl -Propan-2-one

Magnesium (67 mg, 2.8 mmol) was added to 30 mL of anhydrous tetrahydrofuran and benzyl bromide (0.33 mL, 2.8 mmol) was slowly added dropwise with stirring under room temperature nitrogen filling. The catalyst was added with 1,2-dibromoethane and stirred for 1 hour, followed by stirring in 30 ml of N-methoxy-N-methyl-2trityloxy acetamide (500 mg, 1.4 mmol) in anhydrous tetrahydrofuran solution Was slowly added dropwise. After stirring for 1 hour at room temperature, 20 mL of saturated ammonium chloride aqueous solution was slowly added dropwise, the organic layer was extracted, dried over anhydrous magnesium sulfate, and the title compound was obtained by column chromatography in 470 mg of 86% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.43-7.41 (4H, m), 7.32-7.25 (12H, m), 7.19-7.14 (4H, m), 3.83 (2H, s), 2.92 (2H, s )

Mass (EI) 393 (M ⁺ +1)

(2) One- Hydroxy -3- Phenyl -Propan-2-one

Compound (470 mg, 1.2 mmol) of Preparation Example 7 (1) was dissolved in 10 mL of methylene chloride and 10 mL of trifluoroacetic acid, stirred at room temperature for 2 hours, and then the solvent was removed. Then, 140 mg of the title compound was purified by column chromatography. Was obtained in 79% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.37 to 7.29 (3H, m), 7.24 to 7.21 (2H, m), 4.29 (2H, d, J = 4 Hz), 3.73 (2H, s), 2.99 (1H, t, J = 4 Hz)

Mass (EI) 151 (M ⁺ +1)

(3) One- Hydroxy -3- Phenyl -Propan-2-one O-ethyl- Oxime

35 mg of the title compound was obtained in 90% yield from the compound of Preparation Example 7 (2) (30 mg, 0.20 mmol) and ethoxyamine hydrochloride (23 mg, 0.24 mmol) in the same manner as in Preparation Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.34-7.29 (3H, m), 7.25-7.20 (2H, m), 4.27 (2H, d, J = 8 Hz), 4.17 (2H, q, J = 6 Hz) , 4.12 (1H, d, J = 4 Hz), 3.70 (1H, s), 3.61 (1H, s), 2.46 (0.5H, t, J = 4 Hz), 2.31 (0.5H, t, J = 8 Hz), 1.31 (1.5H, t, J = 6 Hz), 1.28 (t, J = 6 Hz)

Mass (EI) 151 (M ⁺ +1)

Example 7 (±) 2-Ethoxy-3- (4- {2-[(E / Z) -ethoxyimino] -3-phenyl-propoxy} -phenyl) -propionic acid Methyl ester

18 mg of the title compound was obtained in 26% yield by the method of Preparation Example 2 and Example 1 from compound of Preparation Example 7 (35 mg, 0.18 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.60 to 7.29 (3H, m), 7.25 to 7.20 (2H, m), 7.15 to 7.72 (2H, m), 6.85 to 6.68 (2H, m), 4.74 (1.1 H, s), 4.45 (0.9H, s), 4.21-4.16 (2H, m), 4.06 (1H, dd, J = 6Hz, 4Hz), 3.82 (0.9H, s), 3.62 (1.1H, s) , 3.61 to 3.57 (1H, m), 3.50 to 3.44 (1H, m), 3.09 (1H, dd, J = 14 Hz, 4 Hz), 2.94 (1H, dd, J = 14 Hz, 6 Hz), 1.32 to 1.26 (3H , m), 1.17 (3H, t, J = 8 Hz)

Mass (EI) 386 (M ⁺ +1)

[ Production Example  8] One- Benzothiazole -2-yl-2- Hydroxy - Ethanon

Benzothiazole (110 mg, 0.83 mmol) was dissolved in 30 mL of anhydrous tetrahydrofuran and butyllithium (2.5M, 0.33 mL) was slowly added dropwise with stirring at -78 ° C. After 30 minutes, 10 mL of N-methoxy-N-methyl-2trityloxy acetamide (300 mg, 0.83 mmol) anhydrous tetrahydrofuran solution was slowly added dropwise to the reaction solution at -78 ° C. After raising the reaction temperature to 0 ° C. over 1 hour, 20 mL of saturated ammonium chloride aqueous solution was slowly added dropwise, the organic layer was extracted, dried over anhydrous magnesium sulfate, and then purified by column chromatography using 1-benzothiazol-2-yl-2. Trityloxy-ethanone (300 mg, 83% yield) was obtained. This compound was obtained in the same manner as in Preparation Example 7 (2), and 70 mg of the title compound was obtained in 53% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.21 to 8.19 (1H, m), 8.04 to 8.01 (1H, m), 7.64 to 7.56 (2H, m), 5.16 (2H, s)

Mass (EI) 194 (M ⁺ +1)

[ Example  8] (±) 3- (4- {2- Benzothiazole -2-yl-2-[(E / Z)- Ethoxyimino ]- Ethoxy }- Fe Nil) -2- Ethoxy Propionic acid

12 mg of the title compound was obtained in 18% yield by the method of Preparation Example 1, Preparation Example 2 and Example 1 from the compound of Preparation Example 8 (30 mg, 0.16 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 (0.67H, d, J = 8Hz), 8.04 (0.33H, d, J = 8Hz), 7.97 (0.67H, d, J = 8Hz), 7.88 (0.33H, d, J = 8Hz), 7.55 ~ 7.44 (2H, m), 7.17-7.14 (2H, m), 7.01-6.96 (2H, m), 5.38 (1.3H, s), 5.30 (0.7H, s), 4.49 (1.3H, q, J = 8 Hz), 4.40 (0.7H, q, J = 8 Hz), 4.07-4.04 (1H, m), 3.60-3.56 (1H, m), 3.48-3.44 (1H, m), 3.10 (1H, dd, J = 14 Hz, 4 Hz), 2.96 (1H, dd, J = 14 Hz, 6 Hz), 1.46 (2H, t, J = 8 Hz), 1.37 (1H, t, J = 8 Hz), 1.16 (3H, t, J = 8 Hz )

Mass (EI) 429 (M ⁺ +1)

[ Example  9] 3- (4- {2- (4- Chlorophenyl ) -2-[(Z)- Ethoxyimino ]- Ethoxy }- Phenyl )-2- Etok Ci-propionic acid

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (22 mg, 0.1 mmol) and 2-bromo-1- (4-chlorophenyl) -ethanone (19 mg, 0.1 mmol 20 mg of the title compound was obtained in 49% yield by the method of Preparation Example 3, Preparation Example 4 and Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.63 ~ 7.60 (2H, m), 7.32 ~ 7.28 (2H, m), 7.14 ~ 7.11 (2H, m), 6.83 ~ 6.81 (2H, m), 5.17 (2H , s), 4.30 (2H, q, J = 8 Hz), 4.05 (1H, dd, J = 6 Hz, 4 Hz), 3.59-3.55 (1H, m), 3.48-3.44 (1H, m), 3.07 (1H, dd, J = 14 Hz, 4 Hz), 2.93 (1H, dd, J = 14 Hz, 6 Hz), 1.35 (3H, t, 8 Hz), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 406 (M ⁺ +1)

[ Example  10] (±) 2- Ethoxy -3- {4- [2-[(Z)- Ethoxyimino ] -2- (4- Trifluoromethyl - Fe Neil) Ethoxy ]- Phenyl } -Propionic acid

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (60 mg, 0.27 mmol) and 2-bromo-1- (4-trifluoromethyl-phenyl) -ethanone (50 mg, 0.19 mmol) to give 5 mg of the title compound in the yield of 6% by the method of Preparation 3, Preparation 4 and Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.79 (2H, d, J = 8 Hz), 7.58 (2H, d, J = 8 Hz), 7.14-7.10 (2H, m), 6.84-6.81 (2H, m) , 5.21 (2H, s), 4.33 (2H, q, J = 8 Hz), 4.04 (1H, dd, J = 6 Hz, 4 Hz), 3.60-3.54 (1H, m), 3.48-3.42 (1H, m), 3.07 (1H, dd, J = 12 Hz, 4 Hz), 2.94 (1H, dd, J = 12 Hz, 6 Hz), 1.37 (3H, t, 8 Hz), 1.16 (3H, t, J = 8 Hz)

Mass (EI) 440 (M ⁺ +1)

[ Example  11] (±) 3- (4- {2- (3,4-dimethyl- Phenyl ) -2-[(Z)- Ethoxyimino ]- Ethoxy }- Phenyl )-2- Ethoxy Propionic acid

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (60 mg, 0.27 mmol) and 2-bromo-1- (3,5-dimethyl-phenyl) -ethanone (50 mg , 0.22 mmol) to give 8.8 mg of the title compound in the yield of 10% by the method of Preparation 3, Preparation 4 and Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.10 to 7.07 (3H, m), 6.97 (1H, s), 6.94 to 6.92 (1H, m), 6.75 to 6.72 (2H, m), 5.12 (2H, s), 4.25 (2H, q, J = 8 Hz), 4.01 (1H, dd, J = 8 Hz, 4 Hz), 3.59-3.53 (1H, m), 3.44-3.38 (1H, m), 3.05 (1H, dd, J = 12 Hz, 4 Hz), 2.93 (1H , dd, J = 12Hz, 8Hz), 2.29 (3H, s), 2.27 (3H, s), 1.34 (3H, t, 8Hz), 1.15 (3H, t, J = 6Hz)

Mass (EI) 400 (M ⁺ +1)

[ Example  12] (±) 3- (4- {2- (2,4- Dichloro - Phenyl ) -2-[(Z)- Ethoxyimino ]- Ethoxy }- Fe  Nil) -2- Ethoxy Propionic acid

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (22 mg, 0.1 mmol) and 2-bromo-1- (2,4-dimethyl-phenyl) -ethanone (22 mg , 0.1 mmol) to give 11 mg of the title compound in a yield of 24% by the method of Preparation 3, Preparation 4 and Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.39 (1H, s), 7.19 to 7.14 (2H, m), 7.14 to 7.11 (2H, m), 6.83 to 6.69 (2H, m), 5.18 (2H, s), 4.28 (2H, q, J = 8 Hz), 4.04 (1H, dd, J = 6 Hz, 4 Hz), 3.59-3.55 (1H, m), 3.47-3.43 (1H, m), 2.92 (1H, dd, J = 14 Hz, 4 Hz), 2.93 (1H , dd, J = 14 Hz, 6 Hz), 1.35 (3H, t, 8 Hz), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 440 (M ⁺ +1)

[ Example  13] (±) 3- (4- {2- (3- methyl - Phenyl ) -2-[(Z)- Ethoxyimino ]- Ethoxy }- Phenyl )-2- Ethoxy Propionic acid

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (60 mg, 0.27 mmol) and 2-bromo-1- (3-methyl-phenyl) -ethanone (40 mg, 0.19 mmol) gave 12.5 mg of the title compound in 17% yield by the methods of Preparation 3, Preparation 4 and Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.48 (1H, s), 7.45-7.43 (1H, s), 7.26-7.22 (1H, m), 7.16-7.72 (3H, m), 6.89-6.83 (2H, m), 5.17 (2H, s) , 4.30 (2H, q, J = 8 Hz), 4.02 (1H, dd, J = 8 Hz, 4 Hz), 3.61-3.57 (1H, m), 3.43-3.39 (1H, m), 3.06 (1H, dd, J = 12 Hz, 4 Hz), 2.93 (1H, dd, J = 12 Hz, 8 Hz), 2.34 (3H, s), 1.35 (3H, t, 8 Hz), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 386 (M ⁺ +1)

[ Example  14] (±) 3- (4- {2- (2- Methoxy - Phenyl ) -2-[(Z)- Ethoxyimino ]- Ethoxy }- Phenyl )-2- Ethoxy Propionic acid

(±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (20 mg, 0.089 mmol) and 2-bromo-1- (2-methoxy-phenyl) -ethanone (20 mg, 0.087 mmol) to give the title compound (12 mg, 34% yield) by the method of Preparation 3, Preparation 4 and Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.32 to 7.28 (1H, m), 7.17 to 7.15 (1H, m), 7.07 to 7.05 (2H, m), 6.87 to 6.84 (2H, m), 6.70 to 6.68 (2H, m), 5.19 (2H, s), 4.27 (2H, q, J = 8 Hz), 4.03 (1H, dd, J = 6 Hz, 4 Hz), 3.75 (3H, s), 3.57-3.53 (1H, m), 3.46-3.42 (1H, m ), 3.07 (1H, dd, J = 14 Hz, 4 Hz), 2.90 (1H, dd, J = 14 Hz, 6 Hz), 1.35 (3H, t, 8 Hz), 1.15 (3H, t, J = 6 Hz)

Mass (EI) 402 (M ⁺ +1)

[ Production Example  9] Methanesulfonic acid  4-acetyl- Phenyl  ester

300 mg (2.2 mmol) of 1- (4-hydroxy-phenyl) -ethanone were dissolved in 2 mL of methylene chloride and 0.46 mL of triethylamine and 0.188 mL (2.4 mmol) of mesyl chloride were slowly added dropwise at 0 ° C. After raising the temperature to room temperature and stirring for 15 minutes, 10 mL of ethyl acetate was added, and the organic layer was washed with water. The organic layer was dried over anhydrous sodium sulfate, filtered and the solvent was removed. Then, the residue was purified by column chromatography to give 450 mg of the title compound in 95% yield.

Mass (EI) 215 (M ⁺ +1)

[ Example  15] (±) 2- Ethoxy -3- {4- [2-[(Z)- Ethoxyimino ] -2- (4- Methanesulfonyloxy - Fe Neil) Ethoxy ]- Phenyl } -Propionic acid

59 mg (0.28 mmol) of the compound of Preparation Example 9 were dissolved in 2 mL of methylene chloride, and 0.024 mL (0.5 M methylene chloride solution) of bromine was slowly added dropwise at 0 ° C. Confirm that the initial material disappeared, 5% sodium thiosulfate was added dropwise. The organic layer was extracted with 10 mL of methylene chloride, dried over anhydrous sodium sulfate and filtered to remove the solvent, followed by preparation of (±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (61 mg, 0.27 mmol). 3, Preparation Example 4 and Example 2 gave 3 mg of the title compound in 2.3% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.75 ~ 7.71 (2H, m), 7.26 ~ 7.23 (2H, m), 7.13 ~ 7.11 (2H, m), 6.85 ~ 6.79 (2H, m), 5.19 (2H, s), 4.31 (2H, q, J = 8 Hz), 4.05 (1H, dd, J = 6 Hz, 4 Hz), 3.60-3.56 (1H, m), 3.49-3.45 (1H, m), 3.13 (3H, s), 3.07 (1H, dd, J = 14 Hz, 4 Hz), 2.94 (1H, dd, J = 14 Hz, 8 Hz), 1.36 (3H, t, 8 Hz), 1.18 (3H, t, J = 8 Hz)

Mass (EI) 466 (M ⁺ +1)

[ Example  16] (±) 2- Ethoxy -3- {4- [2-[(E)- Ethoxyimino ] -2- (3- Phenyl - Isoxazole -5 days)- Ethoxy ]- Phenyl } -Propionic acid

26 mg (0.1 mmol) of 2-bromo-1- (3-phenyl-isoxazol-5-yl) -ethanone was prepared by the method of Preparation Example 1, Preparation Example 3, Example 1 and Example 2, and the title compound. 18 mg was obtained in 41% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.84-7.80 (2H, m), 7.48-7.44 (3H, m), 7.17-7.15 (2H, m), 6.97 (1H, s), 6.92-6.89 (2H, m), 5.15 (2H, s), 4.41 (2H, q, J = 8 Hz), 4.06 (1H, dd, J = 6 Hz, 4 Hz), 3.60-3.56 (1H, m), 3.49-3.45 (1H, m), 3.09 (1H, dd, J = 14 Hz, 4 Hz), 2.95 (1H, dd, J = 14 Hz, 6 Hz), 1.39 (3H, t, 8 Hz), 1.17 (3H, t, J = 6 Hz)

Mass (EI) 439 (M ⁺ +1)

Preparation Example 10 2-Bromo-1- (5-methyl-2-thiophen-2-yl-oxazol-4-yl) -ethanone

(One) 1- (5- methyl -3-oxo-2- Thiophene -2 days- Oxazole -4- days) Ethanon

1 g (7.2 mmol) of pentane-2,3,4-trione3-oxime and thiophene-2-carbaldehyde are dissolved in 10 mL acetic acid and bubbled with hydrogen chloride gas for 15 minutes with stirring at 0 ° C. Stirred for 2 h. Diluted with diethyl ether to crystallize, filtered and dried to give 1.45 g of the title compound in 90% yield.

