KR20060052436A - Bio-metal chip using metal binding protein and method for fabricating the same - Google Patents

Abstract

The present invention relates to a bio-metal chip using a metal binding protein (MBP) and a method for manufacturing the same, and more specifically, a recombinant vector containing a gene encoding the MBP and a target protein (or target peptide), surface expression parent Transformed with a recombinant vector containing a gene encoding a gene and a gene encoding an MBP, a gene encoding a surface expression parent, a gene encoding an MBP, a gene encoding an MBP, and a gene encoding a target protein (or a target peptide) By culturing the microorganisms to produce a cell surface expression of the fusion protein of MBP or MBP-target protein by the fusion protein, surface expression parent of the MBP-target protein, and then position-specifically fixed to the metal chip The present invention relates to a manufacturing method of a bio-metal chip, a bio-metal chip manufactured by the above method, and a detection method of a bio-material using the same. .

According to the present invention, by directly fixing the biomaterial without pretreatment of the surface of the metal chip using MBP, it is possible to produce a bio-metal chip without complex metal chip modification process can be expected to improve the productivity and economy.

Metal binding protein (MBP), cell surface expression matrix, bio-metal chip

Description

Bio-metal Chip Using Metal Binding Protein and Method for Fabricating the Same}

1 is a genetic map of the plasmid pTrcGBP-SA.

Figure 2 is a schematic diagram of a bio-gold chip and sensor system using the GBP of the present invention.

3 is a fusion protein domain structure of GBP and streptavidin (SA) used in the present invention.

4 is a graph showing the results of Surface Plasmon Resonance (SPR) analysis showing the reaction between the GBP fusion protein and the anti-GFP antibody on the bio-gold chip.

5 is a graph showing the results of the UV-vis spectroscopy analysis showing the result of the carbohydrate-protein interaction using the GBP-SA fusion protein on the bio-gold chip according to the present invention, curve 1 is bare gold nanoparticle + GBP Convergence protein + biotin-mannose + ConA-Texas Red, curve 2 is bare gold nanoparticle + GBP fusion protein + biotin-mannose, curve 3 is bare gold nanoparticle analysis.

6 is a genetic map of the recombinant plasmid pTacFadLGBP-1.

7 is a graph showing the results of the SPR analysis confirming that the cells are fixed to the gold surface by GBP expressed on the cell surface, (A) is expressed as a function of the reflectance as a function of the angle of the cells XL1-Blue, (B) is expressed as a function of reflectance versus angle function of cell XL1-Blue (pTacFadLGBP-1). (C) is a graph expressed as a function of resonance angle versus a function of time of cells XL1-Blue and cells XL1-Blue (pTacFadLGBP-1).

8 is a photograph of a cell fixed on a gold surface by an optical microscope.

9 is a graph showing the results of SPR analysis confirming the difference in the degree of cell fixation according to the number of cells.

10 is a graph showing the results of the SPR analysis confirming the difference in the degree of cell fixation according to the external pH conditions.

Figure 11 is a graph showing the results of the SPR analysis that confirmed that the cells fixed on the gold surface is maintained for a certain period of time.

The present invention relates to a bio-metal chip using a metal binding protein (MBP) and a method for manufacturing the same, and more specifically, to a recombinant vector containing a gene encoding the MBP and a target protein (or target peptide). , A recombinant vector containing a gene encoding a surface anchoring motif and a gene encoding an MBP, a gene encoding a surface expression parent, a gene encoding an MBP, and a gene encoding a target protein (or a target peptide) Cultured microorganisms transformed with a recombinant vector containing the above to prepare MBP-target protein fusion protein, cells expressing MBP by surface expressing parent and cells expressing MBP-target protein by surface expressing parent, respectively Next, the production method of the bio-metal chip, characterized in that it is modified (site-specific) to the metal chip (site-specific) It relates to a detection method of a metal material using the same chips and bio-, the bio-production by the above method.

Of the 100,000 human genes predicted by the recent genome project, about 10,000 functions have been identified, and most of these genes are known to be directly related to disease. In addition, since most diseases are caused at the protein level, not at the genetic level, more than 95% of drugs developed or under development target proteins. Therefore, the protein sensor chip reveals the function of biomolecules that specifically interacts with specific proteins, and develops treatment and prevention methods for diseases that were not possible with classical methods based on data obtained through protein function analysis and network analysis. As a key technology in research, small quantities of substances can be selectively analyzed and measured in real time, and thus they are widely used for basic scientific research, measurement of environmental pollutants, and diagnosis of drugs or viruses.

Among the biosensors using metal chips, gold chips are typical. The technologies related to protein-protein, DNA-RNA, and carbohydrate-protein interactions using gold chips have been described as affinity tags (Ni-NTA, Streptavidin, GST). Etc.) or chemical methods, such as amines, ligand thiols, aldehydes, or self-assembly monolayers of functional groups attached to gold chip surfaces Formation of specific proteins by immobilizing the target protein or by adjusting the orientation of the biomolecules at the molecular level to form homogeneous and stable monolayers of biomolecules. The action was analyzed using surface plasmon resonance (SPR) (Hentz et. al ., Anal . Chem ., 68: 3939, 1996; Kukar et al . , Anal . Biochem ., 306: 50, 2002; Hall D., Anal . Biochem . , 288: 109, 2001; Canziani, G. et al . , Methods , 19: 253, 1999; Brockman, JM et al . , JACS, 121: 8044, 1999; Nelson, BP et al . , Anal . Chem ., 73: 1, 2001; Jordan, CE et al . , Anal . Chem . , 69: 4939, 1997; Goodrich, TT et al . , JACS , 126: 4086, 2004).

