KR20050024367A - Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids - Google Patents

Abstract

The present invention relates to nucleic acid molecules and nucleic acid constructs, and to other agents involved in fatty acid synthesis, and more particularly to the proportion of saturated and unsaturated fats. Moreover, the present invention relates to plants in which such preparations have been introduced in which the proportions of saturated and unsaturated fats have been altered. In particular, the present invention relates to plants in which such agents have been introduced in which the ratio of monounsaturated fatty acids to polyunsaturated fatty acids has been altered.

Description

NUCLEIC ACID SEQUENCES AND METHODS OF USE FOR THE PRODUCTION OF PLANTS WITH MODIFIED POLYUNSATURATED FATTY ACIDS

The present invention relates to nucleic acid molecules, nucleic acid constructs and other agents related to fatty acid synthesis. The present invention also relates to plants in which the proportion of saturated and unsaturated fats has been altered, into which such agents are introduced. In particular, the invention relates to plants in which the ratio of monounsaturated fatty acids to polyunsaturated fatty acids has been altered, into which such agents are introduced.

Plant oils have been used in a variety of applications. There is a need for new plant oil compositions and improved means for obtaining oil compositions from biosynthetic or natural plant sources. Based on the oil application desired, various other fatty acid compositions have been desired.

Higher plants appear to synthesize fatty acids via fatty acid synthase (FAS) pathways, which are common metabolic pathways. In developing seeds, where fatty acids bind to the glycerol backbone while forming triglycerides for storage as an energy source for germination, the FAS pathway is located in the plastid. The first step performed is the formation of acetyl-ACP (acyl carrier protein) from acetyl-CoA and ACP, catalyzed by the enzyme acetyl-CoA: ACP transacylase (ATA). Elongation of acetyl-ACP to 16- and 18-carbon fatty acids involves the cycle action of the following series of reactions: 2-carbon units from malonyl-ACP to form β-ketoacyl-ACP Condensation (β-ketoacyl-ACP synthase), reduction of the keto-functional group to alcohol (β-ketoacyl-ACP reductase), dehydration to form endoyl-ACP ) (β-ketoacyl-ACP dehydratase), and the final reduction (enoil-ACP reductase) of enoil-ACP to form extended saturated acyl-ACP. β-ketoacyl-ACP synthase I catalyzes elongation from C4: 0 to palmitoyl-ACP (C16: 0), while β-ketoacyl-ACP synthase II is stearoyl-ACP Catalyze the final extension to (C18: 0). Common plant unsaturated fatty acids, such as oleic acid, linoleic acid and linolenic acid, found in storage triacylglycerides are catalyzed by soluble pigment Δ-9 desaturase (also called "stearoyl-ACP desaturase"). In the reaction, it originated from the desaturation of stearoyl-ACP to form oleyl-ACP (C18: 1). Molecular oxygen is required for desaturation, where reduced ferredoxin acts as an electron co-donor. Further desaturation is continuously affected by the action of membrane bound Δ-12 desaturase and Δ-15 desaturase. Thus, these "desaturases" produce polyunsaturated fatty acids.

In the acquisition of nucleic acid sequences capable of producing phenotypic results in FAS, the desaturation and / or introduction of fatty acids into the glycerol backbone to produce an oil may include identification of metabolic factors of interest, Selection and characterization of enzyme sources with useful kinetics, purification of the protein of interest to allow for amino acid sequencing, amino acid sequence to obtain nucleic acid sequences that can be used as probes to search for the desired DNA sequence Various obstacles are encountered, including but not limited to the use of data, and the construction of constructs, resulting plant transformation and analysis.

Thus, there is a need for methods to modify additional nucleic acid targets and fatty acid compositions. In particular, there is a need for structures and methods for producing a wide range of different fatty acid compositions.

1 is a schematic of the structure pCGN5468.

2 is a schematic of the structure pCGN5469.

3 is a schematic of the structure pCGN5471.

4 is a schematic of the structure pCGN5485.

5 is a schematic of the structure pCGN5486.

6 is a schematic of the structure pCGN5462.

7 is a schematic of the structure pCGN5466.

8 is a schematic of the structure pCGN5464.

9 is a schematic of the structure pCGN5473.

10 is a schematic of the structure pMON68521.

11 is a schematic of the structure pMON68519.

12 is a schematic of the structure pCGN5455.

13 is a schematic of the structure pCGN5459.

Summary of the Invention

According to the present invention, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 4, complements thereof, and fragments of any one thereof Substantially purified nucleic acid molecules have been provided comprising nucleic acid sequences having at least 70% sequence identity with a nucleic acid sequence selected from the group.

According to the present invention, there is also provided a nucleic acid molecule comprising at least 15 consecutive nucleotides of a nucleic acid molecule having the sequence of SEQ ID NO: 12; A nucleic acid molecule comprising at least 15 consecutive nucleotides of a nucleic acid molecule having the sequence of SEQ ID NO: 13; A nucleic acid molecule comprising at least 15 consecutive nucleotides of a nucleic acid molecule having the sequence of SEQ ID NO: 14; And at least 15 consecutive nucleotides of a nucleic acid molecule having the sequence of SEQ ID NO: 4.

In addition, according to the present invention, operably linked components include: (A) a promoter that acts to induce the production of mRNA molecules in plant cells; And (B) under high stringent conditions, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 4, complements thereof and fragments of any of these There has been provided a recombinant nucleic acid molecule comprising a nucleic acid sequence that hybridizes to a nucleic acid sequence selected from the group consisting of:

Furthermore, according to the invention, (a) 85% or more homology with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2, complements thereof and fragments of any one thereof With a first promoter operably linked to a first nucleic acid molecule having a first nucleic acid sequence having (a) and (b) SEQ ID NOs: 4 to SEQ ID NOs: 14, complements thereof and fragments of any one of these Provided is a transformed soybean plant having a nucleic acid molecule comprising a second nucleic acid molecule having a second nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of the second nucleic acid. The molecule is operably linked to the first promoter or operably linked to the second promoter in a polycistronic configuration.

According to the present invention, there is also provided a transgenic soybean plant comprising a double-strand RNAi construct, wherein the first promoter is SEQ ID NO: 1 to SEQ ID NO: 2, its complement And a first nucleic acid molecule having a first nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of fragments of any one of them, and SEQ ID NOs: 4 to SEQ. A second nucleic acid molecule having a second nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of ID NO: 14, its complement and fragments of any one of the above, Operably linked to the nucleic acid molecule.

According to the present invention, there is also provided a transgenic soybean plant comprising a double stranded RNAi construct, wherein the first promoter is SEQ ID NO: 1 to SEQ ID NO: 2, a complement thereof, and any one of them. Operably linked to a first nucleic acid molecule having a first nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of fragments of SEQ ID NOs: 4 to SEQ ID NO: 14, A second nucleic acid molecule having a second nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of their complements and fragments of any one thereof, acts on the second promoter in a dsRNAi configuration. Possibly connected.

According to the present invention, there is also provided a transgenic soybean plant having two or more nucleic acid molecules, each nucleic acid molecule is operably linked to a promoter, and each nucleic acid molecule is SEQ ID NO: 1, 2, 4 14, a nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of their complements and fragments of any one thereof.

According to the present invention there is provided a transgenic soybean plant, wherein the gene selected from the group consisting of FAD2-1A, FAD2-1B, FAD2-2B, FAD3-1A, FAD3-1B, FAD3-1C . The level of transcript of the encoded transcript is a transcript encoded by another gene selected from the group consisting of FAD2-1A, FAD2-1B, FAD2-2B, FAD3-1A, FAD3-1B, FAD3-1C . It was selectively reduced, ensuring that the level of was not at least partially affected.

Furthermore, according to the invention, (a) 85% or more homology with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2, complements thereof and fragments of any one thereof With a first promoter operably linked to a first nucleic acid molecule having a first nucleic acid sequence having (a) and (b) SEQ ID NOs: 4 to SEQ ID NOs: 14, complements thereof and fragments of any one of these A second nucleic acid molecule having a second nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from the group consisting of said second nucleic acid molecule being operably linked to said first promoter or second promoter Transforming the soybean plant with the nucleic acid molecule; And a step of producing the soybean plant having a seed having a reduced linolenic acid content, the method comprising culturing the plant, wherein the plant has a similar genetic background but less linolenic acid than a plant lacking the nucleic acid molecule. Produces seeds with

Furthermore, according to the invention, (a) 85% or more homology with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2, complements thereof and fragments of any one thereof A promoter operably linked to a first nucleic acid molecule having a first nucleic acid sequence having and a group consisting of (b) SEQ ID NO: 4 to SEQ ID NO: 14, their complements and fragments of any one of them A second nucleic acid molecule having a second nucleic acid sequence having 85% or more homology with a nucleic acid sequence selected from said nucleic acid molecule, said second nucleic acid molecule being operably linked to said first promoter or second promoter Transforming the soybean plant into a molecule; And cultivating the plant, a method of producing a soybean plant having seeds having an increased oleic acid content, wherein the plant has a similar genetic background but more oleic acid than a plant lacking the nucleic acid molecule. Produces seeds with

Furthermore, according to the present invention, operably linked components are selected from the group consisting of a first promoter, SEQ ID NOs: 1, 2, 4 to 14, complements thereof and fragments of any one of them Transforming a plant with a nucleic acid molecule comprising a first nucleic acid molecule having a first nucleic acid sequence having 85% or more homology with the nucleic acid sequence; And there is provided a method of producing a plant having a seed having a modified oil composition comprising the step of cultivating the plant, the plant has a similar genetic background, but having a modified oil composition compared to a plant lacking the nucleic acid molecule Produce seeds.

In addition, according to the present invention, as operably linked components, 85% with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 4 to 14, their complements and fragments of any one thereof Or two or more nucleic acid molecules each having a nucleic acid sequence having more than one homology, wherein each nucleic acid molecule is a construct operably linked to a promoter, the method comprising: transforming a plant; And there is provided a method of producing a plant having a seed having an altered ratio of monounsaturated fatty acid to polyunsaturated fatty acid, comprising culturing the plant, wherein the plant has a similar genetic background, but the two or more nucleic acids It produces seeds with altered proportions of monounsaturated fatty acids to polyunsaturated fatty acids relative to plants lacking molecules.

Detailed description of the invention

Description of Nucleic Acid Sequences

SEQ ID NO: 1 shows the nucleic acid sequence of FAD2-1A intron 1.

SEQ ID NO: 2 shows the nucleic acid sequence of FAD2-1B intron 1.

SEQ ID NO: 3 shows nucleic acid sequence of partial FAD2-2 genomic clone.

SEQ ID NO: 4 shows nucleic acid sequence of FAD2-2B intron 1.

SEQ ID NO: 5 shows nucleic acid sequence of FAD3-1A intron 1

SEQ ID NO: 6 shows nucleic acid sequence of FAD3-1A intron 2

SEQ ID NO: 7 shows nucleic acid sequence of FAD3-1A intron 3A.

SEQ ID NO: 8 shows nucleic acid sequence of FAD3-1A intron 4

SEQ ID NO: 9 shows nucleic acid sequence of FAD3-1A intron 5.

SEQ ID NO: 10 shows the nucleic acid sequence of FAD3-1A intron 3B.

SEQ ID NO: 11 shows nucleic acid sequence of FAD3-1A intron 3C.

SEQ ID NO: 12 shows nucleic acid sequence of FAD3-1B intron 3C.

SEQ ID NO: 13 shows nucleic acid sequence of FAD3-1B intron 4

SEQ ID NO: 14 shows nucleic acid sequence of FAD3-1C intron 4

SEQ ID NO: 15 shows cDNA sequence of FAD2-1A gene sequence.

SEQ ID NOs: 16 and 17 show nucleic acid sequences of FAD2-1A PCR primers.

SEQ ID NO: 18 shows nucleic acid sequence of partial FAD2-1A genomic clone.

SEQ ID NO: 19 shows nucleic acid sequence of partial FAD2-1B genomic clone.

SEQ ID NOs: 20 and 21 show nucleic acid sequences of FAD3-1A PCR primers.

SEQ ID NO: 22 shows nucleic acid sequence of FAD2-1B promoter.

SEQ ID NO: 23 shows nucleic acid sequence of partial FAD3-1A genomic clone.

SEQ ID NOs: 24-39 show nucleic acid sequences of PCR primers.

Justice

Here, "gene" refers to a nucleic acid sequence comprising a promoter region associated with expression of a gene product, a 5 'untranslated region comprising introns and exons, and a 5' or 3 'untranslated region associated with expression of a gene product. it means.

Here, the " FAD2 ", "Δ12 desaturase" or "omega-6 desaturase" gene is an enzyme that can catalyze the insertion of a double bond into the fatty acyl moiety at the 12th position as counted from the carboxyl terminus. Means the gene to encode.

Here, when referring to proteins and nucleic acids, the use of the capital letter in normal form, such as "FAD2", means an enzyme, protein, polypeptide or peptide, and the use of capital letters in italics, such as " FAD2, " is limited thereto. Nucleic acid, including genes, cDNAs, and mRNAs.

Here, the term " FAD2-1 " refers to the FAD2 gene that is naturally expressed in a specific way in seed tissue.

Here, the term "FAD2-2" is, (a) and FAD2-1 gene and refers to the FAD2 gene is naturally expressed in multiple tissues, including other genes and, (b) seed.

Here, the " FAD3 ", "Δ15 desaturase" or "omega-3 desaturase" gene is an enzyme that can catalyze the insertion of a double bond into the fatty acyl moiety at the 15th position counting from the carboxyl terminus. Means the gene to encode.

Here, the term " FAD3-1 " refers to the FAD3 gene that is naturally expressed in multiple tissues including seeds.

Here, uppercase letters (A, B, C) following the genetic term are used to refer to family members, eg FAD2-1A is a member of a gene family different from FAD2-1B .

Here, "mid-oleic bean seed" means a seed in which 50 to 75% of oleic acid is present in the oil composition of the seed.

Here, "high-oleic soybean seed" means a seed in which more than 75% of oleic acid is present in the oil composition of the seed.

Here, "non-coding" refers to a nucleic acid molecule sequence that does not encode some or all of the expressed protein. Non-coding sequences include, but are not limited to, introns, promoter regions, 3 'untranslated regions, and 5' untranslated regions.

Here, "intron" does not encode some or all of the expressed protein and is transcribed into an RNA molecule under endogenous conditions, but spliced from the endogenous RNA before it is translated into a protein. A nucleic acid molecule segment, usually a term in the general sense, means a segment of DNA.

Here, "exon" is a term in the general sense meaning a nucleic acid molecule, usually DNA fragment, that encodes part or all of the expressed protein.

Here, a promoter "operably linked" to one or more nucleic acid sequences can induce the expression of one or more nucleic acid sequences, including multiple coding or non-coding nucleic acid sequences arranged in a polycistronic structure.

A "polycistronic gene" or "polycistronic mRNA" is any gene or mRNA that contains a transcribed nucleic acid sequence corresponding to the nucleic acid sequence of one or more genes that are targeted for expression. Such polycistronic genes or mRNAs may include sequences corresponding to introns, 5'UTRs, 3'UTRs, or combinations thereof, and recombinant polycistron genes or mRNAs are, by way of example and not limitation, one gene It is understood that the sequences may correspond to one or more UTRs from and one or more introns from a second gene.

Here, the complement of a nucleic acid sequence means the complement of a full length sequence.

Here, a certain range means the end point of the range unless otherwise stated.

Formulation

The formulations of the present invention, in terms of structural properties such as the ability of a nucleic acid molecule to hybridize with another nucleic acid molecule or the ability of a protein to bind (or compete with another molecule for such binding), are "biologically active Is preferred. Alternatively, this property may be catalytically active and thus may include the ability of the agent to mediate a chemical reaction or response. Preferably the formulation is "substantially purified". As used herein, the term "substantially purified" means a molecule that is separated from substantially all other molecules, usually associated with it, in its original environmental conditions. More preferably, the substantially purified molecule is a predominant species present in the preparation. Substantially purified molecules are at least 60% liberated, at least 75% liberated, preferably at least 90% liberated, most preferably at least 95% liberated, from other molecules present in the natural mixture (excluding solvents) It may have been. The term "substantially purified" is not intended to include molecules that exist in their original environmental conditions.

The formulations of the present invention may also be recombinant. Here, “recombinant” means any agent (including but not limited to, DNA, peptide, etc.) or results derived from, but indirectly, artificial manipulation of a nucleic acid molecule.

Formulations of the present invention are those that facilitate the detection of such agents (e.g., fluorescent labels, Prober et al., Science 238 : 336-340 (1987); Albarella et al., European Patent No. 144914; Chemical Labels, Sheldon et al., US Pat. 4,582,789; Albarella et al., US Pat. No. 4,563,417; modified bases, Miyoshi et al., EP 119448).

Nucleic acid molecule

Formulations of the present invention include nucleic acid molecules. In one aspect of the invention, the nucleic acid molecule comprises a nucleic acid sequence, which, when introduced into a cell or organism, partially affects the level of proteins and / or transcripts encoded by a second FAD2 or FAD3 gene. It is possible to selectively reduce the level of proteins and / or transcripts encoded by the FAD2 or FAD3 gene without affecting. In one preferred aspect of the invention, the nucleic acid molecule comprises a nucleic acid sequence, which, when introduced into a cell or organism, is substantially at the level of a protein and / or transcript encoded by a second FAD2 or FAD3 gene. Without affecting, the level of proteins and / or transcripts encoded by the FAD2 or FAD3 gene can be selectively reduced. In a very preferred aspect of the invention, the nucleic acid molecule comprises a nucleic acid sequence, which, when introduced into a cell or organism, necessarily at the level of a protein and / or transcript encoded by a second FAD2 or FAD3 gene. Without affecting, the level of proteins and / or transcripts encoded by the FAD2 or FAD3 gene can be selectively reduced.

In one preferred aspect, the ability of the nucleic acid molecule to selectively reduce the level of one gene relative to another gene is performed by comparing mRNA transcript levels. In another preferred aspect of the invention, the nucleic acid molecule of the invention is a nucleic acid selected from the group consisting of SEQ ID NOs: 1 to 15, 18, 19, 22, 23, complements thereof and fragments of any one thereof. Sequence. In another preferred aspect of the invention, the nucleic acid molecule of the invention is selected from the group consisting of SEQ ID NOs: 16, 17, 20, 21, 24 to 39, complements thereof and fragments of any one thereof Nucleic acid sequences.

In one aspect of the invention, nucleic acid of the invention refers to a introduced nucleic acid molecule. When a nucleic acid molecule is inserted into a cell or organism as a result of artificial manipulation, it is assumed that it is "introduced" no matter how indirectly it is. Examples of introduced nucleic acid molecules include nucleic acids introduced into cells through transformation, transfection, injection and injection, and conjugation, endocytosis and Nucleic acid introduced into an organism through, but not limited to, methods including but not limited to phagocytosis. The cell or organism may be or derived from a plant, plant cell, algae cell, algae, fungus cell, fungus or bacterial cell.

Herein, "not necessarily affected" means that the level of an agent, such as a protein or mRNA transcript, is changed to such an extent that it is not altered by a particular situation or only affects the physiological function of the agent. In a preferred aspect, the level of the agent that is not necessarily affected is within 20%, preferably within 10% of the level at which the agent is found in cells or organisms free of nucleic acid molecules that can selectively reduce other agents, More preferably within 5%.

As used herein, "substantially unaffected" means that in an agent such as a protein or mRNA transcript, the level of the agent that is substantially unaffected is in a cell or organism that is free of nucleic acid molecules that can selectively reduce other agents. Within 49% of the level at which the agent is found, preferably within 35%, more preferably within 24%.

As used herein, "partially unaffected" means that in an agent such as a protein or mRNA transcript, the level of the agent that is not partially affected is in a cell or organism that is free of nucleic acid molecules that can selectively reduce other agents. Within 80% of the level at which the agent is found, preferably within 65%, more preferably within 50%.

Here, a "selective reduction" of an agent, such as a protein or mRNA, is relative to a cell or organism lacking a nucleic acid molecule capable of selectively reducing the agent. In a preferred aspect, said level of said formulation is selectively reduced by at least 50%, preferably at least 75% or more, more preferably at least 90% or 95%.

When comparing levels of agents, such a comparison is preferably performed between organisms with similar genetic background. In one preferred aspect, similar genetic background means a background in which compared organisms share more than 50% of their nuclear genetic material. In a more preferred aspect, a similar genetic background means a background in which compared organisms share at least 75%, even more preferably at least 90% of their nuclear genetic material. In another even more preferred aspect, similar genetic background means that the organisms being compared are plants, the plant being isogenic except for the genetic material originally introduced using plant transformation techniques. .

In one embodiment of the invention, the nucleic acid molecule, when introduced into a cell or organism, does not partially, substantially or necessarily affect, the level of proteins and / or transcripts encoded by the second FAD2 gene , May selectively reduce the level of proteins and / or transcripts encoded by the FAD2 gene. In a preferred aspect, the ability of the nucleic acid molecule to selectively reduce the level of a gene compared to other genes was performed by comparison of the levels of mRNA transcripts. Here, mRNA transcripts include processed and unprocessed mRNA transcripts.

In other embodiments, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of the protein and / or transcript encoded by the FAD2-2 gene, while FAD2-1 The level of proteins and / or transcripts encoded by the gene can be selectively reduced. In still other embodiments, the nucleic acid molecule, when introduced into a cell or organism, a part on the level of protein and / or transcript is encoded by the FAD2-1 gene, without substantially affecting, or be, FAD2- It is possible to selectively reduce the level of proteins and / or transcripts encoded by two genes.

In another embodiment, the nucleic acid molecule, when introduced into a cell or organism, is encoded by the FAD2 gene without partially, substantially or necessarily affecting the level of protein and / or transcript that is encoded by the FAD3 gene. The level of proteins and / or transcripts may be selectively reduced. In a preferred embodiment, the nucleic acid molecule, when introduced into a cell or organism, does not partially or substantially or necessarily affect the level of proteins and / or transcripts encoded by the FAD3 gene, while the FAD2-1 gene It is possible to selectively reduce the level of proteins and / or transcripts encoded by.

