KR20050020790A - Packaged virus-like particles for use as adjuvants, method of preparation and use - Google Patents

Abstract

The present invention relates to the fields of vaccine, immunology and medicine. The present invention relates to the discovery that viral sheep particles (VLPs) can be loaded and packed with DNA oligonucleotides (CpGs) enriched in unmethylated C and G, respectively. When CpG-VLPs are mixed with antigens, the immunogenicity of these antigens is markedly enhanced. In addition, the T cell response to the antigen is specifically for Th1 type. Surprisingly, covalent linkage of antigen and VLP is not required, but is sufficient to simply mix VLPs and adjuvant for co-administration. In addition, VLPs did not enhance the immune response when not loaded and packed with CpGs, respectively. Thus, antigens mixed with CpG-packed VLPs may be ideal vaccines for vaccination for the prevention or treatment of allergies, tumors and other magnetic molecules and chronic viral diseases.

Description

PACKAGED VIRUS-LIKE PARTICLES FOR USE AS ADJUVANTS, METHOD OF PREPARATION AND USE}

The present invention relates to the fields of vaccine, immunology and medicine. The present invention provides an immune response against an antigen mixed with virus-positive particles (VLPs) packed with an immunostimulatory material, preferably an immunostimulatory nucleic acid, even more preferably an oligonucleotide comprising at least one non-methylated CpG sequence. Provided are compositions and methods for enhancing. The present invention can be used to induce potent antibodies and T cell responses that are particularly useful in the treatment of allergies, tumors and chronic viral diseases and other chronic diseases.

Immune system elements are based on two different basal centers: one is specific or adaptive immunity characterized by relatively slow response-kinetics and the ability to remember; The other is non-specific or innate immunity that shows fast response-kinetics but lacks memory. Lymphocytes are important players in adaptive immunity. Each lymphocyte expresses an antigen-receptor with unique specificities. When the antigen is recognized through the receptor, lymphocytes increase and show effector action. There are few lymphocytes that show specificity for a given antigen or pathogen, and large amounts of proliferation are usually required before effector responses can be measured, and therefore the adaptive immune system is slow kinetics. The adaptive immune system responds more quickly when secondary encounters with antigens, because lymphocytes that expand at significant rates survive longer and can retain the function of some effectors after antigen removal. This is the basis for memory.

In contrast to the situation in lymphocytes, where the specificity for the pathogen is limited to the few cells that must be expanded to achieve action, the cells and molecules of the innate immune system are usually present in large quantities and have a constant number of constant properties associated with the pathogen. (Medzhitov, R. and Janeway, CA, Jr., Cell 91: 295-298 (1997)). Examples of such patterns include lipopolysaccharide (LPS), unmethylated CG-rich DNA (CpG) or double stranded RNA, which are specific for bacterial and viral infection, respectively.

Immunology Most research has focused on the adaptive immune system, and has recently focused on the innate immune system. Histologically, the adaptive and innate immune system were treated and analyzed as two separate entities with little in common. This is inconsistent with the fact that the researchers did not have questions about why antigens are more immune to specific immune systems when applied with adjuvants that stimulate sensitizing immunity (Sotomayor, EM, et al., Nat. Med. 5: 780 (1999); Diehl, L., et al., Nat. Med. 5: 774 (1999); Weigle, WO, Adv. Immunol. 30: 159 (1980)). However, the answer to this question is important in understanding the balance between protective and autoimmunity and in understanding the immune system.

Activation of APCs involved in the rationalized manipulation of the innate immune system and in particular T cell priming to deliberately induce self-specific T cell responses provides a method for treating T cell-based tumors. Thus, most recently, we have focused on using activated dendritic cells (DCs) as antigen-carriers to induce a sustained T cell response (Nestlee et al., Nat. Med. 4: 328 (1998)). Similarly, in vivo activators of the innate immune system, such as CpGs or anti-CD40 antibodies, are applied with tumor cells to enhance their immunity (Sotomayor, EM, et al., Nat. Med. 5: 780 (1999). Diehl, L., et al., Nat. Med. 5: 774 (1999)).

Activation of conventional APCs by factors that stimulate innate immunity can be responsible for inducing self-specific lymphocytes and autoimmunity. It is compatible with the results that administration of LPS with thyroid extract can overcome resistance and cause autoimmune thyroiditis (Weigle, W. 0., Adv. Immunol. 30: 159 (1980)). In addition, in transgenic mouse models, it has recently been found that self-immune cannot induce autoimmunity if APCs are not activated by separate pathways (Garza, KM, et al., J Exp. Med. 191: 2021 (2000). The association with innate immune and autoimmune diseases is understood by the consequence that normal activation of LPS, viral infections or APCs delays or hinders the establishment of peripheral resistance (Vella, AT et al., Immunity 2; 261). (1995); Ehl, S., et al., J. Exp. Med., 187: 763 (1998); Maxwell, JR et al., J. Immunol. 162: 2024 (1999). In this manner, innate immunity not only activates self-specific lymphocytes but also inhibits subsequent elimination. These findings can be extended to the regulation of tumor biology and chronic viral diseases.

The presence of T helper cells (Th cells) is required to induce cytotoxic T lymphocyte (CTL) responses after immunization with subtissue compatible antigens such as HY-antigens (Husmann, LA, and MJBevan, Ann NY.Acad Sci., 532: 158 (1988); Guerder, S., and P. Matzinger, J. Exp. Med. 176: 553 ((1992)) cross-priming, i.e. CTL-response induced by reaction with reaching exogenous antigen has also been shown to require the presence of Th cells (Bennett, SRM et., Al. J. Exp. Med 186: 65 (1997)). It is an important result for tumor therapies that may be important for inducing the defense response of CTLs by tumor cells (Ossendorp, F., et al., J. Exp. Med. 187: 693 (1998)).

Important effector molecules on activated Th cells are CD40-ligands (CD40L) that interact with CD40 on B cells, macrophages and dendritic cells (DCs) (Foy, TM, et al., Annu. Rev. Immunol. 14: 591 (1996). Inducing CD40L on B cells is important for isotype exchange and B cell memory formation (Foy, T.M., et al., Annu. Rev. Immunol. 14: 591 (1996)). More recently, stimulation of CD40 on macrophages and dendritic cells (DCs) has been shown to cause their activation and maturation (Cella, M., et al., Curr. Opin, Immunol. 9:10 (1997)); Banchereua, J., and R.M. Steinman Nature 392: 245 (1998). In particular, DCs produce cytokines such as IL-12 upon activation and upregulate costimulatory molecules. Interestingly, maturation of CD40L-mediated DCs has been shown to result in the helper's action on the CTL response. Indeed, CD40-induced by Th cells allows DCs to initiate CTL-response (Ridge, JP et al., Nature 393: 474 (1998); Bennett, SRM, et al, Nature 393: 478) Schoenenberger, SP et al., Nature 393: 480 (1998). Consistent with earlier observations that Th cells should recognize their ligands on the same APC as CTLs, this indicates that cognate interactions are required (Bennett, SRM et., Al. J. Exp. Med 186: 65). 1997)). Thus, CD40-mediated stimulation by Th cells can provide a CTL-response after stimulating DCs.

In contrast to these Th-dependent CTL responses, viruses can induce a protective CTL-response mainly in the absence of T help (see Bachmann., MF, et al., J. Immunol. 161: 5791 ( In particular, lymphocytic meningitis virus (LCMV) (Leist, TP et al., Immunol 138: 2278 (1987); AHmed, R., et al., Virol. 62: 2102 (1988); Battegay, M. et al., cell Immunol. 167: 115 (1996); Borrow, P., et al., J. Exp, Med 183: 2129 (1996); Whimire, JK et al., J. Virol 70: 8375 (1996) , Influenza virus (Tripp, RA et al., J. Immunol, 30: 679 (1989)) and vaccinia virus (Leist, TP et al., Scand. J. Immonol 30: 679 (1989)) and exromelia virus (Buller, R., et al., Nature 328: 77 (1987)) can respond to CTL-response in mice lacking CD4 ⁺ T cells or lacking the expression of class II or CD40. The mechanism for Th cell independent CTL-response is not currently understood. Although unable to completely stimulate Th cell independent CTL-response, virus-specific CTL-activity is reduced in cells lacking Th-cells, therefore Th cells can enhance anti-viral CTL responses, but this help The mechanism of is not yet fully understood, and recently DCs have been shown to present influenza-inducing antigens by cross-reaction (Albert, ML et al., J. Exp. Med, 188: 1359 (1998); Alber, ML et al., Nature 392; 86 (1998), thus similar to that shown for subtissue conformation antigens and tumor antigens (Ridge, JP et al., Nature 393: 474 (1998); Bennett, SRM, et al. Nature 393: 478 (1998); Schoenenberger, SP et al., Nature 393: 480 (1998)) Th cells can induce CD40 on DCs to help induce CTLs. Thus, stimulating CD40 with CD40L or anti-CD40 antibodies can enhance CTL induction after stimulation by virus or tumor cells.

However, although CD40L is an important activator of DCs, it appears that there are additional molecules that can stimulate maturation and activation of DCs in the immune response. Indeed, it is difficult to determine that CD40 is involved in the induction of CTLs specific to LCMV or VSV (Ruell, C., et al., J. Exp. Med. 189: 1875 (1999)). Thus, the VSV-specific CLT response depends in part on the presence of CD4 ⁺ T cells (Kundig, TM, et al, Immunity 5:41 (1996)), but the action of this helper is not mediated by CD40L. Candidates of effector molecules that cause maturation of DCs in the immune response are Trance and TNF (Bachmann, MF, et al., J. Exp. Med. 189: 1025 (1999); Sallusto, F., and A. Lanzavecchia , J Exp Med 179: 1109 (1994)), but additional proteins with similar properties may be present, such as CpGs.

Administering only purified protein is usually not sufficient to elicit a strong immune response; It has been well demonstrated that commonly isolated antigens must be provided with a helper material called an adjuvant. Antigens administered in these adjuvants are protected from rapid degradation and the adjuvant releases the antigens at low levels for a long time.

Unlike isolated proteins, in the absence of both adjuvant with and without T cell help, the virus elicits a rapid and effective immune response (Bachmann & Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1997)). Primarily viruses are not composed of proteins but can elicit stronger immune responses than their isolated components. For the B cell response, an important factor for the immunogenicity of the virus is the repetition and order of the surface epitopes.

Many viruses exhibit quasi-crystalline surfaces that exhibit a regular array of epitopes that effectively crosslink epitopes-specific immunoglobulins on B cells (Bachmann and Zinkernagel, Immunol. Today 17: 553-558 (1996). )). Crosslinking of surface immunoglobulins on B cells is a powerful activation signal that directly induces cell cycle progression and IgM antibody production. In addition, the so-called B cells activate T helper cells, resulting in the conversion of IgG antibody production from IgM in B cells, forming long-term B cell memory targeted for any vaccination (Bachmann and Zinkernagel, Ann. Rev. Immunol. 15: 235-270 (1997). Viral structure is also associated with anti-antibody production as part of spontaneous responses to autoimmune diseases and pathogens (see Fehr, T., et al., J Exp. Med. 185: 1785-1792 (1997)). . Thus, antigens on virus particles organized in ordered and repeating antigen arrays are highly immunogenic because they can directly activate B cells. However, the immunogenicity of soluble antigens that do not bind to repetitive surfaces is insufficient in the absence of an adjuvant. Pathogens, allergen extracts and tumors typically include adjuvant formulations that can be easily mixed with antigen-formulations that do not require a complex conjugation process because they cannot be readily expressed and cannot bind to repetitive structures. It would be desirable.

In addition to potent B cell responses, viral particles can induce the development of cytotoxic T cell responses, another important part of the immune system. These cytotoxic T cells are particularly important for the elimination of tumors and the removal of non-cytopathic viruses such as HIV or hepatitis B virus. Cytotoxic T cells do not recognize innate antigens but recognize their degradation products associated with MHC class I molecules (Townsend & Bodmer, Ann. Rev. Immunol 7: 601-624 (1989)). Macrophages and dendritic cells can absorb and process exogenous virus particles (except for their soluble isolated components) and can present the resulting degradation products for cytotoxic T cells to activate and proliferate ( Kovacsovics-Bankowski et al., Proc. Natl Acad. Sci. USA 90: 49420 \ -4946 (1993); Bachmann et al., Eur, J. Immunol 26: 2595-26700 (1996)). In addition, activated DCs can process and present soluble proteins.

Viral particles as antigens offer two advantages over their isolated components: (1) due to their highly repetitive surface structure, they directly activate B cells to raise antigen titers and prolong B cell memory; (2) Viral particles, except soluble proteins, can induce cytotoxic T cell responses even when the virus is non-infectious and no adjuvant is present.

Several novel vaccine strategies utilize virus inherent immunogenicity. Some of these approaches describe certain properties of viral particles; (see Harding, C et al., J. Immunology 153: 4925 (1994), describing vaccines consisting of latex beads and antigens); Kovacsovics-Bankowski et al., Proc. Natl Acad. Sci. USA 90: 49420 \ -4946 (1993), which describes a vaccine consisting of iron oxide beads and antigens); U.S.Patent No. 5,334,394 to Kovacsovics-Bankowski et al, which describe synthetic polymers that carry one or more proteins covalently attached thereto on a surface); And a core particle comprising a non-covalent bond coating at least partially covering the surface of the core particle, and at least one biologically active agent in contact with the coated core particle (eg, WO 94/15585). I put it.

In addition, viral sheep particles (VLPs) are used in the field of vaccine manufacture due to their structural and non-infectious properties (eg WO 98/50071). VLPs are super molecular structures made in a symmetrical fashion from many protein molecules having one or more forms. It is non-infectious because it lacks the viral genome. VLPs can be prepared in large quantities primarily by heterologous expression and can be easily purified.

In addition, DNA (CpG) enriched in non-methylated CG motifs present in bacteria and mainly invertebrates in vitro and in vivo showed potent stimulatory activity against B cells, dendritic cells and other APC's. Bacterial DNA is immunostimulatory between many vertebrate species, but individual CpG motifs may be different. Indeed, CpG motifs that stimulate immune cells in mice are not necessarily able to stimulate human immune cells, and vice versa.

Although DNA enriched in unmethylated CG motifs can exhibit immunostimulatory capacity, its efficacy is limited because it is unstable in vitro and in vivo. Thus, it exhibits undesirable pharmacokinetics. In order to make CpG- oligonucleotides more potent, it is usually necessary to introduce and stabilize phosphorothioate modifications of the phosphate backbone.

The second limitation in using CpGs to stimulate an immune response is that there is no specificity because all APC's and B cells that come in contact with CpGs can be stimulated. Thus, stabilizing or packing them in a manner that limits cell activation to cells presenting relevant antigens can improve the efficacy and specificity of DNA oligonucleotides comprising CpGs.

In addition, immunostimulatory CpG-oligodeoxynucleotides induce strong side effects by inducing extramedullary hematopoiesis associated with splenomegaly and lymphadenopathy in mice (Sparwasser et al., J. Immunol. (1999), 162: 2368). -74). Recent evidence has demonstrated that VLPs containing packed CpGs can elicit potent T cell responses to antigens conjugated to VLPs (WO03 / 024481). In addition, packing CpGs enhanced its stability and essentially eradicated side effects such as causing myeloid hematopoiesis accompanied by splenomegaly and lymphadenopathy in mice. In particular, packed CpGs did not induce splenomegaly. However, as mentioned above, most pathogens, tumors and allergen extracts contain a large number of antigens and may be difficult to recombinantly express all of these antigens before they are conjugated with VLPs. Thus, it may be desirable to include an adjuvant formulation that can be simply mixed with the antigen-formulation without the need for a complex conjugate process.

Significant advances have been made in recent vaccination strategies, but there is still a need to improve the current strategies. In particular, there remains a need in the art to develop new and improved vaccines that can induce potent T and B cell responses without the need for conjugating antigens and carrier materials.

Summary of the Invention

The present invention is based on the surprising finding that immunostimulatory materials such as DNA oligonucleotides can be packed into VLPs to make them more immune. Unexpectedly, the nucleic acids and oligonucleotides present in the VLPs, respectively, can be specifically replaced by immunostimulatory substances and DNA-oligonucleotides, each comprising a CpG motif. Surprisingly, these packed immunostimulatory substances, especially immunostimulatory nucleic acids such as unmethylated CpG-containing oligonucleotides, maintained their immunostimulatory capacity without extensively activating the innate immune system. Compositions comprising VLP's and immunostimulatory substances according to the invention, in particular CpG-VLPs, are more markedly immune than their CpG-deficient counterparts and have marked B and T cell responses to antigens applied with packed VLPs. To promote. Unexpectedly, antigens and VLPs did not need to be coupled to enhance the immune response. Also, due to packing, CpGs bound to VLPs did not induce systemic side effects such as splenomegaly.

In a first aspect, the invention provides a virus-positive particle and an immunostimulatory substance, preferably an immunostimulatory nucleic acid, even more preferably an unmethylated CpG-containing oligonucleotide, wherein the substance, nucleic acid or oligonucleotide couples to the virus-positive particle. Provided are compositions for enhancing an immune response in an animal, including ringing or fusion thereto, or otherwise attaching or enclosing, ie bound, preferably packed). The composition further comprises an antigen mixed with virus-positive particles.

In a preferred aspect of the invention, immunostimulatory nucleic acids, especially unmethylated CpG-containing oligonucleotides, are stabilized by phosphorothioate modification of the phosphate backbone. In another preferred aspect, immunostimulatory nucleic acids, particularly unmethylated CpG-containing oligonucleotides, are packed into VLPs by digesting RNA in VLPs and simultaneously adding DNA oligonucleotides comprising selected CpGs. In an equally preferred aspect, the VLPs can be degraded before being reassembled in the presence of CpGs.

In a further preferred aspect, the immunostimulatory nucleic acid does not comprise a CpG motif but nevertheless exhibits immunostimulatory activity. This is described in WO01 / 22972. All sequences described herein are incorporated by reference.

In a preferred aspect of the invention, the unmethylated CpG-containing oligonucleotides are not stable by modification of phosphorothioates of the phosphodiester backbone.

In a preferred embodiment, unmethylated CpG containing oligonucleotides induce IFN-alpha in human cells. In another preferred aspect, the IFN-alpha induced oligonucleotides are flanked by guanosine-rich repeats and comprise a palindromic sequence.

In a further preferred aspect, the virus-positive particles are recombinant virus-positive particles. Also preferably, the virus-positive particles lack the lipoprotein envelope.

Preferably, the recombinant virus-positive particles are hepatitis B virus, measles virus, sindbis virus, rotavirus, goofy disease virus, retrovirus, norwalk virus or human papillomavirus (Papilloma virus), RNA-phage, Qβ- Phage, GA-phage, fr-phage, AP205-phage and Ty, or alternatively consist thereof. In certain aspects, the virus-positive particles comprise or differ from one or more different hepatitis B virus core (capsid) proteins (HBcAgs).

In a further preferred aspect, the virus-positive particle comprises a recombinant protein of RNA-phage, or a fragment thereof. Preferred RNA-phage are Qβ-phage, AP 205-phage, GA-phage, fr-phage.

In another embodiment, the antigen, antigens or antigen mixture is a recombinant antigen. In another aspect, antigens, antigens or antigen mixtures are naturally occurring, including but not limited to pollen, dust, fungi, insects, food, mammalian epidermis, hair, saliva, serum, bees, tumors, pathogens and feathers Extracted from the circle.

In another embodiment, the antigen comprises (1) a polypeptide suitable for inducing an immune response against cancer cells; (2) polypeptides suitable for inducing an immune response against an infectious disease; 3) polypeptides suitable for inducing an immune response against allergens; 4) polypeptides suitable for inducing an immune response against self-antigens; And (5) polypeptides suitable for inducing an immune response against livestock or pets.

In a further aspect, the antigen, antigens or antigen mixture may comprise (1) an organic molecule suitable for inducing an immune response against cancer cells; (2) organic molecules suitable for inducing an immune response against an infectious disease; 3) organic molecules suitable for inducing an immune response against allergens; 4) organic molecules suitable for inducing an immune response against self-antigens; (5) organic molecules suitable for inducing an immune response against livestock or pets; And (6) organic molecules suitable for inducing an immune response against drugs, hormones or toxic compounds.

In certain aspects, the antigen comprises or otherwise consists of a cytotoxic T cell or Th cell epitope. In a related aspect, the antigen comprises or otherwise consists of a B cell epitope. In a related aspect, the virus-positive particles comprise the hepatitis B virus core protein.

In another aspect of the invention, viral-positive particles and immunostimulatory substances, preferably immunostimulatory nucleic acids, even more preferably unmethylated CpG-containing oligonucleotides, wherein the substances, preferably nucleic acids, and even more preferably oligonucleotides are A composition comprising a virus-positive particle (ie, coupled, attached or surrounded), preferably packed with it, and the virus-positive particle mixed with an antigen, several antigens, or an antigen mixture). Provided is a method of enhancing an immune response in a human or other animal, including introducing the animal into an animal.

In another aspect of the invention, the composition is introduced into the animal via subcutaneous, intramuscular, intranasal, intradermal, intravenous or direct lymph nodes. In an equally preferred aspect, the immune enhancing composition is applied topically to a local viral reservoir to which the tumor or vaccination is to be caused.

In a preferred aspect of the invention, the immune response is a T cell response and the T cell response to the antigen is enhanced. In certain aspects, the T cell response is a cytotoxic T cell response and the cytotoxic T cell response to the antigen is enhanced. In another aspect of the invention, the immune response is a B cell response and the B cell response to the antigen is enhanced.

The invention also relates to a vaccine comprising an immunologically effective amount of an immune enhancing composition of the invention in combination with a pharmaceutically acceptable diluent, carrier or excipient. In a preferred aspect, the vaccine further comprises at least one adjuvant, such as Alum or Freund's incomplete adjuvant. The present invention also provides methods of animal immunization and / or treatment comprising administering an immunologically effective amount of the described vaccine to the animal.

In a preferred aspect of the invention, immunostimulant-containing VLPs, preferably immunostimulatory nucleic acid-comprising VLP's, even more preferably unmethylated CpG-comprising oligonucleotide VLPs are used for animal or human vaccination against antigens mixed with modified VLPs. use. Modified VLPs can be used to vaccinate, for example, against tumors, viral diseases, or self-molecules. Vaccination can be for prophylactic or therapeutic purposes, or both. Modified VLPs can also be used to vaccinate against allergies or diseases associated with allergies, such as asthma, to induce antibody responses and / or immune response bias against allergens. The vaccination and treatment can lead to desensitization of previous allergic animals and patients, respectively.

In many cases, the preferred immune response will be directed against antigens mixed with immunostimulatory material-containing VLPs, preferably immunostimulatory nucleic acid-containing VLP's, even more preferably unmethylated CpG-containing oligonucleotide VLPs. The antigen can be a peptide, protein or region and mixtures thereof.

The injection route is preferably subcutaneous or intramuscular but CpG-comprising VLPs can be applied directly into the dermis, intranasal, intravenous or lymph nodes. In an equally preferred aspect, CpG-comprising VLPs are applied topically, to a local viral reservoir to which tumors or vaccinations are intended.

It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are intended to further explain the claimed invention.

Brief description of the drawings

FIG. 1 shows naïve agarose gel electrophoresis (1% agarose) after control incubation or after RNase A degradation when stained with ethidium bromide (A) or Coomassie blue (B) to assess the presence of RNA or protein. VLPs). Recombinantly produced VLPs were diluted in PBS buffer with a final concentration of 0.5 μg / μl protein and absent (lane 1) or absent RNase A (100 μg / ml) (Sigma, Division of Fluka AG, Switzerland) at 37 ° C. for 2 hours. Incubated under (lane 2). Samples were then supplemented with 6-fold concentrated DNA-loading buffer (MBS Fermentas GmbH, Heidelberg, Germany) and transferred for 30 minutes at 100 volts in a raw 1% agarose gel. Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as a reference for the speed of VLPs movement (lane M). The row indicates the presence of RNA (A) or VLPs themselves (B) surrounded by VLPs. Consistent results were obtained in three independent experiments.

FIG. 2 shows RNase A degradation or after control incubation in the presence of buffer only or CpG-containing DNA-oligonucleotides when stained with ethidium bromide (A) or Coomassie blue (B) to assess the presence of RNA / DNA or protein. The VLPs are shown in the following naïve agarose gel electrophoresis (1% agarose). Recombinantly produced VLPs were diluted in PBS buffer with a final concentration of 0.5 μg / μl protein and absent (lane 1) or absent RNase A (100 μg / ml) (Sigma, Division of Fluka AG, Switzerland) at 37 ° C. for 2 hours. Incubated under (lane 2). 5 nmol CpG-oligonucleotides (including phosphorothioate modification of the phosphate backbone) were added to Sample 3 prior to RNase A digestion. Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as a reference for the rate of p33-VLPs migration (lane M). The row indicates the presence of RNA (A) surrounded by p33-VLPs or p33-VLPs themselves (B). Comparable results were obtained when CpG oligonucleotides with normal phosphorus binding were used for co-incubation of VLPs with RNase A.

FIG. 3 shows continuous dialysis before and after RNase A degradation in the presence of CpG-containing DNA-oligonucleotides when stained with ethidium bromide (A) or Coomassie blue (B) to assess the presence of DNA or protein. P33-VLPs are shown in raw agarose gel electrophoresis (1% agarose) afterwards (for removal of VLP-unbound CpG oligonucleotides). Recombinantly produced VLPs were diluted in PBS buffer with a final concentration of 0.5 μg / μl protein and absent (lane 1) or absent RNase A (100 μg / ml) (Sigma, Division of Fluka AG, Switzerland) at 37 ° C. for 2 hours. Incubated under (lanes 2 to 5). 50 nmol CpG-oligonucleotides (including phosphorothioate bonds: lanes 2 and 3, including normal phosphorus modifications of the phosphate backbone: lanes 4 and 5) were added prior to RNase A digestion. The treated samples were completely dialyzed against PBS (4500-fold dilution) for 24 hours using 300 kDa MWCO dialysis membranes (Spectrum Medical Industries Inc., Houston, USA) to remove excess DNA (lanes 3 and 5). Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as a reference for the rate of p33-VLPs migration (lane M). The row indicates the presence of RNA / CpG-DNA (A) or VLPs themselves (B) surrounded by VLPs.

Figure 4 shows after control incubation or after RNase A digestion when stained with ethidium bromide (A) or Coomassie blue (B) to assess the presence of RNA / DNA or protein, where CpG-containing DNA-oligonucleotides VLPs in naïve agarose gel electrophoresis (1% agarose) only after RNA digestion was terminated. Recombinantly produced VLPs were diluted in PBS buffer with a final concentration of 0.5 μg / μl protein and absent (lane 1) or absent RNase A (100 μg / ml) (Sigma, Division of Fluka AG, Switzerland) at 37 ° C. for 2 hours. Incubated under (lane 2). 5 nmol CpG-oligonucleotides (including phosphorothioate modification of the phosphate backbone) were added to Sample 3 only after RNase A digestion. Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as a reference for the rate of p33-VLPs migration (lane M). The row indicates the presence of RNA (A) or VLPs themselves (B) surrounded by VLPs. Similar results were obtained when CpG oligonucleotides with normal phosphorus bonds were used for the assembly of VLPs.

Figure 5 shows RNase A-derived from HBcAg accompanying CpG-rich DNA (normal phosphodiester site), and VLPs dialyzed from unbound CpG-oligonucleotides enhance IgG responses to bee venom allergens (BV). To be effective. 5 μg of bee venom (ALK Abello) alone or in combination with one of the following was given subcutaneously to mice: 50 μg VLPs alone, 50 μg VLPs each loaded and packed with CpG-oligonucleotides or 20 nmol CpG- oligonucleotides 50 μg VLPs. Alternatively mice were given 5 μg of bee venom mixed with VLP loaded and packed with CpG-oligonucleotides alone with 50 μg VLP or with aluminum hydroxide. After 14 days, the same vaccine formulation was boosted into mice and bled on day 21. From day 21, bee venom specific IgG responses were assessed by ELISA. The results are shown as the optimal density for the indicated serum dilutions. The mean of each two mice is shown.

Figure 6 shows that treated VLPs derived from RNase A (HBc) accompanying CpG-rich DNA (normal phosphor binding) and unbound CpG-oligonucleotides to bee venom allergen PLA2 (phospholipase A2). More effective in enhancing IgG2a than in response to an IgG1 response. 5 μg of bee venom (ALK Abello) alone or in combination with one of the following was given subcutaneously to mice: 50 μg VLPs alone, 50 μg VLPs each loaded and packed with CpG-oligonucleotides or 20 nmol CpG- oligonucleotides 50 μg VLPs. Alternatively mice were given 5 μg of bee venom mixed with VLP loaded and packed with CpG-oligonucleotides alone with 50 μg VLP or with aluminum hydroxide. After 14 days, the same vaccine formulation was boosted into mice and bled on day 21. From day 21, the PLA2-specific IgG response was assessed by ELISA. Note that Alum is preferably present to induce IgG1 even in the presence of CpG-packed VLPs or free CpGs. The results are shown as the optimal density for the indicated serum dilutions. The mean of each two mice is shown.

7 shows that free CpGs (HBc), except for CpGs packed into VLPs, significantly increased spleen after vaccination. Mice were immunized with 100 μg VLPs alone, CpGs alone (20 nmol) and 100 μg VLPs containing CpGs mixed or packed with 20 nmol CpGs. Total lymphocyte count / spleen was measured after 12 days.

8 shows allergic temperature drop in VLP (CpG) + bee venom vaccinated mice. Two sets of mice were tested. Group 1 (n = 7) received VLP (CpG) mixed with bee venom as a vaccine. Group 2 (n = 6) received only VLP (CpG). After inoculation with a large amount of bee venom (30 μg), allergic reactions were evaluated through changes in body temperature of the mice. No significant changes in body temperature were observed in any of the mice tested in group 1 who received bee venom with VLP (CpG). In contrast, body temperature was markedly lowered in 4 of 6 animals in group 2 who received only VLP (CpG) as the desensitized vaccine. Thus, these mice were not protected from allergic reactions. Note: The symbols in the figure represent the mean of 6 mice (VLP (CpG)) or 7 (VLP (CpG) + bee venom), including the standard deviation (SD).

9 shows the detection of specific IgE and IgG sera of mice before and after desensitization. All mice were sensitized by 4 injections of bee venom in Alum. Mice were then vaccinated with VLP (CpG) + bee venom to induce a protective immune response or vaccinated with VLP (CpG) only as a control. Blood samples from all mice were taken before and after desensitization and bee venom specific IgE antibodies (Panel A). ), IgG1 antibody (Panel B) and IgG2a antibody (Panel C) were tested by ELISA, respectively. As shown in FIG. 9A, an increase in IgE titers was observed in VLP (CpG) + bee venom vaccinated mice after desensitization. The results are shown as optical density (OD _{450 nm} ) in 1: 250 serum dilutions. The mean of 6 mice (VLP (CpG)) or 7 (VLP (CpG) + bee venom), including the standard deviation (SD), is shown in the figure. In FIG. 9B, anti-bee venom IgG1 serum titers were increased after desensitization only in mice vaccinated with VLP (CpG) + bee venom. The IgG2a serum titers measured in FIG. 9C were also identical. As predicted for successful desensitization, the increase in IgG2a serum titers was most significant. Results are expressed as the mean of two (VLP (CpG)) or three (VLP (CpG) + bee venom) for serum dilutions of 1: 12500 (IgG1) or 1: 500 (IgG2a) including SD.

10 shows the antibody response of Balb / c mice immunized with grass pollen extracts mixed with Qb VLPs, respectively, loaded with Qp VLPs loaded with CpG-2006 or Alum. Grass pollen extract coated on the plate was used for ELISA analysis. Incubate the wells with a 1:60 dilution of each mouse serum or a 1:10 dilution for detection of IgE isotype antibodies from day 21 for IgG1, IgG2a and IgG2b detection and the corresponding isocoupled to horseradishperoxidase It was performed using a type specific anti-mouse secondary antibody. The optimal density was plotted at 450 nm after the colorimetric reaction.

11 shows antibody responses of Balb / c mice sensitized with grass pollen extracts mixed with Alum and then sensitized with grass pollen extracts mixed with Qb VLPs or mixed with Qb VLPs loaded and packed with CpG-2006 or Alum, respectively. Indicates. One group of mice was left untreated. Grass pollen extract coated on the plate was used for ELISA analysis. Wells were incubated with serial dilutions of each mouse serum and detection was performed using IgG1 and IgG2a isotype specific anti-mouse secondary antibodies coupled to horseradish peroxidase. ELISA titers were calculated as the inverse of the dilutions giving 50% of the optimal density at saturation. FIG. 11A shows the titer of IgG1 and FIG. 11B shows the titer of IgG2b.

Figure 12 shows g10gacga-PO packing analysis into HBc33 on 1% agarose gel stained with ethidium bromide (A) or Coomassie blue (B). 15 μg of the following sample was loaded onto the gel: 1. 1 kb MBI Fermentas DNA ladder; 2. untreated HBc33 VLP; 3. HBc33 VLPs treated with RNase A; 4. HBc33 VLPs treated with RNase A and packed with g10gacga-PO; 5. HBc33 VLPs treated with RNase A, packed with g10gacga-PO, treated with Benzonase and dialyzed.

FIG. 13 shows electron micrographs of Qβ VLPs reassembled in the presence of different oligodeoxynucleotides. VLPs were reassembled in the presence of the indicated oligodeoxynucleotide or tRNA but were not purified into homogeneous suspension by size exclusion chromatography. Samples of “complete” Qβ VLPs purified from E. coli. Were used as positive controls.

14 shows nucleic acid content analysis of reassembled Qβ VLPs by nuclease treatment and agarose gel electrophoresis: with 5 μg of reassembled and purified Qβ VLPs and 5 μg of E. coli. Treatment was as directed. After this treatment, the sample was mixed with a loading die and loaded onto a 0.8% agarose gel. After transfer, the gel was first stained with ethidium bromide (A) and the same gel was stained with Coomassie blue (B).

The AP205 VLP protein disassembled in FIG. 15 A shows an electron micrograph, and FIG. 15 B shows the reassembled particles before purification. 15C shows electron micrographs of purified reassembled AP205 VLPs. The magnification of FIGS. 15A-C is 200 000 X. FIG.