However, despite the development of biosensor technology using a variety of gold chips as described above, the current surface treatment technology of the metal chip has a big disadvantage, such as the chemical treatment method of the chip surface is combined with a complex, non-specific protein, Not only are they weak, but they can also be affected by many chemicals, which makes them difficult to put to practical use when testing many protein-protein interactions. In addition, since the high purity is required to fix the protein on the metal chip, a complicated purification process must be included, there is also a disadvantage in that the economy is inferior.

Therefore, one of the requirements for the development of biosensors is the development of a technology that can selectively and stably fix biomaterials on biosensor chips. Traditional immobilization methods can be largely divided into four. The first is to physically or chemically adsorb biomaterials to the surface of the sensor chip, and the second is to generate covalent bonds to the biomaterial on the sensor chip surface. The third method is to capture biomaterials in membranes, matrices, polymers, and the like. Finally, there is a method of inducing crosslinking between biomaterials and immobilizing them on the sensor chip surface.

As a widely used method for immobilizing cells on the surface of sensor chips, there is a method of fixing cells using cell-binding peptides in extracellular matrix (ECM) proteins such as fibronectin and collagen. Cell-binding peptides widely used to improve sensor chip surfaces include Arg-Gly-Asp (RGD) and Arg-Glu-Asp-Val (REDV) (Shin, H. et. al ., J. Biomed . Mater . Res . , 61: 169, 2002; Ranieri, JP et al . , J. Biomed . Mater . Res. , 29: 779, 1995; Hubbell, JA et al ., Biotechnol . , 9: 568, 1991). These cell-binding peptides have been found to bind to receptors located on the cell membrane, which are short in length, easy to synthesize, and economical, and have the advantage of improving the surface for flexible adsorption of cells on the surface of the sensor chip. . Recently, studies on immobilizing cells using self-assembly techniques have been published (Choi, JW et. al . , Biosens. Bioelectron . , 20: 2300, 2005). This technique requires more than 12 hours of preparation time since the surface of the sensor chip is first coated with DNA or protein containing cell-binding peptides, and then the cells are fixed. Cell-binding peptides are susceptible to denaturation or desorption and are difficult to selectively regulate cell-binding peptides.

Recently, cell surface displays based on secretory expression of proteins have emerged. Cell surface expression technology is a technology that attaches and expresses the protein we want on the surface of the cell, and expresses foreign proteins on the surface by using surface proteins of microorganisms such as bacteria and yeast as surface anchoring motif, Recombinant live vaccine, peptide / antibody library production and screening (screening), whole cell absorbent (whole cell absorbent), whole cell bioconversion catalysts, etc. has a variety of applications. For successful cell surface expression, it is necessary to select an appropriate surface protein for expressing foreign protein on the cell surface using the surface protein of the microorganism used. The surface expression matrix used in Escherichia coli has been described as an extracellular membrane protein and a lipid protein (lipoprotein). ), Secretory proteins, and surface organ proteins such as flagella proteins. In the case of Gram-negative bacteria, proteins present in the extracellular membrane such as LamB, PhoE, and OmpA were mainly used. FadL protein, one of the surface-expressing mothers, is an outer membrane protein involved in fatty acid metabolism and transport of Escherichia coli and is composed of 20 antiparallel β-structures (Gristalli, G. et at ., Arch . Biochem . Biophys . , 377: 324, 2000). FadL has nine inner loops pointing into the cytoplasm and ten loops pointing to the outer membrane. Among them, the ninth loop fused the lipase gene to stably and continuously express lipase on the cell surface. (Lee, SH et at ., Appl . Envion . Microbial., 70: 5074, 2004).

Recently, a base sequence of MBP (metal binding protein), a peptide that selectively binds to inorganic metals such as gold, iron oxide, zinc oxide, platinum, silver, silicon dioxide, and zeolite has been discovered using phage display or bacterial display technology. (Sarikaya, M. et al . , Nature Materials , 2: 577, 2003). Gold binding protein consisting of 14 amino acids among metal binding proteins (gold binding protein, GBP) was found to selectively bind to the gold surface (Brown, S., Nature Biotechnol . , 15: 269, 1997) Although GBP is being studied, the exact mechanism of how GBP recognizes and combines gold surfaces is still unknown. In addition, examples of detecting antigen-antibody reactions and protein-protein responses using GBP have been reported so far (Richasrd, G. et. al . , Biosens. Bioelectron . , 13: 1117, 1998; Soh, N. et al ., Talanta , 60: 733, 2003), studies of other biotechnological applications have not been reported.

The protein adsorbed on the gold surface did not drop in the used buffer or Milli Q distilled water for a very long time, indicating that the fusion protein was very strongly bound to the surface. The binding mechanism between the gold surface and GBP is not yet known, but it is predicted that the gold surface has a specific interaction based on the hydrophobic region of the gold surface and the molecular recognition and molecular recognition (Braun). , R., et al . , J. Biomater . Sci ., 13: 747, 2002). GBP is also composed of 14 amino acids and can be used in the form of a monomer, dimer, tripler or polymer, and has a binding affinity with gold when triplet or higher. High (Braun, R., et al. , J. Biomater . Sci ., 13: 747, 2002).

Accordingly, the present inventors have found that MBP or MBP-target proteins by FadL, a bio-metal chip in which the fusion protein of MBP-target proteins is fixed, and an extracellular membrane protein derived from Escherichia coli, using MBP properties specifically binding to the metal chip surface. Cells expressing the fusion protein of the present invention have designed a bio-metal chip that can be selectively, efficiently and stably fixed on the surface of the metal chip.