Mass (EI) 224 (M ⁺ +1)

(2) 1- (5- methyl -2- Thiophene -2 days- Oxazole -4- days) Ethanon

1.45 g (6.5 mmol) of the compound of Preparation Example 10 (1) were dissolved in 40 mL of acetic acid, and 1.3 g (19.5 mmol) of zinc powder was slowly added dropwise at 0 ° C. The reaction temperature was raised to room temperature over 30 minutes, filtered to remove zinc, the solvent was removed, and 100 mg of the title compound was obtained by column chromatography in 7.4% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.68 ~ 7.66 (1H, m), 7.46 ~ 7.44 (1H, m), 7.13 ~ 7.11 (1H, m), 2.68 (3H, s), 2.58 (3H, s)

Mass (EI) 208 (M ⁺ +1)

(3) 2- Bromo -1- (5- methyl -2- Thiophene -2 days- Oxazole -4- days) Ethanon

100 mg (0.48 mmol) of the compound of Preparation Example 10 (2) were dissolved in 10 mL of chloroform, and 0.025 mL (0.48 mmol) of bromine was dissolved in 3 mL of chloroform and slowly added dropwise at 50 ° C. After stirring at 55 ° C. for 30 min, the solvent was removed and column chromatography gave 70 mg of the title compound in 51% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.71 ~ 7.68 (1H, m), 7.50 ~ 7.47 (1H, m), 7.15 ~ 7.12 (1H, m), 4.58 (2H, s), 2.69 (3H, s)

Mass (EI) 287 (M ⁺ +1)

[ Example  17] (±) 2- Ethoxy -3- {4- [2-[(Z)- Ethoxyimino ] -2- (5- methyl -2- Thiophene -2 days- Oxazole -4- days) Ethoxy ]- Phenyl } -Propionic acid

(±) 2-Ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (24 mg, 0.11 mmol) and the compound of Preparation Example 10 (31 mg, 0.11 mmol) The method of Example 2 gave 10 mg of the title compound in 20% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.62 ~ 7.60 (1H, m), 7.39 ~ 7.37 (1H, m), 7.14 ~ 7.11 (1H, m), 7.09 ~ 7.06 (2H, m), 6.92 ~ 6.89 (2H, m), 5.15 (2H, s ), 4.28 (2H, q, J = 8 Hz), 4.05 (1H, dd, J = 6 Hz, 4 Hz), 3.58-3.54 (1H, m), 3.48-3.44 (1H, m), 3.08 (1H, dd, J = 14 Hz, 4 Hz), 2.93 (1H, dd, J = 14 Hz, 6 Hz), 2.46 (3H, s), 1.31 (3H, t, 8 Hz), 1.17 (3H, t, J = 6 Hz)

Mass (EI) 459 (M ⁺ +1)

[ Example  18] (±) 2- Ethoxy -3- {4- [2-[(Z)- Methoxyimino ] -2- (5- methyl -2- Thiophene -2 days- Oxazole -4- days) Ethoxy ]- Phenyl } -Propionic acid

Preparation Example 3, using (±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid methyl ester (18 mg, 0.063 mmol) and the compound obtained in Preparation Example 10 (23 mg, 0.063 mmol) The method of Example 4 and Example 2 gave 12 mg of the title compound in 43% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.62 ~ 7.60 (1H, m), 7.39 ~ 7.37 (1H, m), 7.14 ~ 7.11 (1H, m), 7.09 ~ 7.07 (2H, m), 6.92 ~ 6.88 (2H, m), 5.13 (2H, s ), 4.05 (1H, dd, J = 6 Hz, 4 Hz), 4.03 (3H, s), 3.58-3.54 (1H, m), 3.48-3.44 (1H, m), 3.09 (1H, dd, J = 14 Hz, 4 Hz), 2.93 (1H, dd, J = 14 Hz, 6 Hz), 2.48 (3H, s), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 445 (M ⁺ +1)

[Production Example 11] 2-hydroxy-1- (5-phenyl- [1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime

(One) 2- (t- Butyl - Dimethylsilanyloxy ) -1- (5- Phenyl -[1,3,4] Oxadiazole -2 days)- Ethanon

400 mg (2.7 mmol) of 2-phenyl- [1,3,4] oxadiazole (Jour. Med. Chem., 2001, 44, 1268-1285) was dissolved in 30 mL of anhydrous tetrahydrofuran and stirred at -78 ° C. 1.1 mL of butyllithium (2.5M) was slowly added dropwise. After 1 hour, 250 mg (1.2 mmol) of (t-butyl-dimethylsilanyloxy) -methyl acetate was dissolved in 10 mL of anhydrous tetrahydrofuran and slowly added dropwise at -78 ° C, and the reaction temperature was gradually raised to -30 ° C. gave. TLC confirmed that the initial material disappeared and 20 mL of saturated ammonium chloride was added thereto. The organic layer was extracted, dried over anhydrous magnesium sulfate, and column chromatography was used to obtain 150 mg of the title compound in 38% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.19-8.16 (2H, m), 7.62-7.53 (3H, m), 5.15 (2H, s), 0.97 (9H, s), 0.17 (6H, s)

Mass (EI) 319 (M ⁺ +1)

(2) 2- (t- Butyl - Dimethylsilanyloxy ) -1- (5- Phenyl -[1,3,4] Oxadiazole -2 days)- Ethanon  O-ethyl- Oxime

45 mg (0.14 mmol) of the compound of Preparation Example 11 (1) were used to obtain 30 mg of the title compound, in 59% yield, using the method of Preparation Example 1.

Mass (EI) 361 (M ⁺ +1)

(3) 2- Hydroxy -1- (5- Phenyl -[1,3,4] Oxadiazole -2 days)- Ethanon  O-ethyl- Oxime

30 mg (0.083 mmol) of the compound of Preparation Example 11 (2) were dissolved in 10 mL of anhydrous tetrahydrofuran, and 0.24 mL of tetrabutylammonium fluoride (1 M) was slowly added dropwise while stirring at 0 ° C. After 1 hour, 10 mL of saturated ammonium chloride was added to the reaction solution. The organic layer was extracted with 20 mL of ethyl acetate, dried over anhydrous magnesium sulfate, and then purified by column chromatography to obtain 15 mg of the title compound in 73% yield.

Mass (EI) 248 (M ⁺ +1)

[ Example  19] (±) 2- Ethoxy -3- {4- [2-[(E)- Ethoxyimino ] -2- (5- Phenyl -[1,3,4] Oxadiazole -2 days)- Ethoxy ]- Phenyl } -Propionic acid

5 mg (0.024 mmol) of the compound of Preparation Example 11 were prepared in the same manner as in Preparation Example 2 and Example 4 to obtain 4 mg of the title compound in 38% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 ~ 8.12 (2H, m), 7.56 ~ 7.50 (3H, m), 7.11 ~ 7.09 (2H, m), 6.77 ~ 6.75 (2H, m), 5.23 (2H, s), 4.44 (2H, q, J = 7Hz), 4.05 (1H, dd, J = 6Hz, 4Hz), 3.62 ~ 3.58 (1H, m), 3.49 ~ 3.45 (1H, m), 3.08 (1H, dd, J = 14Hz, 4Hz), 2.94 ( 1H, dd, J = 14 Hz, 6 Hz), 2.48 (3H, s), 1.41 (3H, t, J = 7 Hz), 1.17 (3H, t, J = 6 Hz)

Mass (EI) 440 (M ⁺ +1)

[Manufacture example 12] (±) 2-Ethoxy-3- [4- (3-oxo-butoxy) -phenyl] -prorylic acid methyl ester

(One) (±) 2- Ethoxy -3- [4- (3- methyl - Butte -3- Enyloxy )- Phenyl ] -Propionic acid Methyl ester Porn

228 mg of the title compound was obtained in 52% yield from 0.13 g (1.5 mmol) of 3-methyl-but-3-en-1-ol in the same manner as in Preparation Example 2.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.15 ~ 7.13 (2H, m), 6.84 ~ 6.81 (2H, m), 4.84 (1H, s), 4.80 (1H, s), 4.05 (2H, t, J = 6Hz), 3.99 (1H, dd, J = 8 Hz, 6 Hz), 3.70 (3H, s), 3.63-3.55 (1H, m), 3.38-3.31 (1H, m), 2.96-2.93 (2H, m), 2.49 (2H, t, J = 6 Hz) , 1.80 (3H, s), 1.16 (3H, t, J = 6 Hz)

Mass (EI) 293 (M ⁺ +1)

(2) (±) 2- Ethoxy -3- [4- (3-oxo- Butoxy )- Phenyl ]- Prolic acid Methyl ester

After dissolving 228 mg (0.78 mmol) of the compound of Preparation Example 12 (1) in 4 mL of methylene chloride and bubbling ozone at −78 ° C. for 10 minutes, 225 mg (0.86 mmol) of triphenylphosphine was added thereto. After solvent removal, the title compound was obtained by 47% yield by column chromatography using column chromatography.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.15 ~ 7.12 (2H, m), 6.83 ~ 6.80 (2H, m), 4.21 (2H, t, J = 8Hz), 3.99 (1H, dd, J = 8Hz, 6Hz), 3.70 (3H, s), 3.63 ~ 3.55 (1H, m), 3.38-3.32 (1H, m), 2.96-2.93 (2H, m), 2.89 (2H, t, J = 8 Hz), 2.24 (3H, s), 1.16 (3H, t, J = 8Hz)

Mass (EI) 295 (M ⁺ +1)

[ Example  20] (±) 2- Ethoxy -3- (4- {3-[(E)- Benzyloxyimino ]- Butoxy }- Phenyl )- Prolion mountain

12 mg of the title compound was obtained in 46% yield by the method of Preparation Example 5 and Example 3 from 20 mg (0.068 mmol) of the compound of Preparation Example 12.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.37 ~ 7.26 (5H, m), 7.16 ~ 7.11 (2H, m), 6.83 ~ 6.78 (2H, m), 5.09 (2H, s), 4.11 (2H, t, J = 8Hz), 4.03 (1H, dd , J = 6Hz, 4Hz), 3.62 ~ 3.58 (1H, m), 3.46 ~ 3.42 (1H, m), 3.07 (1H, dd, J = 14Hz, 4Hz), 2.94 (1H, dd, J = 14Hz, 6Hz ), 2.65 (2H, t, J = 8 Hz), 1.95 (3H, s), 1.17 (3H, t, J = 6 Hz)

Mass (EI) 386 (M ⁺ +1)

[ Example  21] (±) 2- Ethoxy -3- (4- {3-[(E)- Phenoxyimino ]- Butoxy }- Phenyl )- Prolic acid

From 8 mg (0.055 mmol) of 11 mg (0.037 mmol) of the compound of Preparation Example 12 and 8 mg (0.055 mmol) of O-phenylhydroxyamine hydrochloride, 8 mg of the title compound was obtained in the yield of 58% by the methods of Preparation Examples 5 and 3.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.33 ~ 7.29 (2H, m), 7.20 ~ 7.12 (4H, m), 7.01 ~ 7.98 (1H, m), 6.86 ~ 6.73 (2H, m), 4.23 (2H, t, J = 8 Hz), 4.05 (1H , dd, J = 6Hz, 4Hz), 3.60-3.55 (1H, m), 3.49-3.45 (1H, m), 3.10 (1H, dd, J = 14Hz, 4Hz), 2.96 (1H, dd, J = 14Hz , 6 Hz), 2.81 (2H, t, J = 8 Hz), 2.12 (3H, s), 1.18 (3H, t, J = 6 Hz)

Mass (EI) 372 (M ⁺ +1)

[Production Example 13] Preparation of Methanesulphonic Acid 2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2propoxyimino-ethyl ester

Preparation Example 11 (2) and 11 (3) from 2- (t-butyl-dimethylsilanyloxy) -1- (5-phenyl- [1,3,4] oxadiazol-2-yl) -ethanone 2-hydroxy-1- (5-phenyl- [1,3,4] oxadiazol-2-yl) -propanone O-ethyl-oxime was obtained using. The alcohol (5 mg, 0.023 mmol) was dissolved in 1 mL of dichloromethane, and triethylamine (5 mg, 0.049 mmol) was added. Mesyl chloride (4 mg, 0.034 mmol) was added to the reaction solution and reacted for 1 hour. After the reaction, 10 mL of ethyl acetate was added, and the organic layer was washed twice with 5 mL of water. The organic layer was dried over anhydrous magnesium sulfate and filtered to remove the solvent.

Mass (EI) 340 (M ⁺ +1)

Production Example 14 2-Ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino) -ethoxy} -phenyl) -propionic acid Ethyl ester  Produce

Methanesulfonic acid 2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2-propoxyimino-ethyl ester (10 mg, 0.029 mmol) and 2-ethoxy-3- (4 12 mg of the title compound was obtained in 85% yield using Preparation Example 3 from -hydroxy-phenyl) -propionic acid methylester (7 mg, 0.031).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.13 to 8.08 (2H, m), 7.57 to 7.40 (3H, m), 7.14 (2H, d, J = 8.8 Hz), 6.92 (2H, d, J = 8.8 Hz), 5.22 (2H, s), 4.35 (2H, t, J = 6.4 Hz), 4.12 (2H, q, J = 7.2 Hz), 3.99-3.96 (1H, m), 3.70 (3H, s), 3.60-3.56 (1H, m), 3.35- 3.31 (1H, m), 2.95-2.93 (2H, m), 1.82-1.78 (2H, m), 1.25 (3H, t, J = 7.2 Hz), 1.15 (3H, t, J = 7.2 Hz), 1.01 (3H, t, J = 7.2 Hz)

Mass (EI) 482 (M ⁺ +1)

[ Example  22] 2-ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino)- Ethoxy }- Phenyl ) -Propionic acid

2-Ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino) -ethoxy} -phenyl) -propionic acid 8 mg of the title compound was obtained in 72% yield using Example 1 from ethyl ester (12 mg, 0.025 mmol).

NMR: Na Form ¹ H-NMR (MeOH-d 4) δ 7.98 ~ 7.92 (2H, m), 7.53 ~ 7.45 (3H, m), 7.13 ~ 7.10 (2H, m), 6.82 ~ 6.78 (2H, m), 5.12 (2H, s), 4.26 (2H, t, J = 6.8 Hz), 3.68-3.65 (2H, m), 3.68-3.65 (1H, m), 3.50-3.46 (1H, m), 3.13-3.09 (1H, m), 2.86-2.82 (1H, m), 2.71-2.65 (1H, m), 1.76-1.67 (2H, m), 0.98 (3H, t, J = 5.6 Hz), 0.91 (3H, t, J = 7.6 Hz)

Mass (EI) 440 (M ⁺ +1)

[ Production Example  15] 2- Bromo -1- (5- methyl -2- Phenyl - Oxazole -4- days) Ethanon  O-ethyl- Oxime

From 1- (5-methyl-2-phenyl-oxazol-4-yl) -ethanone O-ethyl-oxime (100 mg, 0.49 mmol) using Preparation Example 10 (3) 30 mg of the title compound were obtained in 18% yield.

Mass (EI) 324 (M ⁺ +1)

Production Example 16 2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (5-methyl-2-phenyl-oxazol-4-yl) -ethoxy} -phenyl)- Propionic acid Methyl ester  Produce

2-bromo-1- (5-methyl-2-phenyl-oxazol-4-yl) -ethanone O-ethyl-oxime (70 mg, 0.216 mmol) and 2-ethoxy-3- (4-hydride 68 mg of the title compound was obtained in 65% yield using Preparation 3 from oxy-phenyl) -propionic acid methyl ester (48 mg, 0.21 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.00-7.97 (2H, m), 7.43-7.41 (3H, m), 7.12 (2H, d, J = 8.0 Hz), 6.89 (2H, d, J = 8.0 Hz), 5.18 (2H, s), 4.28 (2H, q, J = 8Hz), 3.99-3.96 (1H, m), 3.69 (3H, s), 3.60-3.56 (1H, m), 3.35-3.31 (1H, m), 2.94-2.93 (2H, m), 2.49 (3H, s), 1.34 (3H, t, J = 8 Hz), 1.15 (3H, t, J = 8 Hz)

Mass (EI) 467 (M ⁺ +1)

[ Example  23] 2- Ethoxy -3- (4- {2- (5- Phenyl -[1,3,4] Oxadiazole -2- days) -2- ( Propoxyimi No) -ethoxy} -phenyl) -propionic acid

2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (5-methyl-2-phenyl-oxazol-4-yl) -ethoxy} -phenyl) -propionic acid methyl ester (6 mg, 0.012 mmol), using Example 1 gave 4 mg of the title compound in 70% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.00-7.97 (2H, m), 7.43-7.40 (3H, m), 7.12 (2H, d, J = 8.0 Hz), 6.92-6.89 (2H, m), 5.18 (2H, s), 4.28 (2H, q, J = 8 Hz), 4.06 to 4.03 (1H, m), 3.58 to 3.54 (1H, m), 3.49 to 3.45 (1H, m), 3.11 to 3.06 (1H, m), 2.96 to 2.91 (1H, m) ), 2.49 (3H, s), 1.34 (3H, t, J = 8 Hz), 1.15 (3H, t, J = 8 Hz)

Mass (EI) 453 (M ⁺ +1)

[Production Example 17] Preparation of 2-ethoxy-3- (3- {2oxo-2-phenyl-ethoxy} -phenyl) -propionic acid ethyl ester

2-bromo-1-phenyl-ethanone (26 mg, 0.13 mmol) and 45 mg of the title compound was obtained in 97% yield from Preparation Example 3 from 2-ethoxy-3- (3-hydroxy-phenyl) -propionic acid ethyl ester (30 mg, 0.13 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.02 ~ 7.99 (2H, m), 7.64 ~ 7.60 (1H, m), 7.52 ~ 7.49 (2H, m), 7.22 ~ 7.18 (1H, m), 6.89 ~ 6.80 (3H, m), 5.26 (2H, s ), 4.18 (2H, q, J = 8 Hz), 3.99-3.98 (1H, m), 3.61-3.57 (1H, m), 3.36-3.32 (1H, m), 2.98-2.96 (2H, m), 1.22 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 357 (M ⁺ +1)

Preparation Example 18 Preparation of 2-Ethoxy-3- (3- {2- (ethoxyimino) -2-phenyl-ethoxy} -phenyl) -propionic acid ethyl ester

O-ethyl hydroxyamine hydrochloride (3 mg, 0.03 mmol) and 2-ethoxy-3- (3- {2oxo-2-phenyl-ethoxy} -phenyl) -propionic acid ethyl ester (11 mg, 0.03 mmol) Using Preparation Example 4 from 12 mg of the title compound was obtained in 100% yield.