16 A and B show reassembled AP205 VLPs analyzed by agarose gel electrophoresis. Samples loaded on gel from both figures are from left to right, untreated AP205 VLPs, three samples comprising different amounts of AP205 VLPs reassembled and purified with CyCpG, and untreated Qβ VLPs. The gel on FIG. 16A was stained with ethidium bromide while the same gel was stained with Coomassie blue in FIG. 16B.

FIG. 17 shows SDS-PAGE analysis demonstrating multiple coupling bands consisting of one, two or three peptides coupled to Qβ monomers (arrows, FIG. 17). For simplicity the coupling product of peptides p33 and Qβ VLPs was defined as HBc33, in particular via experimental section.

FIG. 18 shows packing analysis of B-CpGpt into Qbx33 VLPs on 1% Aragos gel stained with ethidium bromide (A) and Coomassie Blue (B). 50 μg of the following sample was loaded onto the gel: 1. untreated Qbx33 VLP; 2. Qbx33 VLPs treated with RNase A; 3. Qbx33 VLPs treated with RNase A and packed with B-CpGpt; 4. Qbx33 VLPs treated with RNase A, packed with B-CpGpt, treated with DNaseI and dialyzed; 5.1 kb MBI Fermentas DNA Letter. (C) shows amount analysis of packed oligos extracted from VLPs on 15% TBE / urea stained with SYBR Gold. The following samples were loaded onto gels: 1. BCpGpt oligo content of 2 μg Qbx33 VLPs after proteolytic enzyme K digestion and RNase A treatment; 2. 20 pmol B-CpGpt control; 3.10 pmol B-CpGpt control; 4.5 pmol B-CpGpt control. 18D and E show packing analysis of g10gacga-PO into Qbx33 VLPs on 1% Aragos gels stained with ethidium bromide (D) and Coomassie Blue (E). 15 μg of the following sample was loaded onto the gel: 1. MBI Fermentas 1 kb DNA ladder; 2. untreated Qbx33 VLP; 3. Qbx33 VLPs treated with RNase A; 4. Qbx33 VLPs treated with RNase A and packed with g10gacga-PO; 5. Qbx33 VLPs treated with RNase A, packed with g10gacga-PO, treated with Benzonase and dialyzed. 18 E and F show packing analysis of dsCyCpG-253 into Qbx33 VLPs on 1% Aragos gels stained with ethidium bromide (E) and Coomassie Blue (F). 15 μg of the following sample was loaded onto the gel: 1. MBI Fermentas 1 kb DNA ladder; 2. untreated Qbx33 VLP; 3. Qbx33 VLPs treated with RNase A; 4. Qbx33 VLPs treated with RNase A and packed with dsCyCpG-253; 5. Qbx33 VLPs treated with RNase A, packed with dsCyCpG-253, treated with RNase A and dialyzed.

Unless stated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described below.

1. Definition

Animals: As used herein, the term "animal" includes, for example, humans, sheep, horses, cattle, pigs, dogs, cats, mice, birds, reptiles, fish, insects, and arachnids.

Antibodies: As used herein, the term “antibody” refers to a molecule capable of binding to an epitope or antigenic determinant. The term encompasses whole antigens and antigen-binding fragments thereof, and is meant to include single chain antibodies. Antibodies include, but are not limited to, human antigen binding antibody fragments such as Fab, Fab 'and F (ab') 2, Fd, single chain Fvs (scFv), single chain antibodies, disulfide-binding Fvs (sdFv) and VL or VH regions. Include fragments to include. The antibody may be of animal origin, including poultry and mammals. Preferably, the antibody is a mammalian example, human, rat, rabbit, goat, guinea pig, camel, horse, or the like, or other suitable animal, such as chicken. As used herein, a “human” antibody comprises an antibody having an amino acid sequence of human immunoglobulin, wherein a human immunoglobulin library or one or more human immunoglobulins have been introduced but do not express endogenous immunoglobulins. Antibody isolated from an animal [U. S. Patent No. 5, 939, 598, which is incorporated by reference in its entirety.

In a preferred aspect of the present invention, the composition of the present invention can be used in the design of a vaccine for treating allergy. Antibodies of the IgE isotype are important components in allergic reactions. Mast cells bind to IgE antibodies on their surface

The binding of certain antigens to IgE molecules bound on mast cell surfaces releases histamine and other mediators of allergic reactions. Thus, inhibiting the production of IgE antibodies is a major target for preventing allergies. This may be possible by obtaining the desired T helper cell response. T helper cell responses can be classified into type ₁ (TH ₁ ) and type 2 (TH ₂ ) T helper cell responses (Romagnani, Immunol. Today 18: 263-266 (1997)). T _H 1 cells secrete interferon-gamma and other cytokines that cause B cells to produce IgG antibodies. In contrast, T _H 2 The predominant psychocaine produced by the cell is IL-4, which causes B cells to produce IgE. In many experimental systems, that are mutually exclusive to the T _H 1 cells suppress the induction of T _H 2 cells and the same and vice versa, so generating a T _H 1 and T _H 2. Thus, a potent antigen that produces a potent T _H 1 response simultaneously inhibits the occurrence of a T _H 2 response and consequently inhibits IgG antibody production. In the presence of high concentrations of IgG antibodies, allergens may be inhibited from binding to IgE bound to mast cells, thereby inhibiting the release of histamine. Thus, the presence of IgG antibodies can protect against IgE mediated allergic reactions. Common substances that cause allergies include, but are not limited to: pollen (eg, grass, hives, birch or mount cedar); House dust and dust mites; Mammalian epidermal allergens and animal dandruff; Fungi and fungi; Insect carcasses and insect poisons; feather; prog; And drugs such as penicillin. See Shough, H. et al., REMINGTON'S PHARMACEUTICAL SCIENCES, 19th edition, (Chap. 82), Mack Publishing Company, Mack Publishing Group, Easton, Pennsylvania (1995), which is incorporated herein by reference in its entirety. Therefore, immunizing an individual with an allergen mixed with virus positive particles containing packing DNA enriched in unmethylated CG motifs would be beneficial before and after allergic transformation.

Antigen: As used herein, the term “antigen” refers to a molecule capable of binding by the T cell receptor (TCR) when presented by an antibody or MHC molecule. As used herein, the term “antigen” also encompasses T-cell epitopes. T-cell epitopes are recognized by T-cell receptors in relation to the MHC I class present on all the bodies except red blood cells, or the II class present on immune cells and especially antigen presenting cells. Recognition events activate T-cells and subsequently produce effector mechanisms such as T-cell proliferation, cytokine secretion, perforin secretion, and the like. Antigens can also be recognized by the immune system and / or induce humoral and / or cellular immune responses that activate B- and / or T- lymphocytes. However, in at least special cases, the antigen comprises or is bound to a T _H cell epitope and is provided in an adjuvant. The antigen may comprise one or more epitopes (B- and T- epitopes). The abovementioned specific response means that the antigen preferably reacts with the corresponding antibody or TCR, typically in a highly specific manner, but not with a number of other antibodies or TCRs which may be caused by other antigens. As used herein, an antigen may also be a mixture of several individual antigens.

As used herein, a "microbial antigen" is an antigen of a microorganism and includes, but is not limited to, infectious viruses, infectious bacteria, parasites and infectious fungi. Such antigens include synthetic microorganisms and naturally occurring isolates and fragments or derivatives thereof and synthetic or recombinant compounds that are identical or similar to naturally occurring microbial antigens and elicit an immune response against the microorganism. When a compound induces a naturally occurring microbial antigen in an immune response (body fluid and / or cellular), it is similar to a naturally occurring microbial antigen. Such antigens are commonly used in the art and are well known to the skilled person.

Infectious viruses found in humans include, but are not limited to retroviridae (eg, human immunodeficiency viruses such as HIV-1 (or HTLV-III, LAV or HTLV-III / LAV, or HIV-III); and others Separation statements, such as HIV-LP); Piconapyridae (eg polio virus, hepatitis A virus; enterovirus, human coxsackie virus, rhinovirus, echovirus); Calcivirida (eg, strains causing gastritis); Tocaviridae (eg encephalitis virus, rubella virus); Flaviviridae (eg dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (eg, coronavirus); Rhabdoviridae (eg, vesicular stomatitis virus, rabies virus); Firobiridae (eg, Ebola virus); Paramyxoviridae (eg, parainfluenza virus, mumps virus, measles virus, respiratory synstium virus); Orthomyxoviridae (eg influenza virus); Bungaviridae (eg Hantaan virus, Bunga virus, Flebovirus and Nairo virus); Arena viridae (hemorrhagic fever virus); Leoviridae (eg, leoviruses, orbiviruses and rotaviruses); In Birnavirida; Hepadnaviridae (hepatitis B virus); Parvovirida (parvovirus); Papobabiridae (papilloma virus, polyoma virus); Adenoviridae (mostly adenovirus); Herpesviridae (herpes simple virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus); Foxviridae (bariola virus, vaccinia virus, fox virus); And Iridoviridae (eg, African Porcine Cholera Virus); And unclassified viruses (e.g., pathogens of spongiform encephalopathy, pathogens of delta hepatitis (determined to be the missing satellite of hepatitis B virus), pathogens of non-A, non-B hepatitis (type 1 = internal) Delivery; type 2 = transdermal delivery (ie, hepatitis C); norweek and related viruses, and astroviruses).

Both gram (-) and gram (+) bacteria act as antigens in vertebrates. Gram (+) bacteria include, but are not limited to, Pasteurella spp., Staphylococcus spp., And Streptococcus spp. Gram (-) bacteria include, but are not limited to, E. coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include, but are not limited to: Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacterium spp. (E.g. M. tuberculosis, M. abium, M. intracellular, M. Kansai, M. Gordonae), Staphylococcus aureus, Neisseria gonorhoea, Inner Sara meningitidis, Monolithic Listeria, Streptococcus piogenes (Group A Streptococcus), Streptococcus agal Lacteti (Group B Streptococcus), Streptococcus (Viridans Group), Streptococcus paecalis, Streptococcus bovis, Streptococcus (Horcyogenic non-oxygen), Streptococcus pneumonia, Pathogenic Campylobacter sp. , Enterococcus sp., Haemophilus influenza, Bacillus anthracis, Corynebacterium, Diphtheriade, Clostridium tetany, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocia, Bacteroi Des sp., Fusobacterium nucleatum, Streptobacillus monioliformis, Tretonema palidium, Treponema perhenuee, Leptospira, Rickettsia, Actinomyces israeli and chlamydia.

Examples of infectious fungi include Cryptococcus neoformans, histoplasma capsulatum, coccidioides imtis, blotomyces dematitis, chlamydia trachomatis and candida albicans. Other infectious organisms (ie protozoa) include plasmodium such as Plasmodium falciparum, Plasmodium malaria, Plasmodium obale, Plasmodium vibox, Toxoplasma gondii and cystosoma.

Other medically relevant microorganisms are described in, for example, C.G.A. Thomas, "Medical Microbiology", Baillierer Tindall, Great Britain 1983, which is incorporated herein by reference in its entirety.

The compositions and methods of the present invention are also useful for treating cancer by stimulating antigen-specific immune responses against cancer antigens. As used herein, a "cancer antigen" is a compound, such as a peptide, associated with a tumor or cancer and capable of eliciting an immune response. In particular, compounds may elicit immune responses when present in connection with MHC molecules. Tumor antigens can be prepared by preparing crude extracts of cancer cells, partially purifying antigens, by recombinant techniques, or as known, for example, as described in Cohen et al., Cancer Research, 54; 1055 (1994). Synthesized antigen can be synthesized from cancer cells. Tumor antigens include antigens that are whole tumor or cancer polypeptides or antigen portions thereof. The antigens can be prepared by isolation or recombination by other methods known in the art. Cancer or tumor, but not limited to biliary tract cancer; Brain cancer; Breast cancer; Uterine cancer; Chorionic carcinoma; Colon cancer; Intrauterine cancer; Esophageal cancer; Stomach cancer; Intraepithelial tumors; Lymphoma; Liver cancer; Lung cancer (eg small cell and non-small cell); Melanoma; Neuroblastoma; Oral cancer; Ovarian cancer; Pancreatic cancer; Prostate cancer; Rectal cancer; sarcoma; cutaneous cancer; Testicular cancer; Thyroid cancer; And renal cancer, and other carcinomas and sarcomas.

Allergens also act as antigens in vertebrates. The term "allergen antigen" as used herein also includes "allergen antigen extract" and "allergen antigen epitope". Examples of allergens include, but are not limited to, pollen (eg, grass, hives, birch and mountain cedar); House dust and dust mites; Mammalian epidermal allergens and animal dandruff; Fungi and fungi; Insect carcasses and insect toxins; feather ; prog; And drugs such as penicillin.

Antigen Determinant: As used herein, the term “antigen determinant” refers to a portion of an antigen specifically recognized by B- or T-lymphocytes. B-lymphocytes that respond to antigenic determinants produce antibodies, while T-lymphocytes respond to antigenic determinants by amplifying or building effector functions important for mediating cell and / or humoral immunity

Antigen Presenting Cells: As used herein, the term “antigen presenting cells” refers to a heterogeneous population of bone marrow induced cells or leukocytes with immunostimulatory capacity. For example, these cells can produce peptides that are bound to MHC molecules that can be recognized by T cells. The term is similar to the term "helper cell" and includes, for example, Langerhans cells, interdigitating cells, dendritic cells, B cells and macrophages. Under some conditions epithelial cells, endothelial cells and other non-myeloid-derived cells may also act as antigen presenting cells.

Bound: As used herein, the term “binding” refers to covalent bonds or attachments, eg, by chemical coupling of unmethylated CpG-comprising oligonucleotides and virus-positive particles, or, for example, between ions. Mentions non-covalent attachment of interactions, hydrophobic interactions, hydrogen bonds and the like. The covalent bonds can be, for example, esters, ethers, phosphoesters, amides, peptides, imides, carbon-sulfur bonds, carbon-phosphorus bonds and the like. The term also includes enclosing or partial enclosing of a material. The term "bonded" is, for example, broader than the terms "coupling," "fused" and "attached". In addition, the term "binding" in the context of an immunostimulatory material that binds to a virus-positive particle also includes the enclosing, or partial enclosing, of the immunostimulating material. Thus, the term "binding" in the context of immunostimulatory materials bound to virus-positive particles is broader and includes "coupling," "fusion", "enclosure", "packing" and "adhesion". For example, non-methylated CpG-comprising oligonucleotides, such as immunostimulatory substances, are surrounded by VLPs without actual binding, covalent or non-covalent bonds so that the oligonucleotides can be properly maintained by simple “packing”.

Coupling: As used herein, the term "coupling" refers to binding by covalent or strong non-covalent bond interactions, typically and preferably by covalent bonds. Methods commonly used to couple biologically active materials by those skilled in the art can be used in the present methods.

Fusion: As used herein, the term “fusion” refers to the combination of amino acid sequences of different origin in one polypeptide by in-frame combination of coding nucleotide sequences. The term "fusion" clearly includes internal fusion, ie insertion of sequences of different origin in the polypeptide chain, in addition to fusion to one end.

CpG: As used herein, the term "CpG" refers to at least one unmethylated cytosine, guanine dinucleotide sequence (e.g., "CpG-oligonucleotide" or DNA that comprises a guerosine which is linked to a cytosine by DNA phosphate bonds) And oligonucleotides that stimulate / activate, such as having, or inducing or increasing, a cleavage action on the expression of cytokines by bone marrow-derived cells of vertebrates. For example, CpGs can be useful for activating B cells, NK cells and antigen presenting cells such as dendritic cells, monocytes and macrophages. CpGs can include nucleotide analogues, such as analogs containing phosphorothioester bonds, and can be double-stranded or single-stranded. Usually, double-stranded molecules are more stable in vivo, while single-stranded have increased immune activity.

Coat Protein (s): As used herein, the term “coat protein (s)” refers to proteins of bacteriophage or RNA-phage that can be incorporated into the capsid assembly of bacteriophages or RNA-phage. However, the term "CP" is used when referring to a specific gene product in the coat protein gene of RNA-phage. For example, certain gene products in the coat protein gene of RNA-phage Qβ are referred to as "Qβ CP", and the "coat protein" of bacteriophage Qβ includes "Qβ CP" and A1 protein. The capsid of bacteriophage Qβ consists mainly of Qβ CP and a few A1 proteins. Similarly, the VLP Qβ coat protein mainly comprises Qβ CP and a few A1 proteins.

Epitopes: As used herein, the term “epitope” refers to a continuous or discontinuous site of a polypeptide having antigen or immunogenic activity in an animal, preferably a mammal, and most preferably a human. Epitopes are recognized by T cells or antibodies via T cell receptors in connection with MHC molecules. As used herein, “immunogenic epitope” is defined as a polypeptide site that induces a T-cell response or an antibody response in an animal, as determined by methods known in the art (see, eg, Geysen et. al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1983)). As used herein, the term “antigen epitope” is defined as a protein site to which an antibody, as determined by methods known in the art, can immunospecifically bind its antigen. Immunospecific binding excludes nonspecific binding but does not necessarily exclude cross-reaction with other antigens. Antigen epitopes need not necessarily be immunogenic. Antigen epitopes may also be T-cell epitopes where they can be immunospecifically bound by T-cell receptors in connection with MHC molecules.

Epitopes may comprise three amino acids in the spatial structure specific to the epitope. Epitopes generally consist of at least about 5 said amino acids, and more typically at least about 8-10 said amino acids. If the epitope is an organic molecule it may be as small as nitrophenyl.

Immune Response: As used herein, the term “immune response” refers to any action by the immune system of an individual directed against a molecule or compound, such as an antigen. In mammals immune responses include the activity of cells and the production of soluble molecules such as cytokines and antibodies. Thus, the term includes humoral and / or cellular immune responses that result in the activation and / or proliferation of B- and / or T-lymphocytes. However, in some cases, the intensity of the immune response is low, and the immune response can only be detected when using at least one substance according to the present invention. An "immunogen" refers to a factor used to stimulate the immune system of a living organism to increase one or more immune system functions and direct it to an immunogenic agent. An “immunogenic polypeptide” is a polypeptide that, alone or in combination with a carrier, induces a cellular and / or humoral immune response regardless of the presence of an adjuvant. Preferably, the antigen presenting cell can be activated.

Immunization: As used herein, the term “immunize” or “immunize” or related term provides the ability to elicit a substantial immune response (including cellular immunity such as antibody and / or effector CTL) to a target antigen or epitope. To mention that. The term does not have to be complete immunity, but the immune response formed should be substantially superior to baseline. For example, if a cellular and / or humoral immune response to a target antigen occurs after applying the methods of the present invention, it may be considered that the mammal has been immunized against the target antigen.

Immunostimulatory Nucleic Acid: As used herein, the term immunostimulatory nucleic acid refers to a nucleic acid capable of inducing and / or enhancing an immune response. As used herein, immunostimulatory nucleic acids include ribonucleic acid and especially deoxyribonucleic acid. Preferably, the immunostimulatory nucleic acid comprises at least one CpG motif, eg, a CG dinucleotide in which C is unmethylated. CG dinucleotides may be a couple of backward and backward homologous sequences and may be included in non-backward and reverse homologous sequences. Immunostimulatory nucleic acids that do not include a CpG motif as described above include via a nucleic acid that lacks a CpG dinucleotide, and a nucleic acid that includes a CG motif having a methylated CG dinucleotide. The term "immunostimulatory nucleic acid" as used herein should also refer to a nucleic acid comprising a modified base such as 4-bromo-cytosine.

Immunostimulatory Substances: As used herein, the term “immunostimulatory substance” refers to a substance capable of inducing and / or enhancing a substance immune response. As used herein, immunostimulatory materials include, but are not limited to, toll-like receptor activating materials and materials that induce cytokine secretion. Toll-positive receptor activating substances include, but are not limited to, immunostimulatory nucleic acids, peptidoglycans, lipopolysaccharides, lipotenic acid, imidazoquinoline compounds, flagellines, lipoproteins, and immunostimulatory organic substances such as Taxol. Include.

Mix: As used herein, the term “mix” refers to a combination of two or more substances, components or elements that are added together and are not chemically combined with each other and can be separated.

Oligonucleotide: As used herein, the term "oligonucleotide" or "oligomer" refers to two or more nucleotides, generally at least about 6 nucleotides to about 100, 000 nucleotides, preferably about 6 to about 2000 nucleotides. , And more preferably about 6 to about 300 nucleotides, even more preferably about 20 to about 300 nucleotides, and even more preferably about 20 to about 100 nucleotides. The term "oligonucleotide" or "oligomer" also refers to a nucleic acid sequence comprising at least 100 to about 2000 nucleotides, preferably at least 100 to about 1000 nucleotides, even more preferably at least 100 to about 500 nucleotides. . "Oligonucleotide" also generally refers to polyribonucleotides or polydeoxyribonucleotides and may be unmodified RNA or DNA or modified RNA or DNA. Modifications may include backbone or nucleotide analogs. "Oligonucleotide" includes, but is not limited to, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded sites, single- and double-stranded RNA, and RNA, single, which is a mixture of single- and double-stranded sites Hydride molecules comprising DNA and RNA which may be strands or, more typically, double-stranded or mixtures of single- and double-stranded sites. In addition, "oligonucleotide" refers to triple-stranded sites comprising RNA or DNA or both RNA and DNA. The oligonucleotides can also be synthetic, gene or recombinant, λ-DNA, cosmid DNA, artificial bacterial chromosomes, yeast artificial chromosomes and linear phages as M13.

The term "oligonucleotide" also includes DNAs or RNAs comprising one or more modified bases and DNAs or RNAs having a backbone modified for stability or for other reasons. For example, suitable nucleotide modifications / analogs include peptide nucleic acids, inosine, tritylated bases, phosphorothioates, alkylphosphothioates, 5-nitroindoledeoxyribofuranosyl, 5-methyldeoxycytosine and 5, 6-dihydro-5, 6-dihydroxydeoxythymidine. Various modifications are made to DNA and RNA; Thus, "oligonucleotide" includes chemically, enzymatically or metabolically modified forms of polynucleotides as commonly found in nature, and chemical forms of DNA and RNA properties of viruses and cells. Other nucleotide analogues / modifications will be apparent to those skilled in the art.

Packaged: As used herein, the term "packing" refers to the state of an immunostimulatory substance, in particular an immunostimulatory nucleic acid, with respect to a VLP. As used herein, the term "packing" includes bonds that may be covalent or non-covalent, such as by ionic interactions, hydrophobic interactions, hydrogen bonding, or the like by chemical coupling. Covalent bonds can be, for example, esters, ethers, phosphoesters, amides, peptides, imides, carbon-sulfur bonds, carbon-phosphorus bonds, and the like. The term "packing" includes, by way of example, the terms "coupling" and "attached", and in particular, and preferably "packing" also includes enclosing, or partially enclosing the material. For example, immunostimulatory materials such as unmethylated CpG-containing oligonucleotides may be surrounded by VLPs without actual binding, covalent or non-covalent binding. Thus, in a preferred sense, the term "packing" refers to the fact that the nucleic acid in a packed state is difficult to hydrolyze by DNAse or RNAse, especially when the immunostimulatory nucleic acid is an immunostimulatory material. In a preferred aspect, the immunostimulatory nucleic acid is most preferably packed into the VLP capsid in a noncovalent manner.

PCR Product: As used herein, the term “PCR product” refers to an amplified copy of a target DNA sequence that can serve as a starting material for PCR. The target sequence can include, for example, double-stranded DNA. The source of DNA for PCR may be complementary DNA, which is also referred to as "cDNA" and may be the product of conversion of mRNA using reverse transcriptase. DNA for PCR may be total genetic DNA extracted from the cell. Cell sources from which DNA can be extracted for PCR include, but are not limited to, blood samples; Human, animal, or plant tissues; Fungi; And bacteria. DNA starting materials for PCR may be unpurified, partially purified or highly purified. The source of the DNA for PCR can be derived from cloned inserts in vectors including, but not limited to, plasmid vectors and bacteriophage vectors. The term "PCR product" is compatible with the term "polymerase chain reaction product".

The composition of the present invention may be optionally combined with a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" means one or more suitable solid or liquid fillers, diluents or encapsulating materials suitable for administration to a human or other animal. The term "carrier" refers to a natural or synthetic organic or inorganic component that is combined with the active ingredient to facilitate application.

Polypeptide: As used herein, the term “polypeptide” refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (or known as peptide bonds). It indicates an amino acid molecular chain and does not refer to a specific length of product. Thus, peptides, dipeptides, tripeptides, oligopeptides and proteins are included in the polypeptide definition. The term also refers to modifications after expression of the polypeptide, such as glycosylation, acetylation, phosphorylation, and the like. Essentially, the recombinant or derived polypeptide is not translated from the designated nucleic acid sequence. It can be formed in any manner, including chemical synthesis.

A substance that "enhances" an immune response refers to a substance that is observed to be larger, amplified, or deviate in some way by adding the substance as compared to the same immune response measured without adding the substance. For example, the lytic activity of cytotoxic T cells can be measured using, for example, a ⁵¹ Cr release assay with and without substance. The amount of substance whose CTL lytic activity is enhanced compared to CTL lytic activity without a substance is referred to as an amount sufficient to enhance the animal's immune response to the antigen. In a preferred aspect, the immune response is enhanced by at least about 2 factors, more preferably about 3 or more factors. The amount or type of cytokine secreted can vary. Alternatively, the amount of antibody derived or subclass thereof may vary.

Effective amount: As used herein, the term “effective amount” refers to an amount necessary or sufficient to achieve the desired biological efficacy. The effective amount of the composition will be the amount that results in this selected result, which can be generally determined by one skilled in the art. For example, an effective amount for the treatment of immunodeficiency may be an amount necessary to activate the immune system to generate an antigen specific immune response when exposed to the antigen. This term has a similar meaning to "sufficient amount".

The effective amount for a particular application may vary depending on factors such as the disease or condition to be treated, the particular composition being administered, the size of the subject, and / or the severity of the disease or condition. One skilled in the art can experimentally measure the effective amount of a particular composition of the present invention without requiring inappropriate experimentation.

Treatment: As used herein, the terms “treatment”, “treat”, “treated” or “treating” refer to prophylaxis and / or treatment. When used in connection with an infectious disease, for example, the term increases the subject's resistance to a pathogen infection or, in other words, reduces the likelihood that the subject will be infected by the pathogen or show signs of illness by the infection. Prophylactic therapies and therapies for combating infection after a subject has been infected, for example, reducing, eliminating or preventing the infection from becoming worse.

Vaccine: As used herein, the term "vaccine" refers to an agent in a form that can be administered to an animal comprising the composition of the present invention. Typically, vaccines comprise conventional saline or buffered aqueous solutions in which the compositions of the present invention are suspended or dissolved. The compositions of the present invention are typically used to prevent, ameliorate, or otherwise treat abnormalities. When introduced into a host, the vaccine may cause an immune response including but not limited to the production of antibodies and / or cytokines, activation of cytotoxic T cells, antigen presenting cells, helper T cells, dendritic cells and / or other cellular responses. Can be.

Optionally, the vaccine of the present invention comprises an adjuvant which may be present in minimum or maximum proportional to the compound of the present invention. As used herein, the term "adjuvant" refers to a substance that allows in-host depot production to provide an enhanced immune response when combined with a nonspecific stimulant of an immune response or a vaccine of the invention. Various adjuvants can be used. For example Freund's complete and incomplete adjuvant, aluminum hydroxide and modified muramyldepeptides.

Viral Sheep Particles (VLPs): As used herein, the term "viral sheep particles" refers to a structure similar to viral particles. In addition, the virus-like particles according to the invention are non-replicating and non-infectious because they lack the replicable and infectious components of the whole or part of the viral genome, especially the viral genome. Viral sheep particles according to the invention may comprise nucleic acids that differ from their genome. Typical and preferred virus-like particles according to the invention are viral capsids, such as viral capsids of viruses, bacteriophages, or RNA-phage. As used interchangeably herein, the term "virus capsid" or "capsid" refers to a polymer assembly consisting of viral protein subunits. Typically and preferably, viral protein subunits are assembled into viral capsids and capsids, each with its own repetitive structure (where the structure is typically spherical or tubular). For example, the capsid of RNA-phage or HBcAg has a symmetric icosahedral sphere. As used herein, the term "capsidic structure" refers to a polymer assembly consisting of viral protein subunits that resemble a capsid form in a defined sense, while maintaining sufficient ordering and repeatability, but deviated from typical symmetrical assemblies. To mention.

VLPs of RNA Phage Coat Proteins: Capsid structures that comprise host RNA and are formed from the self-assembly of 180 subunits of RNA phage coat proteins are referred to as "VLPs of RNA phage coat proteins". One particular example is the VLP of the Qβ coat protein. In particular, the VLP of the Qβ coat protein is formed by reference only through assembly of the Qβ CP subunit (SEQ ID NO: 1) or through expression of Qβ CP comprising a TAA termination codon that inhibits expression of any long chain A1 protein. Kozlovska, TM, et al., Intervirology 39: 9-15 (1996)), may further include an A1 protein subunit (SEQ ID NO: 2) in the capsid assembly. The leadthrough process is low in efficiency and leads to very low levels of A1 protein in VLPs. Multiple examples were performed using different combinations of packed ISS and coupled antigens. No differences in coupling efficiency and packing were observed when using VLPs of the Qβ coat protein assembled only from the Qβ CP subunit or VLPs of the Qβ coat protein comprising the A1 protein subunit in addition. In addition, no immune response was observed between these Qβ VLP formulations. Thus, for the sake of clarity the term "Qβ VLP" is for example illustrative of VLPs of Qβ coat protein assembled only from the Qβ CP subunit or of VLPs of Qβ coat protein further comprising an A1 protein subunit in the capsid. Used in the description.

As used herein, the term "viral particle" refers to the morphological form of the virus. In some virus types it comprises a genome surrounded by a protein capsid; Others have additional structures (eg envelopes, tails, etc.).

Non-enveloped virus particles consist of protein capsids that surround and protect the viral genome. The envelope virus also has a capsid structure surrounding the genetic material of the virus, and further has a lipid bilayer envelope surrounding the capsid.

In a preferred aspect of the invention, VLP's lack a lipoprotein envelope or a lipoprotein-containing envelope. In a further preferred aspect, the VLP's lack both envelopes.

One, one, or one: When one, one, or one is used herein, it is "at least one" unless stated otherwise. Or "one or more".

As will be appreciated by those skilled in the art, certain aspects of the present invention include the use of recombinant nucleic acid techniques such as cloning, polymerase chain reaction, DNA and RNA purification, expression of recombinant proteins in prokaryotic and eukaryotic cells, and the like. The methodology can usually be found in published experimental method menuwalls well known to those skilled in the art (e.g. Sambrook, J. et al., Eds., Molecular cloning, A Laboratory Manual, 2nd. Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989); Ausubel, F. et al., Eds., Current Protocols in Molecular Biology, John H. Wiley & Sons, Inc. (1997). Basic experimental techniques for experiments using tissue culture cell lines (Celis, J., ed., Cell Biology, Academic Press, 2 "d edition, (1998)) and antibody-based techniques (Harlow, E. and Lane, D) Antibody: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1988); Deutscher, MP, "Guide to Protein Purification," Meth.Enzymol. 128, Academic Press San Diego (1990); Scopes, RK. , Protein Purification Principles and Practice, 3rd ed., Springer-Verlag, New York (1994)), also appropriately described in the above documents, all of which are incorporated herein by reference in their entirety.

2. Composition and method for enhancing immune response

The methods described provide compositions and enhancement methods for enhancing an immune response to one or more antigens in an animal. The compositions of the present invention comprise virus-positive particles and immunostimulatory substances, preferably immunostimulatory nucleic acids, even more preferably unmethylated CpG-containing oligonucleotides, wherein the oligonucleotides bind to the virus-positive particles and the resulting modified virus- Both particles comprise or otherwise consist of an antigen, several antigens or an antigen mixture). In addition, the practitioner facilitates the prevention and / or treatment of infectious diseases and chronic infectious diseases, the prevention and / or treatment of cancer, and the prevention and / or treatment of allergic or allergic related diseases such as asthma through the present invention. Including, one can make compositions for various therapeutic and / or prophylactic purposes.

In the context of the present application, viral-like particles refer to structures similar to viral particles, except that they are not pathogenic. Viral particles are generally non-infectious because they lack the viral genome. In addition, virus-like particles can be produced in large quantities by heterogeneous expression and can be easily purified.

In a preferred embodiment, the viral sheep particles are recombinant viral sheep particles. One skilled in the art can produce VLPs using viral coding sequences and recombinant DNA techniques that are readily available to the public. For example, baculovirus expression under the regulatory control of viral promoters, using baculovirus (vector), which is commercially available through appropriate modification of the sequence to functionally linkage coding sequences to regulatory sequences. It can be engineered to express coding sequences of viral envelopes or core proteins in a vector.

Examples of VLPs include, but are not limited to, hepatitis B virus (Ul-rich, et al., Virus Res. 50: 141-182 (1998)), measles virus (Warnes, et al., Gene 160: 173-178 ( 1995)), Sindbis virus, rotavirus (US 5, 071, 651 and US 5, 374, 426), dystrophy virus (twomey, et al., Yaccine 13: 1603-1610, (1995)), Norwalk Capsid protein of the virus (Jiang, X., et al., Science 250: 1580-1583 (1990); Matsui, SM, et al., J. Clin. Invest. 87: 1456-1461 (1991)), retrovirus GAG protein (WO 96/30523), retrotransposon Ty protein pl, hepatitis B virus (WO 92/11291), human papilloma virus (WO 98/15631), RNA phage, Ty, fr-phage, GA-phage and Qβ-phage surface proteins.

As will be readily appreciated by those skilled in the art, the VLP of the present invention is not limited to any particular form. Particles can be synthesized through chemical or biological processes, which can be naturally occurring or non-naturally occurring. By way of example, one example of this type includes viral sheep particles or recombinant forms thereof.