The present inventors also expressed the streptavidin (SA) in GBP using the triplet GBP to positionally fix on the gold chip, and then selectively fix the biotin-bound biomaterial, thereby interfering with the target biomaterial. We have designed an analytical system that can efficiently analyze interactions.

The present inventors have tried to develop a simple method for manufacturing a bio-gold chip in which a bio-material is specifically fixed to a metal chip. As a result, MBP is surface-expressed by the fusion protein and surface expression matrix of MBP-target protein using MBP. Each cell was prepared, and it was confirmed that the biomaterial reaction can be stably detected for a long time by fixing it site-specifically on a metal chip, thereby completing the present invention.

An object of the present invention is to cultivate a fusion protein of MBP-target protein by culturing a microorganism containing a gene encoding MBP and a gene encoding the target protein, and transformed with a recombinant vector configured to express the two genes in a fused form. After manufacturing, to provide a method for producing a bio-metal chip, characterized in that the fixing to the metal chip.

Another object of the present invention is to express the surface by culturing a microorganism transformed with a recombinant vector comprising a gene encoding a cell surface expression parent and a gene encoding an MBP, and the two genes are expressed in a fused form The present invention provides a method for manufacturing a bio-metal chip, which comprises producing a microorganism whose surface is expressed by a parent, and then fixing the microorganism to the metal chip.

Another object of the present invention is a recombinant vector comprising a gene encoding a cell surface expression parent, a gene encoding an MBP and a gene encoding a protein of interest, the MBP and the protein of interest are expressed on the cell surface in a fused form. By culturing the transformed microorganism to produce a microorganism surface-expressed fusion protein of MBP-target protein, and to provide a method for producing a bio-metal chip characterized in that it is fixed to the metal chip.

Still another object of the present invention is to provide a bio-gold chip manufactured by the above method and a biomaterial detection method using the same.

In order to achieve the above object, the present invention provides a recombinant vector comprising a gene encoding the target protein or the peptide of interest and a gene encoding the MBP, and is configured to be expressed in a fused form of the two genes bacteria, fungi and Preparing a transforming microorganism by inserting into a host cell selected from the group consisting of yeast; (b) culturing the transformed microorganism to express a protein of interest or a fusion protein of the peptide and MBP of interest; (c) recovering the microorganism in which the fusion protein is expressed and then crushed to obtain an aqueous fraction containing the fusion protein; And (d) provides a method for producing a bio-metal chip comprising the step of specifically fixing the water-soluble fraction containing the fusion protein to the metal chip.

The present invention also provides a recombinant vector comprising a gene encoding a surface expression parent and a gene encoding an MBP and configured to be expressed on a cell surface in a fused form of the two genes, the group consisting of bacteria, fungi and yeast. Preparing a transforming microorganism by inserting into a host cell selected from the; (b) culturing the transformed microorganism to surface express MBP by a surface expression mother; And (c) provides a method for producing a bio-metal chip comprising the step of specifically fixing the surface-expressed microorganisms on the metal chip the fusion protein.

The present invention also comprises (a) a cell surface containing a gene encoding a surface expression parent, a gene encoding an MBP, and a gene encoding a target protein or a target peptide, wherein the MBP and the target protein or the target peptide are fused. Preparing a transformed microorganism by inserting a recombinant vector configured to be expressed in the host cell into a host cell selected from the group consisting of bacteria, fungi and yeasts; (b) culturing the transformed microorganism to surface express the fusion protein of MBP-target protein or peptide of interest by surface expression parent; And (c) provides a method for producing a bio-metal chip comprising the step of specifically fixing the surface-expressed microorganisms on the metal chip the fusion protein.

In the present invention, the host cell may be characterized by E. coli, and the MBP may be characterized by binding between the N-terminal, C-terminal, or N-C intermediate of the target protein. In addition, the metal and the MBP may be gold and GBP, respectively, but are not limited thereto. The GBP may be characterized in that the triplex or multiplex, GBP triplex may be characterized by having the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

The present invention also provides a fusion protein of the MBP-target protein, a cell expressing the MBP by the surface-expressing parent and a cell expressing the fusion protein of the MBP-target protein by the surface-expressing parent. The present invention provides a method for detecting an interaction between a bio-metal chip fixed in a specific position on a metal chip and a bio-material, wherein the bio-metal chip is used.

In the present invention, the surface expression parent may be FadL, but is not limited thereto. In addition, the target protein may be characterized in that the avidin, the avidin may be characterized in that the form of the other peptide fused to streptavidin or streptavidin, the target peptide is characterized in that the RGD peptide May be, but is not limited thereto.

In the present invention, the fixing may be performed using a patterning through a microcontact printing method, a microchannel using a polydimethylsiloxane (PDMS) template, or a spotting method using a micro array.

In the present invention, the detection may be characterized by performing through SPR or SPR imaging. SPR is a technology that can sensitively analyze the change of the refractive index without the fluorescent label by using a chip coated with a thin metal thin film on the glass chip. Imaging is SPR imaging. As a common analytical method in biosensor systems, it is currently commercialized and used to test protein-protein, protein-DNA, and DNA-DNA interactions.

The present invention also provides a bio-metal chip produced by the above method, to which a fusion protein of MBP-RGD peptide is immobilized, and a cell patterning method characterized by using the bio-metal chip.