In other embodiments, the nucleic acid molecule, when introduced into a cell or organism, does not partially or substantially affect one FAD3 gene, partially or substantially, at the level of a protein and / or transcript encoded by another FAD3 gene. It is possible to selectively reduce the level of proteins and / or transcripts encoded by.

In a further embodiment, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of the protein and / or transcript encoded by the FAD3-1B gene, while FAD3-1C The level of proteins and / or transcripts encoded by the gene can be selectively reduced. In a further embodiment, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of the protein and / or transcript encoded by the FAD3-1A gene, while FAD3-1C The level of proteins and / or transcripts encoded by the gene can be selectively reduced.

In other embodiments, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of the protein and / or transcript encoded by the FAD3-1C gene, while FAD3-1B The level of proteins and / or transcripts encoded by the gene can be selectively reduced. In other embodiments, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of the protein and / or transcript encoded by the FAD3-1A gene, while FAD3-1B The level of proteins and / or transcripts encoded by the gene can be selectively reduced.

In other embodiments, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of proteins and / or transcripts encoded by the FAD3-1B gene, while FAD3-1A The level of proteins and / or transcripts encoded by the gene can be selectively reduced. In other embodiments, the nucleic acid molecule, when introduced into a cell or organism, does not, in part, substantially or necessarily affect the level of proteins and / or transcripts encoded by the FAD3-1C gene, while FAD3-1A The level of proteins and / or transcripts encoded by the gene can be selectively reduced.

Further preferred embodiments of the invention are nucleic acid molecules having at least 50%, 60% or 70% homology with respect to the total length of the nucleic acid molecules of the invention, and nucleic acid molecules complementary to said nucleic acid molecules. More preferably, the nucleic acid molecule comprises a region having at least 80% or 85% homology with respect to the total length of the nucleic acid molecule of the present invention, and a nucleic acid molecule complementary to the nucleic acid molecule. In this regard, nucleic acid molecules having at least 90% homology over the entire length are particularly preferred, and nucleic acid molecules having at least 95% homology are particularly preferred. Moreover, nucleic acid molecules having at least 97% homology are very preferred, nucleic acid molecules having at least 98% and 99% homology are particularly very preferred, and nucleic acid molecules having at least 99% homology are most preferred. .

The present invention also provides a probe having a sequence of a corresponding nucleic acid molecule or fragment thereof, screening a suitable library containing the entire gene for the nucleic acid molecule sequence shown in the sequence listing under stringent hybridization conditions; A nucleic acid molecule comprising a nucleic acid molecule sequence obtainable by separating the nucleic acid molecule sequence is provided. Fragments useful for obtaining such nucleic acid molecules are, for example, the probes and primers described herein.

Nucleic acid molecules of the invention can be used for RNA, cDNA or genomic DNA to isolate full-length cDNA or genomic clones and to isolate cDNA or genomic clones of other genes with high sequence similarity to nucleic acid molecules shown in the sequence listing. It can be used as a hybridization probe.

Nucleic acid molecules of the invention can be readily obtained by using the nucleic acid molecules described herein or fragments thereof to screen for cDNA or genomic libraries obtained from plant species or other suitable organisms. These methods are well known to those skilled in the art, as are the methods for forming the library. In one embodiment, such sequences are obtained by culturing a nucleic acid molecule of the invention with members of a genomic library and recovering a clone that hybridizes with the nucleic acid molecule. In a second embodiment, chromosome walking or reverse PCR methods can be used to obtain such sequences. In a third embodiment, the sequences of nucleic acid molecules of the invention can be used to screen libraries or databases using bioinformatics known in the art. See Bioinformatics , Baxevanis & Ouellette, eds., Wiley-Interscience (1998).

Any of a variety of methods can be used to obtain one or more nucleic acid molecules of the invention. Automated nucleic acid synthesizers can be used for this purpose and can also be used to prepare nucleic acid molecules having sequences found in cells or organisms. Instead of this synthesis, the disclosed nucleic acid molecules can be used to amplify and specify a pair of primers that can be used in the polymerase chain reaction to obtain any desired nucleic acid molecules or fragments.

“Identity”, as is well known in the art, is a relationship between two or more polypeptide sequences or two or more nucleic acid molecule sequences, as determined by comparing sequences. In the art, “identity” also refers to the degree of sequence association between polypeptide or nucleic acid molecule sequences, as determined by matching between strings of sequences. "Identity" is described in Computational Molecular Biology , Lesk, AM, ed., Oxford University Press, New York (1988); Biocomputing : Informatics and Genome Projects , Smith, DW, ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I , Griffin, AM and Griffin, HG, eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology , von Heinje, G., Academic Press (1987); Sequence Analysis Primer , GriBskov, M. and Devereux, J., eds., Stockton Press, New York (1991); And Carillo, H. and Lipman, D., SIAM J. Applied Math , 48: 1073 (1988), and can be easily calculated by known methods. The method of determining homology was designed to show the largest match between test sequences. Moreover, methods for determining homology are codified in known available programs. Computer programs that can be used to determine homology between two sequences include GCG (Devereux, J. et al., Nucleic Acids Research 12 (1): 387 (1984); three designed for nucleic acid sequence lookup (BLASTN, BLASTX and TBLASTX) and five BLAST program suites (Coulson, Trends in Biotechnology , 12: 76-80 (1994); two designed for protein sequence lookups); Birren et al., Genome Analysis, 1 : 543-559 (1997)) The above BLASTX programs include NCBI and other sources (BLAST Manual , Altschul, S. et al., NCBI NLM NIH, Bethesda, MD 20894; Altschul, S. et al., J. Mol. Biol., 215 : 403-410 (1990)) The well known Smith Waterman algorithm can also be used to determine homology.

Parameters for polypeptide sequence comparison typically include:

Algorithm: Needleman and Wunsch, J. Mol. Biol. , 48: 443-453 (1970)

Comparative Matrix: Hentikoff and Hentikoff's BLOSSUM62, Proc. Natl. Acad. Sci. USA, 89: 10915-10919 (1992)

Gap Penalty: 12

Gap Length Penalty: 4

A program that can be used with these parameters can be widely used as a "gap" program by Genetics Computer Group, Madison, Wisconsin. The parameters without penalty for end gaps are the default parameters for peptide comparison.

Parameters for nucleic acid molecule sequence comparisons include:

Algorithm: Needleman and Wunsch, J. Mol. Biol. , 48: 443-453 (1970)

Comparison matrix: match- + 10; Mismatch = 0

Gap Penalty: 50

Gap Length Penalty: 3

Here, "% homology" was determined using the above parameters as default parameters for nucleic acid molecule sequence comparisons and the "gap" program of GCG, version 10.2.

The invention also relates to nucleic acid molecules that hybridize with the nucleic acid molecules of the invention. In particular, the present invention relates to nucleic acid molecules that hybridize under stringent conditions to such nucleic acid molecules. Here, "stringent condition" and "stringent hybridization condition" mean that hybridization generally occurs when there is at least 95% and preferably at least 97% homology between sequences. Examples of stringent hybridization conditions include 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg / After overnight incubation at 42 ° C. in a solution containing ml of denatured and sheared salmon sperm DNA, the hybridization support is washed with 0.1 × SSC at about 65 ° C. Other hybridization and washing conditions are well known and are exemplified in Sambrook et al., Molecular Cloning: A laboratory Manual, 2nd edition, Cold Spring Harbor, NY (1989), especially in Chapter 11.

Upon expression, the protein and / or translocation encoded by the FAD2-1 gene without the nucleic acid molecule partially, substantially or necessarily affecting the level of the protein and / or transcript of the FAD2-2 gene in the plant. In embodiments that can selectively reduce the level of corpse and the level of protein and / or transcript encoded by the FAD3 gene, preferred FAD2-1 nucleic acid sequences are: (1) SEQ ID NO: 1, SEQ ID NO At least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99 with respect to the total length of said nucleic acid molecule having a nucleotide sequence selected from the group consisting of: 2 and fragments thereof. Nucleic acid sequences having% or 100% sequence homology and which do not hybridize to nucleic acid molecules having the nucleotide sequence of SEQ ID NO: 4 under stringent conditions; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD2-1 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). It was selected from the group consisting of nucleic acid molecules representing sequences with% sequence homology.

At the time of expression, the protein and / or trans encoded by the FAD2-2 gene, wherein the nucleic acid molecule does not partially, substantially or necessarily affect the level of the protein and / or transcript of the FAD2-1 gene in the plant. In embodiments that can selectively reduce the level of corpse and the level of proteins and / or transcripts encoded by the FAD3 gene, preferred FAD2-2 nucleic acid sequences are: (1) SEQ ID NO: 4 and fragments thereof Have a sequence homology of at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% with respect to the total length of the nucleic acid molecule having a nucleotide sequence of Nucleic acid sequences that do not hybridize to nucleic acid molecules having nucleotide sequences selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2 under stringent conditions; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD2-2 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). It was selected from the group consisting of nucleic acid molecules representing sequences with% sequence homology.

In embodiments in which the nucleic acid molecule can selectively reduce the FAD3 gene upon expression, preferred FAD3 nucleic acid sequences are selected from the group consisting of (1) SEQ ID NOs: 5-14 and fragments thereof. Having sequence homology of at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% with respect to the total length of the nucleic acid molecule having Nucleic acid sequences that do not hybridize to a nucleic acid molecule having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 4 below; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD3 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). It was selected from the group consisting of nucleic acid molecules representing sequences with% sequence homology.

One subset of nucleic acid molecules of the invention includes fragment nucleic acid molecules. Fragment nucleic acid molecules may consist of, or indeed most of, important part (s) of nucleic acid molecules of the invention, such as those specifically disclosed. Alternatively, the fragments may comprise smaller oligonucleotides (about 15 to about 400 contiguous nucleotide residues, more preferably about 15 to about 30 contiguous nucleotide residues, or about 50 to about 100 contiguous nucleotide residues, or about 100 to about 200 contiguous nucleotide residues, or about 200 to about 400 contiguous nucleotide residues, or about 275 to about 350 contiguous nucleotide residues).

In another aspect, the fragment nucleic acid molecule has a nucleic acid sequence that is at least 15, 25, 50, or 100 contiguous nucleotides of the nucleic acid molecule of the invention. In a preferred embodiment, the nucleic acid molecule is at least 15, 25, 50 or 100 contiguous nucleotides of a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 14 and their complements. Has a nucleic acid sequence.

The fragment of one or more nucleic acid molecules of the invention may be a probe, in particular a PCR probe. A PCR probe is a nucleic acid molecule which can start a polymerase activity in the state which formed the double stranded structure with another nucleic acid molecule. Various methods and PCR techniques exist for determining the structure of PCR probes in the art. For example, Primer3 (www-genome.wi.mit.edu/cgi-bin/primer/primer3.cgi), STSPipeline (www-genome.wi.mit.edu/cgi-bin/www-STS_Pipeline) or GeneUp ( Computer-assisted searches using a program such as Pesole et al., BioTechniques 25 : 112-123 (1998)) can be used to identify potential PCR primers.

Nucleic acid molecules or fragments thereof of the present invention may specifically hybridize with other nucleic acid molecules under certain circumstances. A nucleic acid molecule of the invention specifically hybridizes with a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 14, complements thereof and fragments of any one thereof. Include things.

Here, if two nucleic acid molecules can form an anti-parallel, double-stranded nucleic acid structure, the two nucleic acid molecules can be specifically hybridized to each other.

Nucleic acid molecules of the invention can also encode homologous nucleic acid molecules. Here, a homologous nucleic acid molecule or fragment thereof is a corresponding nucleic acid molecule or fragment thereof in another species (eg, maize FAD2-1 intron nucleic acid molecule is a homolog of Arabidopsis FAD2-1 intron nucleic acid molecule). ). Homologues can also be produced by molecular evolution or DNA shuffling, as a result of which the molecule retains at least one of the functional or structural properties of the original polypeptide (eg, U.S. Pat. 5,811,238).

In another embodiment, the homolog is, alfalfa (alfalfa), Arabidopsis thaliana (Arabidopsis), barley (barley), rape (Brassica campestris), flat (oilseed rape), broccoli (broccoli), cabbage (cabbage), canola, citrus (citrus), cotton (cotton), garlic (garlic), oats (oat), Allium (Allium), flax (flax), listening plants (an ornamental plant), jojoba (jojoba), maize (corn), peanuts ( peanuts, peppers, potatoes, rapeseed, rice, rye, sorghum, strawberries, sugarcane, sugarbeet, tomatoes, wheat, poplar pine (pine), fir (fir), eucalyptus (eucalyptus), apples, lettuce (lettuce), lentils (lentils), grapes, bananas, tea (tea), lawn (turf grasses), sunflower, beans (Phaseolus) Group consisting of krembe, mustard, castor bean, sesame, cottonseed, linseed, safflower and oil palm Expression selected from It is obtained from. Particularly preferred homologues are from the group consisting of canola, corn, rapeseed, rapeseed, soybean, krembe, freshly, castor fruit, peanut, sesame, cottonseed, linseed, rapeseed, safflower, oil palm, flax and sunflower Obtained from selected plants. In an even more preferred embodiment, the homologue is obtained from a plant selected from the group consisting of canola, rapeseed, corn, rapeseed, rapeseed, soybean, sunflower, safflower, oil palm and peanut.

Plant constructs and plant transformants

One or more nucleic acid molecules of the invention may be used for plant transformation or transduction. Foreign genetic material may be introduced into plant cells, which may be regenerated as a whole, fertilized or neutral plants or parts thereof. A foreign genetic material is any genetic material from any source that is naturally occurring or that can be inserted into any organism.

A plant may have one or more families of one or more FAD2 or FAD3 genes (ie, genes encoding enzymes with specific activities present at other locations in the genome of the plant). Here, " FAD2 gene family member" is any FAD2 gene found in the genetic material of a plant. Here, the " FAD3 gene family member" is any FAD3 gene found in the genetic material of a plant. In one embodiment, genotypes may be further classified by similarity of nucleic acid sequences. In a preferred aspect of this embodiment, the genetic family member exhibits at least 60%, more preferably at least 70%, more preferably at least 80% nucleic acid sequence homology at the coding sequence region of the gene.

In one aspect of the invention, the plant comprises at least about 85% of the first promoter with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2, their complements and fragments of any one thereof A group operably linked with a first nucleic acid molecule having a first nucleic acid sequence having homology of, and consisting of SEQ ID NOs: 4 to SEQ ID NO: 14, their complements and fragments of any one of them A double stranded RNAi construct, wherein a second nucleic acid molecule having a second nucleic acid sequence having at least about 85% homology with a nucleic acid sequence selected from is operably linked to the first nucleic acid molecule.

Furthermore, according to the present invention, in a double-stranded RNAi structure, at least a first promoter is selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2, complements thereof and fragments of any one thereof. Operably linked with a first nucleic acid molecule having a first nucleic acid sequence having about 85% homology, SEQ ID NOs: 4 to SEQ ID NO: 14, complements thereof, and fragments of any one thereof A plant is provided comprising a double stranded RNAi construct in which a second nucleic acid molecule having a second nucleic acid sequence having at least about 85% homology with a nucleic acid sequence selected from the group consisting of: is operably linked to a second promoter.

In one embodiment of the invention, the expression level of a protein or transcript of one gene family member may be selectively reduced without partially affecting the level of the protein or transcript of another gene family member. In a preferred embodiment of the invention, the expression level of the protein or transcript of one gene family member can be selectively reduced without substantially affecting the level of the protein or transcript of another gene family member. In a very preferred embodiment of the invention, the expression level of the protein or transcript of one gene family member may be selectively reduced without necessarily affecting the level of the protein or transcript of another gene family member.

In a particularly preferred embodiment, the plant of the invention is expressed by any FAD2 and FAD3 gene when expressed without partially affecting the levels of proteins and / or transcripts of at least one other FAD2 or FAD3 gene in the plant. Nucleic acid sequences capable of selectively reducing the expression level of the encoded protein and / or transcript. In a particularly preferred embodiment, the plant of the invention is expressed by any FAD2 and FAD3 gene when expressed without substantially affecting the levels of proteins and / or transcripts of at least one other FAD2 or FAD3 gene in the plant. Nucleic acid sequences capable of selectively reducing the expression level of the encoded protein and / or transcript. In a particularly preferred embodiment, the plant of the present invention is expressed by any FAD2 and FAD3 gene when expressed without necessarily affecting the level of proteins and / or transcripts of at least one other FAD2 or FAD3 gene in the plant. Nucleic acid sequences capable of selectively reducing the expression level of the encoded protein and / or transcript.

In a more preferred embodiment, the soybean plant of the present invention, when expressed, does not partially affect the levels of proteins and / or transcripts of the FAD2-2 gene in the plant, but is expressed in the FAD2-1 gene and at least one FAD3 gene. And nucleic acid sequences capable of selectively reducing the expression level of the protein and / or transcript encoded by. In a more preferred embodiment, the soybean plant of the present invention, when expressed, has substantially no effect on the level of proteins and / or transcripts of the FAD2-2 gene in the plant, while the FAD2-1 gene and at least one FAD3 gene And nucleic acid sequences capable of selectively reducing the expression level of the protein and / or transcript encoded by. In a more preferred embodiment, the soybean plant of the present invention, when expressed, does not necessarily affect the level of the protein and / or transcript of the FAD2-2 gene in the plant, but is expressed in the FAD2-1 gene and at least one FAD3 gene. Nucleic acid sequences capable of selectively reducing the level of expression of proteins and / or transcripts encoded by them.

In another particularly preferred embodiment, the soybean plant of the present invention, when expressed, does not partially affect the levels of proteins and / or transcripts of the FAD2-2 gene in the plant, and at least two FAD2-1 genes when expressed. And nucleic acid sequences capable of selectively reducing the expression level of proteins and / or transcripts encoded by three or more FAD3 genes. In a more particularly preferred another embodiment, the soybean plant of the present invention, protein and / or the level of transcripts of the FAD2-2 gene in plants include, without not substantially affected, when expressed FAD2-1 gene and at least two And nucleic acid sequences capable of selectively reducing the expression level of proteins and / or transcripts encoded by three or more FAD3 genes. In another particularly preferred embodiment, the soybean plant of the present invention, when expressed, does not necessarily affect the level of proteins and / or transcripts of the FAD2-2 gene in the plant, and when expressed, the FAD2-1 gene and at least two, Nucleic acid sequences capable of selectively reducing the expression levels of proteins and / or transcripts encoded by three or more FAD3 genes.

In a preferred embodiment, the soybean of the present invention comprises a foreign nucleic acid sequence selected from the group consisting of FAD3 introns or fragments thereof, more preferably SEQ ID NOs: 5-14 or fragments thereof.

Especially preferred in other embodiments, the soybean plant of the present invention, protein and / or the level of transcripts of a gene in plants include, without FAD3-1B partially affect, when expressed, is encoded by a gene FAD3-1C Nucleic acid sequences capable of reducing expression levels of proteins and / or transcripts. Especially preferred in other embodiments, the soybean plants of the invention, the protein and / or the level of transcripts of the gene in plants, the FAD3-1B without substantially affecting, when expressed, is encoded by a gene FAD3-1C Nucleic acid sequences capable of reducing expression levels of proteins and / or transcripts. In a particularly preferred alternative embodiment, the soybean plant of the present invention, when without exerting the influence be protein and / or the level of transcripts of FAD3-1B gene in plants, the protein to be expressed is encoded by a gene FAD3-1C And / or nucleic acid sequences capable of reducing the expression level of a transcript.

The FAD2-1 gene, and at least when the nucleic acid sequence is expressed, does not partially affect, substantially affect, or necessarily affect the levels of proteins and / or transcripts of the FAD2-2 gene in plants. In embodiments that can selectively reduce the expression level of proteins and / or transcripts encoded by one FAD3 gene, the preferred FAD2-1 nucleic acid sequence is (1) SEQ ID NO: 4 under stringent conditions. At least 50%, 60% of the total length of the nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and fragments thereof, wherein the composition does not hybridize with a nucleic acid molecule having a nucleic acid sequence of Nucleic acid sequences having 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% sequence homology; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD2-1 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). It was selected from the group consisting of nucleic acid molecules representing sequences having% sequence homology.

In embodiments which can selectively reduce the expression level of the protein and / or transcript encoded by the FAD3 gene when the nucleic acid sequence is expressed, the preferred FAD3 nucleic acid sequence is (1) SEQ ID NO under stringent conditions. : 1, does not hybridize with a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 4, nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5-14 and fragments thereof Nucleic acid sequences having at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% sequence homology with respect to the full length of the nucleic acid molecule having; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD3 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). It was selected from the group consisting of nucleic acid molecules representing sequences having% sequence homology.

In a preferred embodiment, the soybean seeds of the invention have an oil composition of at least 50% oleic acid and up to 10% linolenic acid. In a more preferred embodiment, the soybean seeds of the invention have an oil composition of at least 60% oleic acid and up to 7% linolenic acid. In a particularly preferred embodiment, the soybean seed of the invention has an oil composition of at least 65% oleic acid and at most 5% linolenic acid, preferably at most 4% linolenic acid, more preferably at most 3% linolenic acid. Here, all% compositions of oil in plant parts, such as plants or seeds, were determined by relative mole percentages.

In another preferred embodiment, the soybean seed of the present invention has an oil composition of 50-90% oleic acid and 10% linolenic acid. In a more preferred embodiment, the soybean seed of the present invention has an oil composition of 60-80% oleic acid and 7% linolenic acid. In a particularly preferred embodiment, the soybean seed of the present invention has an oil composition of 65-75% oleic acid and 5% or less linolenic acid, preferably 4% or less linolenic acid, more preferably 3% or less linolenic acid.