In a more specific example, the VLP is a recombinant polypeptide of rotavirus, a recombinant polypeptide of Norwalk virus, a recombinant polypeptide of alphavirus, a recombinant polypeptide of old disease virus, a recombinant polypeptide of measles virus, a recombinant polypeptide of Sindbis virus, a polyoma virus. Recombinant polypeptide, recombinant polypeptide of retrovirus, recombinant polypeptide of hepatitis B virus (e.g., HBcAg), recombinant polypeptide of tobacco mosaic virus, recombinant polypeptide of Block House virus, recombinant polypeptide of human papilloma virus, bacteriophage A recombinant selected from recombinant polypeptides, RNA phage recombination polypeptides, Ty recombination polypeptides, fr-phage recombination polypeptides, GA-phage recombination polypeptides and Qβ-phage recombination polypeptides Polypeptides, or comprises, or alternatively a fragment thereof may be essentially composed of, or otherwise configured. The virus-like particle may further comprise, otherwise consist essentially of, or alternatively consist of one or more of said polypeptides, and a recombinant polypeptide selected from said polypeptide variants, or fragments thereof. Polypeptide variants may, for example, share at least 80%, 85%, 90%, 95%, 97%, or 99% identity at the amino acid level with their wild type counterparts.

In a preferred embodiment, the virus-like particle comprises, consists essentially of, or alternatively consists of a recombinant polypeptide of RNA-phage or a fragment thereof. Preferably, the RNA-phage is a) bacteriophage Qβ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage M11; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; l) bacteriophage PP7; m) is selected from the group consisting of bacteriophage AP25.

In another preferred embodiment of the invention, the virus-like particle comprises, alternatively consists essentially of, or alternatively consists of RNA-bacterial phage Qβ, or RNA-bacterial phage fr, recombinant polypeptide of RNA-bacterial phage AP205, or a fragment thereof. .

In a further preferred aspect of the invention, the recombinant protein comprises, alternatively consists essentially of, or alternatively consists of a coat protein of RNA phage.

RNA-phage coat proteins that form capsids or VLPs, or fragments of bacteriophage coat proteins suitable for self-assembly into capsids or VLPs, are a preferred aspect of the present invention. For example, the bacteriophage Qβ coat protein can be recombinantly expressed in E. coli. In addition, upon expression this protein spontaneously forms capsids. The capsid also forms a structure of unique iterative system.

Specific examples of bacteriophage coat proteins that can be used to prepare the compositions of the present invention include the bacteriophage Qβ (SEQ ID NO: 1; PIR database, Accession No. VCBPQR, Qβ CP and SEQ ID NO: 2; Accession No. AAA16663, Qβ A1 protein). Bacteriophage R17 (SEQ ID NO: 3: PIR Accession No. VCBPR7), Bacteriophage fr (SEQ ID NO: 4: PIR Accession No. VCBPFR), Bacteriophage GA (SEQ ID NO: 5: GenBank Accession No. NP-040754), Bacteriophage SP (SEQ ID NO: 6: GenBank Accession No. CAA30374, referred to as SP CP and SEQ ID NO: 7: Accession No., referred to as SP A1 protein), Bacteriophage MS2 (SEQ ID NO: 8: PIR Accession No. VCBPM2), Bacteriophage M11 ( SEQ ID NO: 9: GenBank Accession No. AAC06250), Bacteriophage MX1 (SEQ ID NO: 10: GenBank Accession No. AAC14699), Bacteriophage NL95 (SEQ ID NO: 11: GenBank Accession No. AAC14704), Bacteriophage f2 (SEQ ID NO: 12: GenBank Accession No. P0361 1), coat proteins of RNA bacteriophages such as bacteriophage PP7 (SEQ ID NO: 13), RNA-bacteriophage AP205 (SEQ ID NO: 90). In addition, a C-terminal truncation missing about 100, about 150, or about 180 amino acids from the A1 protein of bacteriophage Qβ or its C-terminus may be incorporated into the capsid assembly of the Qβ code protein. In general, the percentage of A1 protein relative to Qβ CP in the capsid assembly will be limited to stabilize capsid formation.

Qβ coat proteins have also been found to self-assemble into capsids when expressed in E. coli (Kozlovska TM. Et al., Gene 137: 133-137 (1993)). The obtained capsid or virus-like particle exhibited a icosahedron-type capsid structure having a diameter of 25 nm and a subsymmetric T = 3. In addition, the crystalline structure of phage Qβ was analyzed. Capsids comprise 180 copies of coat protein bound to covalent pentamers and hexamers by disulfide bridges that provide notable stability to the capsid of Qβ coat proteins (Golmohammadi, R. et al., Structural 4: 543-). 5554 (1996). However, VLPs or capsids prepared from recombinant Qβ coat proteins may include subunits that are not bound by disulfite bonds with other subunits in the capsid, or incompletely bound subunits. Thus, when loading recombinant Qβ capsids on reducing SDS-PAGE, a band corresponding to the monomeric Qβ coat protein and a band corresponding to the hexamer or pentamer of the Qβ coat protein can be seen. It may appear as an incompletely disulfide bonded subunit dimer, trimer, or tetramer band in non-reducing SDS-PAGE. Qβ capsid proteins also exhibit specific resistance to organic solvents and denaturing agents. Surprisingly, the inventors have found that concentrations of DMSO and acetonitrile as high as 30%, and guanidinium as high as 1M do not affect the stability of the capsid. The high stability of the capsid of the Qβ coat protein is particularly advantageous for use in the immunization and vaccination of mammals according to the invention.

When expressed in E. coli , Stoll, E. et al. J. Biol. Chem. 252: 990-993 (1977), as observed by the inventors by N-terminal Edman sequencing, the N-terminal methionine of the Qβ coat protein is usually removed. Both VLPs constructed from Qβ coat proteins without N-terminal methionine removed, or VLPs comprising a mixture of Qβ coat proteins with or without N-terminal methionine are included within the scope of the present invention.

Further preferred virus-positive particles of RNA-phage, in particular Qβ according to the invention are described in WO 02/056905, which is hereby incorporated by reference in its entirety.

Additional RNA phage coat proteins have also been shown to self-assemble when expressed in bacterial hosts (Kastelein, RA. Et al., Gene 23: 245-254 (1983), Kozlovskaya, TM. Et al., Dokl. Akad. Nauk SSSR 287: 452-455 (1986), Adhin, MR. Et al., Virology 170: 238-242 (1989), Ni, CZ., Et al., Protein Sci. 5: 2485-2493 (1996), Priano, C. et al., J. Mol. Biol. 249: 283-297 (1995)). In addition to coat proteins, Qβ phage capsids include so-called read-through protein A1 and mutant protein A2. A1 is formed by inhibition at the UGA stop codon and is 329 aa in length. The capsid of the phage Qβ recombinant coat protein used in the present invention lacks the A2 lysis protein and includes RNA from the host. The coat protein of the RNA phage is an RNA binding protein and interacts with the stem loop of the ribosomal binding site of the replicase gene, which acts from the translational inhibitor during the virus's life cycle. Structural elements and sequences of interactions are known (Witherell, GW. & Uhlenbeck, OC. Biochemistry 28: 71-76 (1989); Lim F. et al., J. Biol. Chem. 271: 31839-31845 ( 1996). It is generally known that stem loops and RNA are involved in viral assembly (Golmohammadi, R. et al., Structure 4: 543-5554 (1996).

In a further preferred aspect of the invention, the virus-like particle comprises a mutant coat protein of RNA phage, preferably a mutant coat protein of RNA phage mentioned above, alternatively consists essentially of, or alternatively consists of RNA-phage It comprises, otherwise consists essentially of, or alternatively consists of a recombinant protein or fragment thereof. In another preferred aspect, the mutant coat protein of an RNA phage has been modified by removal of at least one lysine residue by substitution or addition of at least one lysine residue by substitution; Alternatively the mutant coat protein of RNA phage is modified by the deletion of at least one lysine residue, or by addition of at least one lysine residue by insertion.

In another preferred embodiment, the virus-like particle is a coat protein having the amino acid sequence of SEQ ID NO: 1, or the amino acid of the mutant of SEQ ID NO: 11 wherein the SEQ ID NO: 1 and SEQ ID NO: 2 or preferably the N-terminal methionine is cleaved A recombinant protein of RNA-bacteriophage Qβ comprising, alternatively essentially composed or otherwise composed of, or otherwise essentially consisting of, or alternatively consisting of a coat protein mixture having a sequence.

In a further preferred aspect, the present invention provides that the virus-like particle comprises, alternatively consists essentially of, or alternatively consists essentially of, or alternatively consists of, a recombinant protein of Qβ that is mutant Qβ coat protein. do. In another preferred aspect, these mutant coat proteins are modified by removal of at least one lysine residue by substitution or addition of at least one lysine residue by substitution; Alternatively the mutant coat protein of RNA phage is modified by the deletion of at least one lysine residue, or by addition of at least one lysine residue by insertion.

Four lysine residues are exposed on the Qβ coat protein capsid surface. Qβ mutants in which exposed lysine residues have been replaced by arginine can be used in the present invention. Thus, the following Qβ coat protein mutants and mutant Qβ VLPs can be used in the practice of the present invention: “Qβ-240” (Lys13-Arg; SEQ ID NO: 14), “Qβ-243” (Asn 10-Lys; SEQ ID NO: : 15), "Qβ-250" (Lys 2-Arg, Lysl3-Arg; SEQ ID NO: 16), "Qβ- 251" (SEQ ID NO: 17) and "Qβ-259" (Lys 2-Arg, Lysl6- Arg; SEQ ID NO: 18). Thus, in a further aspect of the invention, the viral sheep particles comprise a) the amino acid sequence of SEQ ID NO: 14; b) the amino acid sequence of SEQ ID NO: 15; c) the amino acid sequence of SEQ ID 16; d) the amino acid sequence of SEQ ID 17; And e) a recombinant protein of a mutant Qβ coat protein comprising a protein having an amino acid sequence selected from the amino acid sequence of SEQ ID NO: 18, alternatively consisting essentially, or alternatively. The construction, expression and purification of each of the aforementioned Qβ coat proteins, mutant Qβ coat protein VLPs and capsids are described in WO 02/56905 (incorporated herein by reference). In particular, reference is made to example 18 of the aforementioned application.

In a further preferred aspect of the invention, the virus-like particle comprises a recombinant protein of Qβ or a fragment thereof comprising, alternatively essentially consisting of, or alternatively consisting of, a mixture of one of said Qβ mutants and corresponding A1 proteins, Otherwise it is essentially constructed or otherwise constructed.

In a further preferred aspect of the invention, the viral sheep particles comprise, otherwise consist essentially of, or alternatively consist of recombinant proteins of RNA-phage AP205, or fragments thereof.

The AP205 genome consists of two open reading frames that do not exist in mutant proteins, coat proteins, replicates and associated phages: open reading frames and degradation genes that play an important role in the translation of mutant genes (Klovins, J., et. al., J Gen. ViroL 83: 1523-33 (2002)). AP205 coat protein is a derivative of pQb10 (Kozlovska, TM. Et al., Gene 137: 133-37 (1993)) and can be expressed from plasmid pAP283-58 (SEQ ID NO: 91) comprising the AP205 ribosomal binding site. . Alternatively, the AP205 coat protein can be cloned into pQb185 downstream of the ribosomal binding site present in the vector. Both methods express the protein and form a capsid. Vectors pQb10 and pQb185 are vectors derived from pGEM vectors and the expression of the cloned genes in these vectors is regulated by the trp promoter (Kozlovska, TM et al., Gene 137: 133-37 (1993)). Plasmid pAP283-58 (SEQ ID NO: 91) contains the putative AP205 ribosomal binding site downstream of the XbaI position in the following sequence and immediately upstream of the ATG initiation codon of the AP205 coat protein: tctagaATTTTCTGCGCACCCAT CCCGGGTGGCGCCCAAAGT GAGGAA AATCACATg (SEQ ID NO: 91) Base 77-133). Vector pQb185 contains the Shine Delagarno sequence downstream from the XbaI position and upstream of the initiation codon (tctagaTTAACCCAACGCGT AGGAG TCAGGCCATg (SEQ ID NO: 92), Shine Delagarno sequence underlined).

In a further preferred aspect of the invention, the virus-like particle comprises, otherwise consists essentially of, or alternatively consists of a recombinant coat protein of RNA-phage AP205, or a fragment thereof.

Thus, one preferred aspect of the invention includes an AP205 coat protein that forms a capsid. The protein is prepared from recombinantly expressed or naturally occurring sources. The AP205 coat protein produced in bacteria spontaneously forms a capsid as demonstrated by electron microscopy (EM) and immunodiffusion. The structural properties of the capsid formed by the AP205 coat protein (SEQ ID NO: 90) and that of the capsid formed by the coat protein of the AP205 RNA phage are almost indistinguishable when observed by EM. AP205 VLPs can form vaccine constructs that display highly immunogenic, antigenic and / or antigenic determinants and display antigenic and / or antigenic determinants directed in a repetitive fashion. The bound antigen and / or antigenic determinant induces high titers against the displayed antigen, indicating that it is easy to interact with the antibody molecule and is immunogenic.

In a further preferred embodiment of the invention, the virus-like particle comprises, otherwise consists essentially of, or alternatively consists of a recombinant mutant coat protein of RNA-phage AP205, or a fragment thereof.

AP205 VLPs in a mutant capable of assembling, including an AP205 coat protein (SEQ ID NO: 93) in which proline 5, an amino acid, is substituted with threonine, may also be used in the practice of the present invention, and further preferred examples of the present invention. to be. These VLPs, AP205 VLPs, or AP205 virus particles derived from naturally occurring sources can be combined with antigens to form an ordered repeating array of antigens of the invention.

The AP205 P5-T mutant coat protein can be expressed directly from plasmid pAP281-32 (SEQ ID NO: 94) derived directly from pQb185 and comprising the mutated AP205 coat protein gene instead of the Qβ coat protein gene. A vector for expressing the AP205 coat protein is transfected into E. coli to express the AP205 coat protein.

Methods for expressing coat proteins and mutant coat proteins that self-assemble into VLPs, respectively, are described in Examples 16 and 17. Suitable E. coli strains include, but are not limited to, E. coli K802, JM 109, RR1. Appropriate vectors and strains and combinations thereof are identified by testing the expression of coat proteins and mutant coat proteins, respectively, by SDS-PAGE, and capsid formation and assembly is optionally followed by continuous immunodiffusion analysis (Ouchterlony) after purifying the capsid by gel filtration. test) or by electron microscopy (Kozlovska, TM. et al., Gene 137: 133-37 (1993)).

AP205 coat proteins expressed from vectors pAP283-58 and pAP281-32 may be deficient in early methionine amino acids because they are processed in the cytoplasm of E. coli. AP205 VLPs, or mixtures thereof, in cleaved, uncleaved form are further preferred examples of the present invention.

In a further preferred embodiment of the invention, the virus-like particle comprises or alternatively comprises a mixture of recombinant coat protein of RNA-phage AP205, or a recombinant mutant coat protein of RNA-phage AP205, or a mixture thereof. It consists essentially of the above, or alternatively so.

In a further preferred embodiment of the invention, the virus-like particle comprises, alternatively consists essentially of, or alternatively consists of the recombinant coat protein or recombinant mutant coat protein of RNA-phage AP205.

Recombinant AP205 coat protein fragments that can be assembled into VLPs and capsids, respectively, can also be used in the practice of the present invention. This fragment can be formed by deletion within or at the ends of the coat protein and the mutant coat protein. Insertion into the coat protein and mutant coat protein sequences suitable for assembly into the VLP or fusion of the antigen and coat protein and mutant coat protein sequences is encompassed by the present invention, which results in chimeric AP205 coat proteins, and particles, respectively. Results of fusion to the insertion, deletion and coat protein sequences and assembly suitability into the VLP can be determined by electron microscopy.

AP205 coat protein described above, as described in the current pending US animal garden, filed on July 16, 2002 under the name “molecular antigen array” by the current assignee, Particles formed by coat protein fragments and chimeric coat proteins are subjected to sorting by precipitation and gel filtration using, for example, Sepharose CL-4B, Sepharose CL-2B, Sepharose CL-6B columns and combinations thereof. Purification step can be used in combination to separate in pure form. Other methods of separating viral sheep particles are known and can be used to isolate viral sheep particles (VLPs) of bacteriophage AP205. For example, the use of ultracentrifugation to isolate the VLP of yeast retrotransposon Ty is described in U. S. Patent No. 4, 918, 166, which is incorporated herein by reference.

Crystalline structures of various RNA bacteriophages were measured (Golmohammadi, R. et al., Structure 4: 543-554 (1996)). The information can be used to identify surface exposed residues and to modify the RNA-phage coat protein such that one or more reactive amino acid residues can be inserted by insertion or substitution. Thus, modified forms of bacteriophage coat proteins can be used in the present invention. Thus, variants of the protein forming the capsid or capsid-yang structure (e.g., bacteriophage Qβ, bacteriophage R17, bacteriophage fr, bacteriophage GA, coat protein of bacteriophage SP, bacteriophage MS2 and bacteriophage AP205) are also used to prepare vaccine compositions of the present invention. Can be.

The sequence of variant proteins discussed above differs from wild-type counterparts, but these variant proteins generally retain the ability to form capsids or capsid-like structures. Accordingly, the present invention further provides compositions and vaccine compositions comprising protein variants that form a capsid or capsid-yang structure, and methods of making the compositions and vaccine compositions, and individual protein subunits used to prepare the compositions and vaccine compositions. It includes. Accordingly, variant forms of wild-type proteins (eg, protein variants that form capsid or capsid-yang structures) that form an ordered, repeating array and possess the ability to bind and form capsid or capsid-yang structures are also within the scope of the present invention. Included.

As a result, the present invention further comprises at least 80%, 85%, 90%, 95%, 97%, or 99% amino acids corresponding to wild-type proteins, each forming an ordered array and forming a unique repeating structure, or Each composition and vaccine composition comprising a protein that is otherwise essentially composed or otherwise constructed. In many cases, these proteins will be processed to remove signal peptides (eg, heterologous signal peptides).

Further included within the scope of the invention are nucleic acid molecules encoding proteins used to prepare the compositions of the invention.

In another aspect, the invention further comprises, or alternatively comprises, an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97%, or 99% identical to any of the amino acid sequences set forth in SEQ ID NOs: 1-11 Comprises essentially a composition comprising or alternatively composed protein.

Proteins suitable for use in the present invention also include C-terminal truncation mutants of proteins forming capsid or capsid-yang structures, or VLPs. Specific examples of cleavage mutants include proteins having an amino acid sequence as set forth in any of SEQ ID NOs: 1-11, wherein amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 are removed from the C-terminus. It includes. Typically, this C-terminal truncation mutant will retain the ability to form a capsid or capsid-like structure.

Proteins suitable for use in the present invention also include N-terminal truncation mutants of proteins that form capsids or capsid-yang structures. Specific examples of cleavage mutants include proteins having an amino acid sequence as set forth in any of SEQ ID NOs: 1-11, wherein amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 have been removed from the N-terminus. It includes. Typically, this N-terminal truncation mutant will retain the ability to form a capsid or capsid-like structure.

Additional proteins suitable for use in the present invention also include N- and C-terminal truncation mutants of proteins that form capsids or capsid-like structures. As a specific example of a cleavage mutant, amino acids 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 are removed from the N-terminus and 1, 2, 5, 7, 9, 10, 12, 14 And a protein having an amino acid sequence as set forth in any of SEQ ID NOs: 1-11 wherein amino acid 15, or 17 is removed from the C-terminus. Typically, these N- and C-terminal truncation mutants will retain the ability to form capsid or capsid-yang structures.

The invention further comprises, alternatively consists essentially of, or alternatively consists of an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97%, or 99% identical to the truncation mutants described above A composition comprising a protein.

Accordingly, the present invention provides compositions and vaccine compositions prepared from proteins forming capsids or VLPs, methods of making these compositions from each protein subunit of VLPs or capsids, each protein subunit, nucleic acid molecules encoding these subunits, Methods for preparing the same, and methods for inducing or vaccinating an immune response in a subject using a composition of the invention.

VLPs fragments possessing the ability to induce an immune response are about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 May comprise or otherwise consist of a polypeptide that is 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450 or 500 amino acids, but includes a VLP Will depend on the sequence length of the subunit. Examples of such fragments include fragments suitable for the preparation of immune response enhancing compositions described herein.

In another preferred aspect of the invention, the VLP's lack a lipoprotein envelope or a lipoprotein-containing envelope. In a further preferred aspect, the VLP's lack all envelopes.

Lack of lipoprotein envelope or lipoprotein-containing envelope and, in particular, complete lack of envelope, leads to more defined virus-positive particles in their structures and compositions. Thus, side effects can be minimized by more defined virus-positive particles. In addition, the lack of a lipoprotein envelope or a lipoprotein-containing envelope and, in particular, the complete lack of the envelope, avoids or minimizes the incorporation of potentially toxic substances and pyrogen in virus-positive particles.

As described above, the present invention includes virus-positive particles or recombinant forms thereof. The skilled person is knowledgeable in preparing the particles and mixing the antigens with them. By providing another example, the present invention herein provides for preparing hepatitis B virus-positive particles, such as virus-positive particles (Example 1).

In one aspect, the particles used in the compositions of the present invention consist of hepatitis B capsid (core) protein (HBcAg), HBcAg fragments. In a further example, the particles used in the compositions of the present invention are modified with hepatitis B capsid (core) protein (HBcAg), HBcAg protein fragments to remove or reduce the number of free cysteine residues. Zhou et al. (J. Virol. 66: 5393-5398 (1992) demonstrated that modified HBcAgs retain the ability to bind and form capsids by removing naturally remaining cysteine residues. Core particles for use include those comprising modified HBcAgs, or fragments thereof, in which one or more cysteine residues that naturally remain or are substituted with another amino acid residue (eg, a serine residue).

HBcAg is a protein formed by processing the hepatitis B core antigen precursor protein. Many HBcAg isotypes have been identified and their amino acid sequences are available to those skilled in the art. For example, the HBcAg protein having the amino acid sequence shown in SEQ ID NO: 71 is 183 amino acids in length and is formed by processing the hepatitis B core antigen precursor protein of 212 amino acids. This processing removes 29 amino acids from the N-terminus of the hepatitis B core antigen precursor protein. Similarly, HBcAg protein, 185 amino acids in length, is formed by processing the 214 amino acid hepatitis B core antigen precursor protein. In most cases, each of the compositions and vaccine compositions of the invention can be prepared using a processed form of HBcAg (ie, HBcAg from which the N-terminal leader sequence of the hepatitis B core antigen precursor protein has been removed).

Preferred hepatitis B virus-like particles that can be used in the present invention are for example WO 00/32227, in particular Examples 17-19 and 21-24, and WO 01/85208, in particular Examples 17-19, 21-24. , 31 and 41, and pending US Application No. filed by current assignee on January 18, 2002. 10 / 050,902. The latter application is described in particular in Examples 23, 24, 31 and 51. All three documents are incorporated by reference in their entirety.

The invention also includes HBcAg variants modified by deleting or replacing one or more additional cysteine residues. Thus, the vaccine composition of the present invention comprises a composition comprising HBcAgs deleted from a cysteine residue not present in the amino acid set forth in SEQ ID NO: 71.

Preferred hepatitis B virus-like particles that can be used in the present invention are for example WO 00/32227, in particular Examples 17-19 and 21-24, and WO 01/85208, in particular Examples 17-19, 21-24. , 31 and 41, and pending US Application No. filed by current assignee on January 18, 2002. 10 / 050,902. The latter application is described in particular in Examples 23, 24, 31 and 51. All three documents are incorporated by reference in their entirety.

The invention also includes HBcAg variants modified by deleting or replacing one or more additional cysteine residues.

It is known in the art that free cysteine residues can be involved in many chemical side effects. These side effects include disulfide exchange, eg, reaction with chemicals or metabolites injected or formed in combination therapy with other substances, or with nucleotides upon direct oxidation and UV exposure. In particular, toxin adducts may be formed given the fact that HBcAgs tend to bind nucleic acids. Thus, toxin additives, which may be present in individually low concentrations but together may reach toxic levels, may be distributed among multiple species.

In this regard, the advantage of the use of HBcAgs in a vaccine composition in which modified and naturally occurring cysteine residues are removed is that the sites to which the toxin type binds are quantitatively reduced or eliminated when the antigen or antigenic determinant binds. .

A number of naturally occurring HBcAg variants have been identified that are suitable for use in many implementations. Yuan et al. (J. Virol. 73: 10122-10128 (1999)) described, for example, variants in which isoleucine residues at positions corresponding to position 97 of SEQ ID NO: 19 were replaced by leucine residues or phenylalanine residues. . The amino acid sequences of many HBcAg variants, and several hepatitis B core antigen precursor variants, are shown in GenBank Report AAF121240 (SEQ ID NO: 20), AF121239 (SEQ ID NO: 21), X85297 (SEQ ID NO: 22), X02496 (SEQ ID NO: 23), X85305 (SEQ ID NO: 24), X85303 (SEQ ID NO: 25), AF151735 (SEQ ID NO: 26), X85259 (SEQ ID NO: 27), X85286 (SEQ ID NO: 28), X85260 (SEQ ID NO: 29) , X85317 (SEQ ID NO: 30), X85298 (SEQ ID NO: 31), AF043593 (SEQ ID NO: 32), M20706 (SEQ ID NO: 33), X85295 (SEQ ID NO: 34), X80925 (SEQ ID NO: 35), X85284 (SEQ ID NO: 36), X85275 (SEQ ID NO: 37), X72702 (SEQ ID NO: 38), X85291 (SEQ ID NO: 39), X65258 (SEQ ID NO: 40), X85302 (SEQ ID NO: 41), M32138 (SEQ ID NO: Number: 42), X85293 (SEQ ID NO: 43), X85315 (SEQ ID NO: 44), U95551 (SEQ ID NO: 45), X85256 (SEQ ID NO: 46), X85316 (SEQ ID NO: 47), X85296 (SEQ ID NO: 48), AB033559 (SEQ ID NO: 49), X59795 (SEQ ID NO: 50) ), X85299 (SEQ ID NO: 51), X85307 (SEQ ID NO: 52), X65257 (SEQ ID NO: 53), X85311 (SEQ ID NO: 54), X85301 (SEQ ID NO: 55), X85314 (SEQ ID NO: 56), X85287 (SEQ ID NO: 57), X85272 (SEQ ID NO: 58), X85319 (SEQ ID NO: 59), AB010289 (SEQ ID NO: 60), X85285 (SEQ ID NO: 61), AB010289 (SEQ ID NO: 62), AF121242 ( SEQ ID NO: 63), M90520 (SEQ ID NO: 64), P03153 (SEQ ID NO: 65), AF110999 (SEQ ID NO: 66), and M95589 (SEQ ID NO: 67), each of which is herein incorporated by reference in its entirety. It is cited in the specification. These HBcAg variants are located at positions 12,13, 21,22, 24,29, 32, 33,35, 38,40, 42,44, 45,49, 51,57, 58,59, 64, Located at 66, 67,69, 74,77, 80,81, 87,92, 93, 97,98, 100,103, 105, 106, 109,113, 116,121, 126,130, 133,135, 141,147, 149,157, 176,178, 182 and 183 Different in the amino acid sequence at various positions, including amino acid residues corresponding to amino acid residues. In addition, HBcAg variants suitable for use in the compositions of the present invention and which can be further modified according to the present specification are described in WO 00/198333, WO 00/177158 and WO 00/214478, which are hereby incorporated by reference in their entirety. It is cited in the specification.

HbcAgs suitable for use in the present invention may be derived from any organism as long as it can surround or couple with or otherwise attach to an unmethylated CpG-containing oligonucleotide and induce an immune response.

As mentioned above, processed HBcAgs (ie, sequences lacking leader sequences) will be used in the compositions and vaccine compositions of the present invention. The present invention includes a composition and a method of using the composition, which uses the variant HBcAg described above.

In addition, additional HBcAg variants that can bind to form dimers or multimers are included within the scope of the present invention. Thus, the present invention further removes at least 80%, 85%, 90%, 95%, 97%, or about 99% matched amino acid sequence with one of the wild type amino acid sequences, and suitably the N-terminal leader sequence. Each composition and vaccine composition comprising an HBcAg polypeptide comprising, or otherwise consisting of, these protein forms that have been processed for purposes of treatment.

It is known, as in the Bestfit program, that the amino acid sequence of the polypeptide has an amino acid sequence, or subpart thereof, that is at least 80%, 85%, 90%, 95%, 97%, or about 99% identical to one of the wild type amino acid sequences. Computer program can be determined using conventionally used computer programs. When using Bestfit or any other sequence alignment program to determine if a particular sequence is about 95% identical to the reference amino acid sequence according to the invention, for example, the parameter is set to match the full length reference amino acid. Calculations on sequences and differences of homology of up to 5% of the total amino acid residues in the reference amino acid sequence are accepted.

HBcAg variants and precursors having the amino acid sequences set forth in SEQ ID NOs: 20-63 and 64-67 are relatively similar to each other. Thus, reference to an amino acid residue of an HBcAg variant present at a position corresponding to a particular position in SEQ ID NO: 68 refers to an amino acid residue at that position in the amino acid sequence shown in SEQ ID NO: 68. Since homology between these HBcAg variants is generally very high among hepatitis B viruses infecting mammals, one skilled in the art can review the amino acid sequences shown in SEQ ID NO: 68 and variants of specific HBcAg and "match" amino acid residues. It will not be difficult to check. In addition, the HBcAg amino acid sequence shown in SEQ ID NO: 64, which represents the amino acid of HBcAg derived from a virus infecting Woodchuck, has three amino acid sequences in SEQ ID NO: 64 between amino acid residues 155 and 156 in SEQ ID NO: 68; It is sufficiently homologous to HBcAg having the amino acid sequence shown in SEQ ID NO: 68, which is apparent that the amino acid residue insert is present.

The invention also includes vaccine compositions comprising HBcAg variants of hepatitis B virus that infect poultry, and vaccine compositions comprising fragments of HBcAg variants. For these HBcAg variants, one, two, three or more cysteine residues naturally occurring in this polypeptide may be substituted or deleted with another amino acid residue prior to inclusion in the vaccine composition of the present invention.

As described above, free cysteine residues are removed to reduce the number of sites where the toxin component binds to HBcAg, and the number of cross-linking sites of lysine and cysteine residues of the same or neighboring HBcAg. Thus, in another aspect of the invention, one or more cysteine residues of the hepatitis B virus capsid protein may be substituted or deleted with another amino acid residue.

In another embodiment, the compositions and vaccine compositions of the invention will comprise HBcAgs from which the C-terminal site (eg, amino acid residues 145-185 or 150-185 of SEQ ID NO: 68) has been removed, respectively. Thus, further modified HBcAgs suitable for use in the practice of the present invention include C-terminal truncation mutants. Suitable cleavage mutants include HBcAgs with amino acids 1, 5, 10, 15, 20, 25, 30, 34, 35 removed from the C-terminus.

Further modified HBcAgs suitable for use in the practice of the present invention include N-terminal truncation mutants. Suitable cleavage mutants include modified HBcAgs with amino acids 1, 2,5, 7,9, 10,12, 14,15, or 17 removed from the N-terminus.

Further modified HBcAgs suitable for use in the practice of the present invention include N- and C-terminal truncation mutants. Suitable cleavage mutants have 1, 2,5, 7,9, 10,12, 14,15, or 17 amino acids removed from the N-terminus and 1, 5,10, 15,20, 25, HBcAgs with amino acids 30, 34 and 35 removed.

The invention further comprises a protein comprising, alternatively essentially composed or otherwise constructed an amino acid that is at least 80%, 85%, 90%, 95%, 97%, or 99% identical to the truncation mutants described above Each composition and vaccine composition are included.

In certain aspects of the invention a lysine residue is introduced into the HBcAg polypeptide to mediate binding of one or more antigens to the VLP of HBcAg. In a preferred embodiment, the composition of the invention is modified such that the amino acids corresponding to 79 and 80 are replaced with a peptide having the amino acid sequence of G1y-G1y-Lys-G1y-G1y (SEQ ID NO: 95) in SEQ ID NO: 68 Prepared using HBcAg comprising, alternatively essentially composed or otherwise composed of amino acids 1-144, or 1-149, 1-185. In a further preferred aspect, cysteine residues 48 and 107 of SEQ ID NO: 68 are mutated to serine (SEQ ID NO: 97). The invention further includes compositions comprising corresponding polypeptides having the amino acid sequences set forth in any of SEQ ID NOs: 20-67 with amino acid alterations as mentioned above. Additional HBcAg variants that can bind to form capsids or VLPs and have amino acid variations as mentioned above are further included within the scope of the present invention. Thus, the present invention further comprises, otherwise consists essentially of, or alternatively consists of an amino acid at least 80%, 85%, 90%, 95%, 97%, or 99% identical to any of the wild type amino acid sequences, respectively. Polypeptides, and compositions and vaccine compositions comprising those protein forms, as appropriate, wherein the N-terminal leader sequence has been removed and modified with the aforementioned mutations.

Compositions and vaccine compositions of the present invention may comprise a mixture of different HBcAgs. Thus, the vaccine composition may consist of HBcAgs that differ in amino acid sequence. For example, compositions and vaccine compositions can be prepared including modified HBcAg and “wild-type” HBcAg with one or more amino acid residues modified (eg, deleted, inserted or substituted). In addition, a preferred vaccine composition of the present invention is to present a highly ordered and repeating antigen array in which the antigen is one or more antigens.

In one aspect of the invention virus-positive particles bound by unmethylated CpG-containing oligonucleotides are mixed with antigen / immunogen with enhanced immune response against antigen / immunogen. In one example, a single antigen will be mixed with modified virus-positive particles. In another example, modified VLPs will be mixed with several antigens or even more complex antigen mixtures. Antigens may be extracted or recombinantly produced from natural sources and include but are not limited to pollen, dust, fungi, insects, food, mammalian epidermis, feathers, bees, tumors, pathogens and feathers.

As described above, the present invention relates to modified VLP's, ie immunostimulatory substances, preferably immunostimulatory nucleic acids and even more preferably DNA oligonucleotides or alternatively poly (I: C) bound VLP's, and preferably immunostimulatory substances VLP's, which preferably lead to packed VLPs by binding immunostimulatory nucleic acids and even more preferably DNA oligonucleotides or alternatively poly (I: C) to VLP's, are only directed to antigens via a mixture of modified VLPs and antigens. And the surprising finding that it can enhance T cell responses. Surprisingly, no covalent binding or coupling of the antigen with the VLP is required. In addition, T cell responses to both VLPs and antigens point specifically to the Th1 type. Further packed nucleic acids and CpGs are each protected from degradation, ie they are more stable. In addition, nonspecific activation of cells from the immune system is markedly reduced.