In the present invention, the RGD peptide, which is a kind of ligand substance adsorbed by cells, is fused and expressed on the metal chip by fusion expression in MBP, and then, the cells can be patterned on the metal chip to be used for various drug screening tests.

In the present invention, the GBP consists of 42 amino acids and is known to selectively bind to gold. MBP, which selectively binds to specific inorganic metals such as GBP, can selectively bind to inorganic metal surfaces by chemical factors such as hydrogen bonding, polarity, electronic effects, and structural features such as size and shape (Weissbuch, I. et. al . , Science , 253: 637, 1991). However, in the case of the GBP, the mechanism for selectively binding to the gold surface is not known precisely, except that -KTQATS- in the amino acid sequence is involved in gold crystal formation from Au (III) ions in solution (John, L. et al . , J. Mater . Chem . , 14: 2325, 2004).

In the present invention, the GBP-SA fusion protein expressed from Escherichia coli is expressed in a water-soluble form, followed by a simple cell disruption process, and then the bio-gold chip is produced by fixing the fusion protein to a gold chip in a specific direction. It was. As a result of using the bio-gold chip, it was possible to efficiently induce interactions between biomaterials, and eventually, the antibody could be used to easily label-free the reaction.

In addition, the outer membrane protein FadL derived from Escherichia coli was selected as a surface expression matrix for stably expressing the GBP on the cell surface, and the inventors of the present invention have fused the gene encoding the Escherichia coli extracellular membrane protein to the N-terminus of GBP. Provided are microorganisms transformed from a recombinant vector containing a gene encoding a gene of resistance, a promoter. Empicillin resistance gene was used for the selection of strains. In the present invention, it can be characterized in that the appropriate surface expression matrix to use the GBP to be stably expressed on the cell surface.

The present invention also provides a method in which GBP can directly fix microorganisms expressed on the cell surface without pretreatment of the metal chip surface. The conventional immobilization method is complicated and cumbersome, and the preparation time also needs more than 12 hours since the surface of the sensor chip is first coated with DNA or protein modified with N- or C-terminus. Shall be. On the other hand, the present invention flows the microorganisms expressing the polypeptide directly on the surface of the cell to the surface of the sensor chip, so that the process is simple and the microorganisms can be efficiently fixed within a short time. Since the samples were prepared with PBS buffer, the cells were stably maintained, and GBP expressed on the cell surface was stably maintained at the cell surface.

In the present invention, the cells are stably fixed to the metal chip surface even in various external environments. GBP is expressed on the surface of the cell is fixed on the surface of the gold chip without losing its activity even under various pH conditions, the present method can be applied to fix the cells in a variety of real environments.

In addition, the present invention is not limited to the GBP, by using MBP that selectively binds to various inorganic metals that have been recently discovered (Sarikaya, M. et. al . , Nature Materials , 2: 577, 2003) It will be apparent to those skilled in the art that cell fixation techniques can be applied to various sensor chips.

Hereinafter, the present invention will be described in more detail with reference to the following examples. In conclusion, these examples are only for illustrating the present invention in more detail, it is obvious to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. something to do.

In particular, in the following examples, only the use of the biotin-bound DNA as a biomaterial is described, but it is not particularly limited as long as it can bind the biotin, and the interaction between the biomaterial and the cell-biomaterial using different proteins. Applicability to the detection of actions will be apparent to those of ordinary skill in the art.

In addition, in the following examples, only the use of a recombinant vector comprising a gene encoding FadL and GBP was described. However, a FadL-binding protein by FadL using a recombinant vector containing FadL and GBP and a gene encoding a protein of interest. It will be apparent to those of ordinary skill in the art that a bio-metal chip to which cells expressing a fusion protein may be immobilized.

Example 1 Cloning of the GBP-SA Gene

In order to clone genes expressing GBP-SA into recombinant E. coli, the amino acid sequence of the reported GBP (Brown, S., Nature Biotechnol . 15: 269, 1999). Recombinant plasmid pTrc-EGFP-SA (Park JP, et al . , Biotechnol. Bioproc . Eng. , 9: 137, 2004) was used as the template DNA to use the primers of SEQ ID NOS: 1 to 3 to express GBP and streptavidin in a fused form. For cloning, the cleavage site of restriction enzyme Nco I was inserted into the primer of SEQ ID NO: 1, and the cleavage site of restriction enzyme BamH I was inserted into the synthesized primer of SEQ ID NO: 3.

SEQ ID NO: 5'-GCGAATT CCATGG GCAAAACCCAGGCGACCAGCGGCACCATCCAGAGCATGCA

      TGGTAAAACGCAAGCCACGTCT-3 '(prime 1)

SEQ ID NO: 5'-GGTAAAACGCAAGCCACGTCTGGTACGATTCAATCTATGCACGGTAAAACCC

AAGCGACGAGCGGTACCATTCAGTCTGGCATCATCACCGGCACCTG-3 '(Primer 2)

SEQ ID NO: 3: 5'-CGCGCG GGATCC TTACGGCTTCACCTTGGTG- 3 '( primer 3)

The pTrc-EGFP-SA was used as a template, PCR was performed using the primers of SEQ ID NOs: 2 and 3, and then the amplified PCR product was used as template DNA. Finally, primers of SEQ ID NOs: 1 and 3 were used. PCR was performed to obtain a product in the form of a final fusion of GBP and streptavidin. The first denaturation was performed once at 94 ° C for 5 minutes under the PCR conditions, then the second denaturation was performed at 94 ° C for 1 minute, the annealing at 56 ° C for 1 minute, and the extension at 72 ° C for 1 minute. This was repeated 30 times. After the last extension for 5 minutes at 72 ℃.