In another preferred embodiment, the soybean seed of the present invention has an oil composition of 50-90% oleic acid, 8-16% palmitic acid and up to 10% linolenic acid. In a more preferred embodiment, the soybean seed of the present invention has an oil composition of 60-80% oleic acid, 6-12% palmitic acid and 7% or less linolenic acid. In a particularly preferred embodiment, the soybean seed of the present invention is 65-75% oleic acid, 8-11% palmitic acid and 5% or less linolenic acid, preferably 4% or less linolenic acid, more preferably 3% or less Has an oil composition of linolenic acid.

In a particularly preferred embodiment, the soybean seed of the invention has an oil composition of 65-75% oleic acid, and up to 5% linolenic acid, preferably up to 4% linolenic acid, more preferably up to 3% linolenic acid, here does not affect the level of partially FAD2-2 gene protein and / or transcript of the plant has, or substantially affect, or be sure without affecting, when a nucleic acid sequence and gene expression FAD2-1 It is possible to selectively reduce the expression level of proteins and / or transcripts encoded by at least one FAD3 gene, wherein the FAD2-1 nucleic acid sequence is (1) the nucleic acid of SEQ ID NO: 4 under stringent conditions. Does not hybridize with a nucleic acid molecule having a sequence, and has a total length of said nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and fragments thereof Nucleic acid sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100% sequence homology; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD2-1 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). Is selected from the group consisting of nucleic acid molecules representing sequences having% sequence homology; And the FAD3 nucleic acid sequence does not hybridize to (1) a nucleic acid molecule having a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 4 under stringent conditions, and ID NOs: at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, based on the total length of said nucleic acid molecule having a nucleic acid sequence selected from the group consisting of 5-14 and fragments thereof; Nucleic acid sequences having 98%, 99% or 100% sequence homology; (2) a nucleic acid molecule comprising a sequence also found in the soy FAD3 gene intron; And (3) at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or 100 with respect to the total length of the nucleic acid molecule having the nucleic acid molecule of (2). It was selected from the group consisting of nucleic acid molecules representing sequences having% sequence homology.

In another embodiment, the soybean seeds of the present invention are at least 80%, more preferably at least 90% oleic acid, and at most 5% linolenic acid, preferably at most 4% linolenic acid, more preferably at most 3% linolenic acid. Oil composition.

In a preferred embodiment, the soybean seeds of the present invention are at least 80%, more preferably at least 90% oleic acid, and at most 5% linolenic acid, preferably at most 4% linolenic acid, more preferably at most 3% linolenic acid. Oil composition, wherein the nucleic acid sequence can reduce expression of FAD2-1 , FAD2-2 and at least one FAD3 gene. In a particularly preferred embodiment of this aspect, the nucleic acid sequence is selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 14, their complements and fragments of any one thereof.

In a preferred embodiment of the invention, the soybean seed of the invention has an oil composition of at least 50% oleic acid, more preferably at least 60%, at least 70%, at least 80% or at least 90% oleic acid.

In another preferred embodiment of the invention, the soy seed of the invention has an oil composition of up to 10% linolenic acid, more preferably up to 5%, up to 4% or up to 3% linolenic acid.

Similar genetic material also in other species, such as canola, corn, soybean, Arabidopsis thaliana (Arabidopsis), bean (Phaseolus), peanut, alfalfa, wheat, rice, oats, sorghum, rapeseed, rye, barley, millet, Kim Fescue, perennlal ryegrass, sugar cane, vine cranberry, papaya, banana, safflower, oil palm, flax, muskmelon, apple, cucumber, Dendrobium, gladiolus, chrysanthemum, lily, cotton, eucalyptus, sunflower, rapeseed ( Brassica campestris ), rape, grass, sugar beet, coffee and dioscorea (Christou, INO: Particle Bombardment for Genetic Engineering of Plants , Biotechnology Intelligence Unit.Academic Press, San Diego, Californla (1996)), which can be obtained from monocotyledonous or dicotyledonous plants, including but not limited to canola, corn, rapeseed, rapeseed, rapeseed, soy, cram Burlap, freshly, castor fruit, peanuts, Sesame, cottonseed, linseed, safflower, and oil palm, flax and sunflower are more preferred, and canola, a rapeseed, corn, rapeseed, rapeseed, soybean, sunflower, safflower, oil palm, and peanut more preferred. In a more preferred embodiment, the canola genetic material has been introduced into the canola. In another more preferred embodiment, the rapeseed dielectric material is introduced into the rapeseed. In another particularly preferred embodiment, soybean genetic material has been introduced into soybeans.

Levels of products such as transcripts or proteins can be increased or decreased throughout an organism, such as a plant, or can be located in one or more specific organs or tissues of the organism. Examples include roots, tubers, stems, leaves, stems, fruits, berries, nuts, barks, pods, seeds and flowers. In one or more plant tissues and organs, but not limited thereto, the level of the product may be increased or decreased. Preferred organs are seeds.

Foreign genetic material can be introduced into the host cell using a DNA vector or construct designed for the purpose of introduction. The design of such vectors is generally known to those skilled in the art (see, eg, Plant Molecular Biology: A laboratory Manual , Clark (ed.), Springer, New York (1997)).

The construct or vector may comprise a plant promoter for expressing the desired nucleic acid molecule. In a preferred embodiment, any of the nucleic acid molecules described herein can be operably linked with a promoter site that functions to cause the production of mRNA molecules in plant cells. For example, any promoter that functions to cause the production of mRNA molecules in plant cells can be used, such as but not limited to the promoters described herein. In a preferred embodiment, said promoter is a plant promoter.

Many promoters active in plant cells have been described in the literature. These include nopaline synthase (NOS) promoters (Ebert et al. , Proc. Natl. Acad. Sci. (USA) 84 : 5745-5749 (1987)), octopine synthase (OCS) promoters ( Carried in a tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens ), cauliflower mosaic virus (CaMV) 19S promoter (Lawton et al . , Plant Mol . Biol. 9 : 315-324 (1987)) and CaMV 35S Colimovirus promoters such as promoters (Odell et al ., Nature 313 : 810-812 (1985)), figwort mosaic virus 35S-promoter (US Pat. No. 5,378,619), ribulose-1,5-bis-phosphate carboxyl A photoinducible promoter from the bovine subunit of ssRUBISCO, the Adh promoter (Walker et al . , Proc. Natl. Acad. Sci. (USA) 84: 6624- 6628 (1987)), the sucrose synthase promoter (Yang et al., Proc. Natl. Acad. Sci. (USA) 87 : 4144-4148 (1990)), R gene complex promoter (Chandler et al., The Plant Cell 1 : 1175-1183 (1989)) and chlorophyll a / b binding protein gene promoters. These promoters are used to make DNA constructs expressed in plants; See PCT publication WO 84/02913. The CaMV 35S promoter is preferably used in plants. Promoters known or found to cause transcription of DNA in plant cells can be used in the present invention.

In addition, particularly preferred promoters may be used to express the nucleic acid molecules of the invention in seeds or fruits. Indeed, in a preferred embodiment, the promoter used is a seed specific promoter. Examples of such promoters are napin (Kridl et al., Seed Sci. Res. 1: 209-219 (1991)), phaseolin (Bustos et al., Plant Cell, 1 (9): 839-853 (1989) ), Soybean trypsin inhibitor (Riggs et al., Plant Cell 1 (6): 609-621 (1989)), ACP (Baerson et al., Plant Mol. Biol. , 22 (2): 255-267 (1993)), stearin Loyl-ACP desaturating enzyme (Slocombe et al . , Plant Physiol. 104 (4): 167-176 (1994)), a 'subunits of soy β-conglycinin (soy 7s, (Chen et al., Proc. Natl. Acad. Sci. , 83: 8560-8564 (1986)), and oleosin (e.g., Hong et al . , Plant Mol. Biol. , 34 (3): 549-555 (1997) . 5 'regulatory region from genes, such as Other examples include β-conglycinin promoters (Chen et al . , Dev. Genet. 10 : 112-122 (1989)) and FAE promoters (PCT publication WO 01/11061). Preferred promoters for expression in seeds are the 7S and napin promoters.

Other promoters that can be used are described, for example, in US Pat. No. 5,378,619; 5,391,725; 5,428,147; 5,447,858; 5,608,144; 5,608,144; 5,614,399; 5,633,441; 5,633,435; And 4,633,436. Tissue specific enhancers can also be used (Fromm et al., The Plant Cell 1 : 977-984 (1989)).

In addition, the construct or vector may comprise a nucleic acid sequence which, together with the desired region, serves to terminate, in whole or in part, the transcription of that region. Many such sequences are isolated, including the Tr7 3 'sequence and the NOS 3' sequence (Ingelbrecht et al., The Plant Cell 1 : 671-680 (1989); Bevan et al., Nucleic Acids Res. 11 : 369-385 (1983)). It became. In addition, the plant expression construct of the present invention may be provided with a regulatory transcription termination region. The transcription termination region may be provided by a DNA sequence encoding a desired gene or may be derived from a transcription termination region in which a convenient transcription termination region is originally associated with another gene source, such as a transcription initiation region. Those skilled in the art will recognize that any convenient transcription termination region that can terminate transcription in plant cells can be used in the constructs of the present invention.

In addition, the vector or structure may include adjustment elements. Examples of these include Adh intron 1 (Callis et al., Genes and Develop. 1 : 1183-1200 (1987)), sucrose synthase introns (Vasil et al . , Plant Physiol. 91 : 1575-1579 (1989)) and TMV omega elements (Gallie et al., The Plant Cell 1 : 301-311 (1989)). If appropriate, these and other control elements may be included.

In addition, the vector or structure may include a selectable marker. In addition, selection markers can be used to select plants or plant cells that contain foreign genetic material. Examples of these include, but are not limited to, the neo gene (Potrykus et al . , Mol. Gen. Genet . 199 : 183- coding for kanamycin resistance and that can be selected using kanamycin, RptII, G418 and hpt) . 188 (1985)); Bar gene coding for bialaphos resistance; Variant EPSP synthase genes (Hinchee et al., Bio / Technology 6: 915-922 (1988); Reynaerts et al., Selectable and Screenable Markers. In Gelvin and Schilperoort.Plant Molecular Biology Manual, Kluwer, Dordrecht (1988)); AadA encoding glyphosate resistance (Jones et al . , Mol. Gen. Genet. (1987)); Nitrilease gene (Stalker et al . , J. Biol. Chem. 263 : 6310-6314 (1988)) conferring resistance to bromoxynil; Mutation Acetolactate synthase (ALS) (European Patent Application No. 154,204 (Sept. 11,1985)) conferring imidazolinone or sulfonylurea resistance, ALS (D'Halluin et al., Bio / Technology 10: 309-314 (1992)) and mesotrexate resistant DHFR gene (Thillet et al., J. Biol. Chem. 263 : 12500-12508 (1988)).

In addition, the vector or structure may comprise a screenable marker. Screening markers can be used to monitor expression. Examples of these screening markers include: β-glucuronidase or uid A gene (GUS) (Jefferson, Plant Mol. Biol ), which encodes enzymes for which various chromogenic substrates are known . , REP. 5 : 387-405 (1987); Jefferson et al., EMBO J 6 : 3901-3907 (1987)); R-locus gene (Dellaporta et al., Stadler Symposium 11 : 263-282 (1988)) encoding a product that regulates the production of anthocyanin pigment (red) in plant tissues; β-lactamase gene (Sutcliffe et al . , Proc. Natl. Acad. Sci (USA) 75: 3737-3741 (1978)), genes encoding enzymes for which various chromogenic substrates are known (eg, PADAC, Cro Genetic cephalosporins); Luciferase gene (Ow et al., Science 234 : 856-859 (1986)); Xyl E gene (Zukowsky et al . , Proc. Natl. Acad. Sci. (USA) 80 : 1101-1105 (1983)) encoding catechol deoxygenase capable of converting chromogenic catechol; α-amylase gene (Ikatu et al., Bio / technol . 8 : 241-242 (1990)); Tyrosinase gene (Katz et al., J. Gen. Microbiol. 129 : 2703-2714 (1983)) that encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone and subsequently condensing to melanin; Α-galactosidase capable of converting chromogenic α-galactose substrates.

The term "selection or screening marker gene" also includes the meaning of a gene encoding a secretory marker whose secretion can be detected as a means of identifying and selecting transformed cells. Examples include markers encoding secretory antigens that can be identified by antibody reactions, or even secretory enzymes that can be detected catalytically. Secretory proteins are small detectable proteins (eg, by ELISA), diffuseable proteins, small active enzymes detectable in extracellular solutions (eg, α-amylase, β-lactamase, phosphinothricin transferase). transferases, or proteins that are inserted or trapped into the cell wall (such as proteins containing leader sequences such as those found in extended expression units or tobacco PR-S). And / or screening marker genes will be known to those skilled in the art.

It is understood that two or more nucleic acid molecules of the present invention may be introduced into a plant using a single construct, which construct may comprise one or more promoters. In an embodiment wherein the construct is designed to express two nucleic acid molecules, the two promoters are (i) two constitutive promoters, (ii) two seed-specific promoters, or (iii) one ratio It is preferred that it is a regulatory promoter and one seed-specific promoter. Preferred seed-specific and unregulated promoters are the napin and CaMV promoters, respectively. Exemplary combinations are shown in Example 8. Two or more nucleic acid molecules can be physically linked and expressed using a single promoter, preferably seed-specific or unregulated promoter.

It is understood that two or more nucleic acids of the invention can be introduced into one plant using two or more different constructs. Alternatively, two or more nucleic acids of the invention can be introduced into two different plants, and the plants can be crossed to produce one plant expressing two or more nucleic acids. In RNAi embodiments, it is understood that the sense and antisense strands can be introduced into the same plant as one construct or two constructs. Alternatively, the sense and antisense strands can be introduced into two different plants, and the plants can be crossed to produce one plant that expresses both the sense and antisense strands.

Any of the nucleic acid molecules and constructs of the invention may be introduced into a plant or plant cell in a permanent or temporary manner. Preferred nucleic acid molecules and structures of the invention are described in the detailed description and examples. Another embodiment of the invention generally produces a transgenic plant comprising selecting a suitable plant or plant cell and transforming the plant or plant cell with a recombinant vector to obtain a transformed host cell. It is about how to.

In a preferred embodiment, the plant or cell is associated with or derived from the production of edible or industrial plant oils. Temperate seed oil grains are particularly preferred. Desired plants include rapeseed (canola and High Erucic Acid variants), corn, soybeans, crampes, freshly, castor fruit, peanuts, sesame seeds, cotton, linseed, safflower, oil palm, flax, sunflower And coconuts. The invention is equally applicable to monocotyledonous or dicotyledonous plant species and will be readily applicable to new and / or improved transformants and regulatory techniques.

Methods and techniques for introducing DNA into plant cells are well known to those skilled in the art, and indeed any method by which nucleic acid molecules can be introduced into cells is suitable for use in the present invention. Non-limiting examples of suitable methods include the following; Physical methods such as microinjection, electroporation, gene gun, microprojectile bombardment and vacuum infiltration; Viral vector; And receptor-mediated mechanisms. In addition, other cell transformation methods may be used, such as direct introduction of DNA into pollen, direct injection of DNA into the reproductive organs of plants, or direct injection of DNA into cells of immature embryos, followed by drying Including but not limited to a method of introducing DNA into the plant by a method of rehydrating the embryo.

Agrobacterium (Agrobacterium) - introduction of a parameter is a system that is widely used to introduce a gene into a plant cell. See, eg, Fraley et al., Bio / Technology 3 : 629-635 (1985); Rogers et al . , Methods Enzymol. 153 : 253-277 (1987). The DNA region to be introduced is defined by the border sequence, and intervening DNA is usually inserted into the genome of the plant. Spielmann et al . , Mol. Gen. Genet. 205 : 34 (1986). Current Agrobacterium transforming vectors can be cloned in Agrobacterium as well as E. coli , which allows convenient manipulation. Klee et al., In: Plant DNA Infectious Agents , Hohn and Schell (eds.), Springer-Verlag, New York, pp. 179-203 (1985).

It is well known in the art to regenerate, grow and grow plants from a single plant protoplast transformant or from various transgenic explants. In general, Maliga et al., Methods in Plant Molecular Biology , Cold Spring Harbor Press (1995); See Weissbach and Weissbach, In: Methods for Plant Molecular Biology , Academic Press, San Diego, CA (1988). The plant of the present invention may be part of the breeding program or derived from the program and may also be reproduced using apomixis. Methods of regenerating apomixis plants are known in the art. See, for example, US Pat. No. 5,811,636.

Cosuppression means the reduction of the expression level of a particular endogenous gene or genotype, usually RNA, by expression of homologous sense constructs capable of transcription of stranded mRNA, such as an endogenous gene transcript. (Napoli et al., Plant Cell 2 : 279-289 (1990); van der Krol et al., Plant Cell 2 : 291-299 (1990)). Cosuppression is a single copy of a nucleic acid molecule that is homologous to a nucleic acid sequence found in a cell (Prolls and Meyer, Plant J. 2.465-475 (1992)), or multiple nucleic acid molecules that are homologous to a nucleic acid sequence found in a cell. Due to stable transformation by copying (Mittlesten et al., Mol. Gen. Genet. 244.325-330 (1994)). Genes linked to homologous promoters, although different, can induce cospression of linked genes (Vaucheret, CR Acad. Sci. III 316: 1471-1483 (1993); Flavell, Proc. Natl. Acad. Sci. ( USA) 91 : 3490-3496 (1994)); van Blokland et al., Plant J. 6 : 861-877 (1994); Jorgensen, Trends Biotechnol. 8 : 340-344 (1990); Meins and Kunz, In: Gene Inactivation and Homologous Recombination in Plants , Paszkowski (ed.), Pp.335-348, Kluwer Academic, Netherlands (1994)) (Kinney, Induced Mutations and Molecular Techniques for Crop Improvement, Proceedings of a Symposium 19-23 June 1995 (organized and merged by IAEA and FA), pp. 101-113 (IAEA-SM 340-49).

It is understood that one or more nucleic acids of the present invention may be introduced into plant cells and transcribed using a suitable promoter, the transcription of which may induce cosuppression of endogenous proteins. Such nucleic acid molecules may be operably linked with the same promoter, or other promoters of polycistronic structures.

The antisense approach is a method of inhibiting or reducing the function of genes targeting genetic material (Mol et al . , FEBS Lett. 268 : 427-430 (1990)). The goal of this antisense approach is to use complementary sequences for target genes to prevent mutant expression and to produce mutant cell lines or organisms in which the level of one selected protein is selectively reduced or eliminated. Antisense technology has several advantages over other "reverse genetic" approaches. Inactivation sites and their effects can be manipulated by selection of a promoter for an antisense gene, or by timing of external application or microinjection. Antisense can manipulate its specificity by selecting a unique region of the target gene or a region that shares homology with other related genes (Hiatt et al., In: Genetic Engineering , Setlow (ed.), Vol. 11, New York: Plenum 49-63 (1989).

Antisense RNA technology involves the introduction of RNA complementary to the target mRNA into cells, resulting in specific RNA: RNA double strands formed by base pairing between the antisense substrate and the target mRNA (Green et al., Annu . Rev. Biochem. 55 : 569-597 (1986)). In one embodiment, the process comprises the introduction and expression of an antisense gene sequence. The sequence is the reverse of a portion or all of the normal gene sequence in the promoter subposition, resulting in transcription of non-coding or non-complementary strands into non-coding antisense RNA that hybridizes with the target mRNA, inhibiting its expression (Takayama and Inouye, Crit. Rev. Biochem.Mol . Biol. 25 : 155-184 (1990)). Antisense vectors are constructed by standard methods and introduced into cells by methods including, but not limited to, transformation, transduction, electroporation, microinjection and infection. The type of transformation and the choice of vector will depend on whether the expression is transient or stable. Promoters used for antisense genes can affect the level, timing, tissue, specificity or inducibility of antisense inhibition.

It has also been reported that the introduction of double stranded RNA into cells can be used to disrupt the function of endogenous genes (Fire et al ., Nature 391 : 806-811 (1998)). Such disruption has been demonstrated, for example in Caenorhabditis elegans , and is often referred to as RNA interference or RNAi (Fire et al ., Nature 391 : 806-811 (1998)). Destruction of gene expression in C. elegans by double-stranded RNA has been reported to induce suppression by post-transcriptional mechanisms (Montgomery et al . , Proc. Natl. Acad. Sci. 95 : 15502-15507 (1998). Evidence of gene silencing by double stranded RNA has also been reported for plants (Waterhouse et al . , Proc. Natl. Acad. Sci. 95 : 13959-13964 (1998)).

It has been reported that intron-spliced hairpin structures can also be used to induce post-transcriptional gene suppression (Smith et al ., Nature 407 : 319-320 (2000)). Reports indicate that post-transcriptional gene silencing can be induced at nearly 100% efficiency by the use of intron-spliced RNA with hairpin structures (Smith et al ., Nature 407 : 319-320 (2000)).

It is understood that one or more nucleic acids of the invention may be modified to be effective for RNAi or other post-transcriptional gene suppression methods.

The invention also provides parts of the plant, in particular parts of the reproductive or reservoir organs. Portions of the plant include seeds, endosperm, seed, pollen, roots, tubers, stems, leaves, stems, berries, berries, nuts, barks and pods. pods), seeds and flowers. In a particularly preferred embodiment of the invention, the part of the plant is a seed.

In addition, the present invention provides at least 10,000, more preferably at least 20,000 and even more preferably at least 40,000 seed containers, wherein at least 10% of the seeds, more preferably at least 25%, more preferably Is at least 50%, and even more preferably at least 75% or 90% are seeds derived from the plants of the invention.

The invention also provides a seed container of at least 10 kg, more preferably at least 25 kg and even more preferably at least 50 kg, wherein at least 10%, more preferably at least 25%, more preferably 50% of said seeds. And, even more preferably, at least 75% or 90% are seeds derived from the plants of the present invention.