Mass (EI) 400 (M ⁺ +1)

[ Example  24] 2- Ethoxy -3- (3- {2- ( Ethoxyimino )-2- Phenyl - Ethoxy }- Phenyl ) -Propionic acid

Titled using Example 1 from 2-ethoxy-3- (3- {2- (ethoxyimino) -2-phenyl-ethoxy} -phenyl) -propionic acid ethyl ester (12 mg, 0.03 mmol) 10 mg of compound was obtained in 89% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.68 ~ 7.65 (2H, m), 7.35 ~ 7.32 (3H, m), 7.20 ~ 7.16 (1H, m), 6.84 ~ 6.80 (3H, m), 5.21 (2H, s), 4.31 (2H, q, J = 8 Hz), 4.07-4.04 (1H, m), 3.56-3.52 (1H, m), 3.42-3.38 (1H, m), 3.12-3.08 (1H, m), 2.95-2.90 (1H, m), 1.39 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 372 (M ⁺ +1)

[Production Example 19] Methanesulfonic acid 2- (benzyloxyimino) -propyl ester

(One) 1-hydroxy-propan-2-one O-benzyl- Oxime

2.5 g of the title compound were obtained in 100% yield from hydroxy-propan-2-one (1 g, 13.4 mmol) and O-benzylhydridoamine hydrochloride (2.2 g, 13.7 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.36-7.27 (5H, m), 5.11 (2H, s), 4.26 (2H, s), 1.87 (3H, s)

Mass (EI) 180 (M ⁺ +1)

(2) Methanesulfonic acid  2-( Benzyloxyimino ) -Propyl ester

1-hydroxy-propan-2-one O-benzyl-oxime (200 mg, 1.11 mmol) was dissolved in 2 mL of dichloromethane and triethylamine (0.13 ml, 1.7 mmol) was added. Mesyl chloride (0.31 ml, 2.2 mmol) was added to the reaction solution and reacted for 1 hour. After the reaction, 10 mL of ethyl acetate was added, and the organic layer was washed twice with 5 mL of water. The organic layer was dried over anhydrous magnesium sulfate, filtered and the solvent was removed to give 210 mg of the title compound in 73% yield.

Mass (EI) 258 (M ⁺ +1)

[Production Example 20] Preparation of 3- (3- {2- (benzyloxyimino) -propoxy} -phenyl) -2-ethoxy-propionic acid ethyl ester

Preparation Example 3 from methanesulfonic acid 2- (benzyloxyimino) -propyl ester (16 mg, 0.062 mmol) and 2-ethoxy-3- (3-hydroxy-phenyl) -propionic acid ethyl ester (15 mg, 0.06 mmol) To give 20 mg of the title compound in 80% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.38 ~ 7.30 (5H, m), 7.18 ~ 7.14 (1H, m), 6.85 ~ 6.77 (3H, m), 5.14 (2H, s), 4.52 (2H, s), 4.18 (2H, q, J = 8Hz ), 4.01 to 3.98 (1H, m), 3.62 to 3.58 (1H, m), 3.37 to 3.33 (1H, m), 2.97 to 2.95 (2H, m), 1.98 (3H, s), 1.24 (3H, t , J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 400 (M ⁺ +1)

[ Example  25] 3- (3- {2- ( Benzyloxyimino )- Propoxy }- Phenyl )-2- Ethoxy Propionic acid

80% of the title compound 15 mg was obtained by using Example 1 from 3- (3- {2- (benzyloxyimino) -propoxy} -phenyl) -2-ethoxy-propionic acid ethyl ester (20 mg, 0.05 mmol). Obtained in yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.37 ~ 7.30 (5H, m), 7.19 ~ 7.15 (1H, m), 6.86 ~ 6.78 (3H, m), 5.13 (2H, s), 4.52 (2H, s), 4.05 (2H, q, J = 8Hz ), 3.61-3.57 (1H, m), 3.44-3.40 (1H, m), 3.10-3.05 (1H, m), 2.97-2.92 (2H, m), 1.98 (3H, s), 1.14 (3H, t , J = 8 Hz)

Mass (EI) 372 (M ⁺ +1)

[Production Example 21] 3- (4- {2- (benzyloxyimino) -propoxy} -phenyl) -2- (2-propoxy) -propionic acid Methyl ester  Produce

Methanesulfonic acid 2- (benzyloxyimino) -propyl ester (11 mg, 0.042 mmol and 2- (2-propoxy ) -3- (4-hydroxy-phenyl) -propionic acid methyl ester (10 mg, 0.04 mmol) 15 mg of the title compound was obtained in 86% yield using Preparation Example 3 from

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.38-7.30 (5H, m), 7.13-7.06 (2H, m), 6.84-6.76 (2H, m), 5.13 (2H, s), 4.51 (2H, s), 4.03-4.00 (1H, m), 3.71 (3H, s), 3.52-3.47 (1H, m), 2.96-2.84 (1H, m), 2.61-2.59 (1H, m), 1.98 (3H, s), 1.24 (3H, t, J = 6 Hz ), 1.14 (3H, t, J = 6 Hz)

Mass (EI) 400 (M ⁺ +1)

[ Example  26] 3- (4- {2- ( Benzyloxyimino )- Propoxy }- Phenyl ) -2- (2- Propoxy ) -Propionic acid

Title compound 13 using Example 1 from 3- (4- {2- (benzyloxyimino) -propoxy} -phenyl) -2- (2-propoxy) -propionic acid methyl ester (15 mg, 0.03 mmol) mg was obtained in 93% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.38 ~ 7.29 (5H, m), 7.14 ~ 7.07 (2H, m), 6.85 ~ 6.77 (2H, m), 5.13 (2H, s), 4.51 (2H, s), 4.10 ~ 4.07 (1H, m), 3.56 to 3.50 (1H, m), 2.92 to 2.85 (1H, m), 2.67 to 2.63 (1H, m), 1.98 (3H, s), 1.16 (3H, d, J = 8 Hz), 1.01 (3H, d , J = 8 Hz)

Mass (EI) 386 (M ⁺ +1)

[Production Example 22] 2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid Ethyl ester  Produce

2-bromo-1- (3-phenyl-isoxazol-5-yl) -ethanone O-ethyl-oxime (484 mg, 1.56 mmol) and 2-ethoxy-3- (3-hydroxy-phenyl 646 mg of the title compound was obtained in 88% yield using Preparation 3 from) -propionic acid ethyl ester (373 mg, 1.56 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.83-7.80 (2H, m), 7.48-7.40 (3H, m), 7.22-7.18 (1H, m), 6.97 (1H, s), 6.89-6.82 (2H, m), 5.15 (2H, s), 4.41 (2H, q, J = 7.2 Hz), 4.15 (2H, q, J = 7.2 Hz), 4.00-3.97 (1H, m), 3.61-3.57 (1H, m), 3.34-3.30 (1H, m) , 2.97 (2H, d, H = 5.6 Hz), 1.41 (3H, t, J = 6.8 Hz), 1.20 (3H, t, J = 7.2 Hz), 1.13 (3H, t, J = 6.8 Hz)

Mass (EI) 467 (M ⁺ +1)

[ Example  27] 2- Ethoxy -3- (3- {2- ( Ethoxyimino ) -2- (4- Phenyl - Oxazole -2 days)- Ethoxy } -Phenyl) -propionic acid

2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid ethyl ester (646 mg, 1.38 mmol) Example 1 was used to obtain 270 mg of the title compound in 44% yield.

NMR: Na Form ¹ H-NMR (CDCl ₃ ) δ 7.70 ~ 7.66 (2H, m), 7.40 ~ 7.30 (2H, m), 7.00 ~ 6.97 (2H, m), 6.84 (1H, s), 6.80 ~ 6.75 (2H, m), 6.64 (1H, d, J = 7.5 Hz), 4.93 (2H, s), 4.26 (2H, q, J = 7.5 Hz), 3.79-3.77 (1H, m), 3.33-3.30 (1H, m), 3.01 (2H, d, J = 12 Hz), 2.75 to 2.70 (1H, m), 1.25 (3H, t, J = 6.5 Hz), 0.83 (3H, t, J = 7.0 Hz)

Mass (EI) 439 (M ⁺ +1)

[Manufacture example 23] 2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid Ethyl ester  Produce

2-bromo-1- (3-phenyl-isoxazol-5-yl) -ethanone O-ethyl-oxime (220 mg, 0.71 mmol) and 2-ethoxy-3- (4-hydroxy-phenyl 231 mg of the title compound was obtained in 69% yield from Preparative Example 3 from) -propionic acid ethyl ester (170 mg, 0.71 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.81-7.80 (2H, m), 7.45-7.40 (3H, m), 7.15 (2H, d, J = 8 Hz), 6.97 (1H, s), 6.87 (2H, d, J = 8.5 Hz), 5.14 ( 2H, s), 4.41 (2H, q, J = 7.0 Hz), 4.15 (2H, q, J = 7.0 Hz), 3.96-3.93 (1H, m), 3.58-3.57 (1H, m), 3.34-3.31 (1H, m), 2.94 (2H, d, J = 7 Hz), 1.38 (3H, t, J = 7.0 Hz), 1.19 (3H, t, J = 7 Hz), 1.16 (3H, t, J = 7.0 Hz )

Mass (EI) 467 (M ⁺ +1)

[ Example  28] 2- Ethoxy -3- (4- {2- ( Ethoxyimino ) -2- (4- Phenyl - Oxazole -2 days)- Ethoxy } -Phenyl) -propionic acid

2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid ethyl ester (231 mg, 0.49 mmol Example 1 was used to obtain 152 mg of the title compound in 70% yield.

NMR: ¹ H-NMR (DMSO-d6) δ 7.93 ~ 7.91 (2H, m), 7.53 ~ 7.51 (3H, m), 7.48 (1H, s), 7.13 (2H, d, J = 8 Hz), 6.87 (2H, d, J = 8 Hz), 5.12 (2H , s), 4.33 (2H, q, J = 8.0 Hz), 3.59-3.55 (1H, m), 3.53-3.46 (1H, m), 3.12-3.04 (1H, m), 2.84-2.80 (1H, m ), 2.61 to 2.55 (1H, m), 1.32 (3H, t, J = 8.0 Hz), 0.95 (3H, t, J = 8 Hz)

Mass (EI) 439 (M ⁺ +1)

[Manufacture example 24] 2-ethoxy-3- (3- {2- (ethoxyimino) -2- (4-trifluoromethyl-phenyl) -ethoxy}- Phenyl ) -Propionic acid Ethyl ester  Produce

2-Bromo-1- (4-trifluoromethyl-phenyl) -ethanone O-ethyl-oxime (50 mg, 0.16 mmol) and 2-ethoxy-3- (3-hydroxy-phenyl) -propionic acid 53 mg of the title compound was obtained in 70% yield using Preparation Example 3 from ethyl ester (39 mg, 0.16 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.80 (2H, d, J = 8Hz), 7.59 (2H, d, J = 8.4Hz), 7.18 ~ 7.15 (1H, m), 6.84 (1H, d, J = 7.6Hz), 6.80 ~ 6.75 (2H, m), 5.21 (2H, s), 4.33 (2H, q, J = 7.2 Hz), 4.15 (2H, q, J = 7.2 Hz), 3.98-3.95 (1H, m), 3.60-3.56 (1H, m ), 3.34 to 3.29 (1H, m), 2.94 (2H, d, J = 8 Hz), 1.37 (3H, t, J = 7.2 Hz), 1.24 (3H, t, J = 8 Hz), 1.13 (3H, t , J = 7.2 Hz)

Mass (EI) 468 (M ⁺ +1)

[ Example  29] 2- Ethoxy -3- (3- {2- ( Ethoxyimino ) -2- (4- Phenyl - Oxazole -2 days)- Ethoxy } -Phenyl) -propionic acid

2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid ethyl ester (53 mg, 0.11 mmol 33 mg of the title compound was obtained in 68% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.79 (2H, d, J = 8.4 Hz), 7.59 (2H, d, J = 8.4 Hz), 7.20-7.16 (1H, m), 6.85 (1H, d, J = 8 Hz), 6.79-6.68 (2H, m), 5.22 (2H, s), 4.32 (2H, q, J = 8 Hz), 4.06-4.03 (1H, m), 3.58-3.54 (1H, m), 3.42-3.37 (1H, m), 3.11- 3.07 (1H, m), 2.96 to 2.91 (1H, m), 1.38 (3H, t, J = 8 Hz), 1.13 (3H, t, J = 8 Hz)

Mass (EI) 440 (M ⁺ +1)

Production Example 25 2-Bromo-1- (5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime

(One) 3- Bromo -2- Ethoxyimino Preparation of Propionic Acid

3.4 g of the title compound was prepared in 81% yield using Preparation 4 from 3-bromo-2-oxo-propionic acid (3.33 g, 19.9 mmol) and O-ethoxyhydroxyamine hydrochloride (1.95 g, 19.9 mmol). Got it.

NMR: ¹ H-NMR (CDCl ₃ ) δ 4.45 (2H, q, J = 6.8 Hz), 4.19 (2H, s), 1.39 (3H, 7.2 Hz)

Mass (EI) 211 (M ⁺ +1)

(2) 4- Floro - Benzoic  Acid N- (3- Bromo -2- Ethoxyimino - Propionyl )- Hydrazide  of Production Example

4-fluorobenzhydrazide hydrochloride (950 mg, 5.0 mmol) and 3-bromo-2-ethoxyimino-propionic acid (1.05 g, 4.99 mmol) were dissolved in 30 ml of dichloromethane and then triethylamine (2.1 ml) , 15 mmol) and 2-chloro-1,3-dimethylimidazolinium chloride (850 mg, 5.0 mmol) were added to 0 ° C. and stirred for 10 minutes, and then the temperature was raised to room temperature, followed by stirring for 3 hours. 100 ml of ethyl acetate was added and the organic layer was washed twice with water. The organic layer is dried over anhydrous magnesium sulfate and filtered to remove the solvent. The filtrate was purified by column chromatography to give 900 g of the title compound in 52% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.88 ~ 7.84 (2H, m), 7.17 ~ 7.13 (2H, m), 4.42 ~ 4.35 (4H, m), 1.39 (3H, 7.2 Hz)

Mass (EI) 347 (M ⁺ +1)

( 3) Preparation of 2-bromo-1- (5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime

4-Fluoro-benzoic acid N- (3-bromo-2-ethoxyimino-propionyl) -hydrazide (610 mg, 1.76 mmol) was dissolved in 10 mL of dichloromethane and triethylamine (0.49 ml, 3.5 mmol) and 2-chloro-1,3-dimethylimidazolinium chloride (300 mg, 1.77 mmol) were added to 0 ° C., stirred for 10 minutes, and then heated to room temperature, followed by stirring for 3 hours. 100 mL of ethyl acetate was added and the organic layer was washed twice with water. The organic layer was dried over anhydrous magnesium sulfate and filtered to remove the solvent. The filtrate was purified by column chromatography to give 452 mg of the title compound in 77% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.18-8.14 (2H, m), 7.24-7.20 (2H, m), 4.67 (2H, s), 4.48 (2H, q, J = 8 Hz), 1.43 (3H, 8 Hz)

Mass (EI) 329 (M ⁺ +1)

Production Example 26 2-Bromo-1- (5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-propyl-oxime

(One) 3- Bromo -2- Propoxyimino Preparation of Propionic Acid

1.4 g of the title compound was obtained in 67% yield using Preparation 4 from 3-bromo-2-oxo-propionic acid (1.67 g, 10 mmol) and O-propylhydroxyamine hydrochloride (1.1 g, 9.86 mmol). Got it.

NMR: ¹ H-NMR (CDCl ₃ ) δ 4.14 (4H, m), 4.19 (2H, s), 1.69-1.64 (2H, m), 0.93 (3H, 8 Hz)

Mass (EI) 225 (M ⁺ +1)

(2) Preparation of 4-fluoro-benzoic acid N- (3-bromo-2-propoxyimino-propionyl) -hydrazide

4-Florobenzhydrazide hydrochloride (765 mg, 4.0 mmol) and 3-bromo-2-proposimino-propionic acid (900 mg, 4.01 mmol) were dissolved in 30 mL of dichloromethane and then triethylamine (1.67 ml). , 11.9 mmol) and 2-chloro-1,3-dimethylimidazolinium chloride (680 mg, 4.0 mmol) were added to 0 ° C., stirred for 10 minutes, and then heated to room temperature, followed by stirring for 3 hours. 100 mL of ethyl acetate was added and the organic layer was washed twice with water. The organic layer was dried over anhydrous magnesium sulfate, filtered and the solvent was removed. The filtrate was purified by column chromatography to obtain 900 g of the title compound in 62% yield.