DNA obtained by PCR was subjected to agarose gel electrophoresis to separate DNA fragments of about 500 bp, which were digested with two restriction enzymes Nco I and BamH I, and then the DNA fragments were digested with the same restriction enzyme. The cloned plasmid pTrc99A (Pharmacia Biotech., Uppsala, Sweden) was cloned to produce recombinant plasmid pTrcGBP-SA.

The prepared pTrcGBP-SA was introduced into Escherichia coli XL1-Blue using a heat shock method, to which ampicillin (50 mg / L) and bacto-agar (15 g / L) were added. Recombinant Escherichia coli XL1-Blue / pTrcGBP-SA was prepared by selection in LB plate medium (yeast extract, 5 g / L; tryptone, 10 g / L; NaCl, 10 g / L). Figure 1 shows a gene map of the plasmid pTrcGBP-SA prepared before. In the present embodiment, a form in which the GBP protein binds to the N-terminus of streptavidin was used, and the same result can be obtained by using a form in which the GBP protein binds to the C-terminus of the present invention. For those of ordinary knowledge, this is obvious.

Example 2 Expression of GBP-SA Fusion Protein

Powerful and inducible trc E. coli XL1-Blue (Stratagene, La Jolla, Calif., USA) transformed with the recombinant plasmid pTrcGBP-SA carrying a promoter was cultured to express the GBP-SA fusion protein. In the trc promoter, gene expression is induced by IPTG (isopropyl-β-thiogalactoside) and in the case of Escherichia coli XL1-Blue transformed with pTrcGBP-SA, GBP was fused to streptavidin as follows. The transformed recombinant E. coli was inoculated into a 500 mL flask containing 200 mL of LB liquid medium and incubated at 37 ° C. pTrcGBP-SA recombinant plasmid trc Having a promoter, IPTG was added to induce gene expression. Gene expression induction was performed by adding 1 mM of IPTG when the optical density (OD) measured at 600 nm wavelength with a spectrophotometer was 0.6.

Four hours after induction, the whole culture was centrifuged at 6000 rpm for 5 minutes at 4 ° C, and then the supernatant was discarded and washed once with 100 mL TE buffer (Tris-HCl 10 mM; EDTA 1 mM, pH 8.0). After centrifugation at 6000 rpm for 5 minutes at 100 ℃ solution suspended in 100 mL solution of TE buffer (Tris-HCl 10 mM; EDTA 1 mM, pH 8.0) and ultrasonic crusher (Branson Ultrasonics Co., Danbury, conn., Cells) were disrupted. The crushed solution was centrifuged at 6000 rpm for 30 minutes at 4 rpm to discard insoluble protein and filtered through a 0.2 μm filter to obtain an aqueous protein fraction containing GBP-SA fusion protein. The protein was produced using the Bradford method (Bradford, M. et. al . , Anal . Biochem ., 72: 248, 1976).

Example 3 Preparation of Bio-Gold Chips Fixing GBP-SA Fusion Protein

The water-soluble protein fraction containing the GBP-SA fusion protein obtained in Example 2 was diluted to a concentration of 1 mg / mL with hip buffer (10 mM HEPES, 0.3 M NaCl and 0.05% Tween 20, pH 7.4). Gold chip (K-MAC, Daejeon, Korea) was treated with H ₂ SO ₄ / H ₂ O ₂ (3/1, v / v) solution for 30 minutes to completely remove organic matter on the surface and PDMS (polydimethylsiloxane) After mounting on the chip, the microchannel between the gold chip and the PDMS template is fixed to the surface of the gold chip while flowing at 5 μL / min with a syringe pump (syringe pump, SP210iw, World Precision Instruments, Inc., USA). After washing thoroughly with 10 μL / min flow rate with washing buffer (PBS, pH 8.0), the probe DNA with biotin-modified at 3 primes was finally flowed with 10 μL / min flow rate with distilled water and washed with fine gas with nitrogen gas. In a method characterized in that the flow is carried out, AutoLab SPR instrument (Eco Chemie, KM Utrecht, Netherlands, Biotechnology Research Center Nanobiocenter), and then 50 μL of the water-soluble protein fraction to the gold chip for SPR and reacted for 30 minutes The fusion protein was fixed in a position-specific manner. Next was washed with a washing buffer (10 mM HEPES, 0.3 M NaCl and 0.05% Tween 20, pH 7.4).

In addition, as a control group, 1 mg / mL GFP was diluted with a Heepes buffer (HEPES buffer) fixed solution, and then fixed to the gold chip in the same manner as described above.

Example 4 Detection of Protein-Protein Interactions Using Bio-Gold Chips

The anti-GFP polyclonal antibody was reacted with the gold chip prepared in Example 3 at room temperature for 30 minutes, and then washed at room temperature with a washing buffer (10 mM HEPES, 0.3 M NaCl and 0.05% Tween 20, pH 7.4). . The reaction was detected using the value of the surface refractive index or the response unit (RU) of the gold chip according to the reaction. As a result, as shown in FIG. 4, the GBP-EGFP fusion protein was selectively immobilized on the gold chip to be detected by the anti-GFP polyclonal antibody, but relatively the EGFP protein was hardly detected by the anti-GFP polyclonal antibody. It was not detected.