Any of the plants of the present invention or portions thereof can be processed to produce feed, food, protein or oil preparations. Particularly preferred plant parts for the purposes of the present invention are seeds. In a preferred embodiment, the feed, food, protein or oil preparation is designed for livestock or humans or both. Methods for preparing feed, food, protein or oil preparations are known in the art. See, for example, US Pat. Nos. 4,957,748, 5,100,679, 5,219,596, 5,936,069, 6,005,076, 6,146,669 and 6,156,227. In a preferred embodiment, the protein preparation is a high protein preparation. Such high protein preparations preferably have a protein content of at least 5% w / v, more preferably at least 10% w / v and even more preferably at least 15% w / v. In a preferred oil formulation, the oil formulation is at least 5% w / v, more preferably at least 10% w / v and even more preferably at least 15% w / v of the plant or part thereof of the present invention. Oil content. In a preferred embodiment, the oil preparation is a liquid and has a volume of at least 1, 5, 10 or 50 liters. The present invention provides an oil produced from the plant of the present invention or produced by the method of the present invention. The oil may exhibit increased oxidative stability. The oil may also be a minor component or major component of any resulting product. Moreover, the oil can be mixed with other oils. In a preferred embodiment, the oil produced from the plant of the invention or produced by the process of the invention is 0.5%, 1%, 5%, 10%, 25% by volume or weight of the oil component of any product. , 50%, 75% or 90% or more. In other embodiments, the oil preparation may be mixed and may constitute at least 10%, 25%, 35%, 50% or 75% of the mixture by volume. The oil produced from the plant of the present invention may be mixed with one or more organic solvents or petroleum distillates.

In one embodiment, the oil of the invention has an oil composition of at least 50% oleic acid and up to 10% linolenic acid. In another embodiment, the oil of the present invention has an oil composition of at least 60% oleic acid and up to 7% linolenic acid. In another embodiment, the oil of the invention has an oil composition of at least 65% oleic acid and at most 5% linolenic acid, preferably at most 4% linolenic acid, and more preferably at most 3% linolenic acid.

In another embodiment, the oil of the present invention has an oil composition of 50-90% oleic acid and 10% linolenic acid. In another embodiment, the oil of the invention has an oil composition of 60-80% oleic acid and 7% linolenic acid. In another embodiment, the oil of the present invention has an oil composition of 65-75% oleic acid and 5% or less linolenic acid, preferably 4% or less linolenic acid, and more preferably 3% or less linolenic acid.

In another embodiment, the oil of the invention is an oil of at least 80%, more preferably at least 90% oleic acid and at most 5% linolenic acid, preferably at most 4% linolenic acid, and more preferably at most 3% linolenic acid. Has a composition. In another embodiment, the oil of the invention has an oil composition of at least 50% oleic acid, more preferably at least 60%, at least 70%, at least 80%, at least 90% oleic acid. In another embodiment, the oils of the invention have an oil composition of up to 10% linolenic acid, preferably up to 5%, up to 4%, up to 3% linolenic acid.

Plants of the invention may be part of a breeding program or derived from such a program. The choice of breeding method depends on the type of plant regeneration, the heritability of the trait (s) being improved and the type of commercialized variety (eg F ₁ hybrid variety, purebred variety, etc.). A non-limiting approach, chosen for the breeding of the plant of the present invention, is described below. Any breeding offspring can be screened using markers to enhance the breeding program. It is understood that any commercial and emergency somatoma can be used in a breeding program.

In non-limiting sarcoma examples, soybean FAD2-1A intron inhibitor lines are derived from spontaneous mutations or targeted induced local defects in genomes (TILLING) (McCallum et al ., Nature Biotech, 18 : 455) -457 (2000)), low linolenic acid soybean FAD3 mutations derived from methods such as, but not limited to, gene replacement using RNA / DNA chimeric oligonucleotides, homologous recombination, and T-DNA or transposon mutagenesis. It can be used to pollinate notes. To determine the levels of FAD2-1, FAD2-2, FAD3-1A, FAD3-1C, and FAD3-1B transcripts, include both one or more expressed FAD2 intron regions including knock outs and FAD3 mutations RNA from soybean seeds can be screened using Northern blots (as described in Example 5). The resulting plant was expected to have both parental properties. For fatty acid composition, soybean plants with undetectable or low levels of FAD2 or FAD3 transcripts can be screened.

Plants of the invention can be, for example, part of a breeding program or derived from such a program, wherein the soybean FAD3-1A, FAD3-1B and / or FAD3-1C intron inhibitors are derived from spontaneous mutations, or for example TILLING. Soybean plants with low levels of oleic acid containing FAD2 mutants derived from methods such as, but not limited to, gene replacement using RNA / DNA chimeric oligonucleotides, homologous recombination, and T-DNA or transposon mutagenesis. It can be used to pollinate. To determine the levels of FAD2-1, FAD2-2, FAD3-1A, FAD3-1B, and FAD3-1C transcripts, include both one or more expressed FAD3 intron regions, including knock outs, and FAD2 mutations RNA from soybean seeds can be screened using Northern blots (as described in Example 5). For fatty acid composition, soybean plants with undetectable or low levels of FAD2 or FAD3 transcripts can be screened. The resulting plant was expected to have both parental properties.

The development of new varieties requires the development and selection of variants, the hybridization of these variants and the good hybrid crosses. The hybrid seeds can be produced by hand crossing between selected male-fertilized parents or by using male sterility systems. Hybrids were chosen for any single genetic trait, such as pod color, flower color, seed yield, downy or herbicide resistance, indicating that the seed is a true hybrid. In addition to the traits of the hybrid, additional data about the parental system influence the breeder's decision as to whether to continue a particular hybrid cross. Parents in such hybrid production are for example soybean FAD2-1A intron inhibitors , soybean FAD3-1A , FAD3-1B and / or FAD3-1C intron inhibitors , or FAD2-1A , FAD3-1A, FAD3-1B and And / or intron inhibitors comprising FAD3-1C in any desired combination. Any of these parents may be crossed with naturally occurring or artificially generated mutants with, for example, increased levels of oleic acid and / or reduced levels of linolenic acid.

Backcross breeding has been used to deliver genes for simple inherited, highly heritable traits, such as transgenes, into the reproductive parent, the desired homologous cultivar or inbred line. . Results The plant was expected to have the attributes of the reproducible parent (eg varieties) and the desired traits received from the donor parent. After initial mating, individuals with the phenotype of the donor parent were selected and repeatedly crossed (female) with the reproducing parent. Results The plant was expected to have the attributes of the reproducible parent (eg varieties) and the desired traits received from the donor parent. Donor parents in such crossbreeding production are, for example, soybean FAD2-1A intron inhibitors , or soybean FAD3-1A , FAD3-1B and / or FAD3-1C intron inhibitors , or FAD2-1A , FAD3-1A, FAD3 Intron inhibitors comprising -1B and / or FAD3-1C in any desired combination. The reproducing parent may be any naturally occurring or artificially occurring mutant strain, for example, with increased levels of oleic acid and / or reduced levels of linolenic acid.

Computer Readable Medium

Nucleotide sequence provided as SEQ ID NO: 1 to 15, 18, 19, 22, 23, or a fragment thereof or the complement thereof, or SEQ ID NO: 1 to 15, 18, 19, 22, 23, or their At least 50%, 60% or 70%, preferably 80% or 85%, particularly preferably 90% or 95%, or particularly very preferably 97%, 98% of the sequences provided as fragments or their complements Or nucleotide sequences having 99% homology, may be “provided” in a variety of media to facilitate use. Such media can also provide a subset thereof in a form that allows one of ordinary skill in the art to search for such sequences.

In one application of embodiments of the invention, the nucleotide sequences of the invention may be recorded in computer readable media. By "computer readable medium" is meant any medium that can be directly deciphered and accessed by a computer. Such media include, but are not limited to: floppy disks, hard disks, storage media, and magnetic tape; Optical storage media such as CD-ROM; Electronic storage media such as RAM and ROM; And hybrids of this category, such as magnetic / optical storage media. Those skilled in the art will readily understand how any computer readable medium currently known can be used to make a product comprising a computer readable medium having recorded the nucleotide sequences of the present invention.

Here, "recording" means a process for storing information in a computer-readable medium. One skilled in the art can readily employ any of the currently known methods for recording information on computer readable media to produce a medium comprising the nucleotide sequence information of the present invention. To prepare a computer readable medium having recorded nucleotide sequences of the present invention, those skilled in the art can use various data storage structures. The choice of the data storage structure is generally based on the means selected for accessing the stored information. In addition, various data processor programs and formats can be used to store the nucleotide sequence information of the present invention in a computer readable medium. The sequence information may be formatted in commercially available software such as Word Perfect and Microsoft Word, and may be represented in a word processing text file or in the form of an ASCII file and stored in a database application such as DB2, Sybase, Oracle, or the like. Can be. Those skilled in the art can readily apply several data processor structured formats (eg, text files or databases) to obtain computer readable media having recorded nucleotide sequence information of the present invention.

By providing one or more nucleotide sequences of the present invention, those skilled in the art can readily access the sequence information for various purposes. Computer software can be widely used to enable those skilled in the art to access sequence information provided in a computer readable medium. Software that runs BLAST (Altschul et al., J Mol. Biol. 215 : 403-410 (1990)) and BLAZE (Brutlag et al. , Comp. Chem. 17 : 203-207 (1993)) search algorithms on Sybase systems It can be used to identify nucleic acid molecules other than noncoding regions of the invention in the genome that have homology to noncoding regions derived from an organism. These noncoding regions are commercially important proteins, such as amino acid biosynthesis, metabolism, transcription, translation, RNA processing, nucleic acid and protein degradation, protein modification, and enzymes used for DNA replication, restriction enzyme processing, modification, recombination, and repair. It can be used to influence the expression of.

The invention also provides a system, in particular a computer-based system, having the sequence information described herein. The system is designed to identify commercially important fragments of the nucleic acid molecules of the present invention. Here, "computer-based system" means hardware means, software means and data storage means used to analyze nucleotide sequence information of the present invention. The minimum hardware means of the computer-based system of the present invention includes a central processing unit (CPU), input means, output means and data storage means. Those skilled in the art will readily appreciate that any of the computer-based systems currently available are suitable for use in the present invention.

As noted above, the computer-based system of the present invention includes data storage means in which the nucleotide sequences of the present invention are stored, and hardware and software means necessary for assisting and executing retrieval means. Here, "data storage means" means a memory capable of storing the nucleotide sequence information of the present invention, or a memory access means capable of accessing a product in which the nucleotide sequence information of the present invention is recorded. Herein, "search means" means one or more programs provided to a computer-based system for comparing a target sequence or target structural motif with sequence information stored in the data storage means. Search means were used to identify fragments or regions of the sequence of the invention that match a particular target sequence or target site. Various known algorithms are widely disclosed, and a variety of commercially available software for executing the retrieval means is available and can be used in the computer-based system of the present invention. Examples of such software include, but are not limited to, MacPattern (EMBL), BLASTIN, and BLASTIX (NCBLA). One of the algorithms or executable software packages available for performing homology searches may be applied for use in the computer-based system of the present invention.

The most preferred sequence length of the target sequence is about 10-100 amino acids, or about 30-300 nucleotide residues. However, it will be readily appreciated that while searching for commercially important fragments of nucleic acid molecules of the invention, such as sequence fragments involved in gene expression and protein processing, the target sequence may have a shorter length.

Here, "target structural site" or "target site" means any suitably selected sequence or combination of sequences that is selected based on the three-dimensional structure that is formed upon folding of the target site. Various target sites are known in the art. Protein target sites include, but are not limited to, enzyme active sites and signal sequences. Nucleic acid target sites include, but are not limited to, promoter sequences, cis elements, hairpin structures, and inducible expression elements (protein binding sequences).

Accordingly, the present invention also provides input means for receiving a target sequence, data storage means for storing the target sequence of the sequence of the present invention identified using said searching means, and output means for outputting the identified homologous sequence. To provide. Various structural formats for input and output means can be used for input and output information in the computer-based system of the present invention. The preferred format of the output means ranks fragments of the sequences of the invention by varying the degree of homology to the target sequence or target site. This description provides those skilled in the art with a ranking of sequences that includes varying amounts of target sequences or target sites and confirms the degree of homology included in the identified fragments.

To identify the sequence fragment sequences of the present invention, various comparison means can be used to compare the data storage means with the target sequence or target site. For example, execution software that executes the BLAST and BLAZE algorithms (Altschul et al., J. Mol. Biol. 215 : 403-410 (1990)) can be used to identify noncoding regions within the nucleic acid molecules of the present invention. . Those skilled in the art can readily appreciate that any of the commercially available homology search programs can be used as a search means for the computer-based system of the present invention.

Example 1 Cloning of Desaturase Gene Sequences

1A. Soybean Δ12 Desaturated Enzyme (FAD2-1)

The soy FAD2-1A sequence was identified by screening soybean genomic libraries using soy FAD2-1 cDNA probe. Three candidate soybean FAD2-1 clones were identified and plaques were purified. Two of the three soybean FAD2-1 clones were sequenced by linking to pBluescript II KS + (Stratagene). Both genomic clones (14-1 and 11-12) were identical and the corresponding sequences in the soybean FAD2-1 cDNA were completely identical. The sequence of the entire FAD2-1A clone is provided as SEQ ID NO: 15.

Prior to obtaining full-length clones, a portion of the FAD2-1A genomic clone was prepared using cDNA (primer 11698: primers 12506, 5'-ATACAA GCCACTAGGCAT-3 ', SEQ ID NO: 16) designed from 5' unsaturated sequences. PCR amplification was carried out in 5'-GATTGGCCATGCAATGAGGGAAAAGG-3 ', SEQ ID NO: 17). The resulting PCR product was cloned and sequenced into vector pCR 2.1 (Invitrogen, Carlsbad, CA.). Soybean FAD2-1A partial genome clone (SEQ ID NO: 18) of soybean with intron portion (SEQ ID NO: 1) was identified by comparison with soybean cDNA sequence using the Pustell comparison program on Macvector It was. The FAD2-1A intron sequence (SEQ ID NO: 1) starts after the ATG start codon and has 420 base lengths.

The second FAD2-1 gene family member is also identified and cloned, referred to herein as FAD2-1B . The soybean FAD2-1B partial genomic clone (SEQ ID NO: 19) has a coding region (base pairs 1783-1785 and 2191-2463) and an intron region (base pairs 1786-2190), which is based on a first vector comparison program for beans in Macvector. This was confirmed by comparison with the cDNA sequence of. The FAD2-1B intron sequence (SEQ ID NO: 2) starts after the ATG start codon and has 405 base lengths. Another region of the FAD2-1B partial genomic clone (SEQ ID NO: 19) contains one promoter (base pair 1-1704 ) (SEQ ID NO: 22) and 5'UTR (base pair 1705-1782).

1B. Soybean Δ15 desaturated enzyme (FAD3)

The partial bean FAD3-1A genomic sequence was derived from soybean DNA using the primers 10632: 5'-CUACUACUACUACTCGAGACAAAGCCTTTAGCCTATG-3 '(SEQ ID NO: 20) and 10633: 5'-CAUCAUCAUCAUGGATCCCATGTCTCTCTATGCAAG-3' (SEQ ID N0: 21). PCR amplification. An Expand Long Template PCR system (Roche Applied Sciences, Indianapolis) was used according to the manufacturer's instructions. The resulting PCR product was cloned into the vector pCR2.1 (Invitrogen) and sequenced. The soy FAD3-1A partial genomic clone sequence (SEQ ID NO: 23) and intron regions were confirmed by comparison with the soy FAD3-1A cDNA sequence using the Pastel comparison program in the Macvector.

From the identified partial genomic soybean FAD3-1A sequence (SEQ ID NO: 23), seven introns were identified: FAD3-1A intron # 1 (SEQ ID NO: 5), FAD3-1A intron # 2 (SEQ ID NO : 6), FAD3-1A Intron # 3A (SEQ ID NO: 7), FAD3-1A Intron # 4 (SEQ ID NO: 8), FAD3-1A Intron # 5 (SEQ ID NO: 9), FAD3-1A Intron # 3B (SEQ ID NO: 10), and FAD3-1A intron # 3C (SEQ ID NO: 11). FAD3-1A Intron # 1 is 191 base pairs long, located between 294 and 484, FAD3-1A Intron # 2 is 346 base pairs long, located between 577 and 922, and FAD3-1A intron # 3A Is 142 base pairs long, located between 991 and 1132, FAD3-1A intron # 3B is 98 base pairs long, is located between 1224 and 1321, and FAD3-1A intron # 3C is 115 base pairs long , Located between 1509 and 1623, FAD3-1A intron # 4 is 1228 base pairs long, between 1707 and 2934, and FAD3-1A intron # 5 is 625 base pairs long, 3075 and 3699 Located between times.

The partial soy FAD3-1B genomic sequence was PCR amplified from soybean DNA using the primers 19386: 5'-GGTAACAGAGAAAGAAACATTTGAGC-3 'and 19369: 5'- GCATGCTAACAAAAGTAAGTGC-3'. Amplified enteric PCR system (Roche Applied Sciences, Indianapolis) was used according to the manufacturer's instructions. The resulting PCR product was cloned into the vector pCR 2.1 TOPO (Invitrogen) and sequenced. The soy FAD3-1B partial genomic clone sequence and intron region were confirmed by comparison with the soy FAD3-1B cDNA sequence using the Firstel program at Sequencher. From the identified partial genomic soybean FAD3-1B sequences, seven introns were identified: FAD3-1B intron # 1, FAD3-1B intron # 2, FAD3-1B intron # 3A, FAD3-1B intron # 4 (SEQ ID NO : 13), FAD3-1B intron # 5, FAD3-1B intron # 3B and FAD3-1B intron # 3C (SEQ ID NO: 12).

Example 2 Expression Constructs

2A. Fabrication of pCGN5468, pCGN5469, pCGN5471, pCGN5485 and pCGN5486

The FAD2-1A intron sequence (SEQ ID NO: 1) is a template for the FAD2-1A partial genomic clone (SEQ ID NO: 18) and the primer 12701 (5'-ACGAATTCCTCGAGGTAAA TTAAATTGTGCCTGC-3 ') (SEQ ID NO: 24) and PCR amplification was performed using 12702 (5'- GCGAGATCTATCG ATCTGTGTCAAAGTATAAAC-3 '(SEQ ID NO: 25)). The resulting amplification product was cloned and sequenced into vector pCR 2.1 (Invitrogen). The FAD2-1A intron was then cloned into pCGN3892, an expression cassette, in the sense and antisense directions. Vector pCGN3892 contains the 7S promoter of soybean and RBCS 3 ′ of peas. Both gene fusions were then linked to pCGN9372, a vector containing the CP4 gene, each regulated by the FMV promoter. The resulting expression constructs (pCGN5469 sense (FIG. 2) and pCGN5471 antisense (FIG. 3)) were used to transform soybeans using the following biological methods.

The FAD2-1B intron sequence (SEQ ID NO: 2) is a template for the FAD2-1B partial genome clone (SEQ ID NO: 19) and primer 13883 (5'- GCGATCGATGTATGATGCTAAATTAAATTGTGCCTG-3 '(SEQ ID NO: 28)) and 13876. PCR amplification using (5'-GCGGAATTCCTGTGTCAAAGTATAAAGAAG-3 '(SEQ ID NO: 29)). The resulting amplification product was cloned and sequenced into vector pCR 2.1 (Invitrogen). FAD2-1B intron fused to plasmid pCGN5468 (FIG. 1) (containing the soy 7S promoter fused to FAD2-1A intron (sense) and pea RBCS 3 ′) or pCGN5470 ( FAD2-1A intron (antisense) and pea RBCS 3 ′ Soybean 7S promoter) and the 3 'end of the FAD2-1A intron in the sense and antisense directions, respectively.

The resulting intron binding fusion was then linked to pCGN9372, a vector containing the CP4 gene, each regulated by the FMV promoter. The resulting expression constructs (pCGN5485 (FIG. 4), FAD2-1A and FAD2-1B intron sense; and pCGN5486 (FIG. 5), FAD2-1A and FAD2-1B intron antisense) were used to transform soybeans using the following biological methods: Was used to.

2B. FAD3-1A  Intron PCR Amplification

Four of the seven introns identified from the soybean FAD3-1A genomic clone were PCR amplified using the following as the FAD3-1A partial genomic clone and primer as template: FAD3-1A intron # 1, primer 12568: 5'-GATCGATGCCCGGGGTAATAATTTTTGTGT -3 '(SEQ ID NO: 30) and 12569: 5'-CACGCCTCGAGTGTTCAATTCAATCAATG-3' (SEQ ID NO: 31); FAD3-1A Intron # 2, Primer 12514: 5'-CACTCGAGTTAGTTCATACTGGCT-3 '(SEQ ID NO: 32) and 12215: 5'-CGCATCGATTGCAAAATCCATCAAA-3' (SEQ ID NO: 33); FAD3-1A Intron # 4, Primer 10926: 5'-CUACUACUACUACTCGAGCGTAAATAGTGGGTGAACAC-3 '(SEQ ID NO: 34) and 10927: 5'-CAUCAUCAUCAUCTCGAGGAATTCGTCCATTTTAGTACACC-3' (SEQ ID NO: 35); FAD3-1A Intron # 5, Primer 10928: 5'-CUACUACUACUACTCGAGGCGCGT ACATTTTATTGCTTA-3 '(SEQ ID NO: 36) and 10929: 5'-CAUCAUCAUCAUCT CGAGGAATTCTGCAGTGAATCCAAATG-3' (SEQ ID N0: 37). The PCR product obtained for each intron was cloned into the vector pCR2.1 (Invitrogen) and sequenced.