Mass (EI) 361 (M ⁺ +1)

(3) 2- Bromo -1- (5- (4- Floro - Phenyl )-[1,3,4] Oxadiazole -2 days)- Ethanon  O-propyl- jade Deliberation

4-Fluoro-benzoic acid N- (3-bromo-2-propoxyimino-propionyl) -hydrazide (900 mg, 2.5 mmol) was dissolved in 30 mL of dichloromethane and triethylamine (0.7 ml , 5.02 mmol) and 2-chloro-1,3-dimethylimidazolinium chloride (420 mg, 2.48 mmol) were added to 0 ° C., stirred for 10 minutes, and then heated to room temperature, followed by stirring for 3 hours. 100 mL of ethyl acetate was added and the organic layer was washed twice with water. The organic layer was dried over anhydrous magnesium sulfate, filtered and the solvent was removed, and the filtrate was purified by column chromatography to obtain 823 mg of the title compound in 97% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.18-8.14 (2H, m), 7.24-7.20 (2H, m), 4.68 (2H, s), 4.38 (2H, t, J = 8 Hz), 1.86-1.80 (2H, m), 1.03 (3H, 8 Hz )

Mass (EI) 343 (M ⁺ +1)

[Production Example 27] 2-ethoxy-3- (3- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- Methoxy-phenyl] -propionic acid Ethyl ester  Produce

2-bromo-1- (5- (4 - fluoro - phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime (210 mg, 0.63 mmol) and 260 mg of the title compound was obtained in 86% yield using Preparation Example 3 from 2-ethoxy-3- (3-hydroxy-phenyl) -propionic acid ethyl ester (150 mg, 0.62 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15 ~ 8.11 (2H, m), 7.26 ~ 7.17 (3H, m), 6.90 ~ 6.86 (3H, m), 5.22 (2H, s), 4.44 (2H, q, J = 7.2Hz), 4.19 ~ 4.13 ( 2H, m), 4.00-3.97 (1H, m), 3.63-3.55 (1H, m), 3.38-3.30 (1H, m), 2.97 (2H, d, J = 6 Hz), 1.40 (3H, t, J = 7.2 Hz), 1.21 (3H, t, J = 7.2 Hz), 1.15 (3H, t, J = 7.2 Hz)

Mass (EI) 486 (M ⁺ +1)

[ Example  30] 2- Ethoxy -3- (3- [2- ( Ethoxyimino ) -2- {5- (4- Floro - Phenyl )-[1,3,4] Oksa Diazol-2-yl} -ethoxy-phenyl] -propionic acid

2-ethoxy-3- (3- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- 240 mg of the title compound was obtained in 99% yield using Example 1 from oxy-phenyl] -propionic acid ethyl ester (260 mg, 0.53 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15 ~ 8.11 (2H, m), 7.24 ~ 7.19 (3H, m), 6.89 ~ 6.87 (3H, m), 5.23 (2H, s), 4.46 (2H, q, J = 7.2Hz), 4.13 ~ 4.06 ( 1H, m), 3.62-3.54 (1H, m), 3.48-3.37 (1H, m), 3.12-3.08 (1H, m), 2.99-2.94 (1H, m), 1.40 (3H, t, J = 7.2 Hz), 1.16 (3H, t, J = 6.8 Hz)

Mass (EI) 458 (M ⁺ +1)

Production Example 28 2-ethoxy-3- (4- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxa diazol-2-yl}- Methoxy-phenyl] -propionic acid Ethyl ester  Produce

2-bromo-1- (5- (4 - fluoro - phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime (210 mg, 0.63 mmol) and 260 mg of the title compound was obtained in 85% yield using Preparation 3 from 2-ethoxy-3- (4-hydroxy-phenyl) -propionic acid ethyl ester (150 mg, 0.62 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15-8.11 (2H, m), 7.26-7.15 (4H, m), 6.93-6.70 (2H, m), 5.22 (2H, s), 4.45 (2H, q, J = 6.8 Hz), 4.16 (2H, q, J = 7.2 Hz), 3.97 to 3.94 (1H, m), 3.61 to 3.55 (1H, m), 3.38 to 3.30 (1H, m), 2.95 (2H, d, J = 8 Hz), 1.39 (3H, t, J = 6.8 Hz), 1.22 (3H, t, J = 7.2 Hz), 1.15 (3H, t, J = 6.8 Hz)

Mass (EI) 486 (M ⁺ +1)

[ Example  31] 2- Ethoxy -3- (4- [2- ( Ethoxyimino ) -2- {5- (4- Floro - Phenyl )-[1,3,4] Oksa Diazol-2-yl} -ethoxy-phenyl] -propionic acid

2-ethoxy-3- (4- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- 240 mg of the title compound was obtained in 99% yield using Example 1 from oxy-phenyl] -propionic acid ethyl ester (260 mg, 0.53 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15 ~ 8.12 (2H, m), 7.26 ~ 7.15 (4H, m), 6.94 ~ 6.92 (2H, m), 5.22 (2H, s), 4.46 (2H, t, J = 8Hz), 4.13 ~ 4.03 (1H , m), 3.62 to 3.55 (1H, m), 3.49 to 3.42 (1H, m), 3.10 to 3.06 (1H, m), 2.98 to 2.92 (1H, m), 1.39 (3H, t, J = 7.2 Hz ), 1.17 (3H, t, J = 7.2 Hz)

Mass (EI) 458 (M ⁺ +1)

[Manufacture example 29] 2-ethoxy-3- (3- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e Methoxy} -phenyl) -propionic acid Ethyl ester  Produce

2-bromo-1- (5- (4 - fluoro - phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime (215 mg, 0.62 mmol) and 230 mg of the title compound was obtained in 46% yield using Preparation 3 from 2-ethoxy-3- (3-hydroxy-phenyl) -propionic acid ethyl ester (150 mg, 0.62 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15 ~ 8.12 (2H, m), 7.23 ~ 7.17 (3H, m), 6.89 ~ 6.86 (3H, m), 5.22 (2H, s), 4.36 (2H, t, J = 6.8Hz), 4.19 ~ 4.13 ( 2H, m), 4.00-3.97 (1H, m), 3.63-3.55 (1H, m), 3.38-3.30 (1H, m), 2.96 (2H, d, J = 8 Hz), 1.81 (2H, q, J = 6.8 Hz), 1.23 (3H, t, J = 7.2 Hz), 1.15 (3H, t, J = 7.2 Hz), 1.00 (3H, t, J = 7.8 Hz)

Mass (EI) 500 (M ⁺ +1)

[ Example  32] 2- Ethoxy -3- (3- {2- [5- (4- Floro - Phenyl )-[1,3,4] Oxadiazole -2- day] -2- ( F Lopoxyimino) -ethoxy} -phenyl) -propionic acid

2-ethoxy-3- (3- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e 220 mg of the title compound was obtained in 100% yield using Example 1 from oxy} -phenyl) -propionic acid ethyl ester (230 mg, 0.46 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15 ~ 8.11 (2H, m), 7.23 ~ 7.19 (3H, m), 6.89 ~ 6.87 (3H, m), 5.23 (2H, s), 4.36 (2H, t, J = 8Hz), 4.11 ~ 4.06 (1H , m), 3.60-3.56 (1H, m), 3.47-3.43 (1H, m), 3.10-3.09 (1H, m), 3.00-2.94 (1H, m), 1.81 (2H, q, J = 8 Hz) , 1.15 (3H, t, J = 8 Hz), 1.00 (3H, t, J = 8 Hz)

Mass (EI) 472 (M ⁺ +1)

Production Example 30 2-ethoxy-3- (4- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e Methoxy} -phenyl) -propionic acid Ethyl ester  Produce

2-bromo-1- (5- (4 - fluoro - phenyl)-[1,3,4] oxadiazol-2-yl) -ethanone O-ethyl-oxime (215 mg, 0.62 mmol) and 260 mg of the title compound was obtained in 84% yield using Preparation 3 from 2-ethoxy-3- (4-hydroxy-phenyl) -propionic acid ethyl ester (150 mg, 0.63 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15-8.11 (2H, m), 7.23-7.15 (4H, m), 6.93-6.70 (2H, m), 5.22 (2H, s), 4.45 (2H, t, J = 8 Hz), 4.16 (2H, q , J = 8 Hz), 3.61 to 3.57 (1H, m), 3.36 to 3.32 (1H, m), 2.95 to 2.94 (2H, m), 1.39 (3H, t, 8 Hz), 1.22 (3H, t, J = 8 Hz), 1.16 (3H, t, J = 8 Hz)

Mass (EI) 500 (M ⁺ +1)

[ Example  33] 2- Ethoxy -3- (4- {2- [5- (4- Floro - Phenyl )-[1,3,4] Oxadiazole -2- day] -2- ( F Lopoxyimino) -ethoxy} -phenyl) -propionic acid

2-ethoxy-3- (4- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e 240 mg of the title compound was obtained in 97% yield using Example 1 from oxy} -phenyl) -propionic acid ethyl ester (260 mg, o.52 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.15 ~ 8.12 (2H, m), 7.23 ~ 7.14 (4H, m), 6.95 ~ 6.92 (2H, m), 5.22 (2H, s), 4.36 (2H, t, J = 6.4Hz), 4.06 ~ 4.04 ( 1H, m), 3.60-3.54 (1H, m), 3.49-3.45 (1H, m), 3.11-3.06 (1H, m), 2.97-2.92 (1H, m), 1.80 (2H, m, 7.2 Hz) , 1.21 (3H, t, J = 6.8 Hz), 1.00 (3H, t, J = 7.6 Hz)

Mass (EI) 472 (M ⁺ +1)

Preparation Example 31 2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-trifluoromethyl-phenyl) -ethoxy} -phenyl) -propionic acid Ethyl ester  Produce

2-Bromo-1- (4-trifluoromethyl-phenyl) -ethanone O-ethyl-oxime (50 mg, 0.16 mmol) and 2-ethoxy-3- (4-hydroxy-phenyl) -propionic acid 53 mg of the title compound was obtained in 70% yield using Preparation Example 3 from ethyl ester (39 mg, 0.16 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.79 (2H, d, J = 8 Hz), 7.58 (2H, d, J = 8.4 Hz), 7.12 (2H, d, J = 8.8 Hz), 6.84 (2H, d, J = 8.4 Hz), 5.21 (2H , s), 4.33 (2H, q, J = 6.8 Hz), 4.14 (2H, q, J = 7.2 Hz), 3.96-3.93 (1H, m), 3.61-3.57 (1H, m), 3.35-3.31 ( 1H, m), 2.93 (2H, d, J = 6.4 Hz), 1.36 (3H, t, J = 6.8 Hz), 1.21 (3H, t, J = 6.8 Hz), 1.14 (3H, t, J = 7.2 Hz)

Mass (EI) 468 (M ⁺ +1)

[ Example  34] 2- Ethoxy -3- (4- {2- ( Ethoxyimino ) -2- (4- Phenyl - Oxazole -2 days)- Ethoxy } -Phenyl) -propionic acid

2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid ethyl ester (53 mg, 0.11 mmol 33 mg of the title compound was obtained in 68% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.78 (2H, d, J = 8.0 Hz), 7.58 (2H, d, J = 9 Hz), 7.12 (2H, d, J = 8.5 Hz), 6.82 (2H, d, J = 6.5 Hz), 5.20 (2H , s), 4.31 (2H, q, J = 7.5 Hz), 4.04-4.03 (1H, m), 3.58-3.55 (1H, m), 3.46-3.44 (1H, m), 3.08-3.04 (1H, m ), 2.95 to 2.90 (1H, m), 1.36 (3H, t, J = 7 Hz), 1.15 (3H, t, J = 7 Hz)

Mass (EI) 440 (M ⁺ +1)

[ Production Example  32] 3- Bromo -2-( Propoxyimino ) -Propionic acid Ethyl ester  Produce

440 mg of the title compound was obtained in 34% yield using Preparation Example 1 from 3-bromo-2-oxo-propionic acid ethyl ester (971 mg, 4.97 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 4.40 ~ 4.31 (4H, m), 4.23 (2H, s), 2.06 ~ 1.72 (2H, m), 1.35 (3H, t, J = 8Hz), 0.97 (3H, t, J = 8Hz)

Mass (EI) 253 (M ⁺ +1)

[ Production Example  33] 3- Acetoxy -2-( Propoxyimino ) -Propionic acid Ethyl ester  Produce

3-bromo-2- (propoxyimino) -propionic acid ethyl ester (420 mg, 1.66 mmol) was dissolved in 5 mL of dimethylformamide and sodium acetate was added thereto. After heating at 80 ° C. for 5 hours, ethyl acetate was added and extracted. The extracted solution was dried over anhydrous magnesium sulfate and concentrated to give 257 mg of the title compound in 67% yield using column chromatography.

NMR: ¹ H-NMR (CDCl ₃ ) δ 4.98 (2H, s), 4.35 (2H, q, 8 Hz), 4.28 (2H, t, 8 Hz), 2.06 (3H, s), 1.76-1.60 (2H, m), 1.35 (3H, t, J = 8 Hz ), 0.95 (3H, t, J = 8 Hz)

Mass (EI) 232 (M ⁺ +1)

[ Production Example  34] 3-hydroxy-2- ( Propoxyimino ) -Propionic acid Ethyl ester  Produce

163 mg of the title compound was obtained in 91% yield using Example 1 from 3-acetoxy-2- (propoxyimino) -propionic acid ethyl ester (257 mg, 1.11 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 4.58 (2H, s), 4.26 (2H, t, 6.5 Hz), 1.77-1.72 (2H, m), 0.96 (3H, t, J = 8 Hz)

Mass (EI) 162 (M ⁺ +1)

[ Production Example  35] 3- (t-butyl-dimethyl- Silanyloxy )-2-( Propoxyimino ) -Propionic Produce

3-hydroxy-2- (propoxyimino) -propionic acid ethyl ester (110 mg, 0.67 mmol) was dissolved in 3 mL of dimethylformamide, imidazole (232 mg, 3.40 mmol) was added, and the temperature was decreased to -30 ° C. Lowered. t-butyldimethylsilyl chloride (257 mg, 1.70 mmol) was added thereto, stirred for 1 hour, and then water was added thereto. Extracted with ethyl acetate, dried over anhydrous magnesium sulfate and concentrated. The solution was dissolved in 2 mL of methanol, and potassium carbonate (20 mg, 0.14 mmol) was added thereto, followed by stirring for 2 hours. Ethyl acetate was added, the mixture was washed with 1N aqueous hydrochloric acid solution, the organic layer was dried and concentrated to give 69 mg of the title compound in 39% yield using column chromatography.

NMR: ¹ H-NMR (CDCl ₃ ) δ 4.46 (2H, s), 4.13 (2H, t, 8 Hz), 1.65-1.60 (2H, m), 0.84 (3H, t, J = 8 Hz), 0.78 (9H, s), 0.01 (6H, s)

Mass (EI) 261 (M ⁺ +1)

[Manufacture example 36] 2- (t-butyl-dimethyl-silanyloxy) -1- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -ethanone O-propyl- Oxime  Produce

3- (t-Butyl-dimethyl-silanyloxy) -2- (propoxyimino) -propionic acid (69 mg, 0.25 mmol) and 4-fluoro-N-hydroxy-benzamidine (39 mg, 0.25 mmol ) Was dissolved in 1 mL of dimethylformamide and heated to 100 ° C. and stirred for 6 hours. Ethyl acetate was added, washed with water, dried over anhydrous magnesium sulfate and concentrated. This solution was purified by column chromatography to obtain 40 mg of the title compound in 40% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.04-8.00 (2H, m), 7.07-7.03 (2H, m), 4.71 (2H, s), 4.21 (2H, t, 8 Hz), 1.70-1.65 (2H, m), 0.87 (3H, t, J = 8 Hz), 0.75 (9H, s), 0.01 (6H, s)

Mass (EI) 394 (M ⁺ +1)

[Manufacture example 38] Preparation of 1- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-hydroxy-ethanone O-propyl-oxime

2- (t-butyl-dimethyl-silanyloxy) -1- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -ethanone O-propyl- Oxime (40 mg, 0.1 mmol) was dissolved in 1 mL of tetrahydrofuran, and tetrabutylamonium fluoride (0.3 ml, 0.3 mmol) was added dropwise at room temperature, followed by stirring for 3 hours. Ethyl acetate was added to the reaction solution, washed with water, dried over anhydrous magnesium sulfate and concentrated. This solution was purified by column chromatography to obtain 30 mg of the title compound in 100% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.11 to 8.09 (2H, m), 7.19 to 7.15 (2H, m), 4.84 (2H, s), 4.35 (2H, t, 7 Hz), 1.82 to 1.79 (2H, m), 0.99 (3H, t, J = 9 Hz)

Mass (EI) 280 (M ⁺ +1)

[Manufacture example 39] Preparation of methanesulfonic acid 2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethyl ester

From 1- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-hydroxy-ethanone O-propyl-oxime (30 mg, 0.1 mmol) Preparation 1 was used to obtain 30 mg of the title compound in 84% yield.

Mass (EI) 358 (M ⁺ +1)

[Manufacture example 40] 2-ethoxy-3- (4- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid Ethyl ester  Produce

Methanesulfonic acid 2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethyl ester (15 mg, 0.042 mmol) and 2- 11 mg of the title compound was obtained in 52% yield from Preparation Example 3 from ethoxy-3- (4-hydroxy-phenyl) -propionic acid ethyl ester (13 mg, 0.054 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.86-7.80 (2H, m), 7.47-7.44 (2H, m), 7.16 (2H, d, J = 8.4 Hz), 6.88 (2H, d, J = 8.8 Hz), 5.14 (2H, s), 4.40 (2H, t, J = 6.8 Hz), 4.17 to 4.09 (2H, q, J = 6.0 Hz), 3.97 to 3.94 (1H, m), 3.61 to 3.57 (1H, m), 3.36 to 3.32 (1H, m ), 2.95 (2H, d, J = 6 Hz), 1.39 (3H, t, J = 7.2 Hz), 1.20 (3H, t, J = 6.8 Hz), 1.15 (3H, t, J = 6.4 Hz)

Mass (EI) 500 (M ⁺ +1)

Example 35 2-ethoxy-3- (4- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid Ethyl ester  Produce

2-ethoxy-3- (4- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} 11 mg of the title compound was obtained in 100% yield using Example 1 from -phenyl) -propionic acid ethyl ester (11 mg, 0.022 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 ~ 8.10 (2H, m), 7.24 ~ 7.14 (4H, m), 6.93 ~ 6.90 (2H, m), 5.20 (2H, s), 4.39 (2H, t, J = 8Hz), 4.07 ~ 4.04 (1H , m), 3.62-3.56 (1H, m), 3.50-3.43 (1H, m), 3.11-3.06 (1H, m), 2.99-2.93 (1H, m), 1.86-1.77 (2H, m), 1.16 (3H, t, J = 8 Hz), 1.00 (3H, t, J = 8 Hz)

Mass (EI) 472 (M ⁺ +1)

Production Example 41 2-ethoxy-3- (3- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid Ethyl ester  Produce

Methanesulfonic acid 2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethyl ester (15 mg, 0.042 mmol) and 2- 15 mg of the title compound was obtained in 71% yield using Preparation Example 3 from ethoxy-3- (3-hydroxy-phenyl) -propionic acid ethyl ester (13 mg, 0.054 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 ~ 8.11 (2H, m), 7.26 ~ 7.14 (3H, m), 6.90 ~ 6.84 (3H, m), 5.20 (2H, s), 4.40 (2H, t, J = 6.8Hz), 4.19 ~ 4.13 ( 2H, m), 4.00-3.97 (1H, m), 3.61-3.57 (1H, m), 3.35-3.31 (1H, m), 2.98-2.96 (2H, m), 1.81 (2H, m, J = 7.2 Hz), 1.21 (3H, t, J = 7.2 Hz), 1.15 (3H, t, J = 6.8 Hz), 0.99 (3H, t, J = 7.6 Hz)

Mass (EI) 500 (M ⁺ +1)

Example 36 2-ethoxy-3- (3- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid Ethyl ester  Produce