The innate immune system has the ability to recognize invariant molecular patterns shared by microbial pathogens. Recent studies have shown that recognition is an important step in inducing an effective immune response. The main mechanism by which microbial products increase the immune response is to stimulate APCs, especially dendritic cells, to produce proinflammatory cytokines and to express high moisture, high stimulatory molecules on T cells. These activated dendritic cells subsequently initiate a primary T cell response and dictate the T cell-mediated effector action type.

Synthesized by two classes of nucleic acids: 1) bacterial DNA (specifically referred to as CpG motifs) comprising specifically flanked intranucleotide immunostimulatory sequences, in particular unmethylated CpG dinucleotides, and 2) various types of viruses The resulting double-stranded RNA represents an important member of the components of the microorganism that enhances the immune response. Synthetic Double Strand (ds) RNA As an example, polyinosine-polycytidic acid (poly I: C) can induce dendritic cells to produce proinflammatory cytokines and express high levels of costimulatory molecules.

A series of studies by Tokunaga and Yamamoto et al. Revealed that bacterial DNA or synthetic oligodeoxynucleotides enable human PBMCs and mouse spleen cells to induce type I interferon (IFN) (Review: Yamamoto et al., Springer Semin Immunopathol. 22: 11-19). Poly (I: C) is originally synthesized as a potent inducer of type I IFN and induces IL-12 as another cytokine example.

Preferred ribonucleic acids include polyinosine-polycytidic acid double-stranded RNA (poly I: C). Ribonucleic acid and its variants and methods of production are Levy, H. B (Methods Enzymol. 1981, 78: 242-251), DeClercq, E (Methods Enzymol. 1981, 78: 227-236) and Torrence, PF (Methods Enzymol 1981; 78: 326-331, incorporated herein by reference. Further preferred ribonucleic acids include polynucleotides of inosine acid and cytidiylic acid, such as poly (IC) in which two strands form a double stranded RNA. Ribonucleic acid can be separated from living organisms. Ribonucleic acids also include synthetic ribonucleic acids, in particular synthetic poly (I: C) oligonucleotides, which render nucleases resistant by modification of the phosphodiester backbone, in particular phosphorothioate modification. In a further aspect the ribose backbone of poly (I: C) is replaced with deoxyribose. Those skilled in the art know how to synthesize synthetic oligonucleotides.

Another preferred aspect includes molecules that activate toll-positive receptors (TLRs). To date, ten human toll-positive receptors are known. It is activated by various ligands. TLR2 is activated by peptidoglycan, lipoprotein, lipopolysaccharide, lipoteichonic acid and Zymosan, and macrophage-activated lipopeptides MALP-2; TLR3 is activated by double-stranded RNA, such as poly (I: C); TLR4 is activated by lipopolysaccharide, lipoteiconic acid and taxol and heat-shock proteins such as heat shock proteins HSP-60 and Gp96; TLR5 is activated by bacterial flagella, especially flagellin protein; TLR6 is activated by peptidoglycan, TLR7 is activated by imiquimoid and imidazoquinoline compounds, such as R-848, roxolibin and bropyrimin and TLR9 is activated on bacterial DNA, especially CpG-oligonucleotides. Understanding is activated. Ligands for TLR1, TLR8 and TLR10 are not known to date. However, recent reports have reported that the same receptor reacts with different ligands and additional receptors are present. The ligands listed above are not fully identified and additional ligands are known to those skilled in the art.

Typically, unmethylated CpG-containing oligonucleotides comprise the sequence:

5'X ₁ X ₂ CGX ₃ X ₄ 3 '

Wherein X ₁ , X ₂ , X ₃ and X ₄ are all nucleotides. In addition, the oligonucleotides may comprise about 6 to about 100, 000 nucleotides, preferably about 6 to about 2000 nucleotides, more preferably about 20 to about 2000 nucleotides and even more preferably about 20 To about 300 nucleotides. In addition, oligonucleotides comprise at least 100 to about 2000 nucleotides, preferably at least 100 to about 1000 nucleotides, even more preferably at least 100 to about 500 nucleotides.

In a preferred aspect, the CpG-containing oligonucleotides comprise phosphothioester modifications of one or more phosphate backbones. For example, CpG-containing oligonucleotides having one or more phosphate backbone modifications or all phosphate backbones modified and CpG-containing oligonucleotides in which one, some or all of the nucleotide phosphate backbone modifications are phosphorothioate modifications are within the scope of the invention. Included.

CpG-containing oligonucleotides may also be recombinant, gene, synthetic, cDNA, plasmid-derived and single or double strands. For use in the present invention, nucleic acids can be newly synthesized using a number of methods known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage, SL, and Caruthers, MH, Tet. Let. 22: 1859 (1981); nucleoside H-phosphonate method (Garegg et al., Tet Let. 27: 4051-4054 (1986); Froehler et al., Nucl.Acid.Res. 14: 5399-5407 (1986); Garegget al., Tet.Let. 27: 4055-4058 (1986), Gaffney. et al., Tet. Let. 29: 2619-2622 (1988)) These chemistries can be performed by a variety of commercially available automated oligonucleotide synthesizers, alternatively CpGs that are degraded into oligonucleotides after administration to a subject. Can be produced in large quantities in plasmids (see Sambrook, T., et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor laboratory Press, New York, 1989). Oligonucleotides are restriction enzymes, exonucleases. Or from existing sequences (eg genes or cDNAs) using known techniques such as using endonucleases. have.

Immunostimulatory materials, immunostimulatory nucleic acids and unmethylated CpG-containing oligonucleotides can bind to VLPs by methods known in the art, provided that the composition enhances immune half in animals. For example, oligonucleotides can be bound by covalent or non-covalent bonds. In addition, VLPs may surround, in whole or in part, immunostimulatory materials, immunostimulatory nucleic acids, and unmethylated CpG-containing oligonucleotides. Preferably, immunostimulatory nucleic acids and unmethylated CpG-containing oligonucleotides can bind to VLP sites such as oligonucleotide binding sites (natural or non-naturally occurring), DNA binding sites or RNA binding sites. In another embodiment, the VLP region comprises arginine-rich repeats or lysine-rich repeats.

A specific use of the compositions of the present invention is to activate dendritic cells to enhance specific immune responses against antigens. Dendritic cells can be promoted using ex vivo or in vivo techniques. In vitro methods can be used for autologous or heterologous cells and are preferably used on autologous cells. In a preferred embodiment, dendritic cells can be isolated from peripheral blood or bone marrow but can be isolated from any source of dendritic cells. In vitro manipulation of dendritic cells for cancer immunotherapy has been described in several references in the art, including Engleman, eg, Cytotechnology 25: 1 (1997); Van Schooten, W., et al., Molecular Medicine Today, June, 255 (1997); Steinman, R. M., Experimental Hematology 24: 849 (1996); and G1uckman, J. C., Cytokines, Cellur and Molecular Therapy 3: 187 (1997).

In vivo methods can be used to contact the composition of the present invention with dendritic cells. To accomplish this, CpGs are combined with VLPs mixed with antigens and administered directly to a subject in need of immunotherapy. For example, it is preferable to administer VLPs / CpGs by injection into the local area of the tumor, for example by direct injection into the tumor, by methods known in the art.

In a further preferred embodiment of the invention the non-methylated CpG-containing oligonucleotide comprises the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 122), or alternatively consists essentially of or otherwise consists of. It has been previously discovered that it can stimulate blood cells in vitro (Kuramoto E. et al., Japanese Journal Cancer Research 83, 1128-1131 (1992).

In another preferred aspect of the invention, the immunostimulatory material is an unmethylated CpG-comprising oligonucleotide, wherein the CpG motif of the unmethylated CpG-comprising oligonucleotide is part of a forward and backward homologous sequence. Preferably the forward and backward reverse homology sequence is GACGATCGTC (SEQ ID NO: 105). In another preferred aspect, the forward and backward reverse homologous sequence is located on its 5'-end and its 3'-end flank by less than 10 guanosine entities and preferably the backward and reverse homologous sequence is GACGATCGTC (SEQ ID NO: 105). to be. In a further preferred aspect, the anteroposterior homologous sequence is flanked by its at least three and at most nine guanosine entities at its N-terminus and the anteroposequal homologous sequence is at least six and at most nine guanosine entities thereof. -It is located at the end side. It was unexpectedly found that the immunostimulatory material of the present invention was effectively packed into VLPs. Packing capacity was enhanced compared to the corresponding immunostimulatory material with the sequence GACGATCGTC (SEQ ID NO: 105) flanked by 10 guanosine entities at the 5 'and 3' ends.

In a preferred aspect of the invention the forward and backward reverse homologous sequence comprises, alternatively consists essentially of, or alternatively consists of, GACGATCGTC (SEQ ID NO: 105), wherein the backward and reverse homologous sequence comprises at least three and at most nine It is located on its 5'-end side by guanosine entity and its back and forth homologous sequence is located on its 3'-end side by at least six and up to nine guanosine entities.

In a further preferred aspect of the invention, the immunostimulatory material is an unmethylated CpG-comprising oligonucleotide, wherein the CpG motif of the unmethylated CpG-comprising oligonucleotide is part of a back and forth homologous sequence, wherein the unmethylated CpG-comprising Oligonucleotides are (a) GGGGACGATCGTCGGGGGG ((SEQ ID NO: 106); and commonly abbreviated herein as G3-6), (b) GGGGGACGATCGTCGGGGGG ((SEQ ID NO: 107); and commonly abbreviated herein as G4-6 ), (C) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 108); and commonly abbreviated herein as G5-6), (d) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 109); and commonly abbreviated herein as G6-6 ), (E) GGGGGGGGACGATCGTCGGGGGGG ((SEQ ID NO: 110); and commonly abbreviated herein as G7-6), (f) GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 111); and commonly abbreviated herein as G8-6 ), (G) GGGGGGGGGGACGATCGTCGGGGGGGGG ((SEQ ID NO: : 112); and typically abbreviated as G9-6 herein), and (h) GGGGGGCGACGACGATCGTCGTCGGGGGGG ((SEQ ID NO: 113); has a nucleic acid sequence selected from normal and abbreviated herein as G6).

In a further preferred aspect, the immunostimulatory material is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of the unmethylated CpG-containing oligonucleotide is part of a forward and backward homologous sequence, preferably the backward and reverse homologous sequence is GACGATCGTC (sequence). Number 105), and the front and rear reverse homologous sequences are flanked by their 5'-ends by at least 4 and up to 9 guanosine entities and the front and rear reverse homologous sequences are by at least 6 and up to 9 guanosine entities. On its 3'-terminal side.

In another preferred aspect of the invention, the immunostimulatory material is an unmethylated CpG-comprising oligonucleotide, wherein the CpG motif of the unmethylated CpG-comprising oligonucleotide is part of a backward and backward homologous sequence, and the unmethylated CpG-comprising oligonucleotide (A) GGGGGACGATCGTCGGGGGG ((SEQ ID NO: 107), and commonly abbreviated herein as G4-6); (b) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 108), and commonly abbreviated herein as G5-6); (c) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 109), and commonly abbreviated herein as G6-6); (d) GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO: 110) and commonly abbreviated herein as G7-7); (e) GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 111), and commonly abbreviated herein as G8-8); (f) GGGGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO: 112) and commonly abbreviated herein as G9-9).

In a further aspect of the invention the immunostimulatory material is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of the unmethylated CpG-containing oligonucleotide is part of a forward and backward homologous sequence, preferably the backward and reverse homologous sequence is GACGATCGTC. (SEQ ID NO: 105), the anteroposterior reverse homologous sequence is flanked by its 5'-end flank by at least 5 and at most 8 guanosine entities and the anteroposterior reverse homologous sequence is at least 6 and at most 8 guanosine entities By its 3'-terminal side.

Experimental data show that the immunostimulatory material of the invention, ie, the guanosine flanked forward and backward, homologous and unmethylated CpG-containing oligonucleotides, is preferred when flanked by more guanosine entities Wherein the forward and backward reverse homology sequence is GACGATCGTC (SEQ ID NO: 105) and the forward and backward reverse homology sequence is located at its 3'-end and its 5'-end flank by less than 10 guanosine entities. It has been found to be easier to pack into. However, a decrease in the number of guanosine entities flanking the front and back reverse homologous sequences also reduces the number of stimulating blood cells in vitro. Thus, the packing potential is offset by reducing the biological activity of the designated immunostimulatory material of the present invention. ). One preferred aspect therefore represents a compromise of packing pluripotency and biological activity.

In another preferred aspect of the invention, the immunostimulatory material is an unmethylated CpG-comprising oligonucleotide, wherein the CpG motif of the unmethylated CpG-comprising oligonucleotide is part of a backward and backward homologous sequence, and the unmethylated CpG-comprising oligonucleotide (A) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 108), and commonly abbreviated herein as G5-6); (b) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 109), and commonly abbreviated herein as G6-6); (c) GGGGGGGGACGATCGTCGGGGGGG ((SEQ ID NO: 110), and commonly abbreviated herein as G7-7); (d) GGGGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO: 111), and commonly abbreviated herein as G8-8).

Very Preferred Aspects of the Invention In another preferred aspect of the invention, the immunostimulatory material is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of the unmethylated CpG-containing oligonucleotide is part of a back and forth homologous sequence, The unmethylated CpG-containing oligonucleotide has a nucleic acid sequence of SEQ ID NO: 111, ie the immunostimulatory material is G8-8.

As mentioned above, the optimal sequence used to pack into VLPs is a compromise of packing pluripotency and biological activity. In view of this, the G8-8 immunostimulatory material is a further preferred example of the present invention because it is biologically highly active and at the same time continuously adequately packed.

Compositions of the invention further comprise an antigen or antigenic determinant mixed with a modified virus-positive particle. The present invention provides other compositions depending on the antigen or antigenic determinant selected in view of the desired therapeutic efficacy. Suitable antigens or antigenic determinants for use in the present invention are described in WO 00/32227, WO01 / 85208 and WO 02/056905, which are incorporated herein by reference in their entirety.

The antigen may be of known origin or any antigen not yet known. Bacteria known to cause allergic reactions in sensitized patients; Viruses or other pathogens; tumor; Or from trees, grasses, weeds, plants, fungi, fungi, dust mites, food, or animals. Alternatively, the antigen may be a recombinant antigen obtained by expressing the coding of a suitable nucleic acid therefor. In a preferred embodiment, the antigen is a recombinant antigen. The choice of antigen naturally depends on the desired immunological response and host.

The present invention can be applied to various antigens. In a preferred embodiment, the antigen is a protein, polypeptide or peptide.

Antigens of the invention

(a) a polypeptide suitable for inducing an immune response against cancer cells; (b) a polypeptide suitable for inducing an immune response to an infectious disease; (c) a polypeptide suitable for inducing an immune response to an allergen; (d) polypeptides suitable for inducing an immune response to an immune response in a livestock or pet; (e) carbohydrates naturally occurring on the polypeptide and (f) a fragment (eg, a region) of any of the polypeptides described in (a)-(e).

Preferred antigens include those from pathogens (eg viruses, bacteria, parasites, fungi) tumors (especially tumor-associated antigens or "tumor markers") and allergens. Other preferred antigens include autoantigens and self antigens, respectively.

In a particular aspect described in the examples, the antigen is bee venom. Less than 3% of the population is allergic to bee venom and can cause allergies by sensitizing mice to bee venom. Thus, bee venom is an ideal allergen mixture, which can study the immune response induced by the mixture in the presence or absence of various adjuvants, such as CpG-packed VLPs (see especially Examples 4 and 9). Make sure

In one example, VLPs comprising peptide p33 were used. It should be noted that VLPs comprising peptide p33 are for convenience only and wild type VLPs can also be used in the present invention. Peptide p33 is derived from lymphocytic meningitis virus (LCMV). The p33 peptide represents one of the best studied CTL epitopes (Pircher et al., "Tolerance induction in Double specific T-Cell receptor transgenic mice varies with Antigen," Nature 342: 559 (1989); Tissot et al., "Characterizing the functionality of Recombinant T-cell receptors in vitro: apMHC tetramer basedapproach, "JImmunol Methods 236: 147 (2000); Bachmann et al.," Four types of Ca2 + -signals after stimulation of naive T Cell with T cell agonists, partial agonists andantagonists, "Eur. J. Immunol. 27: 3414 (1997); Bachmann et al.," Functional maturation of an anti-virus cytotoxic T cellular response, "J: Virol. 71: 5764 (1997); Bachmann et al. , "peptide induced TCR-down regulation on naive T cell predicts agonist / partial agonist properties and strictly correlates with T cell activation," Eur. J Immunol. 27: 2195 (1997); Bachmann et al., "Distinct roles for LFA-1 and CD28 during activation of naive T Cell: adhesion versus costimulation, "Iyszmunity 7: 549 (1997)). p33-specific T cells induce fatal diabetes disease in transformed mice (Ohashi et al., "Ablation of 'tolerance' and induction of diabetes by virus infection in virus Antigen transgenic mice," Cell 65: 305 (1991)). It has been shown to inhibit the growth of tumor cells expressing p33 (Kiindig et al., "Fibroblasts act as efficient Antigen-presenting cell in lymphoid organs," Science 268: 1343 (1995); Speiser et al., " CTL tumor therapy specific for an endogenous antigen does not cause autoimmune disease, "J. Exp. Med. 186: 645 (1997)). Thus, this specific epitope is particularly suitable for autoimmune, tumor immunology and viral disease studies.

In one aspect of the invention the antigen or antigenic determinant is useful for the prevention of an infectious disease. Such treatment will be useful for treating a wide range of infectious diseases acting on a wide range of hosts, such as humans, cattle, sheep, pigs, dogs, cats, other mammalian species and non-mammalian species. Infectious diseases are well known to those skilled in the art and include, for example, infections of viral etiologies, such as HIV, influenza, herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, papilloma virus, and the like; Or infections of bacterial etiologies such as pneumonia, tuberculosis, syphilis, and the like; Or parasitic etiologies infections include malaria, swelling flagellosis, rishman's flagellitis, vaginal flagellosis, amoebiasis and the like. Thus, the antigens or antigenic determinants selected for the compositions of the present invention are well known to those skilled in the medical arts; Examples of antigens or antigenic determinants include: HIV antigens gp140 and gp160; Influenza antigens include hemagglutinin, M2 protein and neuraminidase, hepatitis B surface antigen or core, and sporeosomal antigen protein of malaria or fragments thereof.

As described above, antigens include infectious microorganisms such as viruses, bacteria and fungi and fragments thereof, which are derived or recombinant from natural sources.

Infectious viruses of human and non-human vertebrates include retroviruses, RNA viruses, and DNA viruses. Retrovirus groups include simple retroviruses and complex retroviruses. Simple retroviruses include B-type retroviruses, C-type retroviruses, and D-type retrovirus subgroups. An example of a B-type retrovirus is mouse carcinoma virus (MMTV). C-type retroviruses are subgroup C-type group A (Larus sarcoma virus (RSV), avian leukemia virus (ALV), and avian myeloblastosis virus (AMV)) C-type group B (murine leukemia virus (MLV) Feline leukemia virus (FeLV), murine sarcoma virus (MSV), vigon ape leukemia virus (GALV), splenic necrosis virus (SNV), reticuloendothelial virus (RV) and apes sarcoma virus (SSV) It includes. Type D retroviruses include Maize-Pfizer Monkey Virus (MPMV) and Type 1 Monkey Retrovirus (SRV-1). Complex retroviruses include subgroups of lentiviral, T cell leukemia virus, foaming virus. Lentiviruses include HIV-1, as well as HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and equine infectious anemia virus (EIAV). T cell leukemia viruses include HTLV-1, HTLV-II, monkey T cell leukemia virus (STLV), and bovine leukemia virus (BLV). Foaming viruses include human foaming virus (HFV), monkey foaming virus (SFV) and scavenging virus (BFV).

Examples of RNA viruses that are antigens in vertebrates include, but are not limited to: Leoviridae family (genus Orthoreovirus (multiple serotypes of both mammalian and avian retroviruses), genus Orbivirus (blue tongue virus, herds) Egg virus, Kemerovo virus, African horsebird virus, and Colorado mite virus), Rotavirus genus (human rotavirus, Nebraska calf diarrhea virus, murine rotavirus, monkey rotavirus, bovine or sheep rotavirus, avian rotavirus) include); Phycoma viridae family (entertovirus genus (Poliovirus, cocksackie virus A and B, intestinal cell lesion human orphan (ECHO) virus, type A, type C, type D, type E and G hepatitis virus, monkey enterovirus , Murine encephalomyelitis (ME) virus, poliovirus muris, bovine enterovirus, swine enterovirus), cardiovirus genus (encephalomyovirus virus (EMC), mengovirus), rhinovirus genus (including at least 13 subtypes) Human rhinoviruses; other rhinoviruses), genus aptoviruses (including globular disease virus (FMDV)), calcivirida family (including swine bullous rash virus, San Miguel Leone virus, feline piconavirus and Norwalk virus); Tokabirida family (alpha virus genus (East encephalitis virus, Semiki forest virus, Sindbis virus, Chikungunya virus, Ognon- Virus, Ross River virus, Venezuelan encephalitis virus, Western encephalitis virus), Flavirus (mosquito mediated yellow fever virus, dengue virus, Japanese encephalitis virus, St. Lewis encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunjin virus , Central European mediated virus, Far Eastern tick-borne virus, Chiasanu forest virus, Roofing III virus, Poisan virus, Omsk hemorrhagic fever virus, Ruby virus genus (Rubella virus), Pestivirus genus (mucosal disease virus, Porcine cholera virus) (Includes border disease virus); field genus (Bunivirus genus (Buniyamwera and related viruses, California encephalitis group virus), Flebovirus genus (Sandfly fever Sicilian, Rift Valley fever virus), age Lovirus (Congo-Crimia hemorrhagic fever bar Russ, Nairobi sheep disease virus), genus Ucuvirus (including Ukunmiemi and related viruses); orthomyxovirida family (including genus Influenza virus (influenza A type, many human subtypes)); swine influenza virus And bird and horse influenza viruses, influenza B (large number of human subtypes), and influenza C (possibly other genera); Paramyxoviridae (paramyxovirus genus (type 1 parainfluenza virus, Sendai virus, hemocytosis virus, type 2 to 5 parainfluenza virus, Newcastle disease virus, mumps virus), measles virus (measles virus, suba) Acute sclerosis encephalitis virus, distemper virus, reverse virus), pneumovirus (including respiratory synstium virus (RSV), bovine respiratory syntium virus and pneumonia virus of mouse)); Forest virus, Sindbis virus, Chikungunya virus, Orignon-ignon virus, Ross River virus, Venezuela equine encephalitis virus, Western encephalitis virus), Flavirus genus (mosquito-mediated yellow fever virus, dengue virus, Japanese encephalitis virus, St. Lewis) Encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunjin virus, Central European mediated virus, Far Eastern tick-borne virus, Chiasanu forest virus, Roofing III virus, Poisan virus, Omsk hemorrhagic fever virus, Ruby virus genus Bella virus), pestivirus genus (including mucosal disease virus, porcine cholera virus, border disease virus); Family (Bunivirus genus (Buniyamwera and related viruses, California encephalitis group virus), Plebovirus genus (Sandfly fever Sicilian, Rift Valley fever virus), Nairovirus (Congo-Crimia hemorrhagic fever virus, Nairobi sheep) Disease virus), including the genus Ucuvirus (Ukunmiemi and related viruses); Orthomyxoviridae (including influenza virus genus (type A influenza virus, many human subtypes)); Swine influenza virus, and avian and equine influenza viruses; Influenza B (many human subtypes), and influenza C (other possible genus); Paramyxoviridae (paramyxovirus genus (type 1 parainfluenza virus, Sendai virus, hemocytosis virus, type 2 to 5 parainfluenza virus, Newcastle disease virus, mumps virus), measles virus (measles virus, suba) Acute sclerosis encephalitis virus, distemper virus, reverse virus), pneumovirus (including respiratory synstium virus (RSV), bovine respiratory syntium virus and pneumonia virus of mouse)); Rhabdoviridae family (Besciulovirus genus (VSV), Chandipura virus, Pladers-Heart Park virus), Lysavirus genus (rabies virus), Fish rhabdovirus and philovirus (Marburg virus and Ebola virus) include; Arenaviridae family (including lymphocytic choroidal meningitis virus (LCM), Takaribe virus complex, and Lhasa virus); Members of the coronaviridae family (including infectious bronchitis virus (IBV), mouse hepatitis virus, human intestinal coronavirus, and feline infectious peritonitis (cat coronavirus)).

Examples of DNA viruses that are antigens in vertebrates include, but are not limited to, the Foxviridae family (Sortopoxvirus genus (soybeans, smallpox, monkey fox vaccinia, vaccinia, buffalopox, rabbitfox, ectomelia), Genus Repofox virus (myxoma, fibroid), genus Apopox virus (poultry, other avian poxviruses), genus capripoxvirus (yangpox, goatpox), supoxvirus genus (pigpox), parapoxvirus ( Contact pustulic dermatitis virus, pseudovaccinia, bovine papular stomatitis virus); Iridoviridae (including African pig cholera virus, Prag virus 2 and 3, lymphocytic virus of fish); Herpesviridae family (alpha-herpesvirus genus (types 1 and 2 herpes simplex, varicella zoster, equine lactic acid virus, equine herpes virus 2 and 3, pseudoleivis virus, infectious bovine corneal conjunctivitis virus, infectious sino-linitis virus) , Feline rhinobronchiitis virus, infectious laryngeal tracheitis virus), beta-herpesvirus genus (including human cytomegalovirus and cytomegalovirus of pigs, monkeys and rodents); Gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease virus, herpes cymiri, herpesvirus artes, herpesvirus silviragus, guinea pig herpes virus, Luce tumor virus)); Adenoviridae family (Mastadenovirus genus (human subgroups A, B, C, D and E and ungrouped); monkey adenovirus (at least 23 serotypes), infectious dog hepatitis, and cattle, pigs, sheep , Agglutins and many other species of adenoviruses, abiadenovirus genus (algal adenoviruses) and non-cultured adenoviruses; Paphoviridae family (genuine papilloma virus (human papilloma virus, bovine papilloma virus, Schaff rabbit papilloma virus, and various other pathogenic papilloma viruses), polyoma virus genus (polyomavirus, monkey fear factor (SV-40) , Rabbit fear forming factor (RKV), K virus, BK virus, JC virus, and other primate polyoma viruses such as lymphocyte affinity papilloma virus)); Parvovirida family, including the genus Adeno-associated virus, including the genus Parvovirus (cat pancreatic virus, bovine parvovirus, canine parvovirus, allantoin mink disease virus, etc.). Finally, DNA viruses may include viruses that are not included in any of the above families, such as kuru and Creutzfeldt-Jakob disease virus and chronic infectious neuropathy factor (China virus).

Each of the above lists is an example and is not intended to be limiting.

In certain aspects of the invention, the antigen comprises one or more cytotoxic T cell epitopes, Th cell epitopes, or a combination of cytotoxic T cell epitopes and Th cell epitopes.

Examples of preferred methods besides enhancing human antigen specific immune responses would be particularly suitable for the treatment of other mammals or other animals, such as birds, for example hens, roosters, turkeys, ducks, geese, quails and pheasants. will be. Algae are a major target for many types of infections. A common example of infection in chickens is chicken infectious anemia virus (CIAV). CIAV was first isolated in Japan in 1979 during the Marek 'disease vaccination break study (Yuasa et al., Avian Dis. 23: 366-385 (1979)). Since then, CIAV has been detected in commercial poultry in all major livestock producing countries (van Bulow et al., Pp. 690-699 in "Disease of Poultry", 9th edition, Iowa State University Press 1991).

Like other vertebrates, birds can be vaccinated by age. Normally up to 12 weeks against live microorganisms and inactivated microorganisms or other forms of vaccine are vaccinated between 14-18 weeks. In ovo vaccination, vaccination can be performed in the fourth quarter during embryonic development. The vaccine may be administered subcutaneously, by nebulization, orally, intraocularly, intratracheally, intrahepatic, ovary or according to the methods described herein.

Cows and livestock are also susceptible to infection. Diseases affecting these animals cause economic losses, especially in cattle. Livestock such as cattle, horses, pigs, sheep and goats can be protected from infection using the methods of the invention.

Cows can be infected by bovine viruses. Bovine virus diarrhea virus (BVDV) is a small envelope (-)-stranded RNA virus and is classified into pestiviruses together with porcine cholera virus (HOCV) and sheep border disease virus (BDV). Although pestiviruses were previously classified as Tocaviridae family, some studies have suggested that they reclassify into the Flaviviridae family together with the Flavivirus and Hepatitis C virus (HCV) groups.

Equine herpesviruses (EHV) comprise a group of antigenically different biological factors that cause a variety of infections in horses, from asymptomatic disease to fatal disease. It includes Equine Herpesvirus-1 (EHV-1), a ubiquitous pathogen in equine. EHV-1 is associated with prevalence of miscarriage, respiratory tract disease, and central nervous system disease. Other EHV's include EHV-2, or Equine Cytomegalovirus, EHV-3, Equine Rash Virus, and EHV-4, previously classified as EHV-1 subtype 2.

Sheep and goats can be infected by various dangerous microorganisms such as bisna-maedi.

Primates such as monkeys, tailless monkeys, and macaques can be infected by the monkey screening virus. Inactivated cell-virus and acellular whole monkey immunodeficiency vaccines have been reported to protect in macaques (Stott et al., Lancet 36: 1538-1541 (1990); Desrosiers et al., PNAS USA 86: 6353- 6357 (1989); Murphey-Corb et al., Science 246: 1293-1297 (1989); and Carlson et al., AIDS Res. Human Retrobirus 6: 1239-1246 (1990)). Recombinant HIV gp120 vaccines have been reported to protect against chimpanzees (Berman et al., Nature 345: 622-625 (1990)).

Pets and wild-type cats are susceptible to infection by a variety of microorganisms. For example, feline infectious peritonitis is a disease that occurs in both pet and wild cats such as lions, leopards, cheetahs, and jaguars. If it is desired to prevent infection with this and other forms of pathogenic organisms in cats, infection can be prevented by vaccinating cats using the methods of the present invention.

Pet cats have several retroviruses, including but not limited to feline leukemia virus (FeLV), feline sarcoma virus (FeSV), type C endogenous oncoma virus (RD-114), and feline fusion forming virus (FeSFV). ) Can be infected. For the first time, a report has been reported in Federsen et al., Science 235: 790-793 (1987) for feline T-lymphophilic lentivirus (also referred to as cat immunodeficiency). Feline infectious peritonitis (FIP) is a sporadic disease that occurs unpredictably in pets and wild felines. FIP is primarily a disease of pet cats, but has also been found in lions, mountain lions, leopards, cheetahs and jaguars. Smaller wild-type cats suffering from FIP include lynx and caracal, sand cats, and pallas cats.

Virus and bacterial diseases of fin-fish, crustaceans or other aquatic life pose serious problems in aquaculture. Due to the high density of animals in hatchery tanks or enclosed marine farming areas, infectious diseases can eradicate large amounts of storage in pin-fish, shellfish or other aquatic life facilities. Preventing disease rather than intervening once it progresses is a better treatment for threats to fish. Vaccination of fish is the only prophylactic that can provide long-term protection through immunogens. Fish vaccination based on nucleic acid is described, for example, in U. S. Patent No. 5, 780, 448.

The immune system of fish has a number of properties similar to that of mammals, such as the presence of B cells, T cells, lymphatic circulation, complement, and immunoglobulins. Fish have lymphoid subclasses with functions that appear to be similar in many respects to those of mammalian B and T cells. The vaccine can be administered orally or by dipping or injection.

Aquaculture species include, but are not limited to, for example, pin-fish, shellfish or other aquatic animals. Fin-fish includes all vertebrate fish and includes bony or cartilaginous fish such as salmon, carp, catfish, yellowtail, black sea bream, and red snapper. The salmon family is a pin-fish family that includes trout (including stone trout), salmon and arctic char. Examples of crustaceans include, but are not limited to, shellfish, lobster shrimp, crabs, and oysters. Examples of other aquatic animals include, but are not limited to, eel, squid, and octopus.

Examples of polypeptides of viral culture pathogens include, but are not limited to, glycoproteins or nucleoproteins of viral hemorrhagic sepsis virus (VHSV); G or N protein of infectious hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural proteins of infectious pancreatic necrosis virus (IPNV); G protein of the spring virus blood layer (SVC) of the carp; And membrane-associated proteins, tegumin or capsid proteins or glycoproteins of channel catfish virus (CCV).

Polypeptides of bacterial pathogens include, but are not limited to, for example, iron-regulated outer membrane proteins (IROMP), outer membrane proteins (OMP), and A-proteins, bacterial kidney disease of Aeromony salmonisid, which causes boils. P57 protein of Lenibacterium salmoninarum that causes (BKD), major surface related antigen (msa) of Yersinosis, cytotoxin (mpr) expressed on the surface, hemolysin (ish) expressed on the surface, and plastic Gel antigens; Extracellular proteins (ECP), iron-regulated outer membrane proteins (IROMP), and structural proteins of Pasteurelosis; OMP and flagella proteins of Vibrios anguillalum and V. Ordali; Flagella protein, OMP protein, aroA, and purA of Edwards cielosis italuri and E. tarda; And surface antigens of Icthyopthyrius; And cytoplasmic structural and regulatory proteins of columnari; And Rickettsia's structural and regulatory proteins.

Examples of polypeptides of parasitic pathogens include, but are not limited to, surface antigens of Icthyopthyrius.

In another aspect of the invention, a vaccine composition suitable for use in a method of preventing and / or attenuating a disease or condition caused or exacerbated by a "self" gene product (eg tumor necrosis factor) is provided. Accordingly, the compositions of the present invention include compositions that produce antibodies that prevent and / or attenuate diseases or conditions caused or exacerbated by "self" gene products. Examples of diseases or conditions include, but are not limited to, graft-versus-host disease, IgE-mediated allergic reactions, anaphylaxis, adult respiratory distress syndrome, Crohn's disease, allergic asthma, acute lymphocytic leukemia (ALL), non-Hodgkin's lymphoma (NHL) , Graves' disease, systemic lupus erythematosus (SLE), inflammatory autoimmune disease, myasthenia gravis, immunoproliferative disease lymphadenopathy (IPL), angioimmune lymphadenopathy (AIL), immunoblast lymphadenopathy (IBL), rheumatoid Arthritis, diabetes, multiple sclerosis, Alzheimer's disease and osteoporosis.