2C. Fabrication of pCGN5455, pCGN5459, pCGN5456, pCGN5460, pCGN5466 and pCGN5473

FAD3-1A introns # 1, # 2, # 4 and # 5 were connected to pCGN3892 in sense and antisense directions, respectively. pCGN3892 contains a soybean 7S promoter and pea RBCS 3 '. These fusions were linked to pCGN9372, a vector containing the CP4 gene regulated by the FMV promoter for soybean transformation. Expression constructs obtained (pCGN5455 (FIG. 12), FAD3-1A intron # 4 sense; pCGN5459 (FIG. 13) containing FAD3-1A intron # 4 antisense; pCGN5456, FAD3 intron # 5 sense; pCGN5460, FAD3-1A intron # 5 Antisense; pCGN5466 containing FAD3-1A intron # 2 antisense (pCGN5473 (FIG. 9) containing FAD3-1A intron # 1 antisense) was used to transform soybeans using the following biological methods: It became.

Introns # 3C and # 4 were also PCR amplified from the second FAD3 gene family member ( FAD3-1B ). Soy FAD3-1B introns #C and # 4 were PCR amplified from soybean DNA using the following primers: 5'CATGCTTTCTGTGCTTCTC 3 '(SEQ ID N0: 26) and 5' GTTGATCCAACCATAGTCG 3 '(SEQ ID N0: 27) . PCR products were cloned and sequenced into vector pCR 2.1 (Invitrogen). The sequences of FAD3-1B introns # 3C and # 4 are provided as SEQ ID NOs: 12 and 13, respectively.

Intron # 4 was PCR amplified from FAD3-1A, FAD3-1B and FAD3-1C , three soybean FAD3 gene family members. Intron # 4 of the FAD3-1A gene is a FAD3-1A partial genomic clone as a template, and primers 10926: 5'-CUACUACUACUACTCGAGCGTAAATAGTGGGTGAACAC-3 '(SEQ ID N0: 34) and 10927: 5'-CAUCAUCAUCAUCTCGAGGAATTCGTCCATTTTAGTACACC-3' PCR amplification using NO: 35). Intron # 4 of the FAD3-1B gene was PCR amplified using soybean genomic DNA as a template, and primers # 17823: GTATCCCATTTAACAC and # 17824: CTGTGAAATTACATATAG. Intron # 4 of the FAD3-1C gene was PCR amplified using soybean genomic DNA as a template, and primers # 17826: GCGCCGCTCGAGCTGTCCATTTTTGTACAC and # 17825: CCGGCGCTCGAGGTAACAAAAATAAATAGAAAATAGTGAGTG. The PCR product obtained for each intron was cloned and sequenced into vector pCR 2.1 (Invitrogen). FAD3-1A intron # 4 was linked to pCGN3892 in the sense direction. The resulting expression cassette, pCGN5453, contains the 7S alpha 'promoter fused to FAD3-1A intron # 4 with pea RBCS 3'.

2D. pMON68521

To construct pMON68521 (FIG. 10), pCGN5453 (7S alpha ′ promoter was fused with FAD3-1A intron # 4 with pea RBCS 3 ′) and KWHIT 032858 ( PCR2.1 containing FAD3-1B intron # 4) Were digested with EcoRI and linked together to form KWHIT03004 (7S alpha 'promoter fused to FAD3-1A intron # 4 and FAD3-1B intron # 4 with pea RBCS 3').

KWHIT03004 was cleaved with XhoI, KAWHIT032980 (FAD3-1C intron # 4 in PCR2.1 ) was cleaved with EcoRI, and then the ends of all cleaved plasmids were filled and then linked.

The resulting plasmid is KAWHIT030005 (7S alpha 'promoter fused to FAD3-1A intron # 4, FAD3-1B intron # 4 and FAD3-1B intron # 4 with pea RBCS 3'). KAWHIT030005 was digested with SacI and the ends were filled with Klenow fragments of T4 polymerase to produce blunt ends. pCGN5468 (FIG. 1, including the 7S alpha ′ promoter fused with FAD2-1A intron with pea RBCS 3 ′) was cleaved with EcoRI and its ends were filled with Klenau fragments of T4 polymerase to produce smooth ends. . The smooth ends of the plasmids KAWHIT030005 and pCGN5468 are connected to each other so that KWHIT03001 (7S alpha 'promoter with pea RBCS 3', FAD2-1A intron, FAD3-1A intron # 4, FAD3-1B intron # 4, FAD3-1C intron # 4 Fused). KWHIT03001 and pMON70276 (FMV-EF-1 / CP4) are both cleaved with NotI and linked together so that the pMON68521 (FIG. 10) (7S alpha 'promoter with pea RBCS 3' FAD2-1A intron, FAD3-1A intron # 4 , FAD3-1B intron # 4 and FAD3-1C intron # 4, and fused with pea RBCS 3 'to FMV-EF-1 / CP4). pMON68521 was transformed into ABI species of Agrobacterium tumefacience and co-cultured into soybeans.

2E. pMON68519

In constructing plasmid pMON68519 (FIG. 11), pCGN5453 (containing 7S alpha 'promoter fused with FAD3-1A intron # 4 with pea RBCS 3 ′) and KWHIT 032858 (containing FAD-1B intron # 4) pCR2.1) was cleaved with EcoRI and linked together to generate KWHIT03004 (containing 7S alpha 'promoter fused with pea RBCS 3' to FAD3-1A intron # 4 and FAD3-1B intron # 4). KWHIT03004 was digested with XhoI, and KAWHIT032980 (containing FAD3-1C intron # 4 in PCR2.1 ) was digested with EcoRI. The ends of these two truncated plasmids were filled and then the plasmids were linked. The resulting plasmid is referred to as KAWHIT030005 (containing 7S alpha 'promoter fused to FAD3-1A intron # 4, FAD3-1B intron # 4 and FAD3-1B intron # 4 with pea RBCS 3'). KAWHIT030005 is cleaved with SacI, and then the DNA is treated with Klenow fragments of T4 polymerase to produce blunt ends. pCGN7770 (containing the napin promoter and napin 3 ′) was cleaved with XhoI and blunt-ended with the Klenau fragment of T4 polymerase. The smooth ends of the plasmids KAWHIT030005 and pCGN7770 are linked together to contain a naphrine promoter fused with Napin 3 'to KWHIT03007 ( FAD2-1A intron, FAD3-1A intron # 4, FAD3-1B intron # 4, FAD3-1C intron # 4 ).

KWHIT03007 was then cleaved with NotI, and its ends were filled with Klenow fragments of T4 polymerase to form smooth ends. The naphrine promoter fused with FAD2-1A intron, FAD3-1 A intron # 4, FAD3-1B intron # 4, FAD3-1C intron # 4 with Napin 3 '(KWHIT03007), has a smooth terminal linkage with pMON68504 cleaved with EcoRV It became. pMON68504 contained a soy FAD2-1A intron fused to a 7s alpha 'promoter with pea RBCS 3' in a 2 tDNA vector pMON41162 containing a CP4 gene regulated by the FMV promoter. The blunt terminal linkage between KWHIT03007 and pMON6850 produced the plasmid pMON68519. pMON68519 was transformed into ABI species of Agrobacterium tumefacience and co-cultured into soybeans.

Example 3 Plant Transformation and Analysis

Linear DNA fragments containing expression constructs for the sense and antisense inhibition of the Δ12 and Δ15 desaturase genes were subjected to particle bombardment (1988) (Maccarby et al., Bio / Technology , Soybean (Asgrow sp. , 6 : 923-926) or by incubation with ABI species of Agrobacterium tumefacience (Martinel, US Pat. No. 6,384,310). Transformed soybean plants were identified by selection in medium containing glyphosate.

Fatty acid composition was analyzed from the seed of the line transformed with the intron expression construct using gas chromatography. Rl-rich seed oil and Rl single seed oil composition show that the mono- and poly-unsaturated fatty acid compositions have changed in the seed oil of transformed legumes compared to the seeds of untransformed soybeans. Tables I, II and III provide a summary of the results obtained using the structures described above. These data show that sense and antisense expression of the non-coding regions of the desaturase gene resulted in alteration of various fatty acid compositions.

These data also show that introns can be used to obtain various types of fatty acid compositions. Depending on the relative fatty acid composition desired, selection may be made from this line. Since each intron can vary the level of each fatty acid to varying degrees, the intron can be combined according to the desired composition.

Table 1

Table 2: Oil Composition Data for Seeds Containing pMON68521

R1 single seed data

Structural Species ID 16: 0 18: 0 18: 1 18: 2 18: 3

pMON68521 GM_A32162 12.0 3.4 42.8 35.5 5.3

pMON68521 GM_A32162 11.5 2.6 39.4 40.0 5.2

pMON68521 GM_A31619 10.4 2.8 39.1 40.4 5.8

pMON68521 GM_A32162 11.9 2.6 36.7 41.9 5.8

pMON68521 GM_A32162 12.2 2.5 34.9 43.0 6.3

pMON68521 GM_A32162 13.0 2.8 30.4 46.6 6.0

pMON68521 GM_A31610 12.4 1.9 28.3 49.8 7.1

pMON68521 GM_A32162 11.9 2.9 26.5 51.6 6.1

pMON68521 GM_A31792 13.2 3.3 25.3 50.2 7.2

pMON68521 GM_A31395 12.5 3.7 25.1 50.2 6.7

pMON68521 GM_A31393 13.1 3.5 24.1 51.9 5.6

pMON68521 GM_A31615 14.0 2.2 24.0 52.5 6.7

pMON68521 GM_A32209 12.5 3.5 23.7 51.5 7.6

pMON68521 GMA31612 11.8 3.0 23.7 51.1 9.5

pMON68521 GM_A32209 12.6 3.3 23.6 52.2 7.2

pMON68521 GM_A32209 12.4 3.2 23.0 53.1 7.2

pMON68521 GM_A31489 12.3 3.2 22.5 54.0 6.9

pMON68521 GM_A32252 12.7 4.4 22.3 52.4 7.1

pMON68521 GM_A32162 12.6 3.1 22.2 54.9 6.2

pMON68521 GM_A32089 13.5 3.2 22.2 52.4 7.9

pMON68521 GM_A31393 12.6 4.3 22.2 53.0 5.7

pMON68521 GM_A31610 12.5 2.7 21.8 55.5 6.9

pMON68521 GM_A31610 12.6 2.4 21.7 55.8 6.9

pMON68521 GM_A31656 12.7 3.6 21.6 53.2 8.0

pMON68521 GM_A31612 12.3 3.6 21.6 54.0 7.2

pMON68521 GM_A31610 13.2 2.6 21.0 56.2 6.5

pMON68521 GM_A31604 13.5 3.1 20.4 55.3 7.0

pMON68521 GM_A31610 13.2 2.6 20.4 56.7 6.4

pMON68521 GM_A31489 12.8 3.1 20.1 55.5 7.1

pMON68521 GMA31525 12.2 3.0 20.1 57.2 6.3

A3244 13.9 4.1 15.8 56.3 9.0

A3244 13.7 4.1 14.2 57.6 9.3

A3244 13.6 4.3 14.1 57.4 9.7

A3244 13.9 4.1 14.1 56.9 10.0

A3244 13.8 4.4 13.6 57.6 9.8

A3244 14.2 4.8 13.6 56.8 9.5

A3244 14.2 4.3 13.2 56.5 10.8

A3244 14.0 4.2 13.1 57.0 10.6

A3244 14.0 4.5 12.9 57.3 10.3

Table 3: Oil Composition Data for Seeds Containing pMON68519

R1 single seed

Structural Species ID 16: 0 18: 0 18: 1 18: 2 18: 3

pMON68519 GM_A29911 13.0 4.8 40.7 34.4 5.2

pMON68519 GM_A29911 12.3 3.8 38.8 37.5 5.8

pMON68519 GM_A29911 12.3 3.3 34.0 42.6 6.5

pMON68519 GM_A32856 12.9 3.5 33.6 42.2 6.5

pMON68519 GM_A32856 12.6 3.1 33.3 43.4 6.4

pMON68519 GM_A32856 13.0 3.1 31.3 45.4 6.1

pMON68519 GM_A32856 12.7 3.2 28.9 47.3 6.6

pMON68519 GM_A29911 12.9 4.0 28.7 46.5 6.7

pMON68519 GM_A29911 12.2 3.1 28.1 47.4 6.8

pMON68519 GM_A32856 13.3 3.2 26.5 48.7 7.1

pMON68519 GM_A32856 13.2 3.2 26.5 49.3 6.8

pMON68519 GM_A29911 13.1 3.2 26.1 49.4 7.1

pMON68519 GM_A32856 13.2 3.6 25.9 48.9 7.1

pMON68519 GM_A32857 13.3 3.1 23.3 52.2 7.4

pMON68519 GM_A29911 12.8 3.5 23.3 52.5 6.6

pMON68519 GM_A29911 12.6 3.1 21.4 51.9 9.0

pMON68519 GMA29911 13.4 3.6 20.1 53.6 7.9

A3244 13.2 4.3 16.5 55.7 9.7

A3244 13.5 3.2 16.3 56.8 9.2

A3244 13.7 3.4 15.4 57.7 9.2

A3244 13.9 3.3 15.1 57.9 9.1

A3244 13.8 3.6 14.3 58.3 9.2

A3244 13.5 3.4 13.6 58.2 10.4

A3244 13.5 3.9 12.5 58.4 11.2

A3244 14.6 3.8 12.1 58.2 10.8

A3244 14.5 3.9 11.8 57.8 11.4

Example 4

Linear DNA fragments comprising dsRNAi constructs for the inhibition of Δ12 and Δ15 desaturase genes were cultured with Agrobacterium tumefacience , ABI species (Martinel, US Pat. No. 6,384,301), or It was stably introduced into soybean (Asgro species A3244 or A4922A32) via particle bombardment (1988), McCarb et al., Bio / Technology, 6 : 923-926. 1) 7S promoter- FAD2-1A sense intron- FAD3-1A sense intron- FAD3-1B sense intron- splicable FAD3 intron # 5- FAD3-1B antisense intron- FAD3-1A antisense intron- FAD2-1A antisense intron- Pea RBCS; (2) 7S promoter- FAD3-1A sense intron- FAD3-1B sense intron- splicable FAD3 intron # 5- FAD3-1B antisense intron- FAD3-1A antisense intron-pea RBCS; (3) 7S promoter - FAD2-1A sense intron - FAD3-1A sense intron - Splice possible FAD3 intron # 5- FAD3-1A antisense intron -FAD2-1A antisense intron - a representative of the pea RBCS FAD2-1A, FAD2-1B, FAD2-2B, FAD3-1A , FAD3-1B and FAD3-1C intron. The sequences are disclosed in US Patent Application Nos. 10 / 176,149, application date 2002, 6. 21, and US Patent Application Nos. 09 / 638,508, application date 2000, 8, 11, and US provisional application number 60 / 151,224, application date 1999, 8, 26, and US Provisional Application No. 60 / 172,128, filed 1999, 12, 17, without limitation.

Transgenic soybean plants were identified by selection in medium containing glyphosate.

Fatty acid composition was analyzed from transgenic soybean seeds comprising intron RNAi inhibitory constructs. Depending on the relative fatty acid composition desired, certain varieties were selected.

Example 5

5A.

RNA was purified from two FAD2-1 intron inhibitors (5469-14 and 5469-22), two FAD2-1 cDNA inhibitors (positive control) (5462-87 and 5462-133), and negative controls (wild-type seeds). And homozygous R2 seeds derived from seeds obtained from null fragments upon each intron inhibition. Northern gels containing these RNA samples were probed with FAD2-1 cDNA. FAD2-1A transcript levels were significantly reduced in intron and cDNA inhibitors relative to the negative control. The same Northern blot was probed with unregulated FAD2-2 cDNA, with no significant difference in FAD2-2 transcript levels observed between the FAD2-1 intron inhibitor and control. In contrast, FAD2-2 transcription in cDNA inhibitors is significantly reduced. This northern data suggests that introns specifically interfere with the accumulation of FAD2-1 transcripts but not FAD2-2 transcripts. A partial FAD2-2 genomic clone (SEQ ID NO: 3) was PCR amplified and sequence analysis revealed 4.7 KB introns in the 5 'untranslated portion of the gene. The sequence of the FAD2-2 intron (SEQ ID NO: 4) did not share homology with the FAD2-1 intron.

5B.

The four types of FAD3-1A intron RNA # 400 million Jeju, obtained from the seed obtained from the board at the time of short of the three B FAD3-1 intron # 400 million Jeju, negative control seeds (untransformed wild type strains), each intron inhibition It was isolated from homozygous R2 seeds. Northern gels containing these RNA samples were probed into the FAD3-1A 3′UTR section. Endogenous FAD3-1A transcript levels were significantly reduced in FAD3-1 A # 4 intron inhibitors relative to wild-type or null controls. The same northern blot was probed into the FAD3-1B 3′UTR region , with no significant difference observed in endogenous FAD3-1B transcript levels compared to the FAD3-1A intron # 4 inhibitor , wild type or null controls. FAD3-1A intron # 4 (SEQ ID NO: 8 ) sequences of FAD3-1B intron # 4: did not share homology with (SEQ ID NO 13).

Example 6

Southern blot data suggest that there are at least two members of the FAD3 gene family. To determine the sequence of other FAD3 gene family members, and to determine if other members exist, the FAD3-1A gene sequence was used in a query Blast study against the Monsanto soybean DNA sequence database. Candidate ESTs from other FAD3 gene family members were used to design primers. Using this method, two primer sets were designed based on the putative FAD3 sequence. Intron # 4 part was isolated from two other FAD 3 gene family members.

Primers are 211565_1.rl040 EST (meaning FAD3-1B ), (5 'primer # 15024: 5'-CATGCTTTCTGTGCTTCTC-3' (SEQ ID NO: 26) and 3 'primer # 15027: intron # 4 of the FAD3-1A gene 5'-GTTGATCCAACCATAGTCG-3 '(SEQ ID NO: 27)) at the portion corresponding to the position of. These primers were used for PCR amplification of FAD3-1B intron # 4 (SEQ ID NO: 13), which, when sequenced, did not share sequence homology with FAD3-1A intron # 4 (SEQ ID NO: 8). The FAD3-1B gene also contained intron # 3C (SEQ ID NO: 12), which did not share any homology with FAD3-1A intron # 3C (SEQ ID NO: 11).

Another additional intron # 4 was PCR amplified from the second EST, GSV701051989.H1 (meaning FAD3-1C ) using the following primer set: 5 'primer # 16241: 5'-CACCATGGTCATCATCAGAAAC (SEQ ID NO: 38) and 3 'Primer # 16242: TCACGATCCACAGTTGTGAGAC (SEQ ID N0: 39). FAD3-1C Intron # 4 (SEQ ID NO: 14) shares 50% homology with FAD3-1A Intron # 4 (SEQ ID NO: 8), and FAD3-1B Intron # 4 (SEQ ID NO: 13) Did not share homology. FAD3-1C EST, like FAD3-1B EST, contained an intron # 4 splice in the same region of the gene.

Example 7: FAD2-1A / FAD3-1A  Transgenic plant

7A.

FAD2-1A beans was used to water the beans FAD3-1A intron billion Jeju produced according to the process disclosed in Example 3 to suppress the intron. RNA obtained from soybean seeds containing both the expressed FAD3-1A intron region and FAD3-1A intron region was screened using Northern blotting (described in Example 5) for FAD2-1, FAD2-2, FAD3-1A And the level of FAD3-1B transcript was confirmed. Soybean plants showing unidentifiable or low levels of FAD2-1 and FAD3-1A transcripts are screened to confirm the fatty acid composition as disclosed in Example 3.

7B.

Soy FAD2-1A intron inhibitors have also been used to pollinate soy FAD3 mutants with low linolenic acid concentrations derived from mutants. RNA from soybean seeds, including knockouts, containing both one or more expressed FAD2 intron regions and FAD3 variants, was subjected to FAD2-1, FAD2-2, FAD3-1A using Northern blot (described in Example 5). , FAD3-1C and FAD3-1B were screened to determine the levels of transcripts. Soybean plants with unidentifiable or low levels of FAD2 and FAD3 transcripts were screened to confirm the fatty acid composition as disclosed in Example 3.

7C.

FAD3-1A, FAD3-1B , and FAD3-1C intron inhibiting soybeans were used to level soybean plants with increased concentrations of oleic acid, including FAD2 mutants derived from spontaneous variation. FAD3-1A and FAD3-1B Intron- Repressed Soybeans, FAD3-1A and FAD3-1C Intron-Inhibited Soybean, FAD3-1B and FAD3-1C Intron-Inhibited Soybean, FAD3-1A Intron-Inhibited Soybean, FAD3-1B Intron-Inhibited Soybean and FAD3-1C intron inhibited soybeans were used separately to pollinate soybean plants with elevated oleic acid concentrations, each containing FAD2 mutants derived from spontaneous variation. RNA from soybean seeds containing both one or more expressed FAD3 intron regions and FAD2 mutations, including knockouts, was prepared using FAD2-1, FAD2-2, FAD3-1A, FAD3- using Northern blots described in Example 5. Screening was performed to confirm the levels of transcripts of 1B and FAD3-1C . Soybean plants with unidentifiable or low levels of FAD2 and FAD3 transcripts were screened to confirm the fatty acid composition as disclosed in Example 3.

Example 8 Single FAD2 / FAD3  Structure

The preparation of linear DNA fragments containing the sense and antisense FAD2 and FAD3 introns as well as the FAD2 and FAD3 introns capable of producing dsRNA are described in Table 4.

Table 4

As shown, each of the constructs listed in this table has several types depending on the nature and orientation of the structural nucleic acid in the construct. For example, construct 30 can be represented as follows: (1) 7S promoter- FAD2-1B intron 1 (sense) -CaMV promoter- FAD2-2B intron 1 (sense); (2) 7S promoter- FAD2-1B intron 1 (sense) -CaMV promoter- FAD2-2B intron 1 (antisense); (3) 7S promoter- FAD2-1B intron 1 (sense) -CaMV promoter- FAD2-2B intron 1 (dsRNA); (4) 7S promoter- FAD2-1B intron 1 (antisense) -CaMV promoter- FAD2-2B intron 1 (sense); (5) 7S promoter- FAD2-1B intron 1 (antisense) -CaMV promoter- FAD2-2B intron 1 (antisense); (6) 7S promoter- FAD2-1B intron 1 (antisense) -CaMV promoter- FAD2-2B intron 1 (dsRNA); (7) 7S promoter- FAD2-1 B intron 1 (dsRNA) -CaMV promoter- FAD2-2B intron 1 (sense); (8) 7S promoter- FAD2-1B intron 1 (dsRNA) -CaMV promoter- FAD2-2B intron 1 (antisense); Or (9) 7S promoter- FAD2-1B intron 1 (dsRNA) -CaMV promoter- FAD2-2B intron 1 (dsRNA).