2-ethoxy-3- (3- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} 2.4 mg of the title compound was obtained in 23% yield using Example 1 from -phenyl) -propionic acid ethyl ester (15 mg, 0.022 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14-8.10 (2H, m), 7.24-7.14 (3H, m), 6.90-6.88 (3H, m), 5.21 (2H, s), 4.41 (2H, q, J = 8 Hz), 4.09-4.06 (1H , m), 3.60-3.54 (1H, m), 3.47-3.42 (1H, m), 3.14-3.09 (1H, m), 2.99-2.94 (1H, m), 1.87-1.78 (2H, m), 1.14 (3H, t, J = 8 Hz), 1.00 (3H, t, J = 8 Hz)

Mass (EI) 472 (M ⁺ +1)

[ Production Example  42] (1Z) -2- Bromo -1- [5- (4- Chlorophenyl ) -1,3,4- Oxadiazole -2 days] Ethanon  O- Ethyl oxime

60 mg (17% yield) of the title compound from 4-chlorobenzhydrazide hydrochloride (207 mg, 1.0 mmol) and 3-bromo-2-ethoxyimino-propionic acid (272m g, 1.0 mmol) using Preparation Example 25 Got.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 to 8.18 (2H, m), 7.53 to 7.51 (2H, m), 4.67 (2H, s), 4.48 (2H, q, J = 8 Hz), 1.42 (3H, J = 8 Hz)

Mass (EI) 344, 346 (M ⁺ +1)

Production Example 43 (±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid Ethyl ester

(1Z) -2-bromo-1- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-ethyl oxime (15 mg, 0.044 mmol) and ( ±) 2-Ethoxy-3- (4-hydroxyphenyl) -propionic acid ethyl ester (10 mg, 0.044 mmol) was used in Preparation 3 to give 20 mg of the title compound in 91% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.07 ~ 8.05 (2H, m), 7.50 ~ 7.48 (2H, m), 7.16 ~ 7.14 (2H, m), 6.92 ~ 6.90 (2H, m), 5.21 (2H, s), 4.44 (2H, q, J = 7.3 Hz), 4.16 (2H, q, J = 7.4 Hz), 3.97-3.94 (1H, m), 3.62-3.56 (1H, m), 3.37-3.31 (1H, m), 2.95-2.93 (2H, m), 1.39 (3H, t, J = 9.3 Hz), 1.21 (3H, t, J = 7.4 Hz), 1.15 (3H, t, J = 6.7 Hz)

Mass (EI) 502 (M ⁺ +1)

[ Example  37] (±) 3- (4-{[(2E) -2- [5- (4- Chlorophenyl ) -1,3,4- Oxadiazole -2- day] -2- ( Ethoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] 15 mg of the title compound was obtained in 79% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ester (20 mg, 0.040 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.07 ~ 8.02 (2H, m), 7.51 ~ 7.47 (2H, m), 7.17 ~ 7.14 (2H, m), 6.90 ~ 6.87 (2H, m), 5.18 (2H, s), 4.41 (2H, t, J = 7.3 Hz), 3.94-3.91 (1H, m), 3.51-3.47 (1H, m), 3.33-3.27 (1H, m), 3.07-3.01 (1H, m), 2.87-2.82 (1H, m), 1.37 (3H, t, J = 7.3 Hz), 1.07 (3H, t, J = 6.7 Hz)

Mass (EI) 474 (M ⁺ +1)

Production Example 44 (±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- ( Methoxyimino) ethyl] oxy} phenyl) -2-ethoxypropionic acid Ethyl ester

(1Z) -2-bromo-1- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-ethyloxime (15 mg, 0.044 mmol) and ( ±) 2-Ethoxy-3- (3-hydroxyphenyl) propionic acid ethyl ester (10 mg, 0.044 mmol) was used in Preparation 3 to obtain 20 mg of the title compound in 91% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.07 ~ 8.05 (2H, m), 7.50 ~ 7.48 (2H, m), 7.20 ~ 7.17 (1H, m), 6.90 ~ 6.85 (3H, m), 5.21 (2H, s), 4.45 (2H, q, J = 7.3 Hz), 4.19-4.13 (2H, m), 4.00-3.97 (1H, m), 3.62-3.56 (1H, m), 3.37-3.31 (1H, m), 2.98-2.95 (2H, m), 1.40 (3H, t, J = 6.7 Hz), 1.21 (3H, t, J = 7.3 Hz), 1.15 (3H, t, J = 6.7 Hz)

Mass (EI) 502 (M ⁺ +1)

[ Example  38] (±) 3- (3-{[(2E) -2- [5- (4- Chlorophenyl ) -1,3,4- Oxadiazole -2- day] -2- ( Ethoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] 15 mg of the title compound was obtained in 79% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ester (20 mg, 0.040 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.08 ~ 8.04 (2H, m), 7.52 ~ 7.48 (2H, m), 7.22 ~ 7.18 (1H, m), 6.90 ~ 6.86 (3H, m), 5.23 (2H, s), 4.46 (2H, q, J = 7.3 Hz), 4.10-4.07 (1H, m), 3.59-3.54 (1H, m), 3.50-3.44 (1H, m), 3.16-3.10 (1H, m), 3.00-2.94 (1H, m), 1.40 (3H, t, J = 7.3 Hz), 1.16 (3H, t, J = 6.7 Hz)

Mass (EI) 474 (M ⁺ +1)

[ Production Example  45] (1Z) -2- Bromo -1- [5- (3- Chlorophenyl ) -1,3,4- Oxadiazole -2 days] Ethanon  O- Ethyl oxime

80 mg (23% yield) of the title compound from 4-chlorobenzhydrazide hydrochloride (207 mg, 1.0 mmol) and 3-bromo-2-ethoxyimino-propionic acid (272m g, 1.0 mmol) using Preparation Example 25 Got.

Mass (EI) 344, 346 (M ⁺ +1)

Preparation Example 46 (±) 3- (4-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- Methoxyimino) ethyl] oxy} phenyl) -2-ethoxypropionic acid Ethyl ester

(1Z) -2-bromo-1- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-ethyloxime (20 mg, 0.058 mmol) and ( ±) 2-Ethoxy-3- (4-hydroxyphenyl) -propionate was obtained from ester (14 mg, 0.058 mmol) in 23 mg to give 23 mg of the title compound in 79% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 (1H, brs), 8.02 (1H, d, J = 8.6 Hz), 7.53 (1H, dd, J = 8.0, 1.2 Hz), 7.46 (1H, t, J = 7.7 Hz), 7.15 (2H, d , J = 8.6 Hz), 6.91 (2H, d, J = 8.6 Hz), 5.21 (2H, s), 4.46 (2H, q, J = 7.3 Hz), 4.15 (2H, q, J = 7.2 Hz), 3.96 (1H, t, J = 6.1Hz), 3.62 ~ 3.56 (1H, m), 3.38 ~ 3.30 (1H, m), 2.95 ~ 2.93 (2H, m), 1.40 (3H, t, J = 7.3Hz) , 1.21 (3H, t, J = 7.2 Hz), 1.15 (3H, t, J = 6.8 Hz)

Mass (EI) 502 (M ⁺ +1)

[ Example  39] (±) 3- (4-{[(2E) -2- [5- (3- Chlorophenyl ) -1,3,4- Oxadiazole -2- day] -2- ( Ethoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] 11 mg of the title compound was obtained in 50% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ester (23 mg, 0.046 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 (1H, t, J = 1.1 Hz), 8.02 (1H, dd, J = 8.0, 1.1 Hz), 7.53 (1H, dd, J = 8.0, 1.1 Hz), 7.46 (1H, t, J = 8.0 Hz ), 7.15 (2H, d, J = 8.6 Hz), 6.92 (2H, d, J = 8.6 Hz), 5.22 (2H, s), 4.46 (2H, q, J = 7.3 Hz), 4.05 (1H, dd , J = 7.4, 4.3 Hz), 3.60 to 3.54 (1H, m), 3.50 to 3.44 (1H, m), 3.09 (1H, abx, J = 14, 4.3 Hz), 3.09 (1H, abx, J = 14 , 7.4 Hz), 1.40 (3H, t, J = 7.3 Hz), 1.18 (3H, t, J = 7.4 Hz)

Mass (EI) 474 (M ⁺ +1)

Production Example 47 (±) 3- (3-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- Methoxyimino) ethyl] oxy} phenyl) -2-ethoxypropionic acid ethyl ether

(1Z) -2-bromo-1- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-ethyloxime (20 mg, 0.058 mmol) and ( 23 mg of the title compound was obtained in a yield of 79% from ± 2.2-ethoxy-3- (3-hydroxyphenyl) -propionic acid ethyl ester (14 mg, 0.058 mmol) using Preparation Example 3.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 (1H, t, J = 1.1 Hz), 8.03 to 8.01 (1H, m), 7.55 to 7.51 (1H, m), 7.48 to 7.44 (1H, m), 7.19 (1H, t, J = 8.0 Hz) , 6.90 to 6.85 (3H, m), 5.22 (2H, s), 4.46 (2H, q, J = 7.4 Hz), 4.20 to 4.12 (2H, m), 3.99 (1H, dd, J = 7.4, 4.3 Hz ), 3.64 to 3.56 (1H, m), 3.38 to 3.31 (1H, m), 2.98 to 2.94 (2H, m), 1.25 (3H, t, J = 7.4 Hz), 1.15 (3H, t, J = 7.4 Hz)

Mass (EI) 502 (M ⁺ +1)

[ Example  40] (±) 3- (3-{[(2E) -2- [5- (3- Chlorophenyl ) -1,3,4- Oxadiazole -2- day] -2- ( Ethoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] 16 mg of the title compound was obtained in 73% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ether (23 mg, 0.046 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 (1H, t, J = 1.1 Hz), 8.03 to 8.01 (1H, m), 7.55 to 7.51 (1H, m), 7.47 to 7.44 (1H, m), 7.21 (1H, t, J = 8.0 Hz) , 6.90 to 6.77 (3H, m), 5.23 (2H, s), 4.47 (2H, q, J = 7.3 Hz), 4.08 (1H, dd, J = 7.4, 4.3 Hz), 3.60 to 3.54 (1H, m ), 3.50 to 3.42 (1H, m), 3.12 (1H, abx, J = 14, 4.3 Hz), 2.97 (1H, abx, J = 14, 7.4 Hz), 1.41 (3H, t, J = 7.3 Hz) , 1.16 (3H, t, J = 7.4 Hz)

Mass (EI) 474 (M ⁺ +1)

[Manufacture example 48] 2- (t-butyl-dimethyl-silanyloxy) -1- [3- (4-chloro-phenyl)-[1,2,4] oxadiazol-5-yl] -ethanone O-propyl- Oxime  Produce

3- (t-Butyl-dimethyl-silanyloxy) -2- (propoxyimino) -propionic acid (400 mg, 1.5 mmol) and 4-chloro-N-hydroxy-benzamidine (250 mg, 0.15 mmol) 150 mg of the title compound was obtained in 25% yield using Preparation Example 36 from

Mass (EI) 410 (M ⁺ +1)

[Manufacture example 49] Preparation of 1- [3- (4-Chloro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-hydroxy-ethanone O-propyl-oxime

2- (t-butyl-dimethyl-silanyloxy) -1- [3- (4-chloro-phenyl)-[1,2,4] oxadiazol-5-yl] -ethanone O-propyl-oxime 100 mg of the title compound was obtained in 92% yield using Preparation 38 from (150 mg, 0.37 mmol).

Mass (EI) 296 (M ⁺ +1)

[Production Example 50] Preparation of methanesulfonic acid 2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethyl ester

Prepared from 1- [3- (4-chloro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-hydroxy-ethanone O-propyl-oxime (100 mg, 0.34 mmol) Example 1 was used to give 86 mg of the title compound in 68% yield.

Mass (EI) 374 (M ⁺ +1)

Production Example 51 (±) 3- (4-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] Preparation of oxy} phenyl) -2-ethoxypropionic acid ethyl ether

Methanesulfonic acid 2- [3- (4-chloro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethyl ester (7.0 mg, 0.019 mmol) and (±) 8 mg of the title compound was obtained in 82% yield from Preparation Example 3 from 2-ethoxy-3- (4-hydroxyphenyl) propionic acid ethyl ester (4.5 mg, 0.019 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.06 ~ 8.04 (2H, m), 7.46 ~ 7.44 (2H, m), 7.17 ~ 7.15 (2H, m), 6.91 ~ 6.88 (2H, m), 5.19 (2H, s), 4.39 (2H, t, J = 6.7 Hz), 4.16 (2H, q, J = 7.4 Hz), 3.97-3.94 (1H, m), 3.62-3.56 (1H, m), 3.37-3.31 (1H, m), 2.95-2.93 (2H, m), 1.84 to 1.77 (2H, m), 1.21 (3H, t, J = 7.6 Hz), 1.16 (3H, t, J = 7.3 Hz), 0.98 (3H, t, J = 7.4 Hz)

Mass (EI) 516 (M ⁺ +1)

[ Example  41] (±) 3- (4-{[(2E) -2- [3- (4- Chlorophenyl ) -1,2,4- Oxadiazole -5-day] -2- ( Propoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] 7.1 mg of the title compound was obtained in 94% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ether (8.0 mg, 0.016 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.06-8.04 (2H, m), 7.46-7.44 (2H, m), 7.17-7.15 (2H, m), 6.91-6.89 (2H, m), 5.22 (2H, s), 4.39 (2H, t, J = 6.7 Hz), 4.05-4.03 (1H, m), 3.60-3.55 (1H, m), 3.49-3.43 (1H, m), 3.08 (1H, abx, J = 14, 4.3 Hz), 2.95 (1H, abx, J = 14, 7.4 Hz), 1.84 to 1.78 (2H, m), 1.16 (3H, t, J = 7.4 Hz), 0.99 (3H, t, J = 7.4 Hz)

Mass (EI) 488 (M ⁺ +1)

Production Example 52 (±) 3- (3-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (pro Foximino) ethyl] oxy} phenyl) -2-ethoxypropionic acid Ethyl ester  Produce

Methanesulfonic acid 2- [3- (4-chloro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethyl ester (10 mg, 0.027 mmol) and (±) 9.0 mg of the title compound was obtained in 65% yield from Preparation Example 3 from 2-ethoxy-3- (3-hydroxyphenyl) propionic acid ethyl ester (6.4 mg, 0.027 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.07 ~ 8.04 (2H, m), 7.46 ~ 7.44 (2H, m), 7.21 ~ 7.18 (1H, m), 6.89 ~ 6.87 (2H, m), 6.86 ~ 6.83 (1H, m), 5.19 (2H, s ), 4.40 (2H, t, J = 6.7 Hz), 4.19-4.13 (2H, m), 4.00-3.97 (1H, m), 3.61-3.57 (1H, m), 3.35-3.30 (1H, m), 2.98 to 2.96 (2H, m), 1.83 to 1.78 (2H, m), 1.21 (3H, t, J = 8.0 Hz), 1.14 (3H, t, J = 7.3 Hz), 0.99 (3H, t, J = 8.0 Hz)

Mass (EI) 516 (M ⁺ +1)

[ Example  42] (±) 3- (3-{[(2E) -2- [3- (4- Chlorophenyl ) -1,2,4- Oxadiazole -5-day] -2- ( Propoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] 8.0 mg of the title compound was obtained in 94% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ester (9.0 mg, 0.017 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.06 to 8.04 (2H, m), 7.46 to 7.44 (2H, m), 7.22 to 7.19 (1H, m), 6.89 to 6.85 (3H, m), 5.20 (2H, s), 4.40 (2H, t, J = 6.7 Hz), 4.08 to 4.05 (1H, m), 3.60 to 3.54 (1H, m), 3.47 to 3.42 (1H, m), 3.11 (1H, abx, J = 14, 4.3 Hz), 2.96 (1H, abx, J = 14, 7.4 Hz), 1.84 to 1.78 (2H, m), 1.15 (3H, t, J = 7.4 Hz), 0.99 (3H, t, J = 7.4 Hz)

Mass (EI) 488 (M ⁺ +1)

Preparation Example 53 Preparation of (1Z) -2-bromo-1- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-propyl oxime

80 mg (11% yield) of the title compound from 4-chlorobenzhydrazide hydrochloride (414 mg, 2.0 mmol) and 3-bromo-2-propoxyimino-propionic acid (272m g, 2.0 mmol) using Preparation Example 25 Got.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 to 8.08 (2H, m), 7.52 to 7.50 (2H, m), 4.68 (2H, s), 4.39 (2H, t, J = 6 Hz), 1.86 to 1.80 (2H, m), 1.03 (3H, 8 Hz )

Mass (EI) 358, 360 (M ⁺ +1)

Preparation Example 54 (±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (pro Foximino) ethyl] oxy} phenyl) -2-ethoxypropionic acid Ethyl ester  Produce

(1Z) -2-bromo-1- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-ethyl oxime (7.0 mg, 0.020 mmol) and ( ±) 2-Ethoxy-3- (4-hydroxyphenyl) -propionic acid ethyl ester (4.7 mg, 0.020 mmol) was prepared in Preparation 3 using 9.0 mg of the title compound in 89% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.10 ~ 8.05 (2H, m), 7.52 ~ 7.49 (2H, m), 7.17 ~ 7.14 (1H, m), 6.92 ~ 6.90 (3H, m), 5.22 (2H, s), 4.36 (2H, t, J = 6.7 Hz), 4.19-4.13 (2H, m), 3.96-3.94 (1H, m), 3.61-3.57 (1H, m), 3.36-3.32 (1H, m), 2.96-2.94 (2H, m), 1.84 to 1.78 (2H, m), 1.22 (3H, t, J = 8.0 Hz), 1.16 (3H, t, J = 8.0 Hz), 1.00 (3H, t, J = 8.0 Hz)

Mass (EI) 516 (M ⁺ +1)