Example 5 DNA Hybridization Detection Using Bio-Gold Chips

DNA-DNA hybridization reactions and protein-DNA interaction detection on gold chips have been reported by the Corn group. In other words, the functional group attached to the surface of the gold chip is formulated on the surface by using a self assembly monolayer, and the probe DNA is immobilized using the hybridization of the target DNA by using the SPR imaging technique. (Brockman, JM et al . , JACS , 121: 8044, 1999; Smith, EA et al . , Langmuir. , 17: 2502, 2001). Substituting the EGFP gene with the avidin gene, repeating Examples 1 and 2 to prepare a water-soluble protein fraction containing GBP-avidin fusion protein, and then placed the water-soluble protein fraction on the gold chip in the same manner as in Example 3. Specific fixation can be used to prepare a bio-gold chip to which the GBP-avidin fusion protein is immobilized.

The bio-gold chip on which the GBP-avidin fusion protein is immobilized can be used to detect DNA hybridization reaction by avidin-biotin binding by reacting with DNA to which biotin is bound (FIG. 2).

Example 6 Cell Patterning Using Bio-Gold Chips

Applicability of drug screening techniques using cell patterning techniques on glass, polymer and gold surfaces using RGD peptides has been suggested (Lee, KB et al. al . , Langmuir. , 20: 2531, 2004; Pitt, CG et al . , Biomaterials , 1981: 215). As described above, the EGFP gene was replaced with the RGD peptide gene, followed by repeating Examples 1 and 2 to prepare a water-soluble protein fraction containing GBP-RGD peptide fusion protein, and then the water-soluble protein fraction was prepared in the same manner as in Example 3. Position-specific fixation on the gold chip can be used to prepare a bio-gold chip immobilized GBP-RGD peptide fusion protein.

The GBP-RGD peptide fusion protein immobilized bio-gold chip can be used for cell patterning (FIG. 2). That is, the GBP-RGD peptide fusion protein may be patterned on a gold chip using a micro contact printing method, and then the cells may be patterned again using the patterned RGD to be used for drug screening. The patterning can be detected through fluorescence microscopy.

Example 7 Detection of Carbohydrate-Protein Interactions Using Bio-Gold Chips

The carbohydrate-protein interaction can be detected using the GBP-SA fusion protein obtained through Example 3. In other words, the bio-gold chip was fixed using a fusion protein as a capture ligand, and then biotin was reacted by flowing mannose, a conjugated monosaccharide, followed by Texas to concanovalin A, a type of lectin protein. Carbohydrate-protein interactions can be detected by interacting with a red conjugated material. The reaction was confirmed by UV-vis spectroscopy (FIG. 5).

Example 8 Preparation of Recombinant Expression Vector pTacFadLGBP-1

To clone the FadL gene, Escherichia coli W3110 (F- mcrA Using the chromosome of mcrB IN ( rrnD rrnE ) 1E, KCTC 2223) as template DNA, and using primers of SEQ ID NO: 4 and SEQ ID NO: 5, PCR (first denaturation 94 ℃ 3 minutes, second denaturation 94 ℃ 30 seconds , Hybridization 58 ° C. 30 sec, extension 72 ° C. 70 sec, 26 repetitions, last extension 72 ° C. 7 min). DNA recovered from the PCR was separated by DNA fragment of about 1.16 Kb using agarose gel electrophoresis.

The GBP gene was used as a template DNA using the pTrc99AGBP-SA vector cloned in Example 1, and PCR (first denaturation 94 ℃ 3 minutes, second denaturation 94 ℃ 30 using primers SEQ ID NO: 6 and SEQ ID NO: 7). Sec, hybridization 58 ° C. 30 sec, extension 72 ° C. 20 sec, 26 repetitions, last extension 72 ° C. 7 min). DNA obtained from this PCR was separated from DNA fragments of about 140 bp using agarose gel electrophoresis.

SEQ ID NO: 5'-CAGC GAATTC ATGGTCATGAGCCAGAAAACC-3 '(primer 4)

SEQ ID NO: 5'-TGCATTCTAGAACGATTCTGTGCAGGAACTGG-3 '(primer 5)

SEQ ID NO: '5'-AATCGTTCTAGAGCTAGCATGCACGGCAAAACCCAGG-3' (primer 6)

SEQ ID NO: 5'-GAC AAGCTT ACTAGTATTAAGACTGAATGGTACCGCTCGTCGC-3 '(primer 7)

In order to clone the FadL-GBP gene, using the FadL gene and the GBP gene obtained above as template DNA, and using primers of SEQ ID NO: 4 and SEQ ID NO: 7, PCR (first denaturation 94 ℃ 3 minutes, second denaturation 94 30 ° C., hybridization 58 ° C. 30 seconds, extension 72 ° C. 1 min 20 sec, 26 repetitions, last extension 72 ° C. 7 min). DNA obtained from this PCR was separated by DNA fragments of about 1.3 Kb using agarose gel electrophoresis, and digested with restriction enzymes Eco RI and Hin dIII. It was a plasmid pTac99A vector (Park, SJ et) with a tac promoter cleaved with the same restriction enzyme. al . , Biotechnol . Techn. , 12: 1071, 2000) to prepare the recombinant plasmid pTacFadLGBP-1. This recombinant vector was subjected to heat shock method using Escherichia coli XL1-Blue ( recA1 endA1 gyrA96 thi -1 hsdR17 supE44 relA1 lac [F´ proAB lacI ^q Z M15 Tn 10 (Tet ^r )], Stratagene), and transformed, and then screened in LB plate medium added with empicillin (50 μg / L) to obtain a recombinant expression vector pTacFadLGBP-1 (Fig. 6). In the present embodiment, a recombinant vector encoding a fusion protein of FadL-GBP was prepared, but the same result can be obtained by using a form in which the fusion protein of FadL-GBP is bound to the C-terminus of the target protein of the present invention. Being is obvious to those of ordinary knowledge in this field.