In one particular aspect, the compositions of the present invention are autoimmune therapeutics that can be used for the treatment and / or prevention of allergy, cancer or drug addiction.

The selection of antigens or antigenic determinants for use in the manufacture of compositions and in the treatment of allergies is known to those skilled in the medical arts for treating such diseases. Representative examples of antigens or antigenic determinants are as follows: bee venom phospholipase A2; Amb a 1 (Pulverum pollen allergens), Bet v I (Birch pollen allergens); 5 Dol m V (white faced bumblebee bee venom allergen); Der p 1, Derf 2 and Der 2 (house dust mite allergens); Lep d 2 (dust mite allergen); Alt a 1, Aspf 1, and Aspf 16 (fungal allergens); Ara h 1, Ara h 2, and Ara h3 (peanut allergen) and each fragment capable of inducing an immune response. In addition, the present invention is useful for use as an allergen mixture that is separated by a organism or part of a organism, such as pollen extract or bee venom.

In a preferred embodiment, the pollen extract comprises or otherwise consists of trees, grasses, weeds, and garden plants. Examples of tree pollen extracts include, but are not limited to: acacia, alder (gray), almonds, apple trees, apricots, life waters, aspen, aspen, laurel, beech, birch (spring), Birch (white), horsetail, four-leaf maple, ratwood, cedar (but not limited to Japanese cedar), cherry, chestnut, cottonwood, cypress, urinal, elm (American), eucalyptus, Fir, Hackberry, Hemlock, Hickory, Hop-Honbeam, Hardwood, Hyacinth, Acacia, Maple, Melaleuca, Mesquite, High-Made, Clerium, Oak (White), Olive, Orange, Osage Orange, Palo Verde , Peaches, pears, peptide trees, pines, plums, poplars, pellets, redwoods, Russian olives, firs, sweet gums, figs, larch, leathers, walnuts and willows. Examples of grass pollen extracts include, but are not limited to: bahia, barley, beach, sedge, veranda glass, blue glass (Kentucky), bromine, bunch, canary glass. , Chess, corn, steaming grass, grammar, johnson, semi-glass, koeler's, oats, ducklings, earrings, poisonous (perennial), salt, sugarcane, sudan, sweet verna glass, timothy glass , Velvet glass, wheat and wheat wheat. Examples of weed and garden plant extracts include, but are not limited to: alfalfa, amaranth, astrocytes, balsam roots, bassia, beach thorns, broomwood, burrow bush, Careless weed, careless weed, cauliflower seed, chamise, clover, burdock, big cock, cosmos, narcissus, dahlia, daisy, dandelion, swimming, dog fennel, fireweed, gladiolus, maize Tusk, hemp, honeysuckle, hop, iodon bush, jerusalem oak, cocoa, nectar, lily, marigold, chrysanthemum, mexican tee, mugwort, mustard, nettle, pickleweed, nectarine, plaintain ), Poppy, Forever Weed, Quailbush, Urticaria (large), Urticaria (small), Urticaria (west), Rose, Russian thistle, Wild mugwort, Saltbrush, Arin, Scotch broom ), Sea blight, baby swimming, snapdragon, sugar beet, sea Rather, the Western ginseng, winter fat, worm-seed, dabukssuk.

In a preferred aspect, the pollen extract comprises or alternatively consists of rye.

The emergence of seasonal diseases of the urticaria pollen (September-October) induces asthma in several individuals (Marshall, J. et al., J: Allergy Clin. Immunol. 108: 191-197 (2001)). Asthma is characterized by pulmonary inflammation, reversible airflow blockage, and airflow hyperresponsiveness. Leukocytes are reinforced in the airways by a complex cascade of immune responses to atmospheric allergens. In particular, lymphocytes, macrophages, eosinophils, neutrophils, plasma cells, and mast cells infiltrate the bronchial mucosa (Redman, T. et al., Exp. Lung Res. 27: 433-451 (2001)). Eosinophilic reinforcement is associated with increased production of TH2 cytokines IL-4 and IL-5, which are important factors in the asthma process that supports chronic inflammatory processes (Justice, J. etal., Am. J Physiol. Lung cell Mol. Physiol. : L302-L309 (2002), incorporated herein by reference in its entirety). The predominant hives allergen in the short urticaria (Pigweed (Ambrosia Artemisiapolia)) is Amb a 1 (Santeliz, J. et al., J. Allergy Clin. Immunol. 109: 455-462 (2002)) . In certain aspects of the invention the composition comprises Amb a 1 mixed with virus-positive particles (Example 6).

In another preferred aspect, the dust extract comprises or otherwise consists of house dust and dust mites. Examples of house dust include, but are not limited to, house dust, mattress dust, and carpet dust. Examples of dust mites include, but are not limited to, D. parnia, D. prunonisiaus, mite mix, and L. destructor. Dust extracts also include, but are not limited to, cedar and cedar dust, gin cotton dust, oak dust, grain (grain grain), rosewood dust and wood dust.

Dust mites are an important source of perennial home allergens present in the humid climate homes of developed countries (Arlian, L., Current Allergy and Asthma Reports I: 581-586 (2001)). About 60-85% of all patients with bronchial asthma are susceptible to house dust mite dermatopogoldes pteronisus (Arlian, L., Current Allergy and Asthma Rep orts I: 581-586 (2001)). Immunodominant D. pteronicin dust mite allergens include Der p 1, Der f 2, and Der 2 (Kircher, M. et al., RAllergy Clin. Immunol. 109: 517-523 (2002) and Clarke, A. et al., Int. Arch. Allergy ImmunoL 120: 126-134 (1999), incorporated herein by reference in its entirety). In certain aspects of the invention the composition comprises Der p1, Derf 2, Der 2 or a fragment thereof, or an antigen mixture thereof, mixed with virus-positive particles. An important factor for allergic reactions to dust, especially in agricultural societies, is Repidoglypus destructor (Ericksson, T. et al., Clinical and Exp. Allergy 31: 1181-1890 (2001)). The immune predominant L. destructor dust mite allergen is Lep d 2 (Ericksson, T. et al., Clinical and Exp. Allergy 31: 1181-1890 (2001)). In certain aspects of the invention the composition comprises Lep d 2 mixed with virus-positive particles (see Example 8).

 In a preferred embodiment, the fungal extract may be alternaria, aspergillus, botrytis, candida, cephalosporium, cephalo tecisium, caetorium, cladosporium, critococcus, kurburaria, epi Cocum, Epidermophyton, Fusarium, Gelasinospora, Geotricum, Glyclodium, Helmintosporium, Hormodendrum, Microsporium, Mucor, Mycogon, Nigraspora, Paesiromai Seth, Penicillium, Poma, Pullularia, Rifupus, Rhodorura, Rust, Saccharomyces, Smooth, Spondillocladium, Stampyrium, Trichoderma, Trichophyton and Vertisil Include, or otherwise consist of.

Alemaria alenata is recognized as one of the most important fungi for causing allergic diseases in the United States. Alternaria is a major asthma-related allergen in deserts in the United States and Australia and has been reported to cause severe respiratory arrest and death in the Midwest of the United States (Vailes, L. et al., J Allergy Clin. Immunol. 107: 641 (2001). and Shampain, M. et al., Am. Rev. Respir. Dis. 126: 493-498 (1982), incorporated herein by reference in its entirety). The immunodominant Alternaria alenata antigen is Alt a 1 (Vailes, L. et al., J Allergy Clin. Immunol. 107: 641 (2001)). More than 80% of Alternaria-sensitive individuals have Ig E antibodies against Alt a 1 (Vailes, L. et al., Clinical and Exp. Allergy 31: 1891-1895 (2001)). In a particular aspect of the invention the composition comprises Alt a 1 mixed with virus-positive particles (see Example 7). Another opportunistic fungus is Aspergillus pumigatus, which is involved in a wide range of lung diseases, such as allergic asthma. Immunodominant Aspergillus pumigatus antigens include Aspf 1 and Aspf 16 (Vailes, L. et al., J. Allergy Clin. Immunol. 107: 641 (2001)). In certain aspects of the invention the composition comprises Aspf 1 and Aspf 16 or an antigen mixture thereof mixed with virus positive particles (see Example 7).

In another preferred embodiment, the insect extract comprises or otherwise consists of a stinging insect in which the whole body of the insect induces an allergic reaction, a stinging insect in which the poison protein of the insect induces an allergic reaction, an insect inducing an inhalation allergic reaction . Examples of stinging insects whose whole body induces allergic reactions include, but are not limited to, (black) ants, (red) ants, (carpenter) ants, (black / red) hybrid ants, (fire) ants It includes. Examples of stinging insects whose insect proteins induce allergic reactions include, but are not limited to, bees, yellow bumblebees, wasps, yellow jackets, white-faced hornets Includes mixed wasp. Examples of insects that induce inhalation allergic reactions include, but are not limited to, aphids, aphids, butterflies, fly, cicada / locust, crickets, wheels, fleas, deer fly, fruit flies, bees ( Whole body), horsefly, housefly, cicada, mayfly, mexican bean weevil, (dust) mite, mosquito, moth, mushroom fly, helix magnolia fly, juvenile, spider and daphnia. (See Example 4)

In another preferred embodiment, the food extract comprises or alternatively consists of an animal product or a vegetable product. Examples of animal products include, but are not limited to, cattle, chickens, ducks, deer, ducks, eggs (chicken), fish, goats, geese, sheep, milk (cows), milk (goats), pigs, rabbits, shellfish And turkeys. Examples of vegetable products include, but are not limited to, apples, apricots, arrowroot, artichoke, asparagus, avodaco, bananas, beans, beets, berry, cabbage, carrots, celery , Chocolate, citrus fruit, coconut, coffee, cucumber, date palm, eggplant, grains, grapes, vegetables, gum, hops, lettuce, malt, mango, melon, mushrooms, nuts, okra, olives, onions, papaya, parsnips, Peas, peanuts, pears, pimentos, pineapples, plums, potatoes, dried plums, zucchini, radish, rhubarb, spices / seasonings, spinach, squash, tapioca, tea, tomatoes, watermelons and yeast.

Allergy to peanuts and tree nuts causes most fatal and almost fatal anaphylactic reactions (Sampson, H., N. Engl. J Med. 346 (17): 1294-1299 (2002)). About 1.1% of Americans or 3 million people are allergic to peanuts, tree nuts, or both (Sampson, H., N. Engl. J Med. 346 (17): 1294-1299 (2002)). About 6% of Americans have serological evidence that they are susceptible to peanuts (ie, the presence of IgE antibodies specific for peanut proteins), but most people will not develop an allergic reaction when they eat peanuts (Sampson, H. , N. Engl. J. Med. 346 (17): 1294-1299 (2002) and Helm, R et al., J. Allergy Clin. Immunol. 109: 136-142 (2002)). Peanut allergy usually occurs after exposure to peanut protein mainly in the uterus, at lactation, or early in childhood and is a lifelong disease (Sampson, H., N. Engl. J. Med. 346 (17): 1294-1299 (2002); Li, X et al., J. Allergy Clin. Immunol 108: 639-646- (2001) and Helm, R et al., J. Allergy Clin.Imunmun. 109: 136-142 ( 2002)). Infants with peanut allergy have a more severe allergic reaction as they age (Sampson, H., N. Engl. J. Med. 346 (17): 1294-1299 (2002)). Promoting the sale of peanut products as a nutritional source for pregnant and lactating women has led to widespread use of peanut allergy in western countries (Sampson, H., N. Engl. J. Med. 346 (17): 1294-1299 (2002)). .

Peanut allergy symptoms can occur within minutes to hours after ingesting food and, if life-threatening, symptoms include severe bronchial spasms. Currently, Ming teaches his family how to avoid accidental peanut intake as a treatment for peanut allergy, how to recognize early symptoms of allergic reactions, and how to manage the early stages of an anaphylactic reaction (Sampson, H., N. Engl. J. Med. 346 (17): 1294-1299 (2002). Incidental exposure causes an allergic reaction every 3 to 5 years in the average patient with peanut allergy (Sampson, H ., N. Engl. J. Med. 346 (17): 1294-1299 (2002). These accidental exposures include peanut contamination of equipment used in the manufacture of various products, labeling of inappropriate foods, cooking in restaurants. May occur as a result of cross-mixing of food, food, and unexpected exposure (e.g. inhalation of peanut dust in airplanes (Sampson, H., N. Engl. J. Med. 346 (17): 1294-1299 (2002)). Currently, methods for treating acute reactions to peanuts include intramuscular epinephrine; Intensive treatment with oral, intramuscular, or intravenous histamine H1 and H2-receptor antagonists; oxygen; inhaled albuterol; and systemic corticosteroids (Sampson, H., N. Engl. J. Med. 346 ( 17) 1294-1299 (2002) It is also recommended to use oral prednisone and antihistamine for three days after an acute response to peanut, depending on the severity, prevalence of peanut allergy, and frequent persistence throughout life. Prophylactic or therapeutic regimens are needed (Sampson, H., N. Engl. J. Med. 346 (17): 1294-1299 (2002)).

Two important allergic peanut proteins that are recognized by more than 95% of patients with peanut allergy are Ara h1 and Ara h2 (Bannon, G. et al., Int. Arch. Allergy Immunol 124: 70-72 (2001). and Li, X et al., J. Allergy Clin Immunol 106: 150-158 (2000), incorporated herein by reference in its entirety). Ara h3 is recognized by at least 45% of patients with peanut allergy (Li, X et al., J. Allergy Clin Immunol 106: 150-158 (2000). In one preferred embodiment of the invention the composition is a virus positive particle Antigens Ara h1, Ara h2 or Ara h3 or antigen mixtures thereof mixed with (see Example 5).

In another preferred aspect, the epidermal antigens of mammals include, but are not limited to: camel, cat's fur, cat's fur, chinchilla, cattle, deer, dog, gerbilus, goat, guinea pig, hamster , Pig, horse, mohair, monkey, mouse, rabbit, sheep (goat). In another preferred example, feathers include, but are not limited to canaries, chickens, ducks, geese, macaws, pigeons, turkeys. In another preferred aspect, other inhalation factors, including but not limited to acacia, algae, castor seed, cotton swab, cottonseed, deris root, fern spores, grain dust, hemp fiber, hemer, flaxseed, guar gum, jute, Karaya gum, kefirpok, leader, lychee, Oris root, wormwood, silk (raw), sisal, tobacco leaves, trakant and wood dust.

Another preferred aspect includes conventionally defined mammalian allergens extracted or recombinantly expressed from natural sources. This includes, but is not limited to, Fel d 1, Fel d 3 (cistatin) from cats and cats, camels, chinchillas, cattle, deer, dogs, gerbils, goats, guinea pigs, hamsters, pigs, horses, mohairs , Albumin from monkey, mouse, rabbit, sheep (goat).

The selection of antigens or antigenic determinants for compositions and methods for the treatment of cancer is well known to those skilled in the medical arts for treating the disease (see Renkvist et al., Cancer. Immunol. Immunother. 50: 3-15). 2001, cited by reference), such antigens or antigenic determinants are included within the scope of the present invention. Examples of representative antigens or antigenic determinant types are as follows: Her2 (breast cancer); GD2 (neuroblastoma); EGF-R (malignant glioblastoma); CEA (medulla thyroid cancer); CD52 (leukemia); Human melanoma protein gap100; Human melanoma protein gap100 epitopes, such as amino acids 154-162 (SEQ ID NO: KTWGQYWQV, SEQ ID NO: 72), 209-217 (ITDQVPFSV, SEQ ID NO: 73), 280-288 (YLEPGPVTA, SEQ ID NO: 74), 457- 466 (LLDGTATLRL, SEQ ID NO: 75) and 476-485 (VLYRYGSFSV, SEQ ID NO: 76); Human melanoma protein melan- A / MART-1; Human melanoma protein melan-A / MART-1 epitopes, such as amino acids 26-35 (EAAGIGILTV) (SEQ ID NO: 98), 26-35AL (ELAGIGICTV, SEQ ID NO: 99), 27-35 (AAGIGILTV, SEQ ID NO: 77) and 32-40 (ILTVILGVL, SEQ ID NO: 78); Tyrosinase and tyrosinase related proteins (eg TRP-1 and d TRP-2); Tyrosinase epitopes such as amino acids 1-9 (MLLAVLYCL, SEQ ID NO: 79) and 368-376 (YMDGTMSQV, SEQ ID NO: 80); NA17-A nt protein; NA17-A nt protein epitopes as examples amino acids 38-64 (VLPDVFIRC, SEQ ID NO: 81); MAGE-3 protein; MAGE-3 protein epitopes, such as amino acids 271-279 (FLWGPRALV, SEQ ID NO: 82); Other human tumor antigens, such as CEA epitopes, such as amino acids 571-579 (YLSGANLNL, SEQ ID NO: 83); p53 protein; p53 protein epitopes, such as amino acids 65-73 (RMPEAAPPV, SEQ ID NO: 84), 149-157 (STPPPGTRV, SEQ ID NO: 85) and 264-272 (LLGRNSFEV, SEQ ID NO: 86); Her2 / neu epitopes, such as amino acids 369-377 (KIFGSLAFL, SEQ ID NO: 87) and 654-662 (IISAVVGIL, SEQ ID NO: 88); HPV16 E7 protein; HPV16 E7 protein epitopes, such as amino acids 86-93 (TLGIVCPI, SEQ ID NO: 89); And each fragment or mutant that can be used to induce an immune response.

The selection of antigens or antigenic determinants for compositions and methods for the treatment of other diseases or conditions associated with autoantigens is well known to those skilled in the medical field of treating such diseases. Representative examples of such antigens or antigenic determinants include lymphotoxins (eg, lymphotoxin α (LTα), lymphotoxin β (LTβ)), and lymphotoxin receptors, receptor activators of nuclear factor kappaB ligands (RANKL), osteoclasts Related receptors (OSCAR), vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGF-R), interleukin 17 and amyloid beta peptides (Aβ _1-42 ), TNFα, MIF, MCP-1, SDF-1 , Rank-L, M-CSF, Angiotensinogen, Angiotensin I, Angiotensin II, Endoglin, Eotaxin, Grehilin, BLC, CCL21, IL-13, IL-17, IL-5, IL-8, IL -15, bridykinin, lecithin, LHRH, GHRH, GIH, CRH, TRH and gastrins, and each fragment that can be used to induce an immune response.

In certain aspects of the invention the antigen or antigenic determinant is selected from the group consisting of: (a) a recombinant polypeptide of HIV; (b) a recombinant polypeptide of influenza virus (eg, influenzavirus M2 polypeptide or fragment thereof); (c) recombinant polypeptides of hepatitis C virus; (d) recombinant polypeptides of hepatitis B virus; (e) recombinant polypeptides of toxoplasma; (f) recombinant polypeptides of Plasmodium falciparum; (g) a recombinant polypeptide of Plasmodium vibox; (h) recombinant polypeptides of Plasmodium obale; (i) recombinant polypeptides to plasmid malaria; (j) recombinant polypeptides of breast cancer cells; (k) recombinant polypeptides of kidney cancer cells; (l) recombinant polypeptides of prostate cancer cells; (m) recombinant polypeptides of skin cancer cells; (n) recombinant polypeptides of brain cancer cells; (o) recombinant polypeptides of leukemia cells; (p) recombinant profiling; (q) recombinant polypeptides of bee sting allergy; (r) a recombinant polypeptide of nut allergy; (s) pollen recombinant polypeptides; (t) house-dust recombinant polypeptides; (u) recombinant polypeptides of cat or cat hair allergy; (v) recombinant proteins of food allergy; (w) asthma recombinant proteins; (x) chlamydia recombinant protein; (y) antigens extracted from any of the protein sources mentioned in (a-x) above; And (z) fragments of any of the proteins described in (a)-(x).

In another aspect of the invention, the antigen mixed with an immunostimulatory substance, immunostimulatory nucleic acid or unmethylated CpG-containing oligonucleotide and a virus-positive particle packed with is a T cell epitope or a cytotoxic or Th cell epitope. In another aspect of the invention, the antigen mixed with the immuno-stimulatory material, immunostimulatory nucleic acid or unmethylated CpG-containing oligonucleotide packed with virus-positive particles is a B cell epitope. In a further aspect the antigen is a combination of at least two preferably different epitopes in which at least two epitopes are linked directly or by a linking sequence. These epitopes are preferably selected from the group consisting of cytotoxic and Th cell epitopes.

The antigens of the present invention, and in particular the epitopes or epitopes mentioned above, can be synthesized or recombinantly expressed using recombinant DNA techniques and coupled or fused to virus-positive particles. Exemplary methods for describing binding antigens to virus-positive particles are described in WO 00/32227, WO01 / 85208 and WO 02/056905, which are incorporated herein by reference in their entirety.

The present invention also provides a composition for enhancing an immune response in an animal comprising an unmethylated CpG-containing oligonucleotide bound to VLP and VLP, comprising incubating the VLP and oligonucleotide, adding RNase and purifying the composition. Provide a way to. In an equally preferred aspect, the method comprises incubating the VLP and RNase, adding oligonucleotides and purifying the composition. In one example, VLPs are produced in bacterial expression systems. In another embodiment, the RNase is RNase A.

The present invention further provides a composition for enhancing an immune response in an animal comprising a VLP and an unmethylated CpG-containing oligonucleotide bound to the VLP comprising disassembling the VLP, adding an oligonucleotide and reassembling the VLP. Provide a way to. The method may further comprise removing the nucleic acid of the at least partially disassembled VLPs and / or purifying the composition after assembly.

The invention also provides a vaccine composition that may be useful for preventing and / or attenuating a disease or condition. The vaccine composition of the present invention comprises or otherwise consists of an immunologically effective amount of the immune enhancing composition of the present invention together with a pharmaceutically acceptable diluent, carrier or excipient. The vaccine may optionally include an adjuvant.

The present invention further provides a vaccination method for preventing and / or attenuating a disease or condition in an animal. In one aspect, the present invention provides vaccines for preventing infectious diseases in a wide range of animal species, particularly mammalian species, such as humans, monkeys, cattle, dogs, cats, horses, pigs and the like. Vaccines include infections of viral etiologies, such as HIV, influenza, herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, papilloma virus and the like; Or infections of bacterial etiologies such as pneumonia, tuberculosis, syphilis, and the like; Or parasitic etiology infections, for example, malaria, wave flagellosis, Rischman's flagellitis, vaginal flagellosis, amoebiasis and the like.

In another aspect, the present invention provides a vaccine for preventing cancer in a wide range of animal species, particularly mammalian species, such as humans, monkeys, cattle, dogs, cats, horses, pigs, and the like. Without limitation, it can be designed to treat all forms of cancer, including lymphomas, carcinomas, sarcomas, and melanoma.

As will be appreciated by those skilled in the art, when administering a composition of the invention to an animal, it may be a composition comprising salts, buffers, adjuvants or other materials that may be desirable to improve the efficacy of the composition. Examples of materials suitable for use in preparing pharmaceutical compositions are provided from several sources, including REMINGTON'S PHARMACEUTICAL SCIENCES (Osol, A, ed., Mack Publishing Co., (1990)).

Depending on the host species, various adjuvants may be used to increase the immunological response and include, but are not limited to, Freunds (complete and incomplete), inorganic gels such as aluminum hydroxide, surfactants such as lysolecithin, pluron polyol Human adjuvant, including BCG ( bacille Calmette and Corynebacterium parvum ), including polyanions, peptides, oil emulsions, keyhole limfetemocyanines, dinitrophenols Such adjuvants are well known in the art Additional adjuvants that may be administered with the compositions of the present invention include, but are not limited to, monophosphoryl lipid immunomodulators, AdjuVax100a, QS-21, QS-18, CRL1005, aluminum salt (Alum), MF-59, OM-174, OM-197, OM-294, and Virosomal adjuvant techniques.

The adjuvant may also include a mixture of these materials.

Immunologically active saponin fractions having adjuvant activity derived from the bark of South American tree Kirya saponin mona are known in the art. For example QS21, also known as QA21, is an Hplc purified fraction derived from Kiriya saponin mori tree, the production method of which is U. S. Pat. No. 5, 057, 540 (described as QA21). Kiriya saponins are described in Scott et al, Int. Archs. It is also described as an adjuvant by Allergy Appl. Immun., 1985, 77, 409. Monosporyl lipid A and its derivatives are known in the art. Preferred derivatives are 3 de-o-acylated monophosphoryl lipid A, British Patent No. Known from 2220211. Further preferred adjuvants are described in WO00 / 00462, which is incorporated herein by reference in its entirety.

The composition of the present invention is considered to be "pharmaceutically acceptable" when each of the beneficiaries becomes resistant by administration of the composition of the present invention. In addition, the compositions of the present invention will be administered in a "therapeutically effective amount" (ie, an amount that results in a desired physiological effect).

The compositions of the present invention can be administered by a variety of methods known in the art. The particular mode chosen will depend upon the particular composition chosen, the severity of the condition to be treated and the dosage required for therapeutic efficacy. Generally speaking, the methods of the present invention can be carried out using a medically acceptable mode of administration, which means a way of expressing an effective level of the active compound without clinically unacceptable side effects. The mode of administration may be oral, rectal, parenteral, intraracistemal, intravaginal, intraperitoneal, topical (by powder, ointment, drop or transdermal patch), bucal, or oral or nasal spray It includes. As used herein, “parenteral” refers to a mode of administration, including intravenous, intramuscular, intraperitoneal, intratracheal, subcutaneous and intraarticular injection and infusion. Compositions of the invention can also be injected directly into lymph nodes.

Components of the composition for administration include sterile water (eg physiological saline) or insoluble solutions and suspensions. Examples of water-insoluble solvents include propylene glycol, polyethylene glycol, vegetable oils as olive oil, and injectable organic esters as ethyl oleate. Carriers or carriers for hermetic dressings can be used to enhance skin permeability and increase antigen adsorption. The blend is, for example, simultaneously or simultaneously but separately as a mixture; Or sequentially. This includes presentations where the formulations are administered together as a therapeutic mixture, and how the formulations are administered simultaneously but separately, for example, via separate venous lines into the same individual. Further "combined" administration includes separately administering one of the compounds or agents administered first, followed by the second. Dosage depends on the mode of administration, the condition of the subject and the quality of the carrier / adjuvant formulation. Typical amounts range from about 0.001 μg to about 20 mg per subject. Preferred amounts are at least about 1 μg to about 100 μg per subject. Multiple administrations are preferred for immunizing a subject and the protocol is the standard in the field of application to the subject. Typical amounts of antigens are those comparable to, similar to, or consistent with those typically used for administration without the addition of VLP's.

The compositions may conveniently be presented in unit dosage form and may be prepared by methods well known in the art of pharmacy. Preparing a composition of the present invention with a carrier consisting of one or more accessory ingredients. In general, the compositions make the compositions of the invention together with liquid carriers, finely divided solid carriers, or both, to form the product, if necessary, uniformly and intimately.

Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets or lozenges, each comprising a predetermined amount of the composition of the present invention. Other compositions include aqueous liquid suspensions or water-insoluble liquids such as syrups, excirs or emulsions.

Other dosage systems include time-release, delayed release or sustained release dosage systems. The system can avoid repeated administration of the compositions of the present invention as described above while at the convenience of the subject and physician. Various forms of release dosage systems are available and known to those skilled in the art.

Another aspect of the invention includes a method of making a composition of the invention and a method of medically treating cancer and allergies using the composition.

Thus, the present invention relates in particular to the discovery that unmethylated C and G-rich DNA oligonucleotides (CpGs) and viral sheep particles (VLPs) can be loaded and packed, respectively. When CpG-VLPs were mixed with antigens, the immunity of these antigens increased significantly. In addition, T cell responses to the antigens were particularly directed to Th1 type. Surprisingly, covalent binding of antigen and VLP was not required, but was sufficient to simply mix VLPs and adjuvant for co-administration. In addition, VLPs did not enhance the immune response when not loaded and packed with CpGs, respectively. Thus, antigens mixed with CpG-packed VLPs may be ideal vaccines for vaccination for the prevention or treatment of allergies, tumors and other magnetic molecules and chronic viral diseases.

In a further aspect, the present invention (a) incubating the virus-positive particles with an immunostimulatory material; (b) adding RNase; (c) providing a method for preparing a composition for enhancing an immune response in an animal comprising the virus-positive particle and the immunostimulatory material packed in the virus-positive particle, comprising purifying the composition.

In a further aspect, the present invention provides a method for the preparation of (a) incubating virus-positive particles with RNase; (b) adding an immunostimulatory substance; (c) providing a method for preparing a composition for enhancing an immune response in an animal comprising the virus-positive particle and the immunostimulatory material packed in the virus-positive particle, comprising purifying the composition.

In a further aspect the present invention provides a method for the preparation of (a) disassembling virus-positive particles; (b) adding an immunostimulatory substance; (c) a method for preparing a composition for enhancing an immune response in an animal comprising a virus-sheep particle comprising reassembling the virus-sheep particle and an immunostimulatory material packed in the virus-sheep particle. In another aspect, the method for preparing a composition for enhancing an immune response in an animal according to the invention further comprises removing nucleic acid of the disassembled virus-positive particles. In another aspect, a method for preparing a composition for enhancing an immune response in an animal according to the invention further comprises purifying the composition after assembly (c).

In yet another aspect, the present invention provides a method for preparing a virus-inducing particle comprising: (a) incubating the virus-positive particle with a solution comprising metal ions capable of hydrolyzing the nucleic acid of the virus-positive particle; (b) adding an immunostimulatory substance; (c) providing a method for preparing a composition for enhancing an immune response in an animal comprising the virus-positive particle and the immunostimulatory material packed in the virus-positive particle, comprising purifying the composition. Preferably, the metal ions capable of hydrolyzing the nucleic acid of the virus-positive particles are (a) zinc (Zn) ions; (b) copper (Cu) ions; (c) iron (Fe) ions; (d) a mixture of at least one of (a), (b) and / or (c).

In a method for preparing a composition for enhancing an immune response in an animal according to the invention, as mentioned above, the immunostimulatory immunostimulatory material comprises (a) ribonucleic acid, preferably poly- (I: C) or a derivative thereof; (b) oligonucleotides lacking deoxyribonucleic acids, preferably unmethylated CpG motifs, and even more preferably unmethylated CpG-containing oligonucleotides; (c) chimeric nucleic acids; And (d) a mixture of at least one nucleic acid of (a), (b) and / or (c), or alternatively an immunostimulatory nucleic acid selected from the group consisting essentially.

In another preferred aspect of the method of preparing a composition for enhancing an immune response in an animal according to the invention, as mentioned above, the virus-positive particles are produced in a bacterial or mammalian expression system, and in a further preferred aspect, RNase is RNaseA.

The following examples are for illustrative purposes only and are not intended to limit the invention as defined in the claims. Those skilled in the art can readily understand the appropriate modifications and adjustments to the methods and applications described herein and can be performed without departing from any of the examples or of the invention. Accordingly, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the claims and their equivalents.

All patents, patent applications, and publications cited herein are hereby incorporated by reference.

Example 1

VLPs Manufacturing

The DNA sequence of HBcAg comprising peptide p33 from LCMV is set forth in SEQ ID NO: 70. p33-HBcAg VLPs (p33-VLPs) were prepared as follows: Hepatitis B clone pEco63, which contains the complete viral genome of hepatitis B virus, was purchased from ATCC. The preparation of expression plasmids has been described above (see WO 03/024481).

Selected E. coli K802 for good expression was transfected with plasmids and cells were transfected with 5 ml lysis buffer (10 mM Na ₂ HP0 ₄ , 30 mM NaCl, 10 mM EDTA, 0.25% Tween-20, pH 7.0). Incubated and resuspended. 200 μl of lysozyme solution (20 mg / ml) was added. After sonication, 4 μl Benzonase and 10 mM MgCl ₂ were added and the suspension was incubated at RT for 30 minutes, centrifuged at 15,000 rpm for 15 minutes at 4 ° C. and the supernatant was maintained. 20% (w / v) (0.2 g / ml lysate) ammonium sulfate was then added to the supernatant. Incubate on ice for 30 minutes and centrifuge at 20,000 rpm for 15 minutes at 4 ° C., then discard the supernatant and resuspend the pellet in 2-3 ml PBS. 20 ml of PBS-solution were loaded on a Sephacryl S-400 gel filtration column (Amersham Phannacia Biotechnology AG), the fractions were loaded on an SDS-Page gel and the fractions with purified p33-HBcAg VLP capsid were pooled. The pooled fractions were loaded on a Hydroxyappatite column. Flow through (including purified p33-HBcAg VLP capsid) was harvested. Electron microscopy was performed according to standard protocols. Representative examples are described in Storni T., et al. , (2002) J Immunol. ; 168 (6): 2880-6].

 It should be noted that VLPs comprising peptide p33 can be used merely for convenience and wild type VLPs can similarly be used in the present invention. Throughout this specification the terms p33-HBcAg VLP, HBcAg-p33 VLP, p33-VLPs and HBc33 are used interchangeably. In particular, the VLPs used in Examples 1-4 are p33-HBcAg VLPs.

Example 2

CpG-containing oligonucleotides may be packed into HBcAg VLPs.

Recombinant VLPs prepared as described in Example 1 were transferred on native agarose (1%) gel electrophoresis and stained with ethidium bromide or Coomassie blue for RNA / DNA or protein detection (FIG. 1). . Bacterial producing VLPs contain high levels of single stranded RNA, which are expected to bind to arginine repeats appearing around the C-terminus of the HBcAg protein and located within the VLPs as shown in X-ray crystallography. Contaminating RNA can be readily degraded, which can be removed by incubating VLPs with RNase A. The molecular weight of the highly active RNase A enzyme is about 14 kDa and is expected to be small enough to enter VLPs to remove undesirable ribonucleic acids.

Recombinant VLPs were supplemented with CpG-rich oligonucleotides prior to digestion with RNase A (see SEQ ID NO: 69). As shown in FIG. 2, the presence of CpG-oligonucleotides maintained the capsid structure as shown similar migration compared to untreated p33-VLPs. CpG-oligonucleotide containing VLPs were purified from oligonucleotides that failed to bind by dialysis (4500 fold dilution in PBS for 24 hours using a 300 kDa MWCO dialysis membrane) (see Figure 3).

Example 3

CpG-containing oligonucleotides can be packed into VLPs by removing RNA with RNAse and subsequently packing oligonucleotides into VLPs.