These constructs were described previously, including McCarb et al., Particle Impact Method (1988), Bio / Technology, 6 : 923-926, or Agrobacterium mediated transformation (Martinel, US Pat. No. 6,384,301). Can be stably introduced into soybeans (eg, Asgro species A4922 or Asgro species A3244). Transgenic soybean plants were identified by selection in medium containing glyphosate. Gas chromatography was used to analyze the content of fatty acids from the seeds of transgenic soybeans with such constructs.

Example 9

Linear DNA fragments containing expression constructs for the sense and antisense expression of FAD2-1 and FAD2-2 introns can be prepared by particle shock methodology such as McCarb (1988), Biol Technology, 6: 923-926, or Agrobacterium mediated transformation. It can be stably introduced into soybeans (eg, Asgro species A4922 or Asgro species A3244) by the methods described previously, including the method (Martinel, US Patent No. 6,384, 301). The following constructs were introduced: (1) FAD2-1A intron (sense) -FAD2-2 intron (antisense); (2) FAD2-1A intron (sense) -FAD2-2 intron (sense); (3) FAD2-1A intron (antisense) -FAD2-2 intron (antisense); (4) FAD2-1A intron (antisense) -FAD2-2 intron (sense); (5) FAD2-1B intron (sense) -FAD2-2 intron (antisense); (6) FAD2-1B intron (sense) -FAD2-2 intron (sense); (7) FAD2-1B intron (antisense) -FAD2-2 intron (antisense); And (8) FAD2-1B intron (antisense) -FAD2-2 intron (sense). Transgenic soybean plants were identified by selection in medium containing glyphosate. Gas chromatography was used to analyze the content of fatty acids from the seeds of transgenic soybeans with such constructs. Seeds of the transgenic plants showed high concentrations of oleic acid (greater than 80%).

Linear DNA fragments containing expression constructs for sense and antisense expression of the FAD2-1, FAD2-2 and FAD3 introns were prepared using the soybeans (eg, McCarve et al. (1988), Bio / Technology, 6 : 923-926). , Asgro species A4922) can be stably introduced. Exemplary constructs include: (1) FAD2-1A intron (sense or antisense) -FAD2-2 intron (sense or antisense) -FAD3-1A intron 1 (sense or antisense); (2) FAD2-1A intron (sense or antisense) -FAD2-2 intron (sense or antisense) -FAD3-1A intron 4 (sense or antisense); (3) FAD2-1A intron (sense or antisense) -FAD2-2 intron (sense or antisense) -FAD3-1B intron 4 (sense or antisense); And (4) FAD2-1A intron (sense or antisense) -FAD2-2 intron (sense or antisense) -FAD3-1C intron 4 (sense or antisense). Transformed soybean plants were identified by selection in medium containing glyphosate. Gas chromatography was used to analyze the content of fatty acids from the seeds of transgenic soybeans with such constructs. Seeds of the transgenic plants showed high oleic acid (> 80%) concentrations.