[ Example  43] (±) 3- (4-{[(2E) -2- [5- (4- Chlorophenyl ) -1,3,4- Oxadiazole -2- day] -2- ( Propoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (propoxyimino) ethyl] 7.0 mg of the title compound was obtained in 82% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ester (9.0 mg, 0.017 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.07 ~ 8.05 (2H, m), 7.50 ~ 7.48 (2H, m), 7.16 ~ 7.14 (2H, m), 6.93 ~ 6.91 (2H, m), 5.22 (2H, s), 4.35 (2H, t, J = 6.8 Hz), 4.05-4.03 (1H, m), 3.60-3.55 (1H, m), 3.48-3.43 (1H, m), 3.07 (1H, abx, J = 14, 4.3 Hz), 2.94 (1H, abx, J = 14, 7.4 Hz), 1.84 to 1.78 (2H, m), 1.17 (3H, t, J = 7.4 Hz), 0.99 (3H, t, J = 7.4 Hz)

Mass (EI) 488 (M ⁺ +1)

Production Example 55 (±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (pro Preparation of Foxyminomino) ethyl] oxy} phenyl) -2-ethoxypropionic acid ethyl ether

(1Z) -2-bromo-1- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-ethyloxime (7.0 mg, 0.020 mmol) and ( ±) 2-Ethoxy-3- (3-hydroxyphenyl) -propionic acid ethyl ester (4.7 mg, 0.020 mmol) was prepared in Preparation Example 3 using 8.0 mg of the title compound in 80% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.08 ~ 8.05 (2H, m), 7.51 ~ 7.49 (2H, m), 7.21 ~ 7.17 (1H, m), 6.89 ~ 6.86 (3H, m), 5.22 (2H, s), 4.36 (2H, t, J = 6.7 Hz), 4.19-4.14 (2H, m), 4.01-3.99 (1H, m), 3.61-3.57 (1H, m), 3.36-3.32 (1H, m), 2.98-2.96 (2H, m), 1.84 to 1.78 (2H, m), 1.22 (3H, t, J = 8.0 Hz), 1.17 (3H, t, J = 8.0 Hz), 1.00 (3H, t, J = 8.0 Hz)

Mass (EI) 516 (M ⁺ +1)

[ Example  44] (±) 3- (3-{[(2E) -2- [5- (4- Chlorophenyl ) -1,3,4- Oxadiazole -2- day] -2- ( Propoxyimino )ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (propoxyimino) ethyl] 6.0 mg of the title compound was obtained in 79% yield using Example 1 from oxy} phenyl) -2-ethoxypropionic acid ethyl ester (8.0 mg, 0.016 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.07 to 8.04 (2H, m), 7.50 to 7.48 (2H, m), 7.22 to 7.19 (1H, m), 6.89 to 6.85 (3H, m), 5.23 (2H, s), 4.36 (2H, t, J = 6.7 Hz), 4.09-4.07 (1H, m), 3.60-3.54 (1H, m), 3.47-3.42 (1H, m), 3.11 (1H, abx, J = 14, 4.3 Hz), 2.96 (1H, abx, J = 14, 7.4 Hz), 1.84 to 1.78 (2H, m), 1.16 (3H, t, J = 7.4 Hz), 1.00 (3H, t, J = 7.4 Hz)

Mass (EI) 488 (M ⁺ +1)

Preparation Example 56 Preparation of (1Z) -2-bromo-1- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-butyloxime

7 mg (9.8% yield) of the title compound were obtained using Preparation 25 from 4-fluorobenzhydrazide hydrochloride (381 mg, 2.0 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.18-8.14 (2H, m), 7.24-7.20 (2H, m), 4.67 (2H, s), 4.43 (2H, t, J = 8 Hz), 1.82-1.77 (2H, m), 1.52-1.46 (2H , m), 0.99 (3H, 8 Hz)

Mass (EI) 356, 358 (M ⁺ +1)

Production Example 57 (±) 3- (4-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxa diazole- 2-yl] ethyl] oxy} phenyl) -2-ethoxypropionic acid Ethyl ester  Produce

(1Z) -2-bromo-1- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-butyloxime (7.0 mg, 0.020 mmol) and 8.0 mg of the title compound was obtained in 79% yield from Preparation (3) from (±) 2-ethoxy-3- (4-hydroxyphenyl) -propionic acid ethyl ester (4.7 mg, 0.020 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.13 ~ 8.11 (2H, m), 7.22 ~ 7.18 (2H, m), 7.16 ~ 7.14 (2H, m), 6.91 ~ 6.89 (2H, m), 5.20 (2H, s), 4.39 (2H, t, J = 6.7 Hz), 4.15 (2H, q, J = 7.4 Hz), 3.96-3.95 (1H, m), 3.62-3.56 (1H, m), 3.37-3.31 (1H, m), 2.95-2.92 (2H, m), 1.79-1.73 (2H, m), 1.47-1.41 (2H, m), 1.21 (3H, t, J = 7.3 Hz), 1.15 (3H, t, J = 7.4 Hz), 0.96 (3H, t , J = 7.4 Hz)

Mass (EI) 514 (M ⁺ +1)

[ Example  45] (±) 3- (4-{[(2E) -2- ( Butoxyimino ) -2- [5- (4- Florophenyl ) -1,3,4- Oxadiazole -2-yl] ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

(±) 3- (4-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethyl 6.0 mg of the title compound was obtained in 79% yield using Example 1 from] oxy} phenyl) -2-ethoxypropionic acid ethyl ester (8.0 mg, 0.016 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 ~ 8.11 (2H, m), 7.22 ~ 7.18 (2H, m), 7.16 ~ 7.14 (2H, m), 6.93 ~ 6.91 (2H, m), 5.21 (2H, s), 4.40 (2H, t, J = 6.7 Hz), 4.06-4.04 (1H, m), 3.60-3.54 (1H, m), 3.49-3.44 (1H, m), 3.08 (1H, abx, J = 14, 4.3 Hz), 2.95 (1H, abx, J = 14, 7.4 Hz), 1.78 to 1.73 (2H, m), 1.49 to 1.43 (2H, m), 1.17 (3H, t, J = 7.4 Hz), 0.97 (3H, t, J = 7.4 Hz )

Mass (EI) 486 (M ⁺ +1)

Production Example 58 (±) 3- (3-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazole- 2-yl] ethyl] oxy} phenyl) -2-ethoxypropionic acid Ethyl ester  Produce

(1Z) -2-bromo-1- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethanone O-butyloxime (7.0 mg, 0.020 mmol) and 7.0 mg of the title compound was obtained in 70% yield from Preparation (3) from (±) 2-ethoxy-3- (3-hydroxyphenyl) -propionic acid ethyl ester (4.7 mg, 0.020 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 ~ 8.11 (2H, m), 7.11 ~ 7.16 (3H, m), 6.89 ~ 6.86 (3H, m), 5.21 (2H, s), 4.40 (2H, t, J = 6.7Hz), 4.19 ~ 4.13 ( 2H, m), 3.99-3.97 (1H, m), 3.61-3.55 (1H, m), 3.37-3.31 (1H, m), 2.97-2.95 (2H, m), 1.77-1.73 (2H, m), 1.46 to 1.40 (2H, m), 1.21 (3H, t, J = 7.4 Hz), 1.15 (3H, t, J = 7.4 Hz), 0.96 (3H, t, J = 7.4 Hz)

Mass (EI) 514 (M ⁺ +1)

[ Example  46] (±) 3- (3-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxa Diasol -2-yl] ethyl] Oxy } Phenyl )-2- Ethoxypropionic acid

3- (3-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethyl] oxy} 6.0 mg of the title compound was obtained in 91% yield using Example 1 from phenyl) -2-ethoxypropionic acid ethyl ester (7.0 mg, 0.014 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.14 ~ 8.11 (2H, m), 7.22 ~ 7.18 (3H, m), 6.88 ~ 6.86 (3H, m), 5.22 (2H, s), 4.40 (2H, t, J = 6.7Hz), 4.09 ~ 4.06 ( 1H, m), 3.60 to 3.54 (1H, m), 3.48 to 3.44 (1H, m), 3.10 (1H, abx, J = 14, 4.3 Hz), 2.96 (1H, abx, J = 14, 7.4 Hz) , 1.79 to 1.73 (2H, m), 1.48 to 1.43 (2H, m), 1.16 (3H, t, J = 7.4 Hz), 0.97 (3H, t, J = 7.4 Hz)

Mass (EI) 486 (M ⁺ +1)

[Manufacture example 59] Preparation of (1Z) -2-bromo-1- [3- (4-fluorophenyl) isoxazol-5-yl] ethanone O-propyl oxime

(1) Preparation of 2-bromo-1- [3- (4-Floro-phenyl) isoxazole-5-yl] ethanone

5 g (40 mmol) of 4-fluorobenzaldehyde from Heterocycles, 1993, 35 (2), 591-598 and J. Med. Chem., 1991, 34 (2), 600-605, gave 1 g of the title compound.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.86-7.77 (2H, m), 7.32 (1H, s), 7.24-7.18 (2H, m), 4.48 (2H, s)

Mass (EI) 284, 286 (M ⁺ +1)

(2) Preparation of (1Z) -2-bromo-1- [3- (4-fluorophenyl) isoxazol-5-yl] ethanone O-propyl oxime

100 mg (0.35 mmol) of 2-bromo-1- [3- (4-fluorophenyl) isoxazol-5-yl] ethanone was dissolved in methanol, followed by 39 mg (0.35 mmol) of propyloxyamine hydrochloride. After stirring for 10 hours at room temperature, 90 mg of the title compound was obtained by column chromatography in 75% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.86-7.81 (2H, m), 7.28-7.14 (2H, m), 6.89 (1H, s), 4.37 (2H, s), 4.31 (2H, t, J = 8 Hz), 1.85-1.76 (2H, m), 1.01 (3H, t, J = 8 Hz)

Mass (EI) 341, 343 (M ⁺ +1)

Production Example 60 Preparation of (1Z) -2-bromo-1- [3- (4-fluorophenyl) isoxazol-5-yl] ethanone O-ethyloxime

82 mg of the title compound was prepared from 2-bromo-1- [3- (4-fluorophenyl) isoxazol-5-yl] ethanone (480 mg, 1.68 mmol) by the method of Preparation 59- (2). Obtained in 14% yield

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.87-7.80 (2H, m), 7.19-7.13 (2H, m), 6.89 (1H, s), 4.40 (2H, t, J = 8 Hz), 4.37 (2H , s), 1.39 (3H, t, J = 8 Hz)

Mass (EI) 327, 329 (M ⁺ +1)

Preparation Example 61 (±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (propoxyimino) ethyl] oxy} phenyl) Propionic acid Ethyl ester  Produce

(1Z) -2-bromo-1- [3- (4-fluorophenyl) isoxazol-5-yl] ethanone O-propyloxime (145 mg, 0.42 mmol) and (±) 2-ethoxy 132 mg of the title compound was obtained in 63% yield by the method of Preparation Example 3 from 3- (3-hydroxyphenyl) propionic acid ethyl ester (101 mg, 0.42 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.82-7.79 (2H, m), 7.26-7.72 (3H, m), 6.93 (1H, s), 6.89-6.83 (3H, m), 5.15 (2H, s), 4.33 (2H, t, J = 4 Hz ), 4.16 (2H, q, J = 8 Hz), 4.01-3.97 (1H, m), 3.61-3.57 (1H, m), 3.35-3.31 (1H, m), 2.97 (2H, d, J = 4 Hz) , 1.84 to 1.78 (2H, m), 1.24 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz), 1.12 (3H, t, J = 8 Hz)

Mass (EI) 499 (M ⁺ +1)

[ Example  47] (±) 2- Ethoxy -3- (3-{[(2Z) -2- [3- (4- Florophenyl ) Ixoxazole -5-day] -2- ( Propoxyimino )ethyl] Oxy } Phenyl Propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (propoxyimino) ethyl] oxy } Phenyl) propionic acid ethyl ester (132 mg, 0.26 mmol) gave 51 mg of the title compound in 41% yield by the method of Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.84 ~ 7.78 (2H, m), 7.23 ~ 7.12 (3H, m), 6.92 (1H, s), 6.89 ~ 6.84 (3H, m), 5.19 (2H, s), 4.32 (2H, t, J = 6.4 Hz), 4.08 to 4.05 (1H, m), 3.61 to 3.53 (1H, m), 3.46 to 3.38 (1H, m), 3.13 to 3.09 (1H, m), 2.99 to 2.94 (1H, m), 1.85 to 1.76 (2H, m), 1.15 (3H, t, J = 7.2 Hz), 1.00 (3H, t, J = 7.6 Hz)

Mass (EI) 471 (M ⁺ +1)

Production Example 62 (±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy} phenyl) Propionic acid Ethyl ester  Produce

2-bromo-1- [5-methyl-2- (4-fluorophenyl) oxazol-4-yl] -ethanone O-ethyloxime (39 mg, 0.11 mmol) and (±) 2-ethoxy 46 mg of the title compound was obtained in 86% yield by the method of Preparation Example 3 from 3- (3-hydroxyphenyl) propionic acid ethyl ester (28 mg, 0.11 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.83-7.79 (2H, m), 7.26 (1H, s), 7.23-7.72 (2H, m), 6.94 (1H, s), 6.89-6.82 (3H, m), 5.15 (2H, s), 4.41 ( 2H, q, J = 8 Hz, 4.16 (2H, q, J = 8 Hz), 4.01 to 3.97 (1H, m), 3.61 to 3.56 (1H, m), 3.37 to 3.29 (1H, m), 2.97 (2H , d, J = 4 Hz), 1.40 (3H, t, J = 8 Hz), 1.24 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 485 (M ⁺ +1)

[ Example  48] (±) 2- Ethoxy -3- (3-{[(2Z) -2- [3- (4- Florophenyl ) Ixoxazole -5-day] -2- ( Ethoxyimino )ethyl] Oxy } Phenyl Propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy } Phenyl) propionic acid ethyl ester (46 mg, 0.09 mmol) gave the title compound 39 mg in 95% yield by the method of Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.82-7.79 (2H, m), 7.23-7.72 (3H, m), 6.93 (1H, s), 6.90-6.84 (3H, m), 5.16 (2H, s), 4.42 (2H, q, J = 8 Hz ), 4.09-4.06 (1H, m), 3.60-3.56 (1H, m), 3.46-3.38 (1H, m), 3.13-3.09 (1H, m), 2.98-2.94 (1H, m), 1.42 (3H , t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 457 (M ⁺ +1)

Preparation Example 63 (±) 2-ethoxy-3- (4-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy} phenyl) Propionic acid Ethyl ester  Produce

2-bromo-1- [5-methyl-2- (4-fluorophenyl) oxazol-4-yl] -ethanone O-ethyloxime (20 mg, 0.06 mmol) and (±) 2-ethoxy 20 mg of the title compound was obtained in 68% yield by the method of Preparation Example 3 from 3- (4-hydroxyphenyl) propionic acid ethyl ester (15 mg, 0.06 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.82-7.79 (2H, m), 7.27-7.72 (3H, m), 6.94 (1H, s), 6.89-6.82 (3H, m), 5.15 (2H, s), 4.41 (2H, q, J = 8 Hz ), 4.16 (2H, q, J = 8 Hz), 3.99-3.98 (1H, m), 3.61-3.57 (1H, m), 3.35-3.31 (1H, m), 2.98 (2H, d, J = 4 Hz) , 1.40 (3H, t, J = 8 Hz), 1.24 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 485 (M ⁺ +1)

[ Example  49] (±) 2- Ethoxy -3- (4-{[(2Z) -2- [3- (4- Florophenyl ) Ixoxazole -5-day] -2- ( Ethoxyimino )ethyl] Oxy } Phenyl Propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy } Phenyl) propionic acid ethyl ester (20 mg, 0.04 mmol) afforded 12 mg of the title compound in 65% yield by the method of Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.81 ~ 7.77 (2H, m), 7.18 ~ 7.11 (4H, m), 6.98 (1H, s), 6.95 ~ 6.84 (2H, m), 5.13 (2H, s), 4.38 (2H, q, J = 8Hz ), 4.13-4.00 (1H, m), 3.60-3.54 (1H, m), 3.08-3.03 (1H, m), 2.96-2.91 (2H, m), 1.40 (3H, t, J = 8 Hz), 1.12 (3H, t, J = 8 Hz)

Mass (EI) 457 (M ⁺ +1)

[ Production Example  64] 2- Bromo -1- [4- Phenoxyphenyl ] Ethanon  Produce

1- [4-phenoxyphenyl] ethanone (500 mg, 2.35 mmol) was dissolved in 10 ml of chloroform and 3 ml of methanol, and 1.16 g (2.40 mmol) of tetrabutylammonium tribromide were slowly added dropwise at room temperature. After stirring for 9 hours, 50 mL of ethyl acetate was added, washed with 5% Na ₂ S ₂ O ₃ solution, the organic layer was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed to remove 689 mg of the title compound by column chromatography. Obtained in 100% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.98 ~ 7.95 (2H, m), 7.44 ~ 7.40 (2H, m), 7.25 ~ 7.21 (1H, m), 7.10 ~ 7.08 (2H, m), 7.03 ~ 7.00 (2H, m), 4.40 (2H, s )

Mass (EI) 291, 293 (M ⁺ +1)

[ Production Example  65] 2- Bromo -1- [4- Phenoxyphenyl ] Ethanon  O- Profile  Produce

136 mg of the title compound was obtained in 33% yield by the method of Preparation Example 1 from 2-bromo-1- [4-phenoxyphenyl] ethanone (340 mg, 1.16 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.69 ~ 7.67 (2H, m), 7.38 ~ 7.34 (2H, m), 7.16 ~ 7.12 (1H, m), 7.05 ~ 7.00 (4H, m), 4.33 (2H, s), 4.23 (2H, t, J = 8 Hz), 1.82-1.73 (2H, m), 1.00 (3H, t, J = 8 Hz)

Mass (EI) 348, 350 (M ⁺ +1)

[ Production Example  66] 2- Bromo -1- [4- Phenoxyphenyl ] Ethanon  O- Ethyl oxime  Produce