Example 9 GBP Expressed Cell on Surface Using Recombinant Vector

Escherichia coli XL1-Blue transformed with the recombinant vector pTacFadLGBP-1 prepared in Example 8 was inoculated into a 250 mL flask containing 100 mL of LB liquid medium to which ampicillin (50 μg / L) was added and incubated at 37 ° C. . The recombinant vector has a tac promoter and can induce gene expression by treating IPTG. Therefore, when the absorbance measured at 600 nm with a spectrophotometer is 0.4, 0.1 mM IPTG was added to induce gene expression. After 4 hours by IPTG treatment, the culture was centrifuged at 4 ° C. and 6000 rpm for 10 minutes. The supernatant was discarded and the obtained cells were washed with PBS (phosphate buffered saline, 10 mM, pH 7.4) buffer, centrifuged at 4 ° C. and 6000 rpm for 10 minutes, and then suspended again in PBS buffer. Be careful not to burst the cells.

Example 10 Measurement of Cells Fixed on Gold Surface by GBP Expressed on Cell Surface

Surface plasmon resonance (SPR) phenomenon was used to confirm whether the transformant XL1-Blue (pTacFadLGBP-1) prepared in Example 9 was selectively immobilized on the gold surface. Prepare 300 μL of GBP-suspended cells XL1-Blue (pTacFadLGBP-1) in PBS buffer to 1 × 10 ⁷ CFU / mL. In addition, 300 μL was prepared by suspending in PBS buffer so that the cells XL1-Blue 1 × 10 ⁷ CFU / mL as a control experimental group. Gold chips (K-MAC, Daejeon, Korea) are washed with piranha (30% H ₂ O ₂ /70% H ₂ SO ₄ ) solution to completely remove organic matter from the surface, and then mounted on K-MAC SPR equipment, PBS buffer Allow 20 minutes to stabilize the gold chip surface. The XL1-Blue (pTacFadLGBP-1) cells were placed in the sample injecting unit and allowed to react for 30 minutes, and then PBS buffer was flowed. Since the SPR of K-MAC is a single channel surface plasmon resonance device, for the control experiment, the gold chip washed with piranha solution was added to the SPR device, and the PBS buffer was flowed for 20 minutes to stabilize the gold chip surface. Blue cells were placed in the sample injector and allowed to react for 30 minutes, followed by flowing PBS buffer. The results obtained by real time interaction are shown in FIG. 7.

In the case of E. coli XL1-Blue, the angle before and after the reaction on the surface of the SPR sensor chip changed from 51.4 degrees to 51.43 degrees and 0.03 degrees. This means that XL1-Blue cells are not immobilized on the gold chip surface. In the case of Escherichia coli XL1-Blue (pTacFadLGBP-1), the angle before and after the reaction on the surface of the SPR sensor chip was changed about 0.5 degrees from 51.4 degrees to 51.9 degrees, indicating that XL1-Blue (pTacFadLGBP-1) cells were selective on the surface of the SPR sensor chip. Means fixed.

Example 11 Photograph of Cells Fixed on Gold Surface by GBP Expressed on Cell Surface

Cells immobilized on the gold surface were identified by an optical microscope. The cell used in Example 10 is a Gram-negative bacterium, and its cell wall is thin, and the cell wall is also present between the two cell membranes. Staining cells using crystal violets allows the crystal violet to adsorb to the cell wall, making the cells appear purple, making it easier to identify cells that have been immobilized on the gold surface. In Example 10, the gold chip which confirmed that XL1-Blue (pTacFadLGBP-1) cells were fixed to the surface of the SPR sensor chip through SPR was taken out and left at room temperature for 20 minutes to dry the surface. Then, 50 μL of crystal violet (1 g / 50 mL) was dropped on the surface of the gold chip and washed with distilled water after 3 minutes. This was confirmed by using an optical microscope that the cells are fixed on the surface of the gold chip (Fig. 8).

Example 12 : Degree of Immobilization of Cells According to Cell Number

The difference in the degree of immobilization according to the number of cells was confirmed using SPR. When the XL1-Blue (pTacFadLGBP-1) cells used in Example 10 were 1 × 10 ⁷ CFU / mL, the SPR angle was 0.507 ± 0.043 degrees. In addition, when the cells were 1 × 10 ⁶ CFU / mL and 1 × 10 ⁵ CFU / mL, the SPR angles were 0.248 ± 0.033 and 0.049 ± 0.007 degrees, respectively. 9, the larger the number of cells, the larger the SPR angle change range, so the measurement range is extended, but it can be seen that it takes some time until the cells are completely fixed to reach equilibrium.

Example 13: Stability against pH of GBP expressed on cell surface

The difference in the degree of cell immobilization according to the external pH was confirmed using SPR. Changes in the SPR angle were measured by flowing 1.3 × 10 ⁷ CFU / mL of XL1-Blue (pTacFadLGBP-1) cells prepared in Example 9 under various pH conditions (FIG. 10). In general, it was confirmed that the cells are fixed to the sensor chip surface not only in the buffer conditions (pH 7.4) used to fix the cells but also in acidic or basic conditions. This means that the GBP expressed on the cell surface is stably bound to the gold chip surface without losing its activity even in various pH environments.