SEQUENCE LISTING <110> Calgene LLC <120> Nucleic Acid Sequences and Methods of Use for the Production of Plants with Modified Polyunsaturated Fatty Acids <130> 16518.129 <160> 39 <170> PatentIn version 3.1 <210> 1 <211> 420 <212> DNA <213> Glycine max <400> 1 gtaaattaaa ttgtgcctgc acctcgggat atttcatgtg gggttcatca tatttgttga 60 ggaaaagaaa ctcccgaaat tgaattatgc atttatatat cctttttcat ttctagattt 120 cctgaaggct taggtgtagg cacctagcta gtagctacaa tatcagcact tctctctatt 180 gataaacaat tggctgtaat gccgcagtag aggacgatca caacatttcg tgctggttac 240 tttttgtttt atggtcatga tttcactctc tctaatctct ccattcattt tgtagttgtc 300 attatcttta gatttttcac tacctggttt aaaattgagg gattgtagtt ctgttggtac 360 atattacaca ttcagcaaaa caactgaaac tcaactgaac ttgtttatac tttgacacag 420 <210> 2 <211> 405 <212> DNA <213> Glycine max <400> 2 gtatgatgct aaattaaatt gtgcctgcac cccaggatat ttcatgtggg attcatcatt 60 tattgaggaa aactctccaa attgaatcgt gcatttatat tttttttcca tttctagatt 120 tcttgaaggc ttatggtata ggcacctaca attatcagca cttctctcta ttgataaaca 180 attggctgta ataccacagt agagaacgat cacaacattt tgtgctggtt accttttgtt 240 ttatggtcat gatttcactc tctctaatct gtcacttccc tccattcatt ttgtacttct 300 catatttttc acttcctggt tgaaaattgt agttctcttg gtacatacta gtattagaca 360 ttcagcaaca acaactgaac tgaacttctt tatactttga cacag 405 <210> 3 <211> 6220 <212> DNA <213> Glycine max <400> 3 agcttggtac cgagctcgga tccactagta acggccgcca gtgtgctgga attcggcttc 60 tctctcaccc tcctcttcac acattttctg tgcgctctaa caaacattct cgttcacact 120 ttcaggtact tttctctcct tatctcttta tctttattct ttcctacttt attgcttaaa 180 ccaatgctat ctatgcttcg atctcgcctt cttattttcc acttcccttt tctcgcttga 240 tctaaccgtt ttcgccctcc gcgcttcgat tgactgagta catctacgat tctctgttct 300 ttcatttcat agatttcgtc tgattttggc taacttggtt tctgttgcgg ccgattctta 360 catatactga ttgtttagca taaatgaact tgcttgttta gcactatctg catattttcg 420 tcacgcatct ctttcggatc taaggatgaa tctcctattt cctccgtatt atttctcgta 480 tctcttgttc tgtgctaatg ctccagaaaa tggcagcatt gtcttcttct ttgctgtata 540 agtgtttgtg ttgtgaatct ggaagcgatt ttgcgtgagg taacttgcga cttcaactat 600 tatctttcag atctcgttaa tttattagct gctattaatt tgtgtgtgca gtgtcaaact 660 gaagcacacg actgcttaga agttagaatt tgactgactg ttcctctttg atttttttct 720 ttcttttctt tgctwactcg gcctatttaa tgatctttat aaatagatta gtggaccact 780 tggttagttg gtgagttatg aatattcgaa ttttctacca caagttgggt taaaaaaatc 840 tctgcaacta cacgaggatt ttttatttta tttagaggaa actattctgt catccttttt 900 ccgattacac ttttctatca gttgttttga aatatacacc ttaggaatat aatattaccc 960 ctttcggtct taatataaat atattttaat tatttatatt ttatttaatg aaattatttt 1020 taaaatactt tcatttaata gaatttttaa taaagttaaa gacttttatt gtgtagagtt 1080 taacgaagtt aattagtttt cttagtaaat gtaaaatatg ccttttttgt tgtttataat 1140 ggagattgga aaaaatatac tttaattttt ttcaagtgat gaataattat ggatgttttg 1200 tcaatatttt tgtcttgcta tacaactttc agtcttgcca ttaaataatt ttgaatgtgt 1260 tattgatatc tctgaacaat atttagagac gaacataaat tttatatatt ttatataatt 1320 tctttttatt acccttttat tatcaatttt gaaatttggt taatatctgt gtttcatttt 1380 gaggtctcaa atttgatata aggaggttca aaatgcgttg ctagccattt taaagattag 1440 caggagagga aatgtttctg gacttaaatt taaaatatgc ttatttgttt ttcaagagag 1500 agagatcaat atttatataa tacacttgaa ttaatataca ccattgttgc aaaaaaaaaa 1560 aaatattagt tgattgtgtg acaatatttt atattaaata taattagtta atttagttca 1620 agttgagtta catttttaca taccattctt agccgccact tttttatatt tatttgtagg 1680 aataactttt catctgtatc aattttcccc gtctaataaa aagggtttga ctttttctta 1740 taatagagtt tttttttttt tgctttaagt tattgtaaaa taattatttt attttttttg 1800 cctttgtaaa ttatgtatat ttaatgtttt aataggaaaa aaatgttatc aaaagcacta 1860 aaagactaaa attaaacaac cataatttgc aaagatgaaa ataaaaaaat aattttgtaa 1920 agataaaaaa tgaaataaaa tagttaaatt ataggaattt aaaagctatt taaatcaaca 1980 aaagttaaag tttctgtaaa aaaagttcaa tttttttttt tattattgaa aaagttaaag 2040 ctaatgagcg ttcgatttgg gttagtatgt agtatttatt attttcaaga ttttggattt 2100 tattgtcgat gtttctgatt tgaatataat tattttccat tcaacttgtg attttataag 2160 aaaaaaaaag gtacagaaaa aatcaagcgc tttttttatt tcaattagtg gaggtttcac 2220 tgaaatgggt aaagaatcta ttttgcaatc acaattatta ccggtattca actgcaacaa 2280 ggaacaaaat tcctttcgta aatatacgga gaggaatcta ttttgacttg ttgaatttat 2340 ggtaaagtag aatttagaat ttaattatga gttgaagtaa ttttgaataa tttatatgtt 2400 aaatataaaa ttttgtacta agttttattc ataactttga ttctataata caaacataca 2460 taagttcaaa aataatttta attaaaatta attttatcaa tttttattca aacacgagtc 2520 taatttgctt gatgaattaa gaaaataagg aagaaaatat taaaaactag gagagaagtt 2580 aaagagaatt tcatctttat tattctcagt tgtttcaaaa ataatgaaag gatagctata 2640 taatactgta actgagccaa gaacatattt gccgtccgag taaccttttc ttttcttgtt 2700 ccgttttctc cgccgatgaa gagagggaag ggaatgtatc tttgtattta tgttttcaaa 2760 gagttcgtgc ataaaattgg tttaatcaaa tttttcataa gattattatt ttatgatttt 2820 ttaaaataaa ttagtaacta tattccgtaa gtcgtacaca gttatatgta gtaagtaaat 2880 tatattttaa taattattat cttaaaattt tcttaagaac ttggttaaaa tatttttgtt 2940 tgaaaaagtt tatgataact tttttttgtt gaaaaaaagt ttacgattat ctaactcgta 3000 cttagattat ttctaattgg gatttattga agggtttttt aagtaaagaa attgtttctt 3060 atggtttctt ttttattgga caaatttacg tagcaaagag tgtttcttaa aaacaagaca 3120 tgtatccttt gaaaaaaaac tatttctttg aaataaaaaa taatatttat ctggcacata 3180 ataatgttaa aattaaatca taattaggta aaaataaaat aaatataaaa gtatgagttt 3240 gttaagtttt ttataatttt ttattattaa agtaaaatta tgtatgattt ttttataatg 3300 atatgatatt ttagggatca caaaaaataa tgtggtgaat acaaaagtaa ctcaaaaaat 3360 tcatttagta aattttcatt ggagatgcta ttattatgct ttctgattgc tttgtccaaa 3420 aaataaagaa tgttttttta tttgaaaatt gaaaatttct gggtcatgtt aagatcttgt 3480 agacggtaac gtcggcctaa agttgtgtga ggggtgttgc atgcaccgat cattaattac 3540 tcgatatgga aaacgactga aataatttaa tttgatgttg ctaatattgg ccatccctct 3600 catcattatt gtttttttat ttgtaacatg acatattctt gtgggtccgc tacggattgg 3660 gtgtttgttg ccaaaaaata caaaatatct gtggaacaag gataaacagt cttgtttgtt 3720 taattgattg attgatgagt ttgcaagcta tatttttaat ttattttaat taaacttttg 3780 tgttttagtt ctacaatttt attcatcttg attttttttt tacttggcaa aatcatgatt 3840 ttttaatttt tacttatgtt gaaaacaaat ttattgctaa aaaaacattt attctttttt 3900 tagagaaaaa acaaatttgt gatatgtagt gaatcaaatg aaaattttaa acataatata 3960 gaatactcta caaatcaatt ttgagtttct ttatcatttt atttatttat tgacatactt 4020 ctactttctg caaagaccct gactcgtgga agatataggg aaggttatgg aagttagtgt 4080 attgtcatat ctagctatct ttgctaattg aaaaagcctt ccctttgttt acagatctgg 4140 ataaggttgc atgtttattc ttttcaactg tgaatggttc tttgcatctt ttttagtata 4200 tgagattaat gttttaatta ggaagaagct tttagaacat cacccgaatc caattcgttt 4260 tggtttctgt gatcttgatg taaatctata ctaatttggt ttgggcagaa gaaaatgttc 4320 tttgctcaag tcctctagga cgaaaatata aatataacag ggtatatcag atctctattc 4380 ttctgtgggt aatgatagca tgtttctgtt gttttcttat tcttcattgg tcatgataac 4440 ctgctaattc tatttgccac gattgagatg aaaaggtaat gaactagtaa acaataatga 4500 gaagaatatg tcgctactat tgttgaaacg gttacgccag gcacttgagt atgatgcact 4560 attttaatta atgcattttt tttgctttga tgagaacgca cattgttcat tctgattcgg 4620 tgagtttaga aactattgct gataatcctt gatttaagat tttagtcttg ttcatgttca 4680 ttaaaagtgt tgtaaaaaaa tgcactgata tgtcatgtgc agattgtgtg aagatggggg 4740 cgggtggccg aactgatgtt cctcctgcca acaggaagtc agaggttgac cctttgaagc 4800 gggtgccatt tgaaaaacct ccatttagtc tcagccaaat caagaaggtc attccacctc 4860 actgtttcca gcgttctgtt ttccgctcat tctcctatgt tgtttacgac ctcaccatag 4920 ccttctgcct ctattatgtt gccacccatt acttccacct ccttcccagc cctctctctt 4980 tcttggcatg gccaatctac tgggctgtcc aaggttgcat ccttactgga gtttgggtca 5040 ttgcccatga gtgtggccac catgcattca gtgactacca gttgcttgat gatattgttg 5100 gccttgtcct ccactccggt ctcctagtcc catacttttc atggaaatac agccatcgcc 5160 gtcaccactc caacactggt tctcttgagc gggatgaagt atttgtgcca aagcagaagt 5220 cctgtatcaa gtggtactct aaatacctta acaatcctcc aggcagagtc ctcactcttg 5280 ctgtcaccct cacacttggt tggcccttgt acttggcttt aaatgtttct ggaaggcctt 5340 atgatagatt tgcttgccac tatgacccat atggtcccat ttactctgat cgtgaacgac 5400 ttcaaatata tatatcagat gcaggagtac ttgcagtatg ctatggcctt ttccgtcttg 5460 ccatggcaaa aggacttgcc tgggtggtgt gtgtttatgg agttccattg ctagtggtca 5520 atggattttt ggtgttgatt acattcttgc agcatactca ccctgcattg ccacattaca 5580 cttcctctga gtgggactgg ttgagaggag ctttagcaac agtggataga gattatggaa 5640 tcctgaacaa ggtcttccat aatattacag acactcatgt agcacatcac ttgttctcca 5700 caatgccaca ttatcatgca atggaggcta caaaggcaat aaaacccatt ttgggagagt 5760 attatcggtt tgatgagact ccatttgtca aggcaatgtg gagagaggca agagagtgta 5820 tttatgtgga gccagatcaa agtaccgaga gcaaaggtgt attttggtac aacaataagt 5880 tgtgatgatt aatgtagccg aggcttcttt gaactttccc ttgtgactgt ttagtatcat 5940 ggttgcttat tgggaataat tttgttgaac cctgatgttg gtagtaagta tctagacagt 6000 tgcatagcgg ttttgtttac agaataagat atagcctctc tgaacagttt gattattgca 6060 ccatggtttg caatcggtgc atgtcgacca agtttctcaa gactgtggag aagcttattc 6120 ttgttccagt tcttgaatcc aagttgttac cgtattctgt aagccgaatt ctgcagatat 6180 ccatcacact ggcggccgct cgagcatgca tctagagggc 6220 <210> 4 <211> 4597 <212> DNA <213> Glycine max <400> 4 gtacttttct ctccttatct ctttatcttt attctttcct actttattgc ttaaaccaat 60 gctatctatg cttcgatctc gccttcttat tttccacttc ccttttctcg cttgatctaa 120 ccgttttcgc cctccgcgct tcgattgact gagtacatct acgattctct gttctttcat 180 ttcatagatt tcgtctgatt ttggctaact tggtttctgt tgcggccgat tcttacatat 240 actgattgtt tagcataaat gaacttgctt gtttagcact atctgcatat tttcgtcacg 300 catctctttc ggatctaagg atgaatctcc tatttcctcc gtattatttc tcgtatctct 360 tgttctgtgc taatgctcca gaaaatggca gcattgtctt cttctttgct gtataagtgt 420 ttgtgttgtg aatctggaag cgattttgcg tgaggtaact tgcgacttca actattatct 480 ttcagatctc gttaatttat tagctgctat taatttgtgt gtgcagtgtc aaactgaagc 540 acacgactgc ttagaagtta gaatttgact gactgttcct ctttgatttt tttctttctt 600 ttctttgctw actcggccta tttaatgatc tttataaata gattagtgga ccacttggtt 660 agttggtgag ttatgaatat tcgaattttc taccacaagt tgggttaaaa aaatctctgc 720 aactacacga ggatttttta ttttatttag aggaaactat tctgtcatcc tttttccgat 780 tacacttttc tatcagttgt tttgaaatat acaccttagg aatataatat tacccctttc 840 ggtcttaata taaatatatt ttaattattt atattttatt taatgaaatt atttttaaaa 900 tactttcatt taatagaatt tttaataaag ttaaagactt ttattgtgta gagtttaacg 960 aagttaatta gttttcttag taaatgtaaa atatgccttt tttgttgttt ataatggaga 1020 ttggaaaaaa tatactttaa tttttttcaa gtgatgaata attatggatg ttttgtcaat 1080 atttttgtct tgctatacaa ctttcagtct tgccattaaa taattttgaa tgtgttattg 1140 atatctctga acaatattta gagacgaaca taaattttat atattttata taatttcttt 1200 ttattaccct tttattatca attttgaaat ttggttaata tctgtgtttc attttgaggt 1260 ctcaaatttg atataaggag gttcaaaatg cgttgctagc cattttaaag attagcagga 1320 gaggaaatgt ttctggactt aaatttaaaa tatgcttatt tgtttttcaa gagagagaga 1380 tcaatattta tataatacac ttgaattaat atacaccatt gttgcaaaaa aaaaaaaata 1440 ttagttgatt gtgtgacaat attttatatt aaatataatt agttaattta gttcaagttg 1500 agttacattt ttacatacca ttcttagccg ccactttttt atatttattt gtaggaataa 1560 cttttcatct gtatcaattt tccccgtcta ataaaaaggg tttgactttt tcttataata 1620 gagttttttt ttttttgctt taagttattg taaaataatt attttatttt ttttgccttt 1680 gtaaattatg tatatttaat gttttaatag gaaaaaaatg ttatcaaaag cactaaaaga 1740 ctaaaattaa acaaccataa tttgcaaaga tgaaaataaa aaaataattt tgtaaagata 1800 Aaaaaatgaaa taaaatagtt aaattatagg aatttaaaag ctatttaaat caacaaaagt 1860 taaagtttct gtaaaaaaag ttcaattttt ttttttatta ttgaaaaagt taaagctaat 1920 gagcgttcga tttgggttag tatgtagtat ttattatttt caagattttg gattttattg 1980 tcgatgtttc tgatttgaat ataattattt tccattcaac ttgtgatttt ataagaaaaa 2040 aaaaggtaca gaaaaaatca agcgcttttt ttatttcaat tagtggaggt ttcactgaaa 2100 tgggtaaaga atctattttg caatcacaat tattaccggt attcaactgc aacaaggaac 2160 aaaattcctt tcgtaaatat acggagagga atctattttg acttgttgaa tttatggtaa 2220 agtagaattt agaatttaat tatgagttga agtaattttg aataatttat atgttaaata 2280 taaaattttg tactaagttt tattcataac tttgattcta taatacaaac atacataagt 2340 tcaaaaataa ttttaattaa aattaatttt atcaattttt attcaaacac gagtctaatt 2400 tgcttgatga attaagaaaa taaggaagaa aatattaaaa actaggagag aagttaaaga 2460 gaatttcatc tttattattc tcagttgttt caaaaataat gaaaggatag ctatataata 2520 ctgtaactga gccaagaaca tatttgccgt ccgagtaacc ttttcttttc ttgttccgtt 2580 ttctccgccg atgaagagag ggaagggaat gtatctttgt atttatgttt tcaaagagtt 2640 cgtgcataaa attggtttaa tcaaattttt cataagatta ttattttatg attttttaaa 2700 ataaattagt aactatattc cgtaagtcgt acacagttat atgtagtaag taaattatat 2760 tttaataatt attatcttaa aattttctta agaacttggt taaaatattt ttgtttgaaa 2820 aagtttatga taactttttt ttgttgaaaa aaagtttacg attatctaac tcgtacttag 2880 attatttcta attgggattt attgaagggt tttttaagta aagaaattgt ttcttatggt 2940 ttctttttta ttggacaaat ttacgtagca aagagtgttt cttaaaaaca agacatgtat 3000 cctttgaaaa aaaactattt ctttgaaata aaaaataata tttatctggc acataataat 3060 gttaaaatta aatcataatt aggtaaaaat aaaataaata taaaagtatg agtttgttaa 3120 gttttttata attttttatt attaaagtaa aattatgtat gattttttta taatgatatg 3180 atattttagg gatcacaaaa aataatgtgg tgaatacaaa agtaactcaa aaaattcatt 3240 tagtaaattt tcattggaga tgctattatt atgctttctg attgctttgt ccaaaaaata 3300 aagaatgttt ttttatttga aaattgaaaa tttctgggtc atgttaagat cttgtagacg 3360 gtaacgtcgg cctaaagttg tgtgaggggt gttgcatgca ccgatcatta attactcgat 3420 atggaaaacg actgaaataa tttaatttga tgttgctaat attggccatc cctctcatca 3480 ttattgtttt tttatttgta acatgacata ttcttgtggg tccgctacgg attgggtgtt 3540 tgttgccaaa aaatacaaaa tatctgtgga acaaggataa acagtcttgt ttgtttaatt 3600 gattgattga tgagtttgca agctatattt ttaatttatt ttaattaaac ttttgtgttt 3660 tagttctaca attttattca tcttgatttt ttttttactt ggcaaaatca tgatttttta 3720 atttttactt atgttgaaaa caaatttatt gctaaaaaaa catttattct ttttttagag 3780 aaaaaacaaa tttgtgatat gtagtgaatc aaatgaaaat tttaaacata atatagaata 3840 ctctacaaat caattttgag tttctttatc attttattta tttattgaca tacttctact 3900 ttctgcaaag accctgactc gtggaagata tagggaaggt tatggaagtt agtgtattgt 3960 catatctagc tatctttgct aattgaaaaa gccttccctt tgtttacaga tctggataag 4020 gttgcatgtt tattcttttc aactgtgaat ggttctttgc atctttttta gtatatgaga 4080 ttaatgtttt aattaggaag aagcttttag aacatcaccc gaatccaatt cgttttggtt 4140 tctgtgatct tgatgtaaat ctatactaat ttggtttggg cagaagaaaa tgttctttgc 4200 tcaagtcctc taggacgaaa atataaatat aacagggtat atcagatctc tattcttctg 4260 tgggtaatga tagcatgttt ctgttgtttt cttattcttc attggtcatg ataacctgct 4320 aattctattt gccacgattg agatgaaaag gtaatgaact agtaaacaat aatgagaaga 4380 atatgtcgct actattgttg aaacggttac gccaggcact tgagtatgat gcactatttt 4440 aattaatgca ttttttttgc tttgatgaga acgcacattg ttcattctga ttcggtgagt 4500 ttagaaacta ttgctgataa tccttgattt aagattttag tcttgttcat gttcattaaa 4560 agtgttgtaa aaaaatgcac tgatatgtca tgtgcag 4597 <210> 5 <211> 191 <212> DNA <213> Glycine max <400> 5 gtaataattt ttgtgtttct tactcttttt tttttttttt tgtttatgat atgaatctca 60 cacattgttc tgttatgtca tttcttcttc atttggcttt agacaactta aatttgagat 120 ctttattatg tttttgctta tatggtaaag tgattcttca ttatttcatt cttcattgat 180 tgaattgaac a 191 <210> 6 <211> 346 <212> DNA <213> Glycine max <400> 6 ttagttcata ctggcttttt tgtttgttca tttgtcattg aaaaaaaatc ttttgttgat 60 tcaattattt ttatagtgtg tttggaagcc cgtttgagaa aataagaaat cgcatctgga 120 atgtgaaagt tataactatt tagcttcatc tgtcgttgca agttctttta ttggttaaat 180 ttttatagcg tgctaggaaa cccattcgag aaaataagaa atcacatctg gaatgtgaaa 240 gttataactg ttagcttctg agtaaacgtg gaaaaaccac attttggatt tggaaccaaa 300 ttttatttga taaatgacaa ccaaattgat tttgatggat tttgca 346 <210> 7 <211> 142 <212> DNA <213> Glycine max <400> 7 gtatgtgatt aattgcttct cctatagttg ttcttgattc aattacattt tatttatttg 60 gtaggtccaa gaaaaaaggg aatctttatg cttcctgagg ctgttcttga acatggctct 120 tttttatgtg tcattatctt ag 142 <210> 8 <211> 1228 <212> DNA <213> Glycine max <400> 8 taacaaaaat aaatagaaaa tagtgggtga acacttaaat gcgagatagt aatacctaaa 60 aaaagaaaaa aatataggta taataaataa tataactttc aaaataaaaa gaaatcatag 120 agtctagcgt agtgtttgga gtgaaatgat gttcacctac cattactcaa agattttgtt 180 gtgtccctta gttcattctt attattttac atatcttact tgaaaagact ttttaattat 240 tcattgagat cttaaagtga ctgttaaatt aaaataaaaa acaagtttgt taaaacttca 300 aataaataag agtgaaggga gtgtcatttg tcttctttct tttattgcgt tattaatcac 360 gtttctcttc tctttttttt ttttcttctc tgctttccac ccattatcaa gttcatgtga 420 agcagtggcg gatctatgta aatgagtggg gggcaattgc acccacaaga ttttattttt 480 tatttgtaca ggaataataa aataaaactt tgcccccata aaaaataaat attttttctt 540 aaaataatgc aaaataaata taagaaataa aaagagaata aattattatt aattttatta 600 ttttgtactt tttatttagt ttttttagcg gttagatttt tttttcatga cattatgtaa 660 tcttttaaaa gcatgtaata tttttatttt gtgaaaataa atataaatga tcatattagt 720 ctcagaatgt ataaactaat aataatttta tcactaaaag aaattctaat ttagtccata 780 aataagtaaa acaagtgaca attatatttt atatttactt aatgtgaaat aatacttgaa 840 cattataata aaacttaatg acaggagata ttacatagtg ccataaagat attttaaaaa 900 ataaaatcat taatacactg tactactata taatattcga tatatatttt taacatgatt 960 ctcaatagaa aaattgtatt gattatattt tattagacat gaatttacaa gccccgtttt 1020 tcatttatag ctcttacctg tgatctattg ttttgcttcg ctgtttttgt tggtcaaggg 1080 acttagatgt cacaatatta atactagaag taaatattta tgaaaacatg taccttacct 1140 caacaaagaa agtgtggtaa gtggcaacac acgtgttgca tttttggccc agcaataaca 1200 cgtgtttttg tggtgtacta aaatggac 1228 <210> 9 <211> 625 <212> DNA <213> Glycine max <400> 9 gtacatttta ttgcttattc acctaaaaac aatacaatta gtacatttgt tttatctctt 60 ggaagttagt cattttcagt tgcatgattc taatgctctc tccattctta aatcatgttt 120 tcacacccac ttcatttaaa ataagaacgt gggtgttatt ttaatttcta ttcactaaca 180 tgagaaatta acttatttca agtaataatt ttaaaatatt tttatgctat tattttatta 240 caaataatta tgtatattaa gtttattgat tttataataa ttatattaaa attatatcga 300 tattaatttt tgattcactg atagtgtttt atattgttag tactgtgcat ttattttaaa 360 attggcataa ataatatatg taaccagctc actatactat actgggagct tggtggtgaa 420 aggggttccc aaccctcctt tctaggtgta catgctttga tacttctggt accttcttat 480 atcaatataa attatatttt gctgataaaa aaacatggtt aaccattaaa ttcttttttt 540 aaaaaaaaaa ctgtatctaa actttgtatt attaaaaaga agtctgagat taacaataaa 600 ctaacactca tttggattca ctgca 625 <210> 10 <211> 98 <212> DNA <213> Glycine max <400> 10 ggtgagtgat tttttgactt ggaagacaac aacacattat tattataata tggttcaaaa 60 caatgacttt ttctttatga tgtgaactcc atttttta 98 <210> 11 <211> 115 <212> DNA <213> Glycine max <400> 11 ggtaactaaa ttactcctac attgttactt tttcctcctt ttttttatta tttcaattct 60 ccaattggaa atttgaaata gttaccataa ttatgtaatt gtttgatcat gtgca 115 <210> 12 <211> 148 <212> DNA <213> Glycine max <220> <223> FAD3-1B intron 3c <400> 12 gtaatctcac tctcacactt tctttataca tcgcacgcca gtgtgggtta tttgcaacct 60 acaccgaagt aatgccctat aattaatgag gttaacacat gtccaagtcc aatattttgt 120 tcacttattt gaacttgaac atgtgtag 148 <210> 13 <211> 361 <212> DNA <213> Glycine max <220> <223> FAD3-1B intron 4 <400> 13 gtatcccatt taacacaatt tgtttcatta acattttaag agaatttttt tttcaaaata 60 gttttcgaaa ttaagcaaat accaagcaaa ttgttagatc tacgcttgta cttgttttaa 120 agtcaaattc atgaccaaat tgtcctcaca agtccaaacc gtccactatt ttattttcac 180 ctactttata gcccaatttg ccatttggtt acttcagaaa agagaacccc atttgtagta 240 aatatattat ttatgaatta tggtagtttc aacataaaac atacttatgt gcagttttgc 300 catccttcaa aagaaggtag aaacttactc catgttactc tgtctatatg taatttcaca 360 g 361 <210> 14 <211> 1037 <212> DNA <213> Glycine max <400> 14 gtaacaaaaa taaatagaaa atagtgagtg aacacttaaa tgttagatac taccttcttc 60 ttcttttttt tttttttttt gaggttaatg ctagataata gctagaaaga gaaagaaaga 120 caaatatagg taaaaataaa taatataacc tgggaagaag aaaacataaa aaaagaaata 180 atagagtcta cgtaatgttt ggatttttga gtgaaatggt gttcacctac cattactcaa 240 agattctgtt gtctacgtag tgtttggact ttggagtgaa atggtgttca cctaccatta 300 ctcagattct gttgtgtccc ttagttactg tcttatattc ttagggtata ttctttattt 360 tacatccttt tcacatctta cttgaaaaga ttttaattat tcattgaaat attaacgtga 420 cagttaaatt aaaataataa aaaattcgtt aaaacttcaa ataaataaga gtgaaaggat 480 catcattttt cttctttctt ttattgcgtt attaatcatg cttctcttct tttttttctt 540 cgctttccac ccatatcaaa ttcatgtgaa gtatgagaaa atcacgattc aatggaaagc 600 tacaggaacy ttttttgttt tgtttttata atcggaatta atttatactc cattttttca 660 caataaatgt tacttagtgc cttaaagata atatttgaaa aattaaaaaa attattaata 720 cactgtacta ctatataata tttgacatat atttaacatg attttctatt gaaaatttgt 780 atttattatt ttttaatcaa aacccataag gcattaattt acaagaccca tttttcattt 840 atagctttac ctgtgatcat ttatagcttt aagggactta gatgttacaa tcttaattac 900 aagtaaatat ttatgaaaaa catgtgtctt accccttaac cttacctcaa caaagaaagt 960 gtgataagtg gcaacacacg tgttgctttt ttggcccagc aataacacgt gtttttgtgg 1020 tgtacaaaaa tggacag 1037 <210> 15 <211> 4497 <212> DNA <213> Glycine max <400> 15 cttgcttggt aacaacgtcg tcaagttatt attttgttct tttttttttt atcatatttc 60 ttattttgtt ccaagtatgt catattttga tccatcttga caagtagatt gtcatgtagg 120 aataggaata tcactttaaa ttttaaagca ttgattagtc tgtaggcaat attgtcttct 180 tcttcctcct tattaatatt ttttattctg ccttcaatca ccagttatgg gagatggatg 240 taatactaaa taccatagtt gttctgcttg aagtttagtt gtatagttgt tctgcttgaa 300 gtttagttgt gtgtaatgtt tcagcgttgg cttcccctgt aactgctaca atggtactga 360 atatatattt tttgcattgt tcattttttt cttttactta atcttcattg ctttgaaatt 420 aataaaacaa aaagaaggac cgaatagttt gaagtttgaa ctattgccta ttcatgtaac 480 ttattcaccc aatcttatat agtttttctg gtagagatca ttttaaattg aaggatataa 540 attaagagga aatacttgta tgtgatgtgt ggcaatttgg aagatcatgc gtagagagtt 600 taatggcagg ttttgcaaat tgacctgtag tcataattac actgggccct ctcggagttt 660 tgtgcctttt tgttgtcgct gtgtttggtt ctgcatgtta gcctcacaca gatatttagt 720 agttgttgtt ctgcatataa gcctcacacg tatactaaac gagtgaacct caaaatcatg 780 gccttacacc tattgagtga aattaatgaa cagtgcatgt gagtatgtga ctgtgacaca 840 acccccggtt ttcatattgc aatgtgctac tgtggtgatt aaccttgcta cactgtcgtc 900 cttgtttgtt tccttatgta tattgatacc ataaattatt actagtatat cattttatat 960 tgtccatacc attacgtgtt tatagtctct ttatgacatg taattgaatt ttttaattat 1020 aaaaaataat aaaacttaat tacgtactat aaagagatgc tcttgactag aattgtgatc 1080 tcctagtttc ctaaccatat actaatattt gcttgtattg atagcccctc cgttcccaag 1140 agtataaaac tgcatcgaat aatacaagcc actaggcatg gtaaattaaa ttgtgcctgc 1200 acctcgggat atttcatgtg gggttcatca tatttgttga ggaaaagaaa ctcccgaaat 1260 tgaattatgc atttatatat cctttttcat ttctagattt cctgaaggct taggtgtagg 1320 cacctagcta gtagctacaa tatcagcact tctctctatt gataaacaat tggctgtaat 1380 gccgcagtag aggacgatca caacatttcg tgctggttac tttttgtttt atggtcatga 1440 tttcactctc tctaatctct ccattcattt tgtagttgtc attatcttta gatttttcac 1500 tacctggttt aaaattgagg gattgtagtt ctgttggtac atattacaca ttcagcaaaa 1560 caactgaaac tcaactgaac ttgtttatac tttgacacag ggtctagcaa aggaaacaac 1620 aatgggaggt agaggtcgtg tggcaaagtg gaagttcaag ggaagaagcc tctctcaagg 1680 gttccaaaca caaagccacc attcactgtt ggccaactca agaaagcaat tccaccacac 1740 tgctttcagc gctccctcct cacttcattc tcctatgttg tttatgacct ttcatttgcc 1800 ttcattttct acattgccac cacctacttc cacctccttc ctcaaccctt ttccctcatt 1860 gcatggccaa tctattgggt tctccaaggt tgccttctca ctggtgtgtg ggtgattgct 1920 cacgagtgtg gtcaccatgc cttcagcaag taccaatggg ttgatgatgt tgtgggtttg 1980 acccttcact caacactttt agtcccttat ttctcatgga aaataagcca tcgccgccat 2040 cactccaaca caggttccct tgaccgtgat gaagtgtttg tcccaaaacc aaaatccaaa 2100 gttgcatggt tttccaagta cttaaacaac cctctaggaa gggctgtttc tcttctcgtc 2160 acactcacaa tagggtggcc tatgtattta gccttcaatg tctctggtag accctatgat 2220 agttttgcaa gccactacca cccttatgct cccatatatt ctaaccgtga gaggcttctg 2280 atctatgtct ctgatgttgc tttgttttct gtgacttact ctctctaccg tgttgcaacc 2340 ctgaaagggt tggtttggct gctatgtgtt tatggggtgc ctttgctcat tgtgaacggt 2400 tttcttgtga ctatcacata tttgcagcac acacactttg ccttgcctca ttacgattca 2460 tcagaatggg actggctgaa gggagctttg gcaactatgg acagagatta tgggattctg 2520 aacaaggtgt ttcatcacat aactgatact catgtggctc accatctctt ctctacaatg 2580 ccacattacc atgcaatgga ggcaaccaat gcaatcaagc caatattggg tgagtactac 2640 caatttgatg acacaccatt ttacaaggca ctgtggagag aagcgagaga gtgcctctat 2700 gtggagccag atgaaggaac atccgagaag ggcgtgtatt ggtacaggaa caagtattga 2760 tggagcaacc aatgggccat agtgggagtt atggaagttt tgtcatgtat tagtacataa 2820 ttagtagaat gttataaata agtggatttg ccgcgtaatg actttgtgtg tattgtgaaa 2880 cagcttgttg cgatcatggt tataatgtaa aaataattct ggtattaatt acatgtggaa 2940 agtgttctgc ttatagcttt ctgcctaaaa tgcacgctgc acgggacaat atcattggta 3000 atttttttaa aatctgaatt gaggctactc ataatactat ccataggaca tcaaagacat 3060 gttgcattga ctttaagcag aggttcatct agaggattac tgcataggct tgaactacaa 3120 gtaatttaag ggacgagagc aactttagct ctaccacgtc gttttacaag gttattaaaa 3180 tcaaattgat cttattaaaa ctgaaaattt gtaataaaat gctattgaaa aattaaaata 3240 tagcaaacac ctaaattgga ctgattttta gattcaaatt taataattaa tctaaattaa 3300 acttaaattt tataatatat gtcttgtaat atatcaagtt ttttttttta ttattgagtt 3360 tggaaacata taataaggaa cattagttaa tattgataat ccactaagat cgacttagta 3420 ttacagtatt tggatgattt gtatgagata ttcaaacttc actcttatca taatagagac 3480 aaaagttaat actgatggtg gagaaaaaaa aatgttattg ggagcatatg gtaagataag 3540 acggataaaa atatgctgca gcctggagag ctaatgtatt ttttggtgaa gttttcaagt 3600 gacaactatt catgatgaga acacaataat attttctact tacctatccc acataaaata 3660 ctgattttaa taatgatgat aaataatgat taaaatattt gattctttgt taagagaaat 3720 aaggaaaaca taaatattct catggaaaaa tcagcttgta ggagtagaaa ctttctgatt 3780 ataattttaa tcaagtttaa ttcattcttt taattttatt attagtacaa aatcattctc 3840 ttgaatttag agatgtatgt tgtagcttaa tagtaatttt ttatttttat aataaaattc 3900 aagcagtcaa atttcatcca aataatcgtg ttcgtgggtg taagtcagtt attccttctt 3960 atcttaatat acacgcaaag gaaaaaataa aaataaaatt cgaggaagcg cagcagcagc 4020 tgataccacg ttggttgacg aaactgataa aaagcgctgt cattgtgtct ttgtttgatc 4080 atcttcacaa tcacatctcc agaacacaaa gaagagtgac ccttcttctt gttattccac 4140 ttgcgttagg tttctacttt cttctctctc tctctctctc tcttcattcc tcatttttcc 4200 ctcaaacaat caatcaattt tcattcagat tcgtaaattt ctcgattaga tcacggggtt 4260 aggtctccca ctttatcttt tcccaagcct ttctctttcc ccctttccct gtctgcccca 4320 taaaattcag gatcggaaac gaactgggtt cttgaatttc actctagatt ttgacaaatt 4380 cgaagtgtgc atgcactgat gcgacccact cccccttttt tgcattaaac aattatgaat 4440 tgaggttttt cttgcgatca tcattgcttg aattgaatca tattaggttt agattct 4497 <210> 16 <211> 18 <212> DNA <213> Artificial sequence <220> PCR primers <400> 16 atacaagcca ctaggcat 18 <210> 17 <211> 26 <212> DNA <213> Artificial sequence <220> PCR primers <400> 17 gattggccat gcaatgaggg aaaagg 26 <210> 18 <211> 778 <212> DNA <213> Artificial sequence <220> <221> misc_feature (222) (1) .. (778) <223> unsure at all n locations <220> PCR primers <400> 18 atacaagcca ctaggcatgg taaattaaat tgtgcctgca cctcgggata tttcatgtgg 60 ggttcatcat atttgttgag gaaaagaaac tcccgaaatt gaattatgca tttatatatc 120 ctttttcatt tctagatttc ctgaaggctt aggtgtaggc acctagctag tagctacaat 180 atcagcactt ctctctattg ataaacaatt ggctgtaatg ccgcagtaga ggacgatcac 240 aacatttcgt gctggttact ttttgtttta tggtcatgat ttcactctct ctaatctctc 300 cattcatttt gtagttgtca ttatctttag atttttcact acctggttta aaattgaggg 360 attgtagttc tgttggtaca tattacacat tcagcaaaac aactgaaact caactgaact 420 tgtttatact ttgacacagg gtctagcaaa ggaaacaaca atgggaggta gaggtcgtgt 480 ggccaaagtg gaagttcaag ggaagaagcc tctctcaagg gttccaaaca caaagccacc 540 attcactgtt ggccaactca agaaagcaat tccaccacac tgctttcagc gctccctcct 600 cacttcattc tcctatgttg tttatgacct ttcatttgcc ttcattttct acattgccac 660 cacctacttc cacctccttc ctcaaccctt ttccctcatt gcatggccaa tcaagccgaa 720 ttctgcagat atccatcaca tggcggcggn tggngnaggn ntntanaggg cccaattc 778 <210> 19 <211> 2463 <212> DNA <213> Glycine max <400> 19 actatagggc acgcgtggtc gacggcccgg gctggtcctc ggtgtgactc agccccaagt 60 gacgccaacc aaacgcgtcc taactaaggt gtagaagaaa cagatagtat ataagtatac 120 catataagag gagagtgagt ggagaagcac ttctcctttt tttttctctg ttgaaattga 180 aagtgttttc cgggaaataa ataaaataaa ttaaaatctt acacactcta ggtaggtact 240 tctaatttaa tccacacttt gactctatat atgttttaaa aataattata atgcgtactt 300 acttcctcat tatactaaat ttaacatcga tgattttatt ttctgtttct cttctttcca 360 cctacataca tcccaaaatt tagggtgcaa ttttaagttt attaacacat gtttttagct 420 gcatgctgcc tttgtgtgtg ctcaccaaat tgcattcttc tctttatatg ttgtatttga 480 attttcacac catatgtaaa caagattacg tacgtgtcca tgatcaaata caaatgctgt 540 cttatactgg caatttgata aacagccgtc cattttttct ttttctcttt aactatatat 600 gctctagaat ctctgaagat tcctctgcca tcgaatttct ttcttggtaa caacgtcgtc 660 gttatgttat tattttattc tatttttatt ttatcatata tatttcttat tttgttcgaa 720 gtatgtcata ttttgatcgt gacaattaga ttgtcatgta ggagtaggaa tatcacttta 780 aaacattgat tagtctgtag gcaatattgt cttctttttc ctcctttatt aatatatttt 840 gtcgaagttt taccacaagg ttgattcgct ttttttgtcc ctttctcttg ttctttttac 900 ctcaggtatt ttagtctttc atggattata agatcactga gaagtgtatg catgtaatac 960 taagcaccat agctgttctg cttgaattta tttgtgtgta aattgtaatg tttcagcgtt 1020 ggctttccct gtagctgcta caatggtact gtatatctat tttttgcatt gttttcattt 1080 tttcttttac ttaatcttca ttgctttgaa attaataaaa caatataata tagtttgaac 1140 tttgaactat tgcctattca tgtaattaac ttattcactg actcttattg tttttctggt 1200 agaattcatt ttaaattgaa ggataaatta agaggcaata cttgtaaatt gacctgtcat 1260 aattacacag gaccctgttt tgtgcctttt tgtctctgtc tttggttttg catgttagcc 1320 tcacacagat atttagtagt tgttctgcat acaagcctca cacgtatact aaaccagtgg 1380 acctcaaagt catggcctta cacctattgc atgcgagtct gtgacacaac ccctggtttc 1440 catattgcaa tgtgctacgc cgtcgtcctt gtttgtttcc atatgtatat tgataccatc 1500 aaattattat atcatttata tggtctggac cattacgtgt actctttatg acatgtaatt 1560 gagtttttta attaaaaaaa tcaatgaaat ttaactacgt agcatcatat agagataatt 1620 gactagaaat ttgatgactt attctttcct aatcatattt tcttgtattg atagccccgc 1680 tgtccctttt aaactcccga gagagtataa aactgcatcg aatattacaa gatgcactct 1740 tgtcaaatga agggggggaa atgatactac aagccactag gcatggtatg atgctaaatt 1800 aaattgtgcc tgcaccccag gatatttcat gtgggattca tcatttattg aggaaaactc 1860 tccaaattga atcgtgcatt tatatttttt ttccatttct agatttcttg aaggcttatg 1920 gtataggcac ctacaattat cagcacttct ctctattgat aaacaattgg ctgtaatacc 1980 acagtagaga acgatcacaa cattttgtgc tggttacctt ttgttttatg gtcatgattt 2040 cactctctct aatctgtcac ttccctccat tcattttgta cttctcatat ttttcacttc 2100 ctggttgaaa attgtagttc tcttggtaca tactagtatt agacattcag caacaacaac 2160 tgaactgaac ttctttatac tttgacacag ggtctagcaa aggaaacaat aatgggaggt 2220 ggaggccgtg tggccaaagt tgaaattcag cagaagaagc ctctctcaag ggttccaaac 2280 acaaagccac cattcactgt tggccaactc aagaaagcca ttccaccgca ctgctttcag 2340 cgttccctcc tcacttcatt gtcctatgtt gtttatgacc tttcattggc tttcattttc 2400 tacattgcca ccacctactt ccacctcctc cctcacccct tttccctcat tgcatggcca 2460 atc 2463 <210> 20 <211> 44 <212> DNA <213> Artificial sequence <220> PCR primers <400> 20 cuacuacuac uactcgagac aaagccttta gcctttagcc tatg 44 <210> 21 <211> 36 <212> DNA <213> Artificial sequence <220> PCR primers <400> 21 caucaucauc auggatccca tgtctctcta tgcaag 36 <210> 22 <211> 1704 <212> DNA <213> Glycine max <400> 22 actatagggc acgcgtggtc gacggcccgg gctggtcctc ggtgtgactc agccccaagt 60 gacgccaacc aaacgcgtcc taactaaggt gtagaagaaa cagatagtat ataagtatac 120 catataagag gagagtgagt ggagaagcac ttctcctttt tttttctctg ttgaaattga 180 aagtgttttc cgggaaataa ataaaataaa ttaaaatctt acacactcta ggtaggtact 240 tctaatttaa tccacacttt gactctatat atgttttaaa aataattata atgcgtactt 300 acttcctcat tatactaaat ttaacatcga tgattttatt ttctgtttct cttctttcca 360 cctacataca tcccaaaatt tagggtgcaa ttttaagttt attaacacat gtttttagct 420 gcatgctgcc tttgtgtgtg ctcaccaaat tgcattcttc tctttatatg ttgtatttga 480 attttcacac catatgtaaa caagattacg tacgtgtcca tgatcaaata caaatgctgt 540 cttatactgg caatttgata aacagccgtc cattttttct ttttctcttt aactatatat 600 gctctagaat ctctgaagat tcctctgcca tcgaatttct ttcttggtaa caacgtcgtc 660 gttatgttat tattttattc tatttttatt ttatcatata tatttcttat tttgttcgaa 720 gtatgtcata ttttgatcgt gacaattaga ttgtcatgta ggagtaggaa tatcacttta 780 aaacattgat tagtctgtag gcaatattgt cttctttttc ctcctttatt aatatatttt 840 gtcgaagttt taccacaagg ttgattcgct ttttttgtcc ctttctcttg ttctttttac 900 ctcaggtatt ttagtctttc atggattata agatcactga gaagtgtatg catgtaatac 960 taagcaccat agctgttctg cttgaattta tttgtgtgta aattgtaatg tttcagcgtt 1020 ggctttccct gtagctgcta caatggtact gtatatctat tttttgcatt gttttcattt 1080 tttcttttac ttaatcttca ttgctttgaa attaataaaa caatataata tagtttgaac 1140 tttgaactat tgcctattca tgtaattaac ttattcactg actcttattg tttttctggt 1200 agaattcatt ttaaattgaa ggataaatta agaggcaata cttgtaaatt gacctgtcat 1260 aattacacag gaccctgttt tgtgcctttt tgtctctgtc tttggttttg catgttagcc 1320 tcacacagat atttagtagt tgttctgcat acaagcctca cacgtatact aaaccagtgg 1380 acctcaaagt catggcctta cacctattgc atgcgagtct gtgacacaac ccctggtttc 1440 catattgcaa tgtgctacgc cgtcgtcctt gtttgtttcc atatgtatat tgataccatc 1500 aaattattat atcatttata tggtctggac cattacgtgt actctttatg acatgtaatt 1560 gagtttttta attaaaaaaa tcaatgaaat ttaactacgt agcatcatat agagataatt 1620 gactagaaat ttgatgactt attctttcct aatcatattt tcttgtattg atagccccgc 1680 tgtccctttt aaactcccga gaga 1704 <210> 23 <211> 4010 <212> DNA <213> Glycine max <400> 23 acaaagcctt tagcctatgc tgccaataat ggataccaac aaaagggttc ttcttttgat 60 tttgatccta gcgctcctcc accgtttaag attgcagaaa tcagagcttc aataccaaaa 120 cattgctggg tcaagaatcc atggagatcc ctcagttatg ttctcaggga tgtgcttgta 180 attgctgcat tggtggctgc agcaattcac ttcgacaact ggcttctctg gctaatctat 240 tgccccattc aaggcacaat gttctgggct ctctttgttc ttggacatga ttggtaataa 300 tttttgtgtt tcttactctt tttttttttt ttttgtttat gatatgaatc tcacacattg 360 ttctgttatg tcatttcttc ttcatttggc tttagacaac ttaaatttga gatctttatt 420 atgtttttgc ttatatggta aagtgattct tcattatttc attcttcatt gattgaattg 480 aacagtggcc atggaagctt ttcagatagc cctttgctga atagcctggt gggacacatc 540 ttgcattcct caattcttgt gccataccat ggatggttag ttcatactgg cttttttgtt 600 tgttcatttg tcattgaaaa aaaatctttt gttgattcaa ttatttttat agtgtgtttg 660 gaagcccgtt tgagaaaata agaaatcgca tctggaatgt gaaagttata actatttagc 720 ttcatctgtc gttgcaagtt cttttattgg ttaaattttt atagcgtgct aggaaaccca 780 ttcgagaaaa taagaaatca catctggaat gtgaaagtta taactgttag cttctgagta 840 aacgtggaaa aaccacattt tggatttgga accaaatttt atttgataaa tgacaaccaa 900 attgattttg atggattttg caggagaatt agccacagaa ctcaccatga aaaccatgga 960 cacattgaga aggatgagtc atgggttcca gtatgtgatt aattgcttct cctatagttg 1020 ttcttgattc aattacattt tatttatttg gtaggtccaa gaaaaaaggg aatctttatg 1080 cttcctgagg ctgttcttga acatggctct tttttatgtg tcattatctt agttaacaga 1140 gaagatttac aagaatctag acagcatgac aagactcatt agattcactg tgccatttcc 1200 atgtttgtgt atccaattta tttggtgagt gattttttga cttggaagac aacaacacat 1260 tattattata atatggttca aaacaatgac tttttcttta tgatgtgaac tccatttttt 1320 agttttcaag aagccccgga aaggaaggct ctcacttcaa tccctacagc aatctgtttc 1380 cacccagtga gagaaaagga atagcaatat caacactgtg ttgggctacc atgttttctc 1440 tgcttatcta tctctcattc attaactagt ccacttctag tgctcaagct ctatggaatt 1500 ccatattggg taactaaatt actcctacat tgttactttt tcctcctttt ttttattatt 1560 tcaattctcc aattggaaat ttgaaatagt taccataatt atgtaattgt ttgatcatgt 1620 gcagatgttt gttatgtggc tggactttgt cacatacttg catcaccatg gtcaccacca 1680 gaaactgcct tggtaccgcg gcaaggtaac aaaaataaat agaaaatagt gggtgaacac 1740 ttaaatgcga gatagtaata cctaaaaaaa gaaaaaaata taggtataat aaataatata 1800 actttcaaaa taaaaagaaa tcatagagtc tagcgtagtg tttggagtga aatgatgttc 1860 acctaccatt actcaaagat tttgttgtgt cccttagttc attcttatta ttttacatat 1920 cttacttgaa aagacttttt aattattcat tgagatctta aagtgactgt taaattaaaa 1980 taaaaaacaa gtttgttaaa acttcaaata aataagagtg aagggagtgt catttgtctt 2040 ctttctttta ttgcgttatt aatcacgttt ctcttctctt tttttttttt cttctctgct 2100 ttccacccat tatcaagttc atgtgaagca gtggcggatc tatgtaaatg agtggggggc 2160 aattgcaccc acaagatttt attttttatt tgtacaggaa taataaaata aaactttgcc 2220 cccataaaaa ataaatattt tttcttaaaa taatgcaaaa taaatataag aaataaaaag 2280 agaataaatt attattaatt ttattatttt gtacttttta tttagttttt ttagcggtta 2340 gatttttttt tcatgacatt atgtaatctt ttaaaagcat gtaatatttt tattttgtga 2400 aaataaatat aaatgatcat attagtctca gaatgtataa actaataata attttatcac 2460 taaaagaaat tctaatttag tccataaata agtaaaacaa gtgacaatta tattttatat 2520 ttacttaatg tgaaataata cttgaacatt ataataaaac ttaatgacag gagatattac 2580 atagtgccat aaagatattt taaaaaataa aatcattaat acactgtact actatataat 2640 attcgatata tatttttaac atgattctca atagaaaaat tgtattgatt atattttatt 2700 agacatgaat ttacaagccc cgtttttcat ttatagctct tacctgtgat ctattgtttt 2760 gcttcgctgt ttttgttggt caagggactt agatgtcaca atattaatac tagaagtaaa 2820 tatttatgaa aacatgtacc ttacctcaac aaagaaagtg tggtaagtgg caacacacgt 2880 gttgcatttt tggcccagca ataacacgtg tttttgtggt gtactaaaat ggacaggaat 2940 ggagttattt aagaggtggc ctcaccactg tggatcgtga ctatggttgg atcaataaca 3000 ttcaccatga cattggcacc catgttatcc accatctttt cccccaaatt cctcattatc 3060 acctcgttga agcggtacat tttattgctt attcacctaa aaacaataca attagtacat 3120 ttgttttatc tcttggaagt tagtcatttt cagttgcatg attctaatgc tctctccatt 3180 cttaaatcat gttttcacac ccacttcatt taaaataaga acgtgggtgt tattttaatt 3240 tctattcact aacatgagaa attaacttat ttcaagtaat aattttaaaa tatttttatg 3300 ctattatttt attacaaata attatgtata ttaagtttat tgattttata ataattatat 3360 taaaattata tcgatattaa tttttgattc actgatagtg ttttatattg ttagtactgt 3420 gcatttattt taaaattggc ataaataata tatgtaacca gctcactata ctatactggg 3480 agcttggtgg tgaaaggggt tcccaaccct cctttctagg tgtacatgct ttgatacttc 3540 tggtaccttc ttatatcaat ataaattata ttttgctgat aaaaaaacat ggttaaccat 3600 taaattcttt ttttaaaaaa aaaactgtat ctaaactttg tattattaaa aagaagtctg 3660 agattaacaa taaactaaca ctcatttgga ttcactgcag acacaagcag caaaaccagt 3720 tcttggagat tactaccgtg agccagaaag atctgcgcca ttaccatttc atctaataaa 3780 gtatttaatt cagagtatga gacaagacca cttcgtaagt gacactggag atgttgttta 3840 ttatcagact gattctctgc tcctccactc gcaacgagac tgagtttcaa actttttggg 3900 ttattattta ttgattctag ctactcaaat tacttttttt ttaatgttat gttttttgga 3960 gtttaacgtt ttctgaacaa cttgcaaatt acttgcatag agagacatgg 4010 <210> 24 <211> 34 <212> DNA <213> Artificial sequence <220> PCR primers <400> 24 acgaattcct cgaggtaaat taaattgtgc ctgc 34 <210> 25 <211> 33 <212> DNA <213> Artificial sequence <220> PCR primers <400> 25 gcgagatcta tcgatctgtg tcaaagtata aac 33 <210> 26 <211> 19 <212> DNA <213> Artificial sequence <220> PCR primers <400> 26 catgctttct gtgcttctc 19 <210> 27 <211> 19 <212> DNA <213> Artificial sequence <220> PCR primers <400> 27 gttgatccaa ccatagtcg 19 <210> 28 <211> 36 <212> DNA <213> Artificial sequence <220> PCR primers <400> 28 gcgatcgatg tatgatgcta aattaaattg tgcctg 36 <210> 29 <211> 30 <212> DNA <213> Artificial sequence <220> PCR primers <400> 29 gcggaattcc tgtgtcaaag tataaagaag 30 <210> 30 <211> 30 <212> DNA <213> Artificial sequence <220> PCR primers <400> 30 gatcgatgcc cggggtaata atttttgtgt 30 <210> 31 <211> 29 <212> DNA <213> Artificial sequence <220> PCR primers <400> 31 cacgcctcga gtgttcaatt caatcaatg 29 <210> 32 <211> 24 <212> DNA <213> Artificial sequence <220> PCR primers <400> 32 cactcgagtt agttcatact ggct 24 <210> 33 <211> 25 <212> DNA <213> Artificial sequence <220> PCR primers <400> 33 cgcatcgatt gcaaaatcca tcaaa 25 <210> 34 <211> 38 <212> DNA <213> Artificial sequence <220> PCR primers <400> 34 cuacuacuac uactcgagcg taaatagtgg gtgaacac 38 <210> 35 <211> 41 <212> DNA <213> Artificial sequence <220> PCR primers <400> 35 caucaucauc auctcgagga attcgtccat tttagtacac c 41 <210> 36 <211> 39 <212> DNA <213> Artificial sequence <220> PCR primers <400> 36 cuacuacuac uactcgaggc gcgtacattt tattgctta 39 <210> 37 <211> 41 <212> DNA <213> Artificial sequence <220> PCR primers <400> 37 caucaucauc auctcgagga attctgcagt gaatccaaat g 41 <210> 38 <211> 22 <212> DNA <213> Artificial sequence <220> PCR primers <400> 38 caccatggtc atcatcagaa ac 22 <210> 39 <211> 22 <212> DNA <213> Artificial sequence <220> PCR primers <400> 39 tcacgatcca cagttgtgag ac 22