VLPs (comprising bacterial single-stranded RNA and prepared as described in Example 1) were first incubated with RNaseA to remove RNA and in the second step (phosphothioate at normal phosphodiester site and phosphate backbone) Immune stimulating CpG-oligonucleotides (with modifications) were supplemented to the samples (FIG. 4). This experiment clearly shows that CpG-oligonucleotides can be added later rather than absolutely required at the same time for RNA degradation.

Example 4

VLPs comprising CpG-oligonucleotides induce a potent IgG response against co-administered bee toxins.

VLPs prepared as described in Example 1 were used for this experiment. 5 μg of bee venom (ALK Abello) alone or in combination with one of the following was given subcutaneously to mice: 50 μg VLPs alone, 50 μg VLPs each loaded and packed with CpG-oligonucleotides or 20 nmol CpG- oligonucleotides 50 μg VLPs. Alternatively mice were given 5 μg of bee venom mixed with VLP loaded and packed with CpG-oligonucleotides alone with 50 μg VLP or with aluminum hydroxide. After 14 days, the same vaccine formulation was boosted into mice and bled on day 21. From day 21, bee venom specific IgG responses were assessed by ELISA. VLPs treated with RNase A derived from HBcAg accompanying CpG-rich DNA (normal phosphodiester sites) and dialyzed from unbound CpG-oligonucleotides were effective in enhancing IgG responses to bee venom allergens (BV) . As shown in FIG. 5, the presence of free CpGs or VLPs loaded and packed with CpGs, respectively, markedly enhanced the IgG response to bee venom. VLPs without CpGs did not enhance the immune response. In addition, the presence of Alum as an adjuvant increased the IgG response. When IgG subclasses were measured (FIG. 6), CpG-packed VLPs shifted from IgG1 predominance to IgG2a predominance, demonstrating that the Th1 response was used. Interestingly, the presence of Alum enhanced Th2-related isotypes. Thus, high titers of IgG were obtained by adding CpG-packed VLPs in Alum to bee venom, but the reaction was still predominant by IgG1. Importantly, CpGs packed in VLPs had similar efficacy as free CpGs in enhancing IgG responses to bee venom in the presence or absence of Alum, but none of them showed signs of systemic immune activation (FIG. 7). Specifically, vaccination of mice in the presence of free CpGs induced splenomegaly with spleens with an increased total lymphocyte count up to four times, whereas CpGs packed in VLPs did not increase total lymphocyte counts.

Example 5

VLPs Used Against Peanut Allergy

In Examples 5 to 8 below, the used VLPs use Qβ core particles (SEQ ID NO: 1) packed with G10-PO (SEQ ID NO: 122). Five-week old female C3H / HeJ mice were sensitized for peanuts by feeding 5 mg of fresh peanuts roasted with 10 μg of cholera toxin on day 0 into the stomach. Mice were boosted after 1 and 3 weeks. VLP mixed with 10 mg crude peanut extract, VLP mixed with 5 μg Ara h 1, VLP mixed with 5 μg Ara h 2, VLP mixed with 5 μg Ara h 3 in mice 1 week after the final sensitization administration, Or 5 μg of VLPs mixed with each of Ara h 1, Ara h 2 and Ara h 3. Naive mice, mice that received only VLP, mice that received only 10 mg of crude peanut extract, or mice that received VLP mixed with 5 μg of irrelevant antigen were used as controls.

ELISA was used to measure the level of peanut-specific IgE. IgE antibodies specific for Ara h 1, Ara h 2, and Ara h 3 were examined in pooled serum derived from peanut-sensitized mice. Plates were coated with Ara h 1, Ara h 2, and Ara h 3 (2 μg / ml). The levels of IgG subclasses, specifically IgG1 and IgG2a, were determined by ELISA to determine whether to use a TH1 or TH2 response.

Anaphylaxis symptoms were evaluated using the following screening system for 30 to 40 minutes after secondary infection: 0, asymptomatic; 1, scratches and friction around the nose and head; 2, decreased activity with increased puffyness, diarrhea, hairiness, decreased activity, and / or increased respiratory rate around the eyes and mouth; 3, wheezing, dyspnea, and cyanosis around the mouth and tail; 4, inactivity or tremors and convulsions after prodding; 5, death.

Blood was collected 30 minutes after inoculation via secondary intragastric feeding. Plasma histamine levels were measured using an enzyme immunoassay kit (ImmunoTECH Inc, Marseille, France) as described by the manufacturer.

Spleens were removed from peanut-sensitized mice and untreated mice 5 weeks after re-inoculation. As a measure of their activation status, the ability of splenocytes to proliferate after being stimulated in vitro with peanut antigens was measured. Specifically, spleen cells were isolated and suspended in complete culture medium (RPMI-1640 plus 10% FBS, 1% penicillin-streptomycin, and 1% glutamine). Splenocytes (1 × 10 ⁶ / well in 0.2 mL) were incubated in triplicate cultures in microwell plates with or without crude peanut extract, Ara h 1, Ara h 2, or Ara h 3 (10 or 50 μg / ml). Cells stimulated with Con A (2 μg / ml) were used as positive controls. After 6 days, 1 μCi / well of ³ H-thymidine was applied to the cultures for 18 hours. Cells were harvested and the incorporated radioactivity counted on a β- scintillation counter.

Spleen cells were also cultured in 24-well plates (4 × 10 ⁶ / well / ml) with or without crude peanut extract (50 μg / ml) or Con A (2 μg / ml). The supernatant was recovered after 72 hours. IL-4, IL-5, IL-13, and IFN-γ were measured using ELISA according to the manufacturer's instructions to determine if a TH1 or TH2 reaction was used.

Example 6

VLPs used against ragweed allergies

6-10-week-old male C3H / HeJ mice were sensitized to RW by intraperitoneal injection of 80 μg of urticaria (RW) on Day 4 (Daytoxin Content> 2.3 ng / mg RW; Greer Laboratories, Lenoir, NC ). The sensitization solution consisted of 1 mg of RW (Baxter, Deerfield, IL) and 333 ml of Imject alum (Pierce, Rockford, IL) in 1 ml of 0.9% NaCl. One week after the final sensitization administration, mice were administered VLPs mixed with 160 μg of RW or VLPs mixed with 80 μg of Amb a 1. Uncontrolled mice, mice receiving only VLP, mice receiving only 160 μg of RW, or mice receiving VLP mixed with 80 μg of irrelevant antigen were used as controls.

0.5 ml of peripheral blood was collected from the tail on day 25 and mice were anesthetized with ketamine (90 μg / kg body wt) and xylazine (10 mg / kg body wt) followed by RW (0.1 ml of 0/9% NaCl). 10 μg of RW) was administered intratracheally to inoculate. Twelve hours after RW inoculation, 0.5 ml of peripheral blood was collected from Coxley and lungs were washed with 1 ml aliquots of PBS. Samples were centrifuged at 2,000 rpm for 5 minutes and bronchoalveolar lavage fluid was collected. Interleukin IL-4 and IL-5 levels were measured using a two-site immunoenzyme kit (Endogen, Cambridge, Mass.) According to the manufacturer's instructions. The lower detection limit for both IL-4 and IL-5 was 1 pg / ml. The lungs were washed and then removed. Lungs were injected with 30% 4% formaldehyde (in PBS), washed with PBS and soaked in 0.5M sucrose (in PBS) w overnight at 4 ° C. Lungs were inflated and embedded in paraffin. Tissue fragments were stained with hematoxylin and eosin and the extent of inflammatory eosinophil infiltration was measured by image analysis.

Leukocytes were isolated from peripheral blood by centrifugation on discontinuous Percoll gradients followed by hypotonic digestion of the remaining red blood cells. Leukocyte cells by negative-screening process using anti-CD90 and anti-CD45R antibodies to deplete B- and T-cell populations using MACS magnetic bead separation method (Miltenyi Bioteclmical, Auburn, CA) per protocol proposed by the manufacturer Eosinophils were concentrated from. Eosinophil fractions were typically concentrated to <98%.

Purified peripheral blood eosinophils were resuspended in RPMI-1640 (GIBCO-BRL) and 5% fetal bovine serum (GIBCO-BRL) at a cell density of 1 × 10 ⁶ cells / ml. Cells were stimulated with 10 ⁻⁷ M phorbol 12-myristate 13-acetate (PMA) and 10 ⁻⁷ M A-23187 (Sigma) in 96-well plates for 30 minutes, 1 h, and 16 h at 37 ° C. Or stimulated with Amb a 1 (20 μg / ml) for 6 days. The ability of VLPs to reverse the TH2-dominant cytokine secretion profile induced by Amb a 1 was analyzed. Specifically, the ability to produce IFN-γ, IL-4 and IL-5 was analyzed by sandwich ELISA.

Urticaria-specific IgE levels were measured using ELISA. IgE antibodies specific for Amb a1 were monitored in pooled serum derived from urticaria-sensitized mice. Plates were coated with Amb a 1 (2 μg / ml). IgG subclasses, specifically IgG1 and IgG2a, were measured using ELISA according to the manufacturer's instructions to determine if a TH1 or TH2 reaction was used.

Example 7

VLPs used against fungal allergies

VLP or Aspergillus mixed with 10 μg Alt a 1, a 28 kd thermostable dimer, extracted from Alternaria alternata extract as a 28 kd thermostable dimer as an undosed 7 day New Zealand white rabbit Immunized with VLP mixed with 10 μg Aspf 1 or 10 μg Aspf 16, a protein extracted and purified from Pumikatus ( Aspergillus pumigatus). The freezing of the 210 ng protein / ml reconstruction in rabbits and General saline treated VLP only altereuna Ria altereuna other (Alternaria alternata) or Aspergillus road Russ Fu Mika tooth of rabbit received (Aspergillus fumigatus) administered the extract Undosed rabbits were used as controls. The anti-alternaria and anti-aspergillus IgE of rabbits were measured by homologous passive dermal anaphylaxis (PCA). Naive 3-month old New Zealand white rabbits are injected intracutaneously along the back with 0.2 ml serum dilution from 3-month-old immunized rabbits. Sera from rabbits immunized with non-immunized rabbits and bovine serum albumin were tested as controls. After a three day latent period, 2.1 ng of Alternaria or Aspergillus extract protein diluted in 5 ml of 2.5% Evans Blue Die (Fisher Scientific Company, Fair Lawn, NJ) was injected into the recipient rabbits. Histamine phosphate (0.2 ml of 0.275 mg / ml) and normal saline were injected intradermal 10 minutes prior to providing the extract-die mixture to assess the skin test response. Blueing of each injection site was measured 1 hour after die administration. The positive response to either diluent was a blue spot with a diameter of 5 mm or more.

Three month old immunized rabbits and non-immunized control rabbits were anesthetized with 1 to 3 ml of sodium methohexyl (Brevitol, Eli Lilly Co., Indianapolis, IN) in normal saline administered intravenously. A 3.5 mm endotracheal tube (Portex Inc., Woburn MA) was inserted into the rabbit. A 3 cm long rubber balloon (Young Rubber Co., Trenton, NJ) attached to a P-240 catheter (Clay Adams, Parsippany, NJ) was placed in the esophagus. A 4-cm piece of 9-mm diameter endotracheal tube was placed behind the oral intestine, covering the esophageal catheter and the small endotracheal tube to prevent damage by the trailing teeth. The mouth was taped and the animals awakened over 2 hours. After a small amount of air was injected into the balloon, it was adjusted to a point where the end-tidal pressure was almost negative and the artificial heart was minimal. The position of the balloon was adjusted to be located at the phosphorus point. An esophageal balloon catheter was connected to a Hewlett-Packard Model 270 differential pressure transducer (Minneapolis, Minn.) And the pressure difference between the balloon and the endotracheal tube was recorded as transpulmonary pressure. Criteria were measured after the animals fully woke up. This criterion includes respiratory frequency, inspiratory and expiratory flow rates, tidal volume and transpulmonary pressure.

After reference measurement, brine General, the General yeomsujung diluted 1:20 weight / volume altereuna Ria altereuna other (Alternaria alternata) extract, or Aspergillus Fu Road Russ Mika tooth (Aspergillus fumigatus) inoculated with extracts of aerosols It was. 1 ml of normal saline, Alternaria extract, or Aspergillus extract was sprayed directly into the endotracheal tube using an air stream of 4 L / min (compressed air) over 5 minutes. Pulmonary function was measured every 30 minutes over 6 h at the end of the 5 minute inoculation.

ELISA was used to measure levels of Alt a 1, Aspf 1 or Aspf 16-specific IgE. IgE antibodies specific for Alt a 1, Aspf 1 or Aspf 16 were monitored in pooled serum derived from alternaria or Aspergillus-sensitized mice. Plates were coated with Alt a 1, Asp f 1 or Aspf 16 (2 μg / ml). IgG subclasses, specifically IgG1 and IgG2a, were measured using ELISA according to the manufacturer's instructions to determine if a TH1 or TH2 reaction was used.

Example 8

Used VLPs Against Dust Mite Allergy

Day 6 male C57BL / 6 mice were subcutaneously injected with 10 μg of Dermatophogoldes pteronyssinus or Lepidoglyphus destructor whole extracts on day 0 to induce D. pteronisus or L. Desensitize against Destrotor.

On day 14, mice sensitized to D. pteronisinus were extracted from VLPs mixed with 10 μg of D. pteronisinus, 5 μg Der p 1, Der f 2, purified from whole D. pteronisinus extract, And / or immunized with VLPs mixed with Der 2. Uncontrolled mice, mice that received only VLP, mice that received only 10 μg of D. pteronicinus, or mice that received VLPs mixed with 5 μg of unrelated antigen were used as controls.

On day 14, mice sensitized to L. destructor were immunized with VLP mixed with 10 μg of L. destructor, VLP mixed with whole L. destructor extract and purified with 5 μg Lep d 2. Uncontrolled mice, mice that received only VLP, mice that received only 10 μg of L. destroctor, or mice that received VLPs mixed with 5 μg of unrelated antigen were used as controls.

On day 28, 0.5 ml of peripheral blood was collected from the tail, anesthetized with ketamine (90 μg / kg body wt) and xylazine (10 mg / kg body wt), followed by 10 μg of D. pteronisi intranasally. Inoculation was carried out using Knox or L. destructor. 0.5 ml of peripheral blood was collected from the tail at 72 h after inoculation with D. pteronisinus or L. destructor and lungs removed.

Lungs were injected with 30% 4% formaldehyde (in PBS), washed with PBS and soaked in 0.5M sucrose (in PBS) overnight at 4 ° C. Lungs were inflated and embedded in paraffin. Tissue fragments were stained with hematoxylin and eosin and the extent of inflammatory eosinophil infiltration was measured by image analysis.

Leukocytes were isolated from peripheral blood by centrifugation on discontinuous Percoll gradients followed by hypotonic digestion of the remaining red blood cells. Leukocyte cells were isolated from peripheral blood on a discontinuous Percoll gradient. Leukocyte cells by negative-screening process using anti-CD90 and anti-CD45R antibodies to deplete B- and T-cell populations using MACS magnetic bead separation method (Miltenyi Bioteclmical, Auburn, CA) per protocol proposed by the manufacturer Eosinophils were concentrated from. Eosinophil fractions were typically concentrated to <98%.

Purified peripheral blood eosinophils were resuspended in RPMI-1640 (GIBCO-BRL) and 5% fetal bovine serum (GIBCO-BRL) at a cell density of 1 × 10 ⁶ cells / ml. Cells were stimulated with 10 ⁻⁷ M phorbol 12-myristate 13-acetate (PMA) and 10 ⁻⁷ M A-23187 (Sigma) in 96-well plates for 30 minutes, 1 h, and 16 h at 37 ° C. Or 6 μg of Der p 1, Der f 2, Der 2, or Lep d 2 (20 μg / ml). After stimulation, the ability of VLPs to reverse the TH2-dominant cytokine secretion profile induced by 5 μg of Der p 1, Der f 2, Der 2, or Lep d 2 was analyzed. Specifically, the ability to produce IFN-γ, IL-4 and IL-5 was analyzed by sandwich ELISA.

Levels of D. pteronisinus or L. destructor-specific IgE were measured using ELISA. IgE antibodies specific for induced Der p 1, Der f 2, Der 2, or Lep d 2 were monitored in pooled serum derived from D. pteronisus or L. destructor-sensitized mice. Plates were coated with Der p 1, Der f 2, Der 2, or Lep d 2 (2 μg / ml). IgG subclasses, specifically IgG1 and IgG2a, were measured using ELISA according to the manufacturer's instructions to determine if a TH1 or TH2 reaction was used.

Example 9

Desensitization of Mice for Bee Venom Inoculation

Packing of CpG and VLPs and Immunization of Mice with VLPs (CpG) Mixed with Bee venom

Bee venom VLPs having a sequence represented by SEQ ID NO: 70 were prepared in E. coli., Which contains an amount of RNA that can be digested and removed by incubating RNase A with VLPs. The molecular weight of the highly active RNase A enzyme used was about 14 kDa. Recombinantly prepared HBc VLPs concentrated to 0.8 mg / ml in PBS buffer pH 7.2 were incubated at 37 ° C. for 3 h with or without RNase A (300 μg / ml, Qiagen AG, Switzerland). After RNase A digestion, the VLPs were supplemented with 130 nmol / ml CpG oligonucleotides with the phosphorothioate backbone (SEQ ID NO: 69) and incubated at 37 ° C. for 3 h. VLP preparations were dialyzed extensively (10, 000-fold dilution) for 24 hours against PBS pH7.2 using 300 kDa MWCO dialysis membranes (Spectrum Medical Industries Inc., Houston, TX, USA) to immunize mice. RNase A and excess CpG-oligonucleotides were removed.

Groups of 13 CBA / J mice were sensitized by repeated injections of 0.2 μg bee venom (Phannalgen) and 1 mg Alum (Pierce) mixed with PBS on days 0, 9, 23 and 38. A total of 66 μl s. c. (33 μl per side) was administered. After four sensitizations, they were desensitized with VLP (CpG) + bee venom or VLP (CpG) only at 65, 73, and 80 days. Three injections of 50 μg VLP (CpG) +5 μg bee venom each in PBS were administered to the first group of seven mice. 200 μl total capacity. c. in two doses of 100 μl per side. The same amount of VLP (CpG) except bee venom was administered to six second groups according to the same immunization schedule (d65, d73 and d80) as the schedule according to the first group. Finally on day 87 all mice were inoculated with 30 μg of bee venom in a total dose of 300 μl PBS.

Throughout the specification and drawings, the terms VLP (CpG) and VLP-CpG are compatible with each other and refer to a VLP packed with CpG.

Example 10

Evaluation of temperature changes and serum analysis in vaccinated mice vaccinated with bee venom

To assess the protective results of desensitization with VLP (CpG) conjugates, the body temperature of the mice was measured at 10 minute intervals for 1 hour after bee venom inoculation (FIG. 8). 8 shows allergic body temperature drop in VLP (CpG) + bee venom vaccinated mice. Two sets of mice were tested. Group 1 (n = 7) received VLP (CpG) mixed with bee venom as a vaccine. Group 2 (n = 6) received only VLP (CpG). After inoculation with a large amount of bee venom (30 μg), allergic reactions were evaluated through changes in body temperature of the mice. No significant changes in body temperature were observed in any of the mice tested in group 1 who received bee venom with VLP (CpG). In contrast, body temperature was markedly lowered in 4 of 6 animals in group 2 who received only VLP (CpG) as the desensitized vaccine. Thus, these mice were not protected from allergic reactions. Note: The symbols in the figure represent the mean of 6 mice (VLP (CpG)) or 7 (VLP (CpG) + bee venom), including the standard deviation (SD).

For serological analysis, mice on day 0 (preimmune), day 58 (after sensitization) and day 86 (after desensitization) were bleeding retroorbitally. ELISA tests were performed as follows. ELISA plates were coated overnight at 4 ° C. with 5 μg bee venom per 1 ml coating buffer (0.1 M NaHCO, pH 9.6). Plates were blocked with blocking buffer (2% calf albumin albumin (BSA) in PBS (pH 7.4) /0.05% Tween20) at 37 ° C. for 2 hours, washed with PBS (pH7.4) /0.05% Tween20 and then blocked with blocking buffer. Incubation was carried out at room temperature for 2 hours with serial dilutions of heavy mice. Immune serum was pre-adsorbed on Protein G columns for IgE-detection. Plates were washed with PBS (pH 7.4) /0.05% Tween20 and then incubated at 1 μg / ml (Jackson Immunoresearach) for 1 hour at room temperature with hosradiciperoxidase-labeled goth anti-mouse IgE, IgG1 or IgG2a antibodies. . The plate was washed with PBS (pH 7.4) /0.05% Tween20 and the substrate solution was washed with (0.066M Na ₂ HP0 ₄ , 0.035M citric acid (pH5.0) + 0.4mg OPD (1.2-phenylenediamine dihydrochloride) + 0.01% H ₂ 0 ₂ ). After 10 minutes, the color reaction was stopped with 5% H ₂ SO ₄ and the absorbance was read at 450 nm. As a control, pre-immune serum of the same mouse was also tested. ELISA titers are presented as optical density (OD _{450 nm} ) in serum dilutions of 1: 250 (IgE), 1: 12500 (IgG1) or 1: 500 (IgG2a). 9 shows the detection of specific IgE and IgG sera of mice before and after desensitization. Blood samples from all mice were taken before and after desensitization and tested by ELISA for bee venom specific IgE antibodies (Panel A), IgG1 antibodies (Panel B) and IgG2a antibodies (Panel C), respectively. As shown in FIG. 9A, an increase in IgE titers was observed in VLP (CpG) + bee venom vaccinated mice after desensitization. The results are shown as optical density (OD _{450 nm} ) in 1: 250 serum dilutions. The mean of 6 mice (VLP (CpG)) or 7 (VLP (CpG) + bee venom), including the standard deviation (SD), is shown in the figure. In FIG. 9B, anti-bee venom IgG1 serum titers were increased after desensitization only in mice vaccinated with VLP (CpG) + bee venom. The IgG2a serum titers measured in FIG. 9C were also identical. As predicted for successful desensitization, the increase in IgG2a serum titers was most significant. Results are expressed as the mean of two (VLP (CpG)) or three (VLP (CpG) + bee venom) for serum dilutions of 1: 12500 (IgG1) or 1: 500 (IgG2a) including SD.

Example 11

VLPs comprising CpG-oligonucleotides induce an IgG response against co-administered grass pollen extract.

VLPs formed by the coat protein of RNA bacteriophage Qβ were used in this experiment. Either untreated or packed with CpG-2006 oligonucleotides (SEQ ID NO: 114) having phosphorothioate modifications in the phosphorous backbone. CpG-2006 was packaged by incubating 8 ml of Qβ VLP solution (2.2 mg / ml) at 60 ° C. overnight in the presence of 0.2 ml of 100 mM ZnSO ₄ solution. This treatment hydrolyzed the RNA contained in the Qβ VLPs. After dialysis against 20 mM Hepes, pH 7.5 using a dialysis tube (cut-off MWCO 300000), CpG-2006 was added to 130 nmol / 1 ml VLP solution and incubated at 37 ° C. for 3 hours with shaking at 650 rpm. Continuous treatment at 37 ° C. for 3 hours in the presence of 1 mM MgCl ₂ followed by dialysis against 20 mM Hepes, pH 7.5 as above to remove unpacked CpG-2006. The packing of CpG-2006 was confirmed by agarose gel electrophoresis stained with ethidium bromide for visualization of nucleic acid and Coomassie Blue for visualization of protein. Packed VLPs were also analyzed on TBE-urea gels and the amount of packed CpG- oligonucleotides was estimated. About 6.7 nmol of CpG-2006 was packed in 100 μg Qβ VLPs.

1.9 BU grass pollen extract (5-Glass-Mix Pangramin, Abello, perennial rye, orchard, timothy, kentucky bluegrass and broadleaf laver) mixed with one female Balb / c mouse Immunized subcutaneously: 50 μg Qβ VLPs only loaded and packed with CpG-2006 or 3 mg of aluminum hydroxide (Imject, Pierce), respectively. After 14 days, mice were boosted with the same vaccine formulation and bled on day 21. Serum IgG response at day 21 was assessed by ELISA. As shown in FIG. 10, the presence of VLPs, each loaded and packed with CpG-2006, enhanced the IgG2b response to pollen extract. The presence of Qβ VLPs loaded and packed with CpG-2006, respectively, did not induce IgE for pollen extracts, whereas strong IgE responses were observed in the presence of Alum. In contrast to Alum, Qβ-VLP loaded and packed with CpG-2006, respectively, did not induce IgG1 antibodies. This mentions no Th2 localization reaction.

Example 12

VLPs containing CpG-oligonucleotides in allergic mice induce an IgG response against co-administered grass pollen extract.

VLPs formed by the coat protein of RNA bacteriophage Qβ were used in this experiment. Used after packing with CpG-2006 oligonucleotide (SEQ ID NO: 114) as described in Example 11 above.

Female Balb / c mice were sensitized subcutaneously using 1.9 B. U. grass pollen extract (see Example 11) mixed with 3 mg of aluminum hydroxide (Imject, Pierce). After 14 days, mice were boosted with the same vaccine formulation. One group of mice was left untreated. Grass pollen extracts alone or mixed with either 50 μg Qβ VLPs loaded with or packed with 50 μg Qβ VLPs only, CpG-2006 or 3 mg of aluminum hydroxide (Imject, Pierce) on days 21, 28 and 35, respectively. Additional groups were desensitized by injection of BU. Additional groups of mice were desensitized with 50 μg Qβ VLPs loaded and packed with CpG-2006, respectively. Serum IgG response from day 14, 21, 28, 35 and 42 was assessed by ELISA. As shown in FIG. 11, in the presence of VLPs and pollen loaded and packed with CpG-2006, respectively, a strong IgG2b response was induced that was not present in untreated mice or mice treated with pollen extract. The IgG1 response was higher in mice desensitized with Qβ VLPs loaded and packed with CpG-2006, respectively, than in mice treated with pollen only. Untreated mice and mice treated with Qβ VLPs loaded and packed with CpG-2006, respectively, did not induce IgG1 antibodies in the absence of pollen.

Example 13

VLPs containing CpG-oligonucleotides in allergic mice induce IgG responses against co-administered pollen extracts.

VLPs formed by the coat protein of RNA bacteriophage Qβ were used in this experiment. Used after packing with CpG-2006 oligonucleotide (SEQ ID NO: 114) as described in Example 11 above.

Female Balb / c mice were sensitized subcutaneously using tree pollen extract (see Example 11) mixed with 3 mg of aluminum hydroxide (Imject, Pierce). A mix of 2 BU tree compounds extracts containing pollen extracts of Alnus glutinosa , Betula verrucosa and Corylus avellana in a group of mice (three tree mixes) , Abello). The second group contains only Alnus glutinosa pollen extracts, the third group contains only Betula verrucosa pollen extracts, and the fourth group contains only Corylus avellana pollen extracts. Only cedar ( Cryptomeria japonica ) pollen extracts were administered. After 14 days, mice were further inoculated with the same vaccine formulation. One group of mice was left untreated. Persimmons on days 21, 28 and 35 Additional groups were desensitized by injecting the same tree pollen extract 2 BU used for designation, the corresponding extract was used alone or in combination with one of the following: 50 μg Qβ VLPs only, CpG-2006 or 3 respectively. 50 μg Qβ VLPs loaded and packed with mg of aluminum hydroxide (Imject, Pierce) .ELI response to serum IgG from days 14, 21, 28, 35 and 42 Evaluated by SA.

Example 14

VLPs comprising CpG-oligonucleotides in allergic mice induce IgG responses against co-administered feline allergen extracts.

VLPs formed by the coat protein of RNA bacteriophage Qβ were used in this experiment. Used after packing with CpG-2006 oligonucleotide (SEQ ID NO: 114) as described in Example 11 above.

Two groups of female Balb / c mice were subcutaneously sensitized using cat allergen extracts corresponding to 0.5 μg to 5 μg Reld 1 protein. After 14 days, mice were boosted with the same vaccine formulation. One group was left unprocessed. Additional groups were desensitized by injecting the same cat allergen extract used to sensitize on days 21, 28 and 35. This corresponding extract was used alone or in combination with one of the following: 50 μg Qβ VLPs only loaded and packed with CpG-2006 or 3 mg of aluminum hydroxide (Imject, Pierce), respectively. Serum IgG response from day 14, 21, 28, 35 and 42 was assessed by ELISA.

Example 15

VLPs comprising G10-PO induce an IgG response against co-administered allergen extracts.

VLPs formed by the coat protein of RNA bacteriophage Qβ were used in this experiment. Used without treatment or after packing with G10-PO (SEQ ID NO: 122). Packing of G10 was performed as follows:

Disassembly : 45 mg Qβ VLP (measured by Bradford assay) in PBS (20 mM phosphate, 150 mM NaCl, pH 7.8) was reduced to 5 mM DTT for 15 minutes at RT under stirring conditions. After adding magnesium chloride at a final concentration of 700 mM, RNA was precipitated by incubation at RT for 30 minutes under stirring conditions. The solution was centrifuged at 10000 g at 4 ° C. for 10 minutes to separate the precipitated RNA in the pellet. The disassembled Qβ coat protein dimer in the supernatant was used directly in the chromatographic purification step.

Two step purification method of disassembled Qβ coat protein by cation exchange chromatography : The supernatant of the disassembled reaction comprising disassembled coat protein and residual RNA was applied on SP-Sepharose FF. Irradiation was carried out at 260 nm and 280 nm absorbances while running at RT at a flow rate of 5 ml / min. The column was equilibrated with 20 mM sodium phosphate buffer pH 7, 150 mM NaCl; Sam was diluted 1: 10 to reach conductivity of 10 mS / cm or less. An elution step (in 5 ml fractions) was performed with a gradient of 20 mM sodium phosphate to 500 mM sodium chloride to separate the pure Qβ coat protein dimer from the contaminants.

Optionally, the Qβ coat protein dimer (fraction eluted from the cation exchange column) isolated in a continuous step was applied on Sepharose CL4B (Amersham pharmacia biotech) equilibrated with buffer (20 mM sodium phosphate, 250 mM sodium chloride; pH 7.2). Absorbance was irradiated at 260 nm and 280 nm and the fraction corresponding to the Qβ dimer was pooled.

Reassembly : 1 mg / ml of purified Qβ coat protein dimer was used for the assembly of Qβ VLPs in the presence of oligodeoxynucleotide G10-PO. The oligodeoxynucleotide concentration was 35 μΜ in the assembly reaction. The concentration of coat protein dimer in the assembly solution was 70 μΜ. Urea was added to the solution to a final concentration of 1M urea. Alternatively, 2.5 mM DTT was added in addition to urea. Sodium chloride was added to bring the total concentration to 250 mM. Oligodeoxynucleotides packed during the assembly reaction were added to bring the final volume of the assembly reaction to 25 ml. This solution was first diafiltered for 100 minutes against a buffer containing 20 mM sodium phosphate, 250 mM NaCl, pH 7.2 using a Pellikon XL Biomax 5 membrane with a MWCO of 5 kDa at room temperature. Subsequent undialysis or otherwise incubation with 7 mM hydrogen peroxide for 1 hour followed by second diafiltration. In second diafiltration, Pellikon XL Biomax 5 membrane with MWCO 100 kDa or Pellikon XL Biomax 5 membrane with MWCO 300 kDa was used.

Analysis of Qβ VLPs reassembled in the presence of oligodeoxynucleotides:

A ) Hydrodynamic Size of Reassembled Capsids: Reassembled Qβ capsids in the presence of oligodeoxynucleotide G10-PO were analyzed by dynamic light scattering (DLS) and compared to complete Qβ VLPs purified from E. coli. The reassembled capsid exhibited a hydrodynamic size (depending on mass and structure) similar to complete Qβ VLPs.

B) Disulfide Bond Formation in Reassembled Capsid: Reassembled Qβ VLPs were analyzed by non-reducing SDS-PAGE and compared to complete Qβ VLPs purified from E. coli. The reassembled capsid showed a disulfide binding pattern in which pentamers and hexamers were present, similar to complete Qβ VLPs.

C) Nucleic acid content analysis of reassembled Qβ VLPs in the presence of oligodeoxynucleotides by agarose gel electrophoresis and modified polyacrylamide : Reassembled Qβ VLPs were loaded onto a 1% agarose gel and ethidium bromide and Coomassie Stained with Brilliant Blue. Reassembled Qβ VLPs were treated with protease K as described in Example 18. The reaction was then mixed with TBE-urea sample buffer and loaded on 15% polyacrylamide TBE-urea gel. As a qualitative and quantitative basis, 10 pmol, 20 pmol and 40 pmol of oligodeoxynucleotides used in the reassembly reaction were loaded on the same gel. This gel was stained with SYBRR ^R Gold (Molecular Probes cat.No. S-11494). SYBRR ^R Gold staining indicated that the reassembled Qβ capsid contained a nucleic acid that migrates with the oligodeoxynucleotides used in the reassembly reaction. Agarose gels showed the same shift of oligonucleotide staining and protein staining. Along with this, packing of oligonucleotides was demonstrated through the transfer of nucleic acid contents of proteins and Qβ VLPs and the separation of oligonucleotides from particles purified with protease K.

Female Balb / c mice were subcutaneously sensitized with grass pollen or cat hair extract as described in Examples 11 and 14. One group of mice was left untreated. Additional groups were desensitized by injection of the same allergen extract used to sensitize on days 21, 28 and 35. This corresponding extract was used alone or in combination with one of the following: 50 μg Qβ VLPs only loaded and packed with CpG-2006 or 3 mg of aluminum hydroxide (Imject, Pierce), respectively. Serum IgG response from day 14, 21, 28, 35 and 42 was assessed by ELISA.

Example 16:

Cloning of the AP205 Coat Protein Gene

The cDNA (SEQ ID NO: 90) of the AP205 coat protein (CP) was assembled from two DNA fragments generated from phage AP205 RNA using reverse transcription-PCR technology and commercial plasmid pCR 4-TOPO for sequencing. Reverse transcription-PCR techniques are well known to those skilled in the art. The first fragment contained in plasmid p205-246 contained 74 nucleotides encoding the first 24 N-terminal amino acids of CP and 269 nucleotides upstream of the CP sequence. The second fragment comprising plasmid p205-262 comprises 364 nucleotides encoding amino acids 12-131 of CP and an additional 162 nucleotides downstream of the CP sequence. p205-246 and p205-262 were obtained from J. Klovins.