Example 14 Cells Fixed on the Surface of a Sensor Chip for a Time

SPR was used to determine how long the cells fixed on the sensor chip surface remained stable. At pH 7.4, 1 × 10 ⁷ CFU / mL of XL1-Blue (pTacFadLGBP-1) cells prepared in Example 9 were flowed onto the SPR sensor chip, so that the cells were fixed on the sensor chip surface, resulting in an SPR angle of 52.71 at 52.16 degrees. The road increased by about 0.55 degrees and decreased by about 0.05 degrees after about 60 hours (210,000 seconds) (FIG. 11). This means that the cells expressing GBP are stably fixed to the surface of the sensor chip for 60 hours.

The specific parts of the present invention have been described in detail above, and it should be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

As described and demonstrated in detail above, the present invention utilizes the property that MBP specifically binds to a metal chip, and the cells and MBP-target proteins on which MBP is surface-expressed by the fusion protein and surface expression parent of MBP-target protein. There is an effect of providing a method for producing a bio-metal chip, characterized in that the surface-expressed cells are specifically fixed to the metal chip.

According to the present invention, by selectively fixing the target protein and cells to the gold chip widely used in biochips without chemical surface treatment process, the chip fabrication process is simplified, and the complex target protein purification process is not necessary, thereby greatly improving productivity and economic efficiency. You can expect. In addition, the bio-metal chip according to the present invention is stably fixed to the surface of the metal chip even under various pH conditions, it is possible to perform cell fixation experiments in various environments, showing a high detection efficiency, protein-DNA, protein-heavy metal, protein Antibodies, protein-peptides, carbohydrate-proteins, protein-proteins, and cell-biomaterials have the advantage that nonspecific protein binding does not occur in the method of screening new drugs through this system will be very useful.

Claims (24)

Method for manufacturing a bio-metal chip comprising the following steps: (a) a recombinant vector containing a gene encoding the MBP and a gene encoding the target protein or the desired peptide, and configured to be expressed in a fused form of the two genes, into a host cell selected from the group consisting of bacteria, fungi and yeast Preparing to transform the microorganism; (b) culturing the transformed microorganism to express the fusion protein of MBP with the protein of interest or peptide of interest; (c) recovering the microorganism in which the fusion protein is expressed and then crushed to obtain an aqueous fraction containing the fusion protein; And (d) site-specifically immobilizing the water-soluble fraction containing the fusion protein on a metal chip. The method of claim 1 wherein the MBP is GBP and the metal is gold. 3. The method of claim 2, wherein the GBP is triplex or multimer. 4. The method of claim 3, wherein the GBP triplet has the amino acid sequence of SEQ ID NO: 1. The method of claim 1, wherein the MBP is characterized in that the binding between the N-terminal, C-terminal or N-C intermediate of the protein or the peptide of interest. The method of claim 1, wherein the target protein is avidin. The method of claim 1, wherein the target peptide is an RGD peptide. A bio-metal chip produced by the method according to any one of claims 1 to 6, wherein the fusion protein of MBP and the protein of interest is fixed. A bio-gold chip produced by the method of claim 6, wherein a fusion protein of avidin and GBP is immobilized. A method for detecting a DNA hybridization reaction, comprising reacting a DNA having a biotin bound to the bio-gold chip of claim 9. A bio-gold chip produced by the method of claim 7, wherein a fusion protein of GBP and RGD peptide is immobilized. A cell patterning method comprising using the bio-gold chip of claim 11. Method for manufacturing a bio-metal chip comprising the following steps: (A) a recombinant vector containing a gene encoding the surface expression parent and a gene encoding the MBP, and configured to express the cell surface in a fused form of the two genes to a host cell selected from the group consisting of bacteria, fungi and yeast Inserting to prepare a transformed microorganism; (b) culturing the transformed microorganism to surface express MBP by a surface expression mother; And (c) position-specifically immobilizing the microorganism surface-expressed on the fusion protein to the metal chip. Method for manufacturing a bio-metal chip comprising the following steps: (a) a recombinant comprising a gene encoding a surface expression parent, a gene encoding an MBP, and a gene encoding a target protein or a peptide of interest, wherein the MBP and the target protein or peptide are fused to be expressed on the cell surface Preparing a transforming microorganism by inserting the vector into a host cell selected from the group consisting of bacteria, fungi and yeasts; (b) culturing the transformed microorganism to surface express the MBP-target protein or the fusion protein of the desired peptide by a surface expression parent; And (c) position-specifically immobilizing the microorganism surface-expressed on the fusion protein to the metal chip. The method of claim 14, wherein the target protein is avidin. The method of claim 14, wherein the target peptide is an RGD peptide. 15. The method of claim 13 or 14, wherein said surface expression parent is FadL. 15. The method of claim 13 or 14, wherein the MBP is GBP and the metal is gold. 19. The method of claim 18, wherein the GBP is triplex or multiplexed. The method of claim 19, wherein the GBP triplet has the amino acid sequence of SEQ ID NO: 1. 20. The method of claim 19, wherein the fixation directly fixes the MBP-expressing cells without pretreatment of the metal chip surface. A bio-metal chip produced by the method according to any one of claims 13 to 21, wherein a microorganism having surface-expressed MBP is immobilized thereon. The bio-gold chip of claim 22, wherein MBP is GBP and the metal is gold. 23. A protein-DNA, a protein-heavy metal, a protein-antibody, a protein-peptide, a carbohydrate-protein, a protein-protein and a cell-biomaterial, characterized by using the bio-metal chip of claim 8 or 22. A method of detecting selected interactions from a group.

Images