Claims (19)

At least 70% of the sequence on the sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 4, complements thereof and fragments of any one thereof A substantially purified nucleic acid molecule comprising a nucleic acid sequence having homology. Recombinant nucleic acid molecule, which is operably linked, comprising: (a) a promoter that acts to induce the production of mRNA molecules in plants; And (b) under very stringent conditions, SEQ ID NO: 4, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, their complement and fragments of any of these A nucleic acid sequence that hybridizes to a nucleic acid sequence selected from the group. (a) a agent having a first nucleic acid sequence having at least 85% homology with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to SEQ ID NO: 2, complements thereof and fragments of any one thereof 1) a first promoter operably linked to a nucleic acid molecule, and (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 14, their complements and fragments of any one thereof A nucleic acid molecule comprising a second nucleic acid molecule having a second nucleic acid sequence having at least% homology, wherein the second nucleic acid molecule is operably linked to the first promoter or to the second promoter in a polycistronic structure. Soybean transgenic plants having a. 4. The transgenic soy plant of claim 3 wherein a single promoter is operably linked to the first and second nucleic acid molecules. The transgenic soybean plant according to claim 4, wherein said single promoter is a seed specific promoter. The transgenic soybean plant according to claim 3, wherein both the first promoter and the second promoter are seed specific promoters. The transgenic soybean plant according to claim 6, wherein both the first promoter and the second promoter are 7S promoters. 4. The transgenic soybean plant according to claim 3, wherein said first promoter is different from said second promoter. The transgenic soybean plant according to claim 8, wherein the first promoter is a 7S promoter and the second promoter is a napin promoter. 4. The level of transcript encoded by the FAD2-1 gene according to claim 3, wherein the first nucleic acid molecule is transcribed and does not partially affect the level of the transcript encoded by the FAD2-2 gene. Transgenic soybean plant, characterized in that it can selectively reduce. 4. The level of transcript encoded by the FAD2-1 gene according to claim 3, wherein the first nucleic acid molecule is transcribed and does not substantially affect the level of the transcript encoded by the FAD2-2 gene. Transgenic soybean plant, characterized in that it can selectively reduce. 4. The method of claim 3, wherein the first nucleic acid molecule is transcribed to change the level of the transcript encoded by the FAD2-1 gene without necessarily affecting the level of the transcript encoded by the FAD2-2 gene. Transgenic soybean plant, characterized in that it can be selectively reduced. Each nucleic acid molecule is operably linked to a promoter, and each nucleic acid molecule is selected from the group consisting of SEQ ID NO: 1, 2, 4-14, their complements and fragments of any one thereof; A transgenic soybean plant having two or more nucleic acid molecules, having a nucleic acid sequence having at least 85% homology. The method of claim 13, wherein the first nucleic acid molecule is transcribed and does not partially affect, substantially affect, or necessarily affect the level of the transcript encoded by the second FAD gene, A transgenic soybean plant, characterized in that it is possible to selectively reduce the level of transcript encoded by the first FAD gene. Without at least partially affecting the levels of transcripts encoded by other genes selected from the group consisting of FAD2-1A, FAD2-1B, FAD2-2B, FAD3-1A, FAD3-1B and FAD3-1C , A transgenic soybean plant, wherein the levels of transcripts encoded by genes selected from the group consisting of FAD2-1A, FAD2-1B, FAD2-2B, FAD3-1A, FAD3-1B, and FAD3-1C are selectively reduced. A method of producing a soybean plant with seeds having a reduced linolenic acid content, comprising the following steps: (a) a agent having a first nucleic acid sequence having at least 85% homology with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, complements thereof and fragments of any one thereof A first promoter operably linked to one nucleic acid molecule, and (b) operably linked to a first promoter or a second promoter, wherein SEQ ID NOs: 4 to SEQ ID NOs: 14, complements thereof, and any of these Transforming the soybean plant with a nucleic acid molecule comprising a second nucleic acid molecule having a second nucleic acid sequence having at least 85% homology with a nucleic acid sequence selected from the group consisting of one fragment; And cultivating the plant having a similar genetic background, but producing a seed having less linolenic acid than the plant lacking the nucleic acid molecule. A method of producing a soybean plant with seeds having an increased oleic acid content, comprising the following steps: (a) a agent having a first nucleic acid sequence having at least 85% homology with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 2, complements thereof and fragments of any one thereof A first promoter operably linked to one nucleic acid molecule, and (b) operably linked to a first promoter or a second promoter, wherein SEQ ID NOs: 4 to SEQ ID NOs: 14, complements thereof, and any of these Transforming the soybean plant with a nucleic acid molecule comprising a second nucleic acid molecule having a second nucleic acid sequence having at least 85% homology with a nucleic acid sequence selected from the group consisting of one fragment; And cultivating the plant having a similar genetic background but producing seeds having more oleic acid than the plant lacking the nucleic acid molecule. A method of producing a plant having a seed having a modified oil composition, comprising the following steps: Operably linked components comprising at least 85% of a first promoter and a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 4 to 14, their complements, and fragments of any one of them Transforming the plant with a nucleic acid molecule comprising a first nucleic acid molecule having a first nucleic acid sequence having homology; And cultivating the plant having a similar genetic background, but producing a seed having an altered oil composition as compared to the plant lacking the nucleic acid molecule. A method of producing a plant having a seed having an altered ratio of monounsaturated fatty acid to polyunsaturated fatty acid, comprising the following steps: Wherein each nucleic acid molecule is operably linked to a promoter and is operably linked components, comprising: SEQ ID NOs: 1, 2, 4 to 14, their complements and fragments of any one of them Transforming the plant with a construct comprising two or more nucleic acid molecules each having a nucleic acid sequence having at least 85% homology with the selected nucleic acid sequence; And cultivating said plant having a similar genetic background but producing seeds having an altered ratio of monounsaturated fatty acids to polyunsaturated fatty acids relative to plants lacking said at least two nucleic acid molecules.