179 mg of the title compound was obtained in 46% yield by the method of Preparation Example 1 from 2-bromo-1- [4-phenoxyphenyl] ethanone (340 mg, 1.1 6 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.69 ~ 7.67 (2H, m), 7.38 ~ 7.34 (2H, m), 7.16 ~ 7.12 (1H, m), 7.05 ~ 7.00 (4H, m), 4.36 (2H, s), 4.30 (2H, q, J = 8 Hz), 1.35 (3H, t, J = 8 Hz)

Mass (EI) 334, 336 (M ⁺ +1)

Preparation Example 67 (±) 2-Ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid Ethyl ester  Produce

2-bromo-1- [4-phenoxyphenyl] ethanone O-propyloxime (20 mg, 0.057 mmol) and (±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid ethyl ester (13.7 mg, 0.057 mmol) to give 20 mg of the title compound in 69% yield by the method of Preparation Example 3.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.63 (2H, m), 7.35 ~ 7.31 (2H, m), 7.13 ~ 7.11 (3H, m), 7.02 ~ 6.94 (4H, m), 6.86 ~ 6.82 (2H, m), 5.18 (2H, s ), 4.19 (2H, t, J = 8 Hz), 4.14 (2H, q, J = 8 Hz), 3.96-3.93 (1H, m), 3.62-3.55 (1H, m), 3.37-3.29 (1H, m) , 2.93 (2H, d, J = 8 Hz), 1.81-1.72 (2H, m), 1.20 (3H, t, J = 8 Hz), 1.15 (3H, t, J = 8 Hz), 0.99 (3H, t, J = 8 Hz)

Mass (EI) 506 (M ⁺ +1)

[ Example  50] (±) 2- Ethoxy -3- (4-{[(2Z) -2- (4- Phenoxyphenyl )-2( Propoxyimino ) Ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid ethyl ester (20 mg, 0.039 mmol 14 mg of the title compound was obtained in 75% yield by the method of Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.65 ~ 7.63 (2H, m), 7.35 ~ 7.31 (2H, m), 7.14 ~ 7.09 (3H, m), 7.01 ~ 6.93 (4H, m), 6.89 ~ 6.83 (2H, m), 5.18 (2H, s ), 4.20 (2H, t, J = 8 Hz), 4.04-4.01 (1H, m), 3.62-3.54 (1H, m), 3.45-3.40 (1H, m), 3.08-3.03 (1H, m), 2.95 ~ 2.90 (1H, m), 1.81-1.72 (2H, m), 1.18 (3H, t, J = 8 Hz), 0.99 (3H, t, J = 8 Hz)

Mass (EI) 478 (M ⁺ +1)

Preparation Example 68 (±) 2-Ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid Ethyl ester  Produce

2-bromo-1- [4-phenoxyphenyl] ethanone O-propyloxime (20 mg, 0.057 mmol) and (±) 2-ethoxy-3- (3-hydroxyphenyl) propionic acid ethyl ester (13.7 mg, 0.057 mmol) to give 28 mg of the title compound in 97% yield by the method of Preparation Example 3.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.64 (2H, m), 7.35 ~ 7.31 (2H, m), 7.18 ~ 7.09 (2H, m), 7.02 ~ 6.93 (4H, m), 6.84 ~ 6.78 (3H, m), 5.18 (2H, s), 4.20 (2H, t, J = 8 Hz), 4.14 (2H, q, J = 8 Hz), 3.98-3.96 (1H, m), 3.61-3.57 (1H, m), 3.35 to 3.31 (1H, m), 2.95 (2H, d, J = 4 Hz), 1.85 to 1.75 (2H, m), 1.21 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz), 1.00 (3H, t, J = 8 Hz)

Mass (EI) 506 (M ⁺ +1)

[ Example  51] (±) 2- Ethoxy -3- (3-{[(2Z) -2- (4- Phenoxyphenyl )-2( Propoxyimino ) Ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid ethyl ester (28 mg, 0.055 mmol ) Gave 6.6 mg of the title compound in 25% yield by the method of Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.65 ~ 7.63 (2H, m), 7.34 ~ 7.31 (2H, m), 7.17 ~ 7.11 (2H, m), 7.01 ~ 6.94 (4H, m), 6.84 ~ 6.80 (3H, m), 5.18 (2H, s), 4.19 (2H, t, J = 6.5 Hz), 4.05-4.03 (1H, m), 3.56-3.54 (1H, m), 3.40-3.36 (1H, m ), 3.10 to 3.06 (1H, m), 2.95 to 2.92 (1H, m), 1.85 to 1.75 (2H, m), 1.13 (3H, t, J = 6.5 Hz), 0.99 (3H, t, J = 7 Hz )

Mass (EI) 478 (M ⁺ +1)

Preparation Example 69 (±) 2-Ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid Ethyl ester  Produce

2-bromo-1- [4-phenoxyphenyl] ethanone O-ethyloxime (20 mg, 0.059 mmol) and (±) 2-ethoxy-3- (4-hydroxyphenyl) propionic acid ethyl ester (14.3 mg, 0.060 mmol) to give 24 mg of the title compound in% yield by the method of Preparation Example 3.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.64 (2H, m), 7.35 ~ 7.31 (2H, m), 7.13 ~ 7.09 (3H, m), 7.02 ~ 6.93 (4H, m), 6.84 ~ 6.81 (2H, m), 5.17 (2H, s), 4.29 (2H, q, J = 8 Hz), 4.15 (2H, q, J = 8 Hz), 3.95-3.94 (1H, m), 3.63-3.57 (1H, m), 3.37 to 3.30 (1H, m), 2.93 (2H, d, J = 8 Hz), 1.34 (3H, t, J = 8 Hz), 1.20 (3H, t, J = 8 Hz), 1.15 (3H, t , J = 8 Hz)

Mass (EI) 492 (M ⁺ +1)

[ Example  52] (±) 2- Ethoxy -3- (4-{[(2Z) -2- (4- Phenoxyphenyl )-2( Ethoxyimino )ethyl] jade Phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid ethyl ester (24 mg, 0.048 mmol 16 mg of the title compound was obtained in 71% yield by the method of Example 1.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.65 ~ 7.62 (2H, m), 7.35 ~ 7.31 (2H, m), 7.15 ~ 7.09 (3H, m), 7.02 ~ 6.93 (4H, m), 6.83 (2H , d, J = 8.8 Hz), 5.16 (2H, s), 4.28 (2H, q, J = 8 Hz), 4.01-3.98 (1H, m), 3.61-3.53 (1H, m), 3.42-3.35 (1H , m), 3.06 to 3.01 (1H, m), 2.94 to 2.89 (1H, m), 1.34 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 464 (M ⁺ +1)

Production Example 70 (±) 2-Ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid Ethyl ester  Produce

2-bromo-1- [4-phenoxyphenyl] ethanone O-ethyloxime (20 mg, 0.059 mmol) and (±) 2-ethoxy-3- (3-hydroxyphenyl) propionic acid ethyl ester (14.3 mg, 0.060 mmol) to give 24 mg of the title compound in 82% yield by the method of Preparation.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.64 (2H, m), 7.36 ~ 7.31 (2H, m), 7.17 ~ 7.09 (2H, m), 7.02 ~ 6.94 (4H, m), 6.84 ~ 6.77 (3H, m), 5.18 (2H, s ), 4.30 (2H, q, J = 8 Hz), 4.16 (2H, q, J = 8 Hz), 4.00-3.96 (1H, m), 3.61-3.55 (1H, m), 3.37-3.29 (1H, m) , 2.95 (2H, d, J = 4 Hz), 1.36 (3H, t, J = 8 Hz), 1.21 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 492 (M ⁺ +1)

[ Example  53] (±) 2- Ethoxy -3- (3-{[(2Z) -2- (4- Phenoxyphenyl )-2( Ethoxyimino )ethyl] jade Phenyl) propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid ethyl ester (20 mg, 0.04 mmol 13 mg of the title compound was obtained in 70% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.66 ~ 7.64 (2H, m), 7.36 ~ 7.32 (2H, m), 7.18 ~ 7.12 (2H, m), 7.02 ~ 6.94 (4H, m), 6.85 ~ 6.80 (3H, m), 5.19 (2H, s), 4.32 (2H, q, J = 8 Hz), 4.06-4.03 (1H, m), 3.60-3.54 (1H, m), 3.43-3.37 (1H, m) , 3.11 to 3.06 (1H, m), 2.97 to 2.91 (1H, m), 1.34 (3H, t, J = 8 Hz), 1.14 (3H, t, J = 8 Hz)

Mass (EI) 464 (M ⁺ +1)

[ Production Example  71] 2- Bromo -1- [2- Phenyl -1,3-thiazol-4-yl] Ethanon  Produce

Phenylthioamide (680 mg, 4.95 mmol) and 1,4-dibromo-2,3-butanedione (1.2 g, 4.92 mmol) are heated in 10 ml of dioxane for 2 hours. After distilling off the solvent, 610 mg of the title compound was obtained by column chromatography in 43% yield.

NMR: ¹ H-NMR (CDCl ₃ ) δ 8.04 (1H, s), 8.01 to 7.91 (2H, m), 7.52 to 7.46 (3H, m), 4.57 (2H, s)

Mass (EI) 282, 284 (M ⁺ +1)

[ Production Example  72] 2- Bromo -1- [2- Phenyl -1,3-thiazol-4-yl] Ethanon  O- Profile  Produce

430 mg of the title compound was obtained in 63% yield from the method of Preparation 1 from 2-bromo-1- [2-phenyl-1,3-thiazol-4-yl] ethanone (564 mg, 1.99 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.98-7.97 (2H, m), 7.67 (1H, s), 7.44-7.42 (3H, m), 4.60 (2H, s), 4.25 (2H, t, J = 6.5 Hz), 1.80 to 1.77 (2H, m), 1.01 (3H, t, J = 7 Hz)

Mass (EI) 339, 341 (M ⁺ +1)

Preparation Example 73 (±) 2-Ethoxy-3- (4-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) Ethyl] oxy} phenyl) propionic acid Methyl ester  Produce

2-bromo-1- [2-phenyl-1,3-thiazol-4-yl] ethanone O-propyloxime (8 mg, 0.023 mmol) and (±) 2-ethoxy-3- (4- 5 mg of the title compound was obtained in 38% yield by the method of Preparation Example 3 from hydroxyphenyl) propionic acid ethyl ester (12 mg, 0.036 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.95 to 7.73 (2H, m), 7.66 (1H, s), 7.42 to 7.39 (3H, m), 7.12 (2H, d, J = 9.5 Hz), 6.90 ( 2H, d, J = 8.5 Hz), 5.27 (2H, s), 4.26 (2H, t, J = 6.5 Hz), 4.14 (2H, q, J = 7.5 Hz), 3.96-3.93 (1H, m), 3.59-3.56 (1H, m), 3.34-3.31 (1H, m), 2.93 (2H, d, J = 7 Hz), 1.82-1.72 (2H, m), 1.20 (3H, t, J = 6.5 Hz), 1.14 (3H, t, J = 6.5 Hz), 0.99 (3H, t, J = 7 Hz)

Mass (EI) 497 (M ⁺ +1)

[ Example  54] (±) 2- Ethoxy -3- (4-{[(2Z) -2- (2- Phenyl -1,3-thiazol-4-yl) -2- ( Propoxy Imino) ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (4-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl 4.5 mg of the title compound was obtained in 95% yield by the method of Example 1 from propionic acid methyl ester (5 mg, 0.01 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.95-7.73 (2H, m), 7.66 (1H, s), 7.42-7.39 (3H, m), 7.12 (2H, d, J = 8.5 Hz), 6.91 (2H, d, J = 8.5 Hz), 5.27 (2H, s), 4.25 (2H, t, J = 6.5 Hz), 4.03 to 4.01 (1H, m), 3.58 to 3.54 (1H, m), 3.45 to 3.41 (1H, m), 3.08 to 3.04 (1H , m), 2.94 to 2.90 (1H, m), 1.82 to 1.72 (2H, m), 1.16 (3H, t, J = 7 Hz), 0.99 (3H, t, J = 7 Hz)

Mass (EI) 469 (M ⁺ +1)

Preparation Example 74 (±) 2-ethoxy-3- (3-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl) propionic acid Methyl ester  Produce

2-bromo-1- [2-phenyl-1,3-thiazol-4-yl] ethanone O-propyloxime (8 mg, 0.023 mmol) and (±) 2-ethoxy-3- (3- 10 mg of the title compound was obtained in 87% yield by the method of Preparation Example 3 from hydroxyphenyl) propionic acid ethyl ester (12 mg, 0.036 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.95-7.73 (2H, m), 7.67 (1H, s), 7.41-7.40 (3H, m), 7.18-7.15 (1H, m), 6.88-6.83 (3H, m), 5.27 (2H, s), 4.26 (2H, t, J = 6.5 Hz), 4.14 (2H, q, J = 6.5 Hz), 3.98-3.96 (1H, m), 3.60-3.54 (1H, m), 3.34-3.30 (1H, m) , 2.95 (2H, d, J = 6 Hz), 1.78-1.75 (2H, m), 1.19 (3H, t, J = 7.5 Hz), 1.13 (3H, t, J = 7.5 Hz), 0.99 (3H, t , J = 7.5 Hz)

Mass (EI) 497 (M ⁺ +1)

[ Example  55] (±) 2- Ethoxy -3- (3-{[(2Z) -2- (2- Phenyl -1,3-thiazol-4-yl) -2- ( Propoxy Imino) ethyl] oxy} phenyl) propionic acid

(±) 2-ethoxy-3- (3-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl 7 mg of the title compound was obtained in 74% yield by the method of Example 1 from propionic acid methyl ester (10 mg, 0.02 mmol).

NMR: ¹ H-NMR (CDCl ₃ ) δ 7.93-7.92 (2H, m), 7.67 (1H, s), 7.42-7.39 (3H, m), 7.19-7.16 (1H, m), 6.87-6.63 (3H , m), 5.27 (2H, dd, J = 12.5 Hz, 8,5 Hz), 4.27 (2H, t, J = 6.5 Hz), 4.03 to 4.01 (1H, m), 3.55 to 3.52 (1H, m), 3.40-3.37 (1H, m), 3.09-3.06 (1H, m), 2.95-2.91 (1H, m), 1.81-1.75 (2H, m), 1.12 (3H, t, J = 7 Hz), 0.99 (3H , t, J = 7 Hz)

Mass (EI) 469 (M ⁺ +1)

Example 56 Construction of a Reporter Vector Placing Luciferase Structure Gene Under the GAL4 Transcription Factor Response Sequence

GAL4 response sequence having the basic unit (UAS) repeated 8 times and having the restriction enzyme MluI site at the 5 'end and the restriction enzyme HindIII site at the 5' end: 5'-GTGCAGGTGCCAGAACATTT CTCTATCGAT AGG TA (CTCGGAGGACAGTACTCCG) TA (CTCGGAGGACAGTACTCCG) TA (CTCGGAGGACAGTACTCCG) TA (CTCGGAGGACAGTACTCCG) TA (CCTCGGAGGACAGTACTCCG)

(CTCGGAGGACAGTACTCCG) (CTCGGAGGACAGTACTCCG) (CTCGGAGGACAGTACTCCG) TA CCGTCGACTT TAGAGGGTAT AT-3 '(base sequence in parentheses indicates base unit UAS) was synthesized by DNA synthesizer and plasmid pGL3-Basic (Promega, Cat.No. E1751) multiple restriction. It was inserted at the MluI-HindIII site in the enzyme recognition site. As a result, a pGL3-GAL4 vector was constructed in which 8 x UASs were followed by the luciferase structural gene.

Example 57 Construction of Expression Vectors Expressing Fusion Proteins of GAL4 Protein with Ligand Binding Site in PPAR Protein

Using a mammalian cell expression vector pZeoSV (Cat. No. V85001) from Invitrogen as a base vector, a protein in which the DNA binding site of GAL4 and the ligand binding site of PPAR is fused as a structural gene is a vector expressed under the control of the SV40 promoter. Built.

(One) GAL4  Insertion of cDNA encoding DNA binding site of transcription factor into amplification and expression vector

To amplify the DNA binding site of the yeast basic transcription factor GAL4 protein, the following primers were synthesized using a DNA synthesizer: primer GAL4-HIII (5'-GC AAGCTT GAAGCAAGCCTCCTGAAAG ATG AAG CTA CTG TCT TCT ATC GAA C-3 ') Contains a gene encoding the amino acid from the amino terminus of the amino terminal side of the GAL4 amino acids 1 to 8 and at the same time includes the restriction enzyme HindIII recognition site. The primer GAL4-KI (5'-AA GGTACC GGT AAA TTC CGG CGA TAC AGT CAA CTG TCT TTG A-3 ') contains a gene encoding amino acids 141st to 147th of the DNA binding region carboxy terminus of GAL4 At the same time it contains a restriction enzyme KpnI recognition site. 2 μg of the primer GAL4-HIII and 2 μg of the primer GAL4-KI were added to the reaction tube, and then 10 ng of the plasmid pGBT9 (Clonetech, Cat. No. K1605-A) and 10 μl of 10-fold polymerization buffer solution (50 mM) were added. KCl, 100 mM Tris-HCl, pH 9.0, 1% Triton X-100, 2.5 mM mgCl ₂ ), 10 μl of 2 mM dNTP (2mM dGTP, 2mM dATP, 2mM dCTP and 2mM dTTP), 2.5 Monomer Taq Polymerase After distilled water was added and the total volume was 100 μl, PCR was performed 25 times under conditions of 40 seconds at 95 ° C. (denaturation), 55 seconds at 30 seconds (annealing), and 72 ° C. at 1 minute (polymerization). The PCR product obtained above was isolated from 2% agarose gel and found to have amplified about 488 base pairs of nucleic acid, and was purified from agarose gel under the same conditions. The isolated nucleic acid was purified by restriction enzymes HindIII and KpnI under conditions of NEB buffer solution 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM mgCl ₂ , 1 mM dithiothreitol (pH 7.9)). After complete cleavage, they were extracted with phenol / chloroform (hereafter referred to as fragment GAL4-H / K) and dissolved in 20 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) solution. It was.