Plasmid 283.-58 was designed by two-step PCR to fuse both CP fragments from plasmids p205-246 and p205-262 in one full length CP sequence. An upstream primer p1.44 comprising an NcoI site for cloning into plasmid pQb 185, or p1 comprising an Xbal site for cloning into plasmid pQb 10. 45, and p1 comprising a HindIII restriction site. 46 was used (underlined the recognition sequence of the restriction enzyme):

p1.44 5'-NN CC ATG G CA AAT AAG CCA ATG CAA CCG-3 '(SEQ ID NO: 100)

p1.45 5'-NN TCTAGA ATTTTCTGCGCACCCATCCCGG-3 '(SEQ ID NO: 101)

p1.46 5'-NN AAGC TT A AGC AGT AGT ATC AGA CGA TAC G-3 '(SEQ ID NO: 102)

Fragments in the primary PCR further using two primers, p1.47 annealing to the 5 'end of the fragment contained in p205-262, and p1.48 annealing to the fragment 3' end contained in the plasmid p205-246 Was amplified. Primers p1.47 and p1.48 are complementary to each other.

p1.47: 5'-GAGTGATCCAACTCGTTTATCAACTACATTT-TCAGCAAGTCTG- 3 '(SEQ ID NO: 103)

p1.48: 5'-CAGACTTGCTGAAAATGTAGTTGATAAACGA-GTTGGATCACTC- 3 '(SEQ ID NO: 104)

In the first two PCR reactions, two fragments were prepared. Primary fragments were prepared using primers p1.45 and p 1.48 and template p205-246. Secondary fragments were prepared using primers p1.47 and p1.46, and template p205-262. Two fragments with primer combinations p 1. 45 and p 1. 46 or p 1. 44 and p 1.46 were used as templates for the secondary PCR reaction, splice-overlap extension. The two second-stage PCR reaction products were digested with XbaI or NcoI, and HindIII, respectively, and using the same restriction sites into each of two pGEM-derived expression vectors, pQb 10 or pQb185, under the control of the E. coli tryptoprim operon promoter. Cloned.

PAP283-58 (SEQ ID NO: 91) comprising two plasmids, the gene encoding AP205 CP in pQb10 (SEQ ID NO: 90), and pAP281-32 (SEQ ID NO: 93) with the mutation Pro5 → Thr (SEQ ID NO: 93) : 94) was obtained. Coat sequences were confirmed by DNA sequencing. PAP283-58 contains 49 nucleotides upstream of the ATG coton of CP, downstream of the XbaI site and includes putative original ribosomal binding sites of coat protein mRNA.

Example 17:

Expression and Purification of Recombinant AP205 VLPs

A. Expression of Recombinant AP205 VLPs

E. coli JM109 was transformed with plasmid pAP283-58. Single colonies were inoculated into 5 ml LB liquid medium containing 20 μg / ml ampicillin and incubated at 37 ° C. for 16-24 hours without shaking.

The prepared inoculum was diluted 1: 100 in 100-300 ml of LB medium containing 20 μg / ml ampicillin and incubated at 37 ° C. overnight without shaking. The resulting secondary inoculum was diluted 1:50 in 2TY medium containing 0.2% glucose and buffering phosphate and incubated overnight at 37 ° C. on a shaker. Cells were harvested by centrifugation and frozen at -80 ° C.

B. Purification of Recombinant AP205 VLPs

Solutions and Buffers:

1. Lysis buffer

50 mM Tris-HCl pH 8.0 with 5 mM EDTA, 0.1% tritonX100 and 5 μg / ml PMSF.

2. S AS

Saturated ammonium sulfate in water

3. Buffer N ET .

20 mM Tris-HCl with 5 mM EDTA, pH 7.8 and

150 mM NaCl.

4. PEG

40% of NET (w / v) polyethylene glycol 6000

Dissolution:

Frozen cells were resuspended in lysis buffer at 2 ml / g cells. The mixture was sonicated five times for 15 seconds at 22 kH at an interval of one minute to freeze the solution on ice. The lysates were centrifuged using F34-6-38 rotor (Ep endorf) at 12,000 rpm for 20 minutes. All of the centrifugation steps described below were performed using the same rotor blade unless otherwise noted. The supernatant was stored at 4 ° C. and the cell pieces were washed twice with lysis buffer. After centrifugation, the supernatant of the lysate and the wash fractions were pooled.

Further ammonium sulfate precipitation can be used to purify AP205 VLPs. In the first step, the concentration of ammonium sulfate in which AP205 VLPs did not precipitate was selected. The resulting pellets were discarded. In the next step, the concentration of ammonium sulfate in which AP205 VLP was quantitatively precipitated was selected and AP205 VLPs were separated from the pellets of the precipitation step by centrifugation (14 000 rpm, 20 minutes). The obtained pellet was dissolved in NET buffer.

Chromatography:

Capsid proteins from pooled supernatants were loaded onto Sepharose 4B column (2.8 × 70 cm) and eluted at 4 ml / h / fraction using NET buffer. Fractions 28-40 were recovered and precipitated with ammonium sulfate at 60% saturation. Fractions were analyzed by Western blot using SDS-PAGE and antiserum specific for AP205 prior to precipitation. The pellet separated by centrifugation was resuspended in NET buffer, loaded onto Sepharose 2B column (2.3 × 65 cm) and eluted at 3 ml / h / fraction. Fractions were analyzed by SDS-PAGE and fractions 44-50 were collected, pooled and precipitated with ammonium sulfate at 60% saturation. The pellet separated by centrifugation was resuspended in NET buffer, loaded onto Sepharose 6B column (2.5 × 47 cm) and eluted at 3 ml / h / fraction. Fractions were analyzed by SDS-PAGE. Fractions 23-27 were collected and the salt concentration was adjusted to 0.5 M, precipitated with PEG 6000 and added to 40% stock in water to 13.3% final concentration. The pellet separated by centrifugation was resuspended in NET buffer, loaded onto the same Sepharose 2B column as above and eluted in the same manner. Fractional analysis by SDS-PAGE is shown in Figure 6C. Fractions 43-53 were collected and precipitated using ammonium sulfate at 60% saturation. The pellet separated by centrifugation was redissolved in water and the protein solution obtained was dialyzed extensively against water. About 10 mg of purified protein could be isolated per mg of cell.

Observation of the virus-like particles under an electron microscope showed that they were identical to the phage particles.

Example 18

Immunostimulatory nucleic acids can be packed into HBcAg VLPs.

When produced in E. coli by expressing the hepatitis B core antigen fusion protein p33-HBcAg (HBc33) (see Example 1), HBcAg VLPs contain RNA that can be cleaved and removed by incubating VLPs and RNase A together. . VLPs comprising peptide 33 are for convenience only and wild type VLPs can similarly be used in the present invention.

Enzymatic RNA hydrolysis : 1 x PBS buffer (KC1 0.2 g / L, KH ₂ PO ₄ 0.2 g / L, NaCl 8 g / L, Na ₂ HP0 ₄ 1.15 g / L) Concentration of 1.0 mg / ml in pH 7.4 Recombinantly generated HBcAg-p33 (HBc33) VLPs were incubated in a thermomixer at 650 rpm at 37 ° C. for 3 hours in the presence of 300 μg / ml RNase A (Qiagen AG, Switzerland).

Packing of immunostimulatory nucleic acids : RNA was digested with RNAse A and HBcAg-p33 VLPs were supplemented with 130 nmol / ml CpG-oligonucleotides B-CpG, NKCpG, G10-PO (Table 1). Similarly, 150mer single-strand Cy150-1 and 253mer double strand dsCyCpG-253, both containing multiple CpG motifs, were added at 130nmol / ml or 1.2nmol / ml respectively and incubated in a thermomixer at 37 ° C for 3 hours. Double stranded CyCpG-253 DNA was prepared by cloning into CyCpG's double stranded multimer into the EcorV site of pBluescript KS-. The resulting plasmids prepared in E. coli XLl-blue and isolated using Qiagen Endofree Plasmide Giga Kit were digested with restriction endonucleases XhoI and XbaI and the resulting restriction products were separated by agarose electrophoresis. 253 bp inserts were separated by electro-elution and ethanol precipitation. The sequence was confirmed by both strands.

Table 1: Terms and sequences of immunostimulatory nucleic acids used in the examples

DNAse I treatment : Packed HBcAg-p33 VLPs were then digested with DNaseI (5 U / ml) (DNaseI, RNase free Fluka AG, Switzerland) at 37 ° C. for 3 hours and 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to complete dialysis (2 × 200-fold volume) against PBS pH 7.4 to remove RNAse A and excess CpG- oligonucleotides.

Benzonase Treatment : Some single strand oligodeoxynucleotides were partially resistant to DNaseI treatment, so Benzonase treatment was used to remove free oligonucleotides from the sample. 100-120 U / ml Benzonase (Merck KGaA, Darmstadt, Germany) and 5 mM MgCl ₂ were added before dialysis and incubated at 37 ° C. for 3 h.

Dialysis : VLP samples packed with immunostimulatory nucleic acids used in the immunization experiments of mice were completely dialyzed against PBS pH 7.4 for 24 hours using a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) ( 2 × 200-fold volumes) added enzyme and free nucleic acid were removed.

Packing Assay : Free of packed immunostimulatory nucleic acids: 1 μl proteolytic enzyme K (600 U / ml, Roche, Mannheim, Germany), 3 μl 10% SDS-solution and 6 μl 10 in 50 μl capsid solution Pear protease buffer (0.5 M NaCl, 50 mM EDTA, 0.1 M Tris pH 7.4) was added and incubated overnight at 37 ° C. VLPs were completely hydrolyzed under these conditions. Proteolytic enzyme K was inactivated by heating at 65 ° C. for 20 minutes. 1 μl of RNAse A (Qiagen, 100 μg / ml, 250-fold dilution) was added to 25 μl of capsid. 2-30 μg of capsid is mixed with 1 volume of 2x loading buffer (IxTBE, 42% w / v urea, 12% w / v Ficoll, 0.01% Bromphenolblue), heated at 95 ° C. for 3 minutes and loaded on a 10% ( Oligonucleotides about 20 nt in length) or 15% (> 40 mer or greater nucleic acid) TBE / urea polyacrylamide gel (Invitrogen). Alternatively samples were loaded on 1% agarose gels containing 6 × loading die (10 mM Tris pH 7.5, 50 mM EDTA, 10% v / v glycerol, 0.4% orange G). TBE / urea gels were stained with SYBRGold and agarose gels were stained with ethidium bromide.

12 shows G10-PO oligonucleotide packing with HBc33. The RNA content in the VLPs was markedly reduced after RNase A treatment (FIG. 12A) while most capsids migrated with slow migration smears, possibly due to the removal of negatively charged RNA (FIG. 12B). After incubation with excess oligonucleotides the capsid contained more nucleic acid than the RNAseA treated capsid and therefore moved at a similar rate as the untreated capsid. Further treatment of DNAse I or Benzonase degrades the free oligonucleotide while the oligonucleotide packed in the capsid does not degrade, which clarifies the packing of the oligonucleotide. The discovery that oligonucleotides repaired the transfer of capsid clearly demonstrated the packing of oligonucleotides.

Similar results and figures were obtained for the other oligonucleotides used and mentioned in this example.

Example 19

Qβ disassembly, reassembly and packing

Disassembly : precipitate 10 mg Qβ VLP (termine interchangeably used Qβ capsid) (measured by Bradford assay) at 20 mM HEPES, pH 7.4, 150 mM NaCl using solid ammonium sulfate with a final saturation of 60% I was. Precipitated overnight at 4 ° C. and precipitated VLPs by centrifugation (SS-34 cylinder) at 4 ° C. for 60 minutes. The pellet was resuspended in 1 ml 6 M guanidine hydrochloride (GuHCl) containing 100 mM DTT (final concentration) and incubated at 4 ° C. for 8 h.

Purification of Qβ coat protein by size exclusion chromatography : The solution was clarified for 10 minutes at 14000 rpm (Eppendorf 5417 R, fixed angle cylinder F45-30-11, used in all subsequent steps) and 7 M urea, 100 mMTrisHCl, pH 8.0 , Overnight dialysis against buffer containing 10 mM DTT (2000 ml). The dialysis buffer was exchanged once and the bowing continued for an additional 2 hours. The resulting suspension was centrifuged at 14000 rpm for 10 minutes at 4 ° C. The negligible precipitate was discarded and the supernatant maintained a "load fraction" containing the disassembled coat protein and RNA. Protein concentration was measured by Bradford assay and 5 mg of total protein was applied on a HiLoad ^™ SuperdeX ^™ 75 prep grade column (26/60, Amersham Biosciences) equilibrated with 7 M urea, 100 mM TrisHCl and 10 mM DTT. Size exclusion chromatography was performed with equilibration buffer (7 M urea, 100 mM TrisHCl pH 8.0, 10 mM DTT) at a flow rate of 0.5 ml / min at 12 ° C. Absorbance at 254 nm and 280 mn was investigated during elution. Two peaks were separated. The polymer peaks took precedence over the apparent low molecular peaks. Peaks were collected in 1.5 ml fractions and aliquots were analyzed by SDS-PAGE followed by Coomassie staining and SYBR ^R Gold staining. This shows that RNA can be separated from the coat protein eluted at the second peak.

Purification of Qβ Coat Protein by Ion Exchange Chromatography : Alternatively, the clarified supernatant was dialyzed overnight in a buffer containing 7 M urea, 20 mM MES, 10 mM DTT, pH 6.0 (2000 ml). Dialysis buffer was exchanged once and dialysis continued for an additional 2 hours.

The resulting suspension was centrifuged at 14000 rpm for 10 minutes at 4 ° C. The negligible precipitate was discarded and the supernatant maintained a "load fraction" containing the disassembled coat protein and RNA. Protein concentration was measured by Bradford assay and 10 mg of total protein was diluted to 10 ml final volume using Buffer A (see below) and equilibrated with Buffer A: 7 M urea, 20 mM MES, 10 mM DTT, pH 6.0. 1 ml / min of 1 ml HiTrap ^™ SP HP column (Amersham Biosciences, cat. No. 17-1151-01). Flowthrough containing RNA was collected as first fraction. The column was washed thoroughly with Buffer A (30CV) and then the bound Qβ coat protein was washed with 0% -100% Buffer B (gradient length 5CV; Buffer A: see above, Buffer B: 7 M urea, 20 mM MES, 10 eluted with a linear gradient from mM DTT, 2 MNaCl, pH 6.0). Upon loading, washing and eluting the absorbance at 254 mn and 280 nm was investigated. 1 ml peak fractions were collected and analyzed by SDS-PAGE followed by Coomassie staining and SYBR ^R Gold staining. Fractions containing Qβ coat protein except RNA were identified and pH was adjusted by adding 100 μl of 1M TrisHCl, pH 8.0.

Samples containing Qβ coat protein except RNA were pooled and dialyzed overnight against 0.87 M urea, 100 mMTrisHCl, 10 mM DTT (2000 ml), exchange buffer once and continue dialysis for an additional 2 hours. The resulting suspension was centrifuged at 14000 rpm for 10 minutes at 4 ° C. The negligible precipitate was discarded and the supernatant was maintained as "assembled coat protein". Protein concentration was measured by Bradford assay.

Reassembly: VLPs were reassembled in the presence of oligodeoxynucleotides using a purified Qβ coat protein at a concentration of 0.5 mg / ml. Oligodeoxynucleotides were used for the assembly reaction more than 10-fold relative to the calculated theoretical amount of Qβ-VLP capsid (concentration of monomer divided by 180). After the Qβ coat protein was mixed with the oligodeoxynucleotide to be packed during the assembly reaction, the solution (the volume of 5 ml or less) was first mixed at 4 ° C. for 2 h with 500 ml of NET buffer containing 10% P-mercaptoethanol. After dialysis, continuous dialysis with NET buffer at flow rate 8 ml / h at 4 ° C. over 72 h was finally followed by an additional 72 hours in the same continuous mode using a buffer consisting of 20 mM TrisHCl pH 8.0, 150 mM NaCl. Was dialyzed during. The resulting suspension was centrifuged at 14000 rpm for 10 minutes at 4 ° C. A small amount of precipitate was discarded and the supernatant contained reassembled and packed VLPs. Protein concentration was measured by Bradford assay and if necessary reassembled and packed VLPs using a centrifugal filter device (Millipore, UFV4BCC25, 5K NMWL) to concentrate the final protein concentration to 3 mg / ml.

Purification of Reassembled and Packed VLPs : Total up to 10 mg of protein was loaded on Sepharose CL-4B column (16/70, Amersham Biosciences) equilibrated with 20 mM HEPES pH 7.4, 150 mM NaCl.

Size exclusion chromatography was performed with equilibration buffer (20 mM HEPES pH 7.4, 150 mM NaCl) at a flow rate of 0.4 ml / min at room temperature. Absorbance at 254 nm and 280 mn was investigated during elution. Two peaks were separated. The polymer peaks took precedence over the apparent low molecular peaks. Peaks were collected in 0.5 ml fractions and aliquots were confirmed by SDS-PAGE followed by Coomassie Blue staining. Calibration from fully Qβ capsid and E. coli to highly purified Qβ capsid revealed that the apparent molecular weight of the main first peak is consistent with the Qβ capsid.

Analysis of Qβ VLPs reassembled in the presence of oligodeoxynucleotides:

A ) Overall structure of the capsid: oligodeoxynucleotides (CyOpA (SEQ ID NO: 127), Cy (CpG) 200 pA (SEQ ID NO: 126), Cy (CpG) 20 (SEQ ID NO: 125), CyCyCy (SEQ ID NO: 128), Qβ VLPs reassembled in the presence of one of (CpG) 200pA) (SEQ ID NO: 124) or in the presence of tRNA from Roche Molecular Biochemicals, cat. Analyzes (negative staining with uranyl acetate pH 4.5) and compared to complete Qβ VLPs from E. coli. The Risemblin reaction lacking nucleic acid was used as a negative control. The reassembled capsid exhibits the same structural properties and properties as complete Qβ VLPs (FIG. 13).

B ) Hydrodynamic Size of Reassembled Capsids: Reassembled Qβ capsids in the presence of oligodeoxynucleotides were analyzed by dynamic light scattering (DLS) and compared to complete Qβ VLPs purified from E. coli. The reassembled capsid exhibited a hydrodynamic size (depending on mass and structure) similar to complete Qβ VLPs.

C ) Disulfide bond formation in reassembled capsid: Reassembled Qβ VLPs were analyzed by intact polyacrylamide gel electrophoresis and compared to complete Qβ VLPs purified from E. coli. The reassembled capsid showed a disulfide binding pattern in which pentamers and hexamers were present, similar to complete Qβ VLPs.

D ) Nucleic acid content analysis of reassembled Qβ VLPs in the presence of oligodeoxynucleotides by agarose gel electrophoresis : 5 μg reassembled Qβ VLPs were 0.35 units of RNase A (Qiagen, cat.No. 19101), 15 units Were incubated at 37 ° C. for 3 hours at 25 μl of total reaction volume without DNAse I (Fluka, cat. No. 31136) or without the addition of additional enzymes. Complete Qβ VLPs purified from E. coli. Were used as controls to incubate under the same conditions as described for the capsid reassembled in the presence of oligodeoxynucleotides. Loading was carried out on 0.8% agarose gel primary stained with ethidium bromide (FIG. 14A) and subsequently on 0.8% agarose gel stained with Coomassie blue (FIG. 14B). None of the enzymes added via ethidium bromide degraded the nucleic acid content in the reassembled Qβ capsid, indicating that the nucleic acid content (ie oligodeoxynucleotide) is protected. This result indicates that the oligodeoxynucleotide added during the assembly reaction is packed into the newly formed capsid. In contrast, the addition of RNase A degraded the nucleic acid content in complete Qβ VLPs purified from E. coli., Indicating that the nucleic acid content in these VLPs consists of RNA. In addition, ethidium bromide staining and Coomasie blue staining of agarose gels shifted nucleic acids containing Qβ VLPs (reassembled and purified, respectively, from E. coli.) To about the same size, which resulted in E The size of the complete Qβ VLPs purified from coli. became similar to the Qβ VLPs.

Thus, the gel shows that DNAse I protected oligodeoxynucleotides are present in the reassembled Qβ VLPs. Moreover, the packed oligodeoxynucleotides can be extracted with phenol / chloroform and then digested with DNAse I except RNAse A. The oligodeoxynucleotides can be successfully packed into Qβ VLPs by initially disassembling the VLPs, purifying the disassembled coat protein from the nucleic acid and subsequently disassembling the VLPs in the presence of oligodeoxy nucleotides.

E) Nucleic Acid Content Analysis of Reassembled Qβ VLPs in the Presence of Oligodeoxynucleotides with Modified Polyacrylamide : 40 μg Reassembled Qβ VLPs (0.8 mg / ml) were 0.5 mg / ml Protease K (PCR-grade) , Roche Molecular Biochemicals, cat.No. 1964364) and reaction buffer were incubated at 37 ° C. for 3 hours in a total reaction volume of 60 μl according to the manufacturer's instructions. Complete Qβ VLPs purified from E. coli. Were used as controls to incubate with proteolytic enzyme K under the same conditions as described for the capsid reassembled in the presence of oligodeoxynucleotides. The reaction was then mixed with TBE-urea sample buffer and loaded on 15% polyacrylamide TBE-urea gel (Novexe, Invitrogen cat. No. EC6885). 1 pmol, 5 pmol, and 10 pmol oligodeoxynucleotides used in the reassembly reaction as qualitative and quantitative criteria were loaded on the same gel. The gel was fixed with 10% acetic acid, 20% methanol, equilibrated to neutral pH and stained with SYBRR ^R Gold (Molecular Probes cat.No. S-11494). SYBRR ^R Gold staining indicated that the reassembled Qβ capsid contained a nucleic acid that migrates with the oligodeoxynucleotides used in the reassembly reaction. Note that full ring Qβ VLPs (purified from E. coli.) Do not contain nucleic acids of similar size. At the same time, oligodeoxynucleotides are protected from DNase I degradation through analysis of nucleic acid content of Qβ VLPs reassembled in the presence of oligodeoxynucleotides, indicating that the added oligodeoxynucleotides are appropriate means (e.g., Proteolytic enzyme K degradation of Qβ VLPs).

FIG. 13 shows electron micrographs of Qβ VLPs reassembled in the presence of different oligodeoxynucleotides. VLPs were reassembled in the presence of the indicated oligodeoxynucleotide or tRNA but were not purified into homogeneous suspension by size exclusion chromatography. Samples of “complete” Qβ VLPs purified from E. coli. Were used as positive controls. Importantly, the designated nucleic acid could be added during the assembly reaction to form the correct cream and structure of VLPs when compared to the "positive" control. This suggests that conventional reassembly procedures are independent of the nucleotide sequence and the length of the oligodeoxynucleotides used. Note that addition of nucleic acid during the assembly reaction is necessary to form Qβ VLPs because no particles are formed if the nucleic acid is deleted during the assembly reaction.

14 shows nucleic acid content analysis of reassembled Qβ VLPs by nuclease treatment and agarose gel electrophoresis: with 5 μg of reassembled and purified Qβ VLPs and 5 μg of E. coli. Treatment was as directed. After this treatment, the sample was mixed with a loading die and loaded onto a 0.8% agarose gel. After transfer, the gel was first stained with ethidium bromide (A) and the same gel was stained with Coomassie blue (B). Note that the nucleic acid content of the reassembled and purified Qβ VLPs is resistant to RNase A degradation while the nucleic acid content of purified Qβ VLPs from E. coli was degraded when incubated with RNase A. This indicates that the nucleic acid content of the reassembled Qβ VLPs consists of deoxynucleotides that are protected from RNase A degradation. Thus, oligodeoxynucleotides were packed into Qβ VLPs during the assembly reaction.

Example 20

AP205 disassembly-purification-assembly and packing of immunostimulatory nucleic acids

A. Assembly and Reassembly of AP205 VLPs from Substances That Can Be Reassembled without Adding Oligonucleotide Disassembly: 40 mg of frozen and purified AP205 VLP (SEQ ID NO: 90 or 93) was added to 4 ml 6 M GuHCl. Redissolved and incubated overnight at 4 ° C. overnight. The assembly mixture was centrifuged at 8000 rpm (Eppendorf 5417 R, fixed angle cylinder FF34-6-38, then used in all steps). The supernatant was dialyzed against NET buffer (including 20 mM Tris-HCI, pH 7.8, 5 mM EDTA and 150 mM NaCl) for 3 days with three exchanges of buffer while redissolving the pellet in 7 M urea. Alternatively, dialysis was performed in a continuous manner over 4 days. The dialysed solution was centrifuged at 8000 rpm for 20 minutes, the pellet was redissolved in 7 M urea and the supernatant was pelleted with ammonium sulfate (saturation 60%) and redissolved in 7 M urea containing 10 mM DTT. All previous pellets redissolved in 7 M urea were mixed and precipitated with ammonium sulfate (saturation 60%) and redissolved in 7 M urea containing 10 mM DTT. The redissolved material was mixed in 7 M urea containing 10 mM DTT and loaded on an equilibrated Sephadex G75 column containing 10 mM DTT and eluted with 7 M urea buffer at 2 ml / h. One peak eluted from the column. 3 ml of fractions were collected. Peaks containing the AP205 coat protein were pooled and precipitated with ammonium sulfate (saturation 60%). The pellet was separated by centrifugation at 8000 rpm for 20 minutes. Redissolved in 7 M urea containing 10 mM DTT and loaded on a short Sepharose 4B column (1.5 × 27 cm Sepharose 4B, 2 ml / h, 7 M urea, 10 mM DTT: as elution buffer). One main keep with small shoulder was eluted from the column. Fractions containing the AP205 coat protein, except the shoulder, were confirmed by SDS-PAGE and pooled. 10.3 ml of sample were obtained. For measurement, an aliquot of 25-fold diluted protein was measured and the concentration of the protein was predicted by spectrophotometry using the following formula: {(1.55 x OD280-0.76 x OD260) x volume}. The average concentration was 1 nmol / ml of VLP (2.6 mg / ml). The absorbance ratio at 280 mn to 260 nm was 0.12 / 0. It was 105.

Reassembly: 1. 1 ml beta-mercaptoethanol was added to the sample and the assembly reaction was set up as follows:

1 ml of AP205 coat protein, no nucleic acid

1 ml AP205 coat protein, rRNA (approximately 200 OD260 units, 10 nmol)

9 ml of AP205 coat protein, CyCpG (370 μl of 225 pmol / μl solution, ie 83 nmol).

This mixture was dialyzed for 1 hour against 30 ml of NET buffer containing 10% beta-mercaptoethanol. Dialysis was carried out along the mixture without nucleic acid. Dialysis was then performed in a continuous manner and 1 L of NET buffer was exchanged over 3 days. The reaction mixture was successively dialyzed against water (5 buffer exchanges) and frozen. Redissolved in water and analyzed by EM. All mixtures included cappsies, indicating that the AP205 VLP assembly is independent of the presence of detectable nucleic acid as measured by agarose gel electrophoresis using ethidium bromide staining and demonstrated by EM analysis. The EM method was as follows: Protein suspensions were adsorbed on carbon-fonmvar coated grids and stained with 2% phosphotonic acid (pH 6, 8). The grid was examined with a JEM100C (JEOL, Japan) electron microscope at an acceleration voltage of 80 kV. Image reading (negative) was performed on Kodak electronic imaging film and printed negatively on Kodak Polymax ground to obtain electron micrographs. VLPs reassembled in the presence of CyCpG were purified on Sepharose 4B column (1 × 50 cm) and eluted with NET buffer (1 ml / h). Fractions were analyzed in an Ouchterlony assay, and fractions containing VLPs were pooled. 8 ml of sample were obtained, which were desalted against water by dialysis and dried. The yield of capsid was 10 mg. Analysis of the material redissolved in 0.6% agarose gel stained with ethidium-bromide showed that the capsid lacked nucleic acid. Samples of the assembly reactions comprising CyCpG taken after mass reassembly before mass dialysis were analyzed on a 0.6% agarose gel. A band was obtained that moved to the same height as the complete AP205 VLP and stained with both ethidium-bromide and Coomassie blue staining, indicating that the AP205 VLP containing oligodeoxynucleotides were reassembled. After the reassembly process, oligodeoxynucleotides can be diffused out of VLPs through mass dialysis steps. Importantly, AP205 VLPs can also be reassembled in the absence of detectable oligodeoxynucleotides as measured by agarose gel electrophoresis using ethidium bromide staining. Thus, oligodeoxynucleotides can successfully bind to AP205 VLPs after initial disassembly of the VLPs, purifying coat proteins disassembled from the nucleic acid, and subsequently reassembling the VLPs in the presence of oligodeoxynucleotides.

B. Reassembly of AP205 VLPs using disassembly material that could not be reassembled in the absence of added oligonucleotides

Disassembly: 100 mg of purified and crossed recombinant AP205 VLPs were used to disassemble as described above. Substantially perform all steps described under disassembly in Part 1, except using 8 M urea to dissolve the pellets of the ammonium sulphate soak step and eliminating the gel filtration steps using the pre-assembly CL-4B column. It was. The pooled fraction of the Sephadex G-75 column contained 21 mg of protein as determined by spectroscopy using the formula described in Part A. The ratio of absorbance at 280 mn to absorbance at 260 nm of the sample was 0.16 to 0.125. Samples were diluted 50 fold for measurement.

Reassembly: The protein sample produced from Sephadex G-75 gel filtration purification step was precipitated with ammonium sulfate (saturation 60%) and the resulting pellet was dissolved in 2 ml 7 M urea, 10 mM DTT. Samples were diluted with 8 ml of 10% 2-mercaptoethanol in NET buffer and dialyzed against 40 ml of 10% 2-mercaptoethanol in NET buffer for 1 hour. 0.4 ml of CyCpG solution (109 nmol / ml) was added to the protein sample in the dialysis bag to initiate the assembly. All dialysiss were set and NET buffer was used as the elution buffer. Dialysis was performed for 2 days and samples were taken for EM analysis after completion of the dialysis step (FIG. 44 B). The dialysis assembly solution was concentrated by successive dialysis against 50% v / v glycerol in NET buffer. One day after dialysis, the buffer was exchanged once. Dialysis was performed for a total of three days.

The dialysed and concentrated assembly solution was purified in NET buffer by gel filtration on a Sepharose 4-B column (1 × 60 cm) at a flow rate of 1 ml / hour.

Fractions were tested in the Ouchterlony assay and fractions containing the capsid were dried, resuspended in water and chromatographed again on a 4-B column equilibrated at 20 mM Hepes pH 7.6. Three formulas: 1. (183 * OD ^{230 nm} -75.8 * OD ^{260 nm} ) * volume (ml)-2. ((OD ^{235 nm-} OD ^{280 nm} ) /2.51) x volume-3. ((OD ^{228. 5nm -OD 234. 5 nm) * 0.} 37) was determined to be the amount of x the volume of the VLP of the Bulletin risem using one of 6-26mg protein.

Reassembled AP205 VLPs were analyzed by SDS-PAGE under EM, agarose gel electrophoresis and non-reducing conditions as described above.

EM analysis of the disassembled material showed that AP205 VLP treatment with guanidium-chloride disrupted the capsid assembly of the VLP. Reassembly of oligonucleotide and disassembled material yields the capsid (FIG. 15B), which is purified and further concentrated by gel filtration (FIG. 15C). Two particles of different sizes were obtained; Particles of about 25 nm in diameter and smaller particles can be seen in the electron micrograph of FIG. 44C. No assembly was observed in the absence of oligonucleotides. Loading the reassembled particles on agarose electrophoresis revealed that the reassembled particles contained nucleic acids. Extraction of the nucleic acid content by phenol extraction, followed by agarose gel stained with ethidium bromide, revealed that the particles contained oligonucleotides used for assembly (FIG. 45A). The identity of the packed oligonucleotide was controlled by loading a sample of this oligonucleotide side into the side for the nucleic acid material extracted from the particles. By successive staining of the agarose gel loaded with the reassembled AP205 VLP and previously stained with ethidium bromide with Coomassie blue, the oligonucleotide content and the protein content of the particle move together (FIG. 16B), which means that the oligonucleotide Indicates that it is packed inside.

Movement in the absence of reducing agent when loaded with reassembled AP205 VLPs on an SDS-PAGE gel indicates that the reassembled particles form a disulfide bridge as in the case of untreated AP205 VLPs. Also, the disulfide bridge pattern is identical to the untreated particles.

The AP205 VLP protein disassembled in FIG. 15 A shows an electron micrograph, and FIG. 15 B shows the reassembled particles before purification. 15C shows electron micrographs of purified reassembled AP205 VLPs. The magnification of FIGS. 15A-C is 200 000 X. FIG.

16 A and B show reassembled AP205 VLPs analyzed by agarose gel electrophoresis. Samples loaded on gel from both figures are from left to right, untreated AP205 VLPs, three samples comprising different amounts of AP205 VLPs reassembled and purified with CyCpG, and untreated Qβ VLPs. The gel on FIG. 16A was stained with ethidium bromide while the same gel was stained with Coomassie blue in FIG. 16B.

Example 21

Immunostimulatory nucleic acids can be packed into Qβ VLPs.

Coupling of p33 Peptide with Qβ VLPs:

Recombinantly produced virus-positive particles (Qβ VLPs) of RNA-bacteriophage Qb or without N-terminal CGG or and C-terminal GGC kidney (CGG-KAVYNFATM (SEQ ID NO: 115) and KAVYNFATM-GGC (SEQ ID NO: : 131)) and used after coupling to the p33 peptide. Recombinantly produced Qβ VLPs were derivatized with 10 molar excess of SMPH (Pierce) at 25 ° C. for 0.5 h and then dialyzed at 4 ° C. against 20 mM HEPES, 150 mM NaCl, pH 7.2 to remove unreacted SMPH. Peptides were added to 5-fold molar excess and allowed to react for 2 hours in a thermomixer at 25 ° C. in the presence of 30% acetonitrile. FIG. 17 shows SDS-PAGE analysis demonstrating multiple coupling bands consisting of one, two or three peptides coupled to Qβ monomers (arrows, FIG. 17). For simplicity the coupling product of peptides p33 and Qβ VLPs was defined as Qbx33, in particular via experimental section. It should be noted that VLPs comprising peptide p33 were used for convenience and wild type VLPs could be used in the present invention.

When expressed in bacteriophage Qβ capsid proteins and produced in E. coli, Qβ VLPs contain RNA that can be cleaved and removed by incubating VLPs with RNase A.

Low ionic strength and low Qβ concentration enable Qβ VLPs to be RNA hydrolyzed by RNase A:

Qβ VLPs at 1.0 mg / ml in 20 mM Hepes / 150 mM NaCl buffer (HBS) pH 7.4 were directly digested with RNase A (300 μg / ml, Qiagen AG, Switzerland) or diluted with 4 volumes of H ₂ O to give a final 0.2 x HBS concentration was followed by incubation with RNase A (60 μg / ml, Qiagen AG, Switzerland). Incubate at 650 rpm for 3 hours in the thermomixer. Agarose gel electrophoresis and ethidium bromide staining demonstrated that only very pharmaceutical reduction of RNA content was observed in 1 × HBS, whereas most RNA was hydrolyzed in 0.2 × HBS. In agreement with this, the capsid shift was not changed after adding RNAse A in 1 × HBS, but moved more slowly after adding RNAse A in 0.2 × HBS.

Low ionic strength increases nucleic acid packing in Qβ VLPs:

After RNase A digestion, Qβ VLPs were concentrated to 1 mg / ml in 0.2 × HBS using a Millipore Microcon or Centriplus concentrator and aliquots were dialyzed against 1 × HBS or 0.2 × HBS. Qβ VLPs were supplemented with 130 nmol / ml CpG- oligonucleotide B-CpG and incubated at 37 ° C. for 3 hours in a thermomixer. Qβ VLPs were subsequently digested with Benzonase at 37 ° C. (100 U / ml) for 3 hours. Samples were analyzed on 1% agarose gels after staining with ethidium bromide or Coomassie Blue. Very small oligonucleotides could be packed in 1 x HBS while strong ethidium bromide staining bands could be detected in 0.2 x HBS, indicating that they were co-located with Coomassie blue staining of the capsid.

Different immunostimulatory nucleic acids can be packed in Qβ and Qbx33 VLPs with low ionic strength:

After RNase A digestion, Qβ or Qbx33 VLPs were concentrated to 1 mg / ml in 0.2 x HBS using Millipore Microcon or Centriplus concentrator and 130nmol / ml CpG-oligonucleotides B-CpGpt, g10gacga and 253 mer dsCyCpG-253 (Table 1 ) Was incubated at 37 ° C. for 3 hours in a thermomixer. Qβ or Qbx33 VLPs were subsequently digested with DNAse I (5 U / ml) or Benzonase (100 U / ml) at 37 ° C. for 3 hours. Samples were analyzed on 1% agarose gels after staining with ethidium bromide or Coomassie Blue. 18 shows that different nucleic acids B-CpGpt, g10gacga and 253mer dsDNA can be packed into Qbx33. The packed nucleic acid was resistant to DNAse I degradation and remained packed upon dialysis (FIG. 18). Packing of B-CpGpt was confirmed by nucleic acid release by agarose electrophoresis and ethidium bromide staining after protease K digestion (FIG. 18C).

FIG. 18 shows packing analysis of B-CpGpt into Qbx33 VLPs on 1% Aragos gel stained with ethidium bromide (A) and Coomassie Blue (B). 50 μg of the following sample was loaded onto the gel: 1. untreated Qbx33 VLP; 2. Qbx33 VLPs treated with RNase A; 3. Qbx33 VLPs treated with RNase A and packed with B-CpGpt; 4. Qbx33 VLPs treated with RNase A, packed with B-CpGpt, treated with DNaseI and dialyzed; 5.1 kb MBI Fermentas DNA Letter. (C) shows amount analysis of packed oligos extracted from VLPs on 15% TBE / urea stained with SYBR Gold. The following samples were loaded onto gels: 1. BCpGpt oligo content of 2 μg Qbx33 VLPs after proteolytic enzyme K digestion and RNase A treatment; 2. 20 pmol B-CpGpt control; 3.10 pmol B-CpGpt control; 4.5 pmol B-CpGpt control. 18D and E show packing analysis of g10gacga-PO into Qbx33 VLPs on 1% Aragos gels stained with ethidium bromide (D) and Coomassie Blue (E). 15 μg of the following sample was loaded onto the gel: 1. MBI Fermentas 1 kb DNA ladder; 2. untreated Qbx33 VLP; 3. Qbx33 VLPs treated with RNase A; 4. Qbx33 VLPs treated with RNase A and packed with g10gacga-PO; 5. Qbx33 VLPs treated with RNase A, packed with g10gacga-PO, treated with Benzonase and dialyzed. 18 E and F show packing analysis of dsCyCpG-253 into Qbx33 VLPs on 1% Aragos gels stained with ethidium bromide (E) and Coomassie Blue (F). 15 μg of the following sample was loaded onto the gel: 1. MBI Fermentas 1 kb DNA ladder; 2. untreated Qbx33 VLP; 3. Qbx33 VLPs treated with RNase A; 4. Qbx33 VLPs treated with RNase A and packed with dsCyCpG-253; 5. Qbx33 VLPs treated with RNase A, packed with dsCyCpG-253, treated with RNase A and dialyzed.

Example 22

Packing of Immunostimulatory Nucleic Acids into VLPs

Degradation of Nucleic Acid Contents of RNase A and ZnS0 ₄ Mediated VLPs

Qβ VLPs were treated with RNase A as described in Example 21 under low ionic strength (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4) conditions. Alternatively, Qβ VLPs and AP205 VLPs were treated with ZnSO ₄ as described in Example 11 under low ionic strength (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4) conditions. AP205 VLP (1 mg / ml) in 20 mM Hepes pH 7.4 or 20 mM Hepes, 1 mM Tris, pH 7.4 was treated at 2.5 ° C ZnS0 ₄ with 50 mM at 48 ° C. at Eppendorf Thermomixer Comfort 550 rpm. Samples of Qβ VLPs and AP205 VLPs were centrifuged at 14000 rpm and the supernatant dialyzed against 2 1 20 mM Hepes, pH 7.4 at 2 h at 4 h in a 10.000 MWCO Spectra / Por ^R dialysis tube (Spectrum, cat.nr. 128 118). The buffer was exchanged and dialyzed overnight. Samples were dialyzed similarly to Example 11 and then clarified and protein concentration in the supernatant was measured by Bradford assay.

Rnase A and ZnSO ₄  Packing of ISS into Treated VLPs

After RNA hydrolysis and dialysis, Qβ and AP205 VLPs (1-1.5 mg / ml) were added to 130 μl of CpG oligonucleotides (NKCpG-cf. Table 1; G3-6, G8-8-cf. 1 mM oligonucleotide stock in 10 mM Tris pH 8). Samples were incubated at 650 rpm in a thermal shaker at 37 ° C. for 3 hours. Samples were subsequently treated with 125 U Benzonase / ml VLPs (MerckKGaA, Darmstadt, Germany) in the presence of 2 mM MgCl ₂ and incubated for 3 hours prior to dialysis. Samples were dialyzed in 300.000 MWCO Spectra / Por ^R dialysis tubes (Spectrum, cat.nr. 131 447) at 2 h at 4 ° C. first for 20 mM Hepes, pH 7.4 and exchange buffer, then for the same buffer overnight It was. After dialysis the samples were centrifuged at 14000 rpm and the protein concentration in the supernatant was measured by Bradford assay.

Agarose gel electrophoresis and staining with successive ethidium bromide and Coomassie Blue showed that oligonucleotides were packed into VLPs.

Example 23

Packing of Oligonucleotides flanked by immunostimulatory guanosine into VLPs

Qbx33 VLPs (Qβ VLPs coupled to peptide p33, Reference Example 21) were subjected to RNase as described in Example 21 under low ionic strength (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4). Treatment with A hydrolyzed the RNA content of Qbx33 VLPs. Oligonucleotides flanked with guanosine after dialysis against 20 mM Hepes pH 7.4 (Table 2: G3-6, G7-7, G8-8, G9-9 or G6, 1 in 10 mM Tris pH 8) mM oligonucleotide stock) and incubated as described in Example 22. Subsequently, Qbx33 VLPs were treated with Benzonase and dialyzed in a 300.000 MWCO tube. Samples with oligos G7-7, G8-8 and G9-9 were free buffered by changing the buffer four times over three days. Packing was confirmed on 1% Aragos gel and on TBE / urea after protease K digestion.

Table 2 Sequences of immunostimulatory nucleic acids used in the examples

Lower case letters represent deoxynucleotides linked by phosphorothioate bonds and upper case letters represent deoxynucleotides linked by phosphodiester bonds.

Example 24

Ribonucleic Acid Packing into VLPs

ZnSO ₄  Nucleic Acid Content Degradation of Dependent VLPs

Qβ VLPs were treated with ZnSO ₄ as described in Example 11 under low ionic strength (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4) conditions. AP205 VLP (1 mg / ml) in 20 mM Hepes pH 7.4 or 20 mM Hepes, 1 mM Tris, pH 7.4 was treated at 50 ° C. with 2.5 mM ZnSO ₄ at 2.5 ppm ZnSO ₄ at Eppendorf Thermomixer Comfort at 550 rpm. Qβ VLPs and AP205 VLPs samples were centrifuged at 14000 rpm and dialyzed against 20 mM Hepes, pH 7.4, as described in Example 22.

Packing of Poly (I: C) into ZnSO ₄ -treated VLPs:

Immunostimulating ribonucleic acid poly (I: C), (cat. Nr. 27-4732-01, poly (I) poly (C), Pharmacia Biotech) was dissolved in PBS (Invitrogen cat. Nr. 14040) or water Was 4 mg / ml (9 μΜ). Poly (I: C) was incubated at 60 ° C. for 10 minutes and cooled to 37 ° C. Incubated poly (I: C) was added to ZnSO ₄ -treated Qβ or AP205 VLPs (1-1.5 mg / ml) in a 10-fold molar excess and the mixture was incubated at 650 rpm in a thermomixer at 37 ° C. for 3 hours. . Subsequently, excess free poly (I: C) was enzymatically hydrolyzed by incubation with 125 U Benzonase per 1 ml VLP in the presence of 2 mM MgCl ₂ at 37 ° C. for 3 hours at 300 rpm in the thermomixer. Upon Benzonase hydrolysis, the samples were centrifuged at 14000 rpm and the supernatant was dialyzed against 20 mM Hepes, pH 7.4 at 4 h at 2 h in a 300.000 MWCO Spectra / Por ^R dialysis tube (Spectrum, cat.nr. 131 447). After the buffer was exchanged, it was dialyzed against the same buffer overnight. After dialysis the samples were centrifuged at 14000 rpm and the protein concentration in the supernatant was measured by Bradford assay.

Packing was confirmed on 1% Aragos gel and on TBE / urea after protease K digestion.

Example 25

Packing of Oligonucleotides flanked by immunostimulatory guanosine into HBcAg VLPs

HBcAg VLPs were treated with RNase A as described in Example 21 under low ionic strength (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4) to hydrolyze the RNA content of the VLPs. Oligonucleotides flanking guanosine after dialysis against 20 mM Hepes pH 7.4 (Table 2; G3-6, G7-7, G8-8, G9-9, G10-PO or G6, 10 mM Tris pH 8 mM 1 mM oligonucleotide stock) and incubated as described in Example 22. Subsequently, VLPs were treated with Benzonase and dialyzed in 300.000 MWCO tubes. Packing was confirmed on 1% Aragos gel and on TBE / urea after protease K digestion.

Example 26

Ribonucleic Acid Packing into HBcAg VLPs

HBcAg VLPs were treated with ZnS0 ₄ as described in Example 11 under low ionic strength (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4) and 20 mM Hepes pH 7.4 as described in Example 22. Was dialyzed against. Poly (I: C) was added to HBcAg VLPs in a 10-fold molar excess as described in Example 24 and incubated at 650 rpm in a thermomixer at 37 ° C. for 3 hours. Subsequently, excess free poly (I: C) was enzymatically hydrolyzed by incubation with 125 U Benzonase per 1 VLP in the presence of 2 mM MgCl ₂ at 37 ° C. for 3 hours at 300 rpm in the thermomixer. Samples were purified after Benzonase hydrolysis in analogy to Example 11 and dialyzed as in Example 24. After dialysis the samples were centrifuged at 14000 rpm and the protein concentration in the supernatant was measured by Bradford assay.

Example 27

Qβ disassembly and packing

Disassembly and Reassembly of Qβ VLPs:

45 mg Qβ VLP (measured by Bradford assay) in PBS (20 mM phosphate, 150 mM NaCl, pH 7.5) was reduced to 100 mM DDT for 15 minutes at RT under stirring conditions. After incubation for 15 min at RT under stirring conditions, RNA was precipitated by adding magnesium chloride to a final concentration of 700 mM. The solution was centrifuged at 4000 rpm for 10 minutes at 4 ° C. (Eppendorf 5810 R, fixed angle cylinder A-4-62, then used in all steps) to separate the precipitated RNA in the pellet. The disassembled Qβ coat protein dimer in the supernatant was used directly in the chromatographic purification step.

Method for two-step purification of disassembled Qβ coat protein by cation exchange chromatography and size exclusion chromatography : The supernatant of the disassembled reaction containing disassembled coat protein and residual RNA was prepared using SP-Sepharose FF (16/20; 6 ml). Amersham pharmacia biotech). Irradiation was carried out at 260 nm and 280 nm absorbances while running at RT at a flow rate of 5 ml / min. The column was equilibrated with 20 mM sodium phosphate buffer pH 7, 150 mM NaCl; Sam was diluted 1: 10 to reach a conductivity of 9 mS / cm or less (dilution for this conductivity is necessary and performed using 0.5 x equilibration buffer). An elution step (in 5 ml fractions) was performed with a gradient of 20 mM sodium phosphate to 500 mM sodium chloride to separate the pure Qβ coat protein dimer from the contaminants. The column was regenerated with 0.5 M NaOH.

In the second step, the Sephacry S-100 HR column (26/60; 320 ml; Amersham pharmacia) was equilibrated with the isolated Qβ coat protein dimer (the fraction eluted from the cation exchange column) with buffer (20 mm sodium sulfate, 150 mM sodium chloride; pH 6.5). biotech). Chromatography was performed at RT with a flow rate of 2.5 ml / min. Irradiation was performed at 260 nm and 280 nm absorbances. 5 ml of fractions were collected. The column was regenerated with 0.5 mM NaOH.

Reassembly : 2 mg / ml of purified Qβ coat protein dimer was used for the assembly of Qβ VLPs in the presence of oligodeoxynucleotide G8-8. The oligodeoxynucleotide concentration was 10 μΜ in the assembly reaction. The concentration of coat protein dimer in the assembly solution was 40 μΜ. Urea was added to the solution so that the final concentration was 1 M urea and 5 mM DTT. Oligodeoxynucleotides packed during the reassembly reaction were finally added with H ₂ 0 to bring the final volume of the reassembly reaction to 3 ml. This solution was first dialyzed against 1500 ml buffer containing 20 mM Tris HCl, 150 mM NaCl, pH 8.0 at 4 ° C. for 72 h. The dialysed assembly mixture was centrifuged at 4 ° C. for 10 minutes at 14 000 rpm. A small amount of precipitate was discarded and the supernatant contained reassembled and packed VLPs. Protein concentration was measured by Bradford assay. The reassembled and packed VLPs were concentrated with a centrifugal filter device (Millipore, UFV4BCC25, 5K NMWL) to bring the final protein concentration to 3 mg / ml.

Reassembled and packed VLPs are purified:

Up to 10 mg total protein was loaded on a Sepharose CL-4B column (16/70, Amersham Biosciences) equilibrated with 20 mM HEPES, 150 mM NaCl, pH 7.4. Size exclusion chromatography was performed using Equilibration buffer (20 mM HEPES, 150 mM NaCl, pH 7.4) at room temperature with a flow rate of 0.4 ml / min. The absorbance at 254 nm and 280 mn was investigated. Two peaks were separated. The polymer peaks took precedence over the apparent low molecular peaks. Peaks were collected in 0.5 ml fractions and the Qb VLPs containing fractions were identified by SDS-PAGE followed by Coomassie Blue staining. Calibration of the column with full and highly purified Qβ capsid from E. coli revealed that the apparent molecular weight of the main first peak is consistent with the Qβ capsid.

Analysis of Qβ VLPs reassembled in the presence of oligodeoxynucleotides:

A ) Hydrodynamic Size of Reassembled Capsids: Reassembled Qβ capsids in the presence of oligodeoxynucleotide G8-8 were analyzed by dynamic light scattering (DLS) and compared to complete Qβ VLPs purified from E. coli. The reassembled capsid exhibited a hydrodynamic size (depending on mass and structure) similar to complete Qβ VLPs.

B) Disulfide Bond Formation in Reassembled Capsid: Reassembled Qβ VLPs were analyzed by non-reducing SDS-PAGE and compared to complete Qβ VLPs purified from E. coli. The reassembled capsid exhibited a disulfide binding pattern in which pentamers and hexamers were present identically to complete Qβ VLPs.

C) Nucleic Acid Content Analysis of Reassembled Qβ VLPs in the Presence of Oligodeoxynucleotides with Modified Polyacrylamide : Reassembled Qβ VLPs (0.4 mg / ml) containing G8-8 oligonucleotides were added to 2 mM MgCl ₂ . In the presence, incubated at 37 ° C. for 2 hours with 125 U Benzonase per 1 ml Qβ VLPs. Subsequently, Benzonase treated Qβ VLPs were treated as described in Example 11, Protease K (PCR-grade, Roche Molecular Biochemicals, cat. No. 1964364). The reaction was mixed with TBE-urea sample buffer and loaded on 15% polyacrylamide TBE-urea gel (Novex Invitrogen cat.No. EC6885). 1 pmol, 5 pmol, and 10 pmol oligodeoxynucleotides used in the reassembly reaction as qualitative and quantitative criteria were loaded on the same gel. The gel was fixed with 10% acetic acid, 20% methanol, equilibrated to neutral pH and stained with SYBRR ^R Gold (Molecular Probes cat.No. S-11494). SYBRR ^R Gold staining indicated that the reassembled Qβ capsid contained a nucleic acid that migrates with the oligodeoxynucleotides used in the reassembly reaction. At the same time, oligodeoxynucleotides are separated through the separation of oligodeoxynucleotides from particles purified by proteolytic enzyme K degradation and resistance to Benzonase degradation of nucleic acid contents of reassembled Qβ VLPs in the presence of oligodeoxynucleotides. Packing proved

Example 28

VLPs comprising G10-PO induce a Th1 type response to grass pollen extract co-administered in the presence of Alum.

VLPs formed by the coat protein of RNA bacteriophage Qb were used in this experiment. Used after being untreated or packed with G10-PO (SEQ ID NO: 115) as described in Example 15 above. Female Balb / c mice were mixed with Alum (Imject, Pierce) in the presence of 50 μg Qβ VLP only or 50 μg Qβ VLP loaded and packed with G10-PO, respectively (5-glass-mix Pangramin, Abello, perennial rye Sensitized subcutaneously using, orchard, timothy, Kentucky blue glass and broadleaf laver. The control group was administered with pollen extract mixed only with Alum. After 50 days, mice were boosted with the same vaccine formulation and bled on day 57. Serum IgG response from day 57 was assessed by ELISA. The control group showed an anti-pollutant antibody of the IgG1 isotype, but none of the IgG2a isotypes. The presence of VLPs loaded with loading with G10-PO induced an IgG2a response to pollen extract. IgE for pollen extracts was not induced in the presence of Qb VLPs loaded and packed with G10-PO, respectively, but only IgE responses were observed in the presence of Alum. This indicates that G10-PO loaded into VLPs can induce a Th1 response and inhibit Alum induced IgE production.

SEQUENCE LISTING <110> Cytos Biotechnology AG BACHMANN, MARTIN F RENNER, WOLFGANG A <120> PACKAGING OF DNA INTO VIRUS-LIKE PARTICLES FOR USE AS ADJUVANTS: METHOD OF <130> C62313PC <150> US 60 / 389,898 <151> 2002-06-20 <160> 131 <170> PatentIn version 3.2 <210> 1 <211> 132 <212> PRT <213> Bacteriophage Q-beta <400> 1 Ala Lys Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Lys Asp Gly Lys 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Ala Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 2 <211> 329 <212> PRT <213> Bacteriophage Q-beta <400> 2 Met Ala Lys Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Lys Asp Gly 1 5 10 15 Lys Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser 65 70 75 80 Cys Asp Pro Ser Val Thr Arg Gln Ala Tyr Ala Asp Val Thr Phe Ser 85 90 95 Phe Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu 100 105 110 Leu Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln 115 120 125 Leu Asn Pro Ala Tyr Trp Thr Leu Leu Ile Ala Gly Gly Gly Ser Gly 130 135 140 Ser Lys Pro Asp Pro Val Ile Pro Asp Pro Pro Ile Asp Pro Pro Pro 145 150 155 160 Gly Thr Gly Lys Tyr Thr Cys Pro Phe Ala Ile Trp Ser Leu Glu Glu 165 170 175 Val Tyr Glu Pro Pro Thr Lys Asn Arg Pro Trp Pro Ile Tyr Asn Ala 180 185 190 Val Glu Leu Gln Pro Arg Glu Phe Asp Val Ala Leu Lys Asp Leu Leu 195 200 205 Gly Asn Thr Lys Trp Arg Asp Trp Asp Ser Arg Leu Ser Tyr Thr Thr 210 215 220 Phe Arg Gly Cys Arg Gly Asn Gly Tyr Ile Asp Leu Asp Ala Thr Tyr 225 230 235 240 Leu Ala Thr Asp Gln Ala Met Arg Asp Gln Lys Tyr Asp Ile Arg Glu 245 250 255 Gly Lys Lys Pro Gly Ala Phe Gly Asn Ile Glu Arg Phe Ile Tyr Leu 260 265 270 Lys Ser Ile Asn Ala Tyr Cys Ser Leu Ser Asp Ile Ala Ala Tyr His 275 280 285 Ala Asp Gly Val Ile Val Gly Phe Trp Arg Asp Pro Ser Ser Gly Gly 290 295 300 Ala Ile Pro Phe Asp Phe Thr Lys Phe Asp Lys Thr Lys Cys Pro Ile 305 310 315 320 Gln Ala Val Ile Val Val Pro Arg Ala 325 <210> 3 <211> 129 <212> PRT <213> Bacteriophage R17 <400> 3 Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asn Asp Gly Gly Thr Gly 1 5 10 15 Asn Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu Trp 20 25 30 Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser Val 35 40 45 Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr Ile Lys Val Glu Val 50 55 60 Pro Lys Val Ala Thr Gln Thr Val Gly Gly Val Glu Leu Pro Val Ala 65 70 75 80 Ala Trp Arg Ser Tyr Leu Asn Met Glu Leu Thr Ile Pro Ile Phe Ala 85 90 95 Thr Asn Ser Asp Cys Glu Leu Ile Val Lys Ala Met Gln Gly Leu Leu 100 105 110 Lys Asp Gly Asn Pro Ile Pro Ser Ala Ile Ala Ala Asn Ser Gly Ile 115 120 125 Tyr <210> 4 <211> 130 <212> PRT <213> Bacteriophage f2 <400> 4 Met Ala Ser Asn Phe Glu Glu Phe Val Leu Val Asp Asn Gly Gly Thr 1 5 10 15 Gly Asp Val Lys Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu 20 25 30 Trp Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser 35 40 45 Val Arg Gln Ser Ser Ala Asn Asn Arg Lys Tyr Thr Val Lys Val Glu 50 55 60 Val Pro Lys Val Ala Thr Gln Val Gln Gly Gly Val Glu Leu Pro Val 65 70 75 80 Ala Ala Trp Arg Ser Tyr Met Asn Met Glu Leu Thr Ile Pro Val Phe 85 90 95 Ala Thr Asn Asp Asp Cys Ala Leu Ile Val Lys Ala Leu Gln Gly Thr 100 105 110 Phe Lys Thr Gly Asn Pro Ile Ala Thr Ala Ile Ala Ala Asn Ser Gly 115 120 125 Ile Tyr 130 <210> 5 <211> 130 <212> PRT <213> Bacteriophage GA <400> 5 Met Ala Thr Leu Arg Ser Phe Val Leu Val Asp Asn Gly Thr Gly 1 5 10 15 Asn Val Thr Val Val Pro Val Ser Asn Ala Asn Gly Val Ala Glu Trp 20 25 30 Leu Ser Asn Asn Ser Arg Ser Gln Ala Tyr Arg Val Thr Ala Ser Tyr 35 40 45 Arg Ala Ser Gly Ala Asp Lys Arg Lys Tyr Ala Ile Lys Leu Glu Val 50 55 60 Pro Lys Ile Val Thr Gln Val Val Asn Gly Val Glu Leu Pro Gly Ser 65 70 75 80 Ala Trp Lys Ala Tyr Ala Ser Ile Asp Leu Thr Ile Pro Ile Phe Ala 85 90 95 Ala Thr Asp Asp Val Thr Val Ile Ser Lys Ser Leu Ala Gly Leu Phe 100 105 110 Lys Val Gly Asn Pro Ile Ala Glu Ala Ile Ser Ser Gln Ser Gly Phe 115 120 125 Tyr ala 130 <210> 6 <211> 132 <212> PRT <213> Bacteriophage SP <400> 6 Met Ala Lys Leu Asn Gln Val Thr Leu Ser Lys Ile Gly Lys Asn Gly 1 5 10 15 Asp Gln Thr Leu Thr Leu Thr Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ser Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Val Ser Val Ala Gln Pro Ser Arg Asn Arg Lys Asn Phe Lys 50 55 60 Val Gln Ile Lys Leu Gln Asn Pro Thr Ala Cys Thr Arg Asp Ala Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Ser Ala Phe Ala Asp Val Thr Leu Ser Phe 85 90 95 Thr Ser Tyr Ser Thr Asp Glu Glu Arg Ala Leu Ile Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Asp Pro Leu Ile Val Asp Ala Ile Asp Asn Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 7 <211> 329 <212> PRT <213> Bacteriophage SP <400> 7 Ala Lys Leu Asn Gln Val Thr Leu Ser Lys Ile Gly Lys Asn Gly Asp 1 5 10 15 Gln Thr Leu Thr Leu Thr Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ala Gln Pro Ser Arg Asn Arg Lys Asn Phe Lys Val 50 55 60 Gln Ile Lys Leu Gln Asn Pro Thr Ala Cys Thr Arg Asp Ala Cys Asp 65 70 75 80 Pro Ser Val Thr Arg Ser Ala Phe Ala Asp Val Thr Leu Ser Phe Thr 85 90 95 Ser Tyr Ser Thr Asp Glu Glu Arg Ala Leu Ile Arg Thr Glu Leu Ala 100 105 110 Ala Leu Leu Ala Asp Pro Leu Ile Val Asp Ala Ile Asp Asn Leu Asn 115 120 125 Pro Ala Tyr Trp Ala Ala Leu Leu Val Ala Ser Ser Gly Gly Gly Asp 130 135 140 Asn Pro Ser Asp Pro Asp Val Pro Val Val Pro Asp Val Lys Pro Pro 145 150 155 160 Asp Gly Thr Gly Arg Tyr Lys Cys Pro Phe Ala Cys Tyr Arg Leu Gly 165 170 175 Ser Ile Tyr Glu Val Gly Lys Glu Gly Ser Pro Asp Ile Tyr Glu Arg 180 185 190 Gly Asp Glu Val Ser Val Thr Phe Asp Tyr Ala Leu Glu Asp Phe Leu 195 200 205 Gly Asn Thr Asn Trp Arg Asn Trp Asp Gln Arg Leu Ser Asp Tyr Asp 210 215 220 Ile Ala Asn Arg Arg Arg Cys Arg Gly Asn Gly Tyr Ile Asp Leu Asp 225 230 235 240 Ala Thr Ala Met Gln Ser Asp Asp Phe Val Leu Ser Gly Arg Tyr Gly 245 250 255 Val Arg Lys Val Lys Phe Pro Gly Ala Phe Gly Ser Ile Lys Tyr Leu 260 265 270 Leu Asn Ile Gln Gly Asp Ala Trp Leu Asp Leu Ser Glu Val Thr Ala 275 280 285 Tyr Arg Ser Tyr Gly Met Val Ile Gly Phe Trp Thr Asp Ser Lys Ser 290 295 300 Pro Gln Leu Pro Thr Asp Phe Thr Gln Phe Asn Ser Ala Asn Cys Pro 305 310 315 320 Val Gln Thr Val Ile Ile Ile Pro Ser 325 <210> 8 <211> 130 <212> PRT <213> Bacteriophage MS2 <400> 8 Met Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asp Asn Gly Gly Thr 1 5 10 15 Gly Asp Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu 20 25 30 Trp Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser 35 40 45 Val Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr Ile Lys Val Glu 50 55 60 Val Pro Lys Val Ala Thr Gln Thr Val Gly Gly Val Glu Leu Pro Val 65 70 75 80 Ala Ala Trp Arg Ser Tyr Leu Asn Met Glu Leu Thr Ile Pro Ile Phe 85 90 95 Ala Thr Asn Ser Asp Cys Glu Leu Ile Val Lys Ala Met Gln Gly Leu 100 105 110 Leu Lys Asp Gly Asn Pro Ile Pro Ser Ala Ile Ala Ala Asn Ser Gly 115 120 125 Ile Tyr 130 <210> 9 <211> 133 <212> PRT <213> Bacteriophage M11 <400> 9 Met Ala Lys Leu Gln Ala Ile Thr Leu Ser Gly Ile Gly Lys Lys Gly 1 5 10 15 Asp Val Thr Leu Asp Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ala Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Ile Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln Val Lys Ile Gln Asn Pro Thr Ser Cys Thr Ala Ser Gly Thr 65 70 75 80 Cys Asp Pro Ser Val Thr Arg Ser Ala Tyr Ser Asp Val Thr Phe Ser 85 90 95 Phe Thr Gln Tyr Ser Thr Val Glu Glu Arg Ala Leu Val Arg Thr Glu 100 105 110 Leu Gln Ala Leu Leu Ala Asp Pro Met Leu Val Asn Ala Ile Asp Asn 115 120 125 Leu Asn Pro Ala Tyr 130 <210> 10 <211> 133 <212> PRT <213> Bacteriophage MX1 <400> 10 Met Ala Lys Leu Gln Ala Ile Thr Leu Ser Gly Ile Gly Lys Asn Gly 1 5 10 15 Asp Val Thr Leu Asn Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ala Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Ile Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln Val Lys Ile Gln Asn Pro Thr Ser Cys Thr Ala Ser Gly Thr 65 70 75 80 Cys Asp Pro Ser Val Thr Arg Ser Ala Tyr Ala Asp Val Thr Phe Ser 85 90 95 Phe Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Leu Val Arg Thr Glu 100 105 110 Leu Lys Ala Leu Leu Ala Asp Pro Met Leu Ile Asp Ala Ile Asp Asn 115 120 125 Leu Asn Pro Ala Tyr 130 <210> 11 <211> 330 <212> PRT <213> Bacteriophage NL95 <400> 11 Met Ala Lys Leu Asn Lys Val Thr Leu Thr Gly Ile Gly Lys Ala Gly 1 5 10 15 Asn Gln Thr Leu Thr Leu Thr Pro Arg Gly Val Asn Pro Thr Asn Gly 20 25 30 Val Ala Ser Leu Ser Glu Ala Gly Ala Val Pro Ala Leu Glu Lys Arg 35 40 45 Val Thr Val Ser Val Ala Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys 50 55 60 Val Gln Ile Lys Leu Gln Asn Pro Thr Ala Cys Thr Lys Asp Ala Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Ser Gly Ser Arg Asp Val Thr Leu Ser Phe 85 90 95 Thr Ser Tyr Ser Thr Glu Arg Glu Arg Ala Leu Ile Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Lys Asp Asp Leu Ile Val Asp Ala Ile Asp Asn Leu 115 120 125 Asn Pro Ala Tyr Trp Ala Ala Leu Leu Ala Ala Ser Pro Gly Gly Gly 130 135 140 Asn Asn Pro Tyr Pro Gly Val Pro Asp Ser Pro Asn Val Lys Pro Pro 145 150 155 160 Gly Gly Thr Gly Thr Tyr Arg Cys Pro Phe Ala Cys Tyr Arg Arg Gly 165 170 175 Glu Leu Ile Thr Glu Ala Lys Asp Gly Ala Cys Ala Leu Tyr Ala Cys 180 185 190 Gly Ser Glu Ala Leu Val Glu Phe Glu Tyr Ala Leu Glu Asp Phe Leu 195 200 205 Gly Asn Glu Phe Trp Arg Asn Trp Asp Gly Arg Leu Ser Lys Tyr Asp 210 215 220 Ile Glu Thr His Arg Arg Cys Arg Gly Asn Gly Tyr Val Asp Leu Asp 225 230 235 240 Ala Ser Val Met Gln Ser Asp Glu Tyr Val Leu Ser Gly Ala Tyr Asp 245 250 255 Val Val Lys Met Gln Pro Pro Gly Thr Phe Asp Ser Pro Arg Tyr Tyr 260 265 270 Leu His Leu Met Asp Gly Ile Tyr Val Asp Leu Ala Glu Val Thr Ala 275 280 285 Tyr Arg Ser Tyr Gly Met Val Ile Gly Phe Trp Thr Asp Ser Lys Ser 290 295 300 Pro Gln Leu Pro Thr Asp Phe Thr Arg Phe Asn Arg His Asn Cys Pro 305 310 315 320 Val Gln Thr Val Ile Val Ile Pro Ser Leu 325 330 <210> 12 <211> 129 <212> PRT <213> Bacteriophage F2 <400> 12 Ala Ser Asn Phe Thr Gln Phe Val Leu Val Asn Asp Gly Gly Thr Gly 1 5 10 15 Asn Val Thr Val Ala Pro Ser Asn Phe Ala Asn Gly Val Ala Glu Trp 20 25 30 Ile Ser Ser Asn Ser Arg Ser Gln Ala Tyr Lys Val Thr Cys Ser Val 35 40 45 Arg Gln Ser Ser Ala Gln Asn Arg Lys Tyr Thr Ile Lys Val Glu Val 50 55 60 Pro Lys Val Ala Thr Gln Thr Val Gly Gly Val Glu Leu Pro Val Ala 65 70 75 80 Ala Trp Arg Ser Tyr Leu Asn Leu Glu Leu Thr Ile Pro Ile Phe Ala 85 90 95 Thr Asn Ser Asp Cys Glu Leu Ile Val Lys Ala Met Gln Gly Leu