On the other hand, 2 μg of the plasmid pZeoSV was completely digested with restriction enzymes HindIII and KpnI under the conditions of NEB buffer 2, and then nucleic acid fragments of about 3.5 kb were separated and purified with 1% agarose gel. This fragment is hereinafter referred to as "fragment pZeoSV-H / K".

100 ng of the fragment GAL4-H / K and 100 ng of the fragment pZeoSV-H / K were obtained from the conjugation reaction tube, followed by 2 µl of 10-fold conjugation solution (50 mM Tris-HCl (pH). 7.8), 10 mM mgCl ₂ , 10 mM dithiothreitol, 1 mM ATP, 25 μg / ml bovine serum albumin) and 10 units of T4 DNA ligase were added and distilled water was added so that the total volume was 20 ml. The reaction was carried out for a time. After the reaction, E. coli HB101 (ATCC 33694) was transformed to obtain plasmid pZeo-GAL containing the DNA binding site of fragment GAL4 (see FIG. 1).

(2) human PPAR γ Acquisition of DNA Fragments Encoding Ligand Binding Sites and GAL4 -Human PPAR γ Construction of Chimeric Receptor Protein Expression Vectors

From the nucleotide sequence information of the human PPARγ gene (gene bank number, NM_015869), the following primers were synthesized. The primer GLBD-f (5'-GG GGTACC TCT CAT AAT GCC ATC AGG TTT GGG CGG ATG C-3 ') contains a gene encoding Ser ¹⁷⁶ to Met ¹⁸⁵ of the human PPARγ gene, and at the same time a restriction enzyme KpnI recognition site. It is included. The primer GLBD-r (5'-CC ACGCGT CTA GTA CAA GTC CTT GTA GAT CTC C-3 ') has a termination codon to stop the translation at the 478th amino acid and the gene encoding Tyr ⁴⁷⁸ from Glu ⁴⁷² of the human PPARγ gene. At the same time it has a restriction enzyme MluI recognition site. Using human PPARγ full-length cDNA isolated from human liver cDNA library as a template, DNA fragments encoding Tyr ⁴⁷⁸ from Ser ¹⁷⁶ containing human PPARγ ligand binding sites were amplified by PCR using the above-mentioned primers. The PCR product obtained above was isolated from 1% agarose gel and confirmed that about 900 base pairs of nucleic acid was amplified, and was purified from agarose gel under the same conditions. The nucleic acid separated and purified above was completely digested with the restriction enzymes KpnI and MluI under the conditions of NEB buffer 2, and then extracted with phenol / chloroform (hereinafter, this fragment is referred to as 'fragment GLBD-K / M'). It was dissolved in μl of TE solution.

On the other hand, 2 μg of the plasmid pZeo-GAL obtained above was completely digested with restriction enzymes KpnI and MluI under the conditions of NEB buffer 2, and nucleic acid fragments of about 4.0 kb were separated and purified with 1% agarose gel. Hereinafter, this fragment is called "fragment pZeoGAL-K / M".

100 ng of the fragment GLBD-K / M and 100 ng of the fragment pZeoGAL-K / M were obtained in the conjugation reaction tube, followed by 2 μl of 10-fold conjugation solution and 10 units of T4 DNA ligase. Was added, distilled water was added so that the total volume was 20 µl, and the conjugation reaction was carried out for 12 hours. After the reaction, E. coli HB101 (ATCC 33694) was transformed, and a DNA fragment encoding a human PPARγ ligand binding site was inserted downstream of the DNA encoding the GAL4 DNA binding site of the pZeoGAL to express the desired effector protein. A vector was obtained (hereinafter, referred to as 'pZeo-GAL-PPARγLBD') (see FIG. 2).

(3) Acquisition of DNA fragments encoding human PPAR α ligand binding region and Gal4 -human PPAR α Construction of Chimeric Receptor Protein Expression Vectors

From the nucleotide sequence information of the human PPARα gene (gene bank number, NM_005036), the following primers were synthesized. The primer ALBD-f (5′-GG GGTACC TCA CAC AAC GCG ATT CGT T-3 ′) contains a gene encoding Arg ^l75 from Ser ¹⁶⁷ of the human PPARα gene and at the same time contains a restriction enzyme KpnI recognition site. The primer ALBD-r (5'-CC ACGCGT TCA GTA CAT GTC CCT GTA GAT CTC CTG C-3 ') has an end codon to terminate translation at the 468th amino acid and the gene encoding Tyr ⁴⁶⁸ from Gln ⁴⁶¹ of the human PPARα gene. At the same time it has a restriction enzyme MluI recognition site. Using human PPARα full-length cDNA isolated from human liver cDNA library as a template, DNA fragments encoding Tyr ⁴⁶⁸ from Ser ¹⁶⁷ containing human PPARα ligand binding sites were amplified by PCR using the above-mentioned primers. The PCR product obtained above was isolated from 1% agarose gel and confirmed that about 900 base pairs of nucleic acid was amplified, and was purified from agarose gel under the same conditions. The nucleic acid separated and purified above was completely digested with the restriction enzymes KpnI and MluI under the conditions of NEB buffer 2, and then extracted with phenol / chloroform (hereinafter, this fragment is referred to as 'fragment ALBD-K / M'). Dissolved in μl of TE solution.

100 ng of the fragment ALBD-K / M and 100 ng of the fragment pZeoGAL-K / M were obtained in the conjugation reaction tube, followed by 2 μl of 10-fold conjugation solution and 10 units of T4 DNA ligase. Was added, distilled water was added so that the total volume was 20 µl, and the conjugation reaction was carried out for 12 hours. After completion of the reaction, E. coli HB101 (ATCC 33694) was transformed, and a DNA fragment encoding a human PPARα ligand binding site was inserted downstream of the DNA encoding the GAL4 DNA binding site of pZeoGAL to express the desired effector protein. A vector was obtained (hereinafter, referred to as 'pZeo-GAL-PPARαLBD') (see FIG. 3).

[ Example  58] Transformation

Monkey kidney cells sprayed with the CV-1 cells with 10% fetal calf 6.0 x 10 ⁴ cells per well density in 24-well plates in serum (FBS) DMEM a ^TM medium (Life Technologies Inc.) supplemented with 5% Incubated at 37 ° C. for 24 hours in the presence of carbon dioxide gas. After incubation, the culture was replaced with 200 μl OptiMEM ^™ medium (Life Technologies Inc.) per well and used for transformation. The amount of DNA was used at 480 ng of pGL3-GAL4, 48 ng of pZeo-GAL-PPARγLBD or pZeo-GAL-PPARαLBD and 128 ng of pCH110 (Amersham, Cat. No. 27-4508-01) per well. DNA was dissolved in 29 μl OptiMEM ^™ medium, and then 1 μl of PLUS reagent (Invitrogen) was added, stirred, and left standing at room temperature for 15 minutes. To the mixture of DNA and PLUS reagent, 1 μl of LIPOFECTAMINE (Invitrogen) diluted with 29 μl of OptiMEM ^™ medium was added, stirred, and allowed to stand at room temperature for 15 minutes. The solution containing the complex of the DNA prepared by the above method and LIPOFECTAMINE was added dropwise to the CV-1 cells incubated in a 24-well plate, stirred gently, and then incubated at 37 ° C for 3 hours in the presence of 5% carbon dioxide. . After incubation, DMEM ^™ medium supplemented with 260 μl of 20% fetal calf serum (FBS) per well was added and incubated for 24 hours at 37 ° C. in the presence of 5% carbon dioxide, followed by analysis.

Example 59 Determination of Antifungal Activity against Human PPAR α or PPAR γ

(One) Luciferase ( Luciferase ) Expression level measurement

Culture medium was removed from the transformed cells in Example 39, and the compounds of Examples 1-55 were dissolved in DMSO, added to DMEM ^™ medium supplemented with 5% fetal calf serum (FBS) and placed in each well After incubation for 24 hours at 37 ℃ in the presence of 5% carbon dioxide gas. After incubation for 24 hours, the culture medium was removed and the cells washed twice with PBS (Life Technologies Inc.), followed by the addition of 100 μl of PLB ^TM Lysis Buffer (Promega Corporation) per well and gentle at room temperature for 20 minutes. After stirring, 20 μl of cell lysate was taken from each well, transferred to a cell culture plate (Costar) for 96-well Luminometer, and luciferase activity was determined by the Luciferase Assay System as recommended by the supplier. Measurement was made through a ^TM kit (Promega Corporation).

(2) Beta galactosidase (β- galactosidase Activity measurement

Transfer 20 µl of the cell lysate to a 96-well assay plate (Falcon, Cat. No. 353911), add 100 µl of ONPG (O-nitrophenyl β-galacti-pyranoside) solution to each well, and 37 ° C. It was left incubator for 2 hours. Thereafter, 50 μl of 1 M sodium carbonate (Na ₂ CO ₃ ) solution was added to each well, and the absorbance was measured at 415 nm.

(3) Ligand Activity

The activity of beta galactosidase measured by the above method was used to correct the efficiency of transformation in cell lysate, and the relative activity of luciferase was measured to compare the activity of each compound. The experimental results were expressed as fold increase with respect to the control group based on the control value added only 5% DMSO without compound. Based on this, Tables 1 and 2 below describe EC ₅₀ , the inhibitory potency of the compounds of Examples 1-55. EC ₅₀ (Effective concentration fifty) represents a concentration of 50% effective based on the maximum effect of the drug.

As described above, the compound of formula 1 according to the present invention exhibits an excellent anti-inflammatory effect against PPARγ and PPARα. Thus, the compounds according to the invention can be used as medicaments for the treatment and prevention of human PPARγ and PPARα related diseases such as diabetes, diabetes related complications, inflammation and the like.

Those skilled in the art to which the present invention pertains will be able to perform various applications and modifications within the scope of the present invention based on the above contents.

Claims (11)

A compound represented by the following formula (1), a pharmaceutically acceptable salt or isomer thereof.

(One) Where A is substituted or unsubstituted alkyl, heteroalkyl, aromatic or heteroaromatic; D is hydrogen, lower alkyl, phenyl or benzyl; E and G are each independently hydrogen or lower alkyl; n is 1 or 2; The compound, pharmaceutically acceptable salt or isomer thereof of claim 1, wherein A is selected from the following substituents. (Iii) lower alkyl unsubstituted or substituted by alkoxy, halogen or CF ₃ (Ii) phenyl or benzyl unsubstituted or substituted with lower alkyl, alkoxy, halogen or CF ₃ (Ⅲ)

(Ⅳ)

,

,

,

(Ⅴ)

,

,

,

, here, X is N or C Each R 1 is independently one of the following substituents;

or

Wherein R 2, R 3 and R 4 are each independently hydrogen, halogen, lower alkyl. The compound, pharmaceutically acceptable salt or isomer thereof of claim 1, wherein the lower alkyl is C ₁ -C ₄ alkyl. The compound, pharmaceutically acceptable salt or isomer thereof of claim 1, wherein the compound is a compound of the following: (±) 3- (4- {2-[(E) -benzyloxyimino] -propoxy} -phenyl) -2-ethoxy-propionic acid (±) 2-ethoxy-3- (4- {2-[(Z) -ethoxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid (±) 2-ethoxy-3- (4- {2-[(Z) -benzyloxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid (±) 2-ethoxy-3- (4- {2-[(Z) -hexyloxyimino] -2-phenyl-ethoxy} -phenyl) -propionic acid (±) 2-ethoxy-3- (4- {2-[(Z) -ethoxyimino] -2-naphthalen-2-yl-ethoxy} -phenyl) -propionic acid (±) 3- (4- {2-biphenyl-4-yl-2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid (±) 2-Ethoxy-3- (4- {2-[(E / Z) -ethoxyimino] -3-phenyl-propoxy} -phenyl) -propionic acid methyl ester (±) 3- (4- {2-benzothiazol-2-yl-2-[(E / Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid 3- (4- {2- (4-Chlorophenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid (±) 2-ethoxy-3- {4- [2-[(Z) -ethoxyimino] -2- (4-trifluoromethyl-phenyl) -ethoxy] -phenyl} -propionic acid (±) 3- (4- {2- (3,4-Dimethyl-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid (±) 3- (4- {2- (2,4-Dichloro-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid (±) 3- (4- {2- (3-methyl-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid (±) 3- (4- {2- (2-methoxy-phenyl) -2-[(Z) -ethoxyimino] -ethoxy} -phenyl) -2-ethoxy-propionic acid (±) 2-ethoxy-3- {4- [2-[(Z) -ethoxyimino] -2- (4-methanesulfonyloxy-phenyl) -ethoxy] -phenyl} -propionic acid (±) 2-Ethoxy-3- {4- [2-[(E) -ethoxyimino] -2- (3-phenyl-isoxazol-5-yl) -ethoxy] -phenyl} -propionic acid (±) 2-ethoxy-3- {4- [2-[(Z) -ethoxyimino] -2- (5-methyl-2-thiophen-2-yl-oxazol-4-yl)- Ethoxy] -phenyl} -propionic acid (±) 2-ethoxy-3- {4- [2-[(Z) -methoxyimino] -2- (5-methyl-2-thiophen-2-yl-oxazol-4-yl)- Ethoxy] -phenyl} -propionic acid (±) 2-ethoxy-3- {4- [2-[(E) -ethoxyimino] -2- (5-phenyl- [1,3,4] oxadiazol-2-yl)- Methoxy] -phenyl} -propionic acid (±) 2-ethoxy-3- (4- {3-[(E) -benzyloxyimino] -butoxy} -phenyl) -prolic acid (±) 2-ethoxy-3- (4- {3-[(E) -phenoxyimino] -butoxy} -phenyl) -prolic acid 2-Ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino) -ethoxy} -phenyl) -propionic acid 2-Ethoxy-3- (4- {2- (5-phenyl- [1,3,4] oxadiazol-2-yl) -2- (propoxyimino) -ethoxy} -phenyl) -propionic acid 2-Ethoxy-3- (3- {2- (ethoxyimino) -2-phenyl-ethoxy} -phenyl) -propionic acid 3- (3- {2- (benzyloxyimino) -propoxy} -phenyl) -2-ethoxy-propionic acid 3- (4- {2- (benzyloxyimino) -propoxy} -phenyl) -2- (2-propoxy) -propionic acid 2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid 2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid 2-Ethoxy-3- (3- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid 2-ethoxy-3- (3- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- Methoxy-phenyl] -propionic acid 2-ethoxy-3- (4- [2- (ethoxyimino) -2- {5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl}- Methoxy-phenyl] -propionic acid 2-ethoxy-3- (3- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e Methoxy} -phenyl) -propionic acid 2-ethoxy-3- (4- {2- [5- (4-fluoro-phenyl)-[1,3,4] oxadiazol-2-yl] -2- (propoxyimino) -e Methoxy} -phenyl) -propionic acid 2-Ethoxy-3- (4- {2- (ethoxyimino) -2- (4-phenyl-oxazol-2-yl) -ethoxy} -phenyl) -propionic acid 2-ethoxy-3- (4- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid ethyl ester 2-ethoxy-3- (3- {2- [3- (4-fluoro-phenyl)-[1,2,4] oxadiazol-5-yl] -2-propoxyimino-ethoxy} -Phenyl) -propionic acid ethyl ester (±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (4-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (3-{[(2E) -2- [5- (3-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (ethoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (4-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (3-{[(2E) -2- [3- (4-chlorophenyl) -1,2,4-oxadiazol-5-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (4-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (3-{[(2E) -2- [5- (4-chlorophenyl) -1,3,4-oxadiazol-2-yl] -2- (propoxyimino) ethyl] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (4-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethyl ] Oxy} phenyl) -2-ethoxypropionic acid (±) 3- (3-{[(2E) -2- (butoxyimino) -2- [5- (4-fluorophenyl) -1,3,4-oxadiazol-2-yl] ethyl ] Oxy} phenyl) -2-ethoxypropionic acid (±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (propoxyimino) ethyl] oxy Phenyl) propionic acid (±) 2-ethoxy-3- (3-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy Phenyl) propionic acid (±) 2-ethoxy-3- (4-{[(2Z) -2- [3- (4-fluorophenyl) isoxazol-5-yl] -2- (ethoxyimino) ethyl] oxy Phenyl) propionic acid (±) 2-ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid (±) 2-ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (propoxyimino) ethyl] oxy} phenyl) propionic acid (±) 2-ethoxy-3- (4-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid (±) 2-ethoxy-3- (3-{[(2Z) -2- (4-phenoxyphenyl) -2 (ethoxyimino) ethyl] oxy} phenyl) propionic acid (±) 2-ethoxy-3- (4-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl Propionic acid (±) 2-ethoxy-3- (3-{[(2Z) -2- (2-phenyl-1,3-thiazol-4-yl) -2- (propoxyimino) ethyl] oxy} phenyl Propionic acid. A process for preparing the compound of formula 1 according to claim 1 by a process comprising the step of reacting a compound of formula 2 with a compound of formula 3 in the presence of a base:

In the above scheme, A, D, E, G, and n are the same as in the general formula (1), and X represents Cl, Br, I or OMs (methanesulfonyloxy group). A method of preparing a compound of Chemical Formula 1 according to claim 1 by a process comprising a process of preparing a compound of Chemical Formula 15 by reacting a compound of Chemical Formula 14 with a compound of Chemical Formula 3 :

In the above scheme, A, D, E, G and n are the same as in formula 1, and X represents Cl, Br, I or OMs (methanesulfonyloxy group). (a) a pharmacologically effective amount of a compound according to claim 1; And (b) a pharmaceutically acceptable carrier, diluent, or excipient, or combination thereof; Pharmaceutical composition comprising a. 8. The composition of claim 7, wherein the composition is used for the treatment and prevention of PPARγ and PPARα related diseases. The composition of claim 8, wherein the PPARγ and PPARα related diseases are diabetes, diabetes related complications, or inflammation. The composition of claim 9, wherein the diabetes-related complication is hyperlipidemia, arteriosclerosis, obesity, hypertension, retinopathy, or renal failure. A method of using the compound of formula 1 according to claim 1 in the manufacture of a medicament for the treatment or prevention of human PPARγ and PPARα related diseases.

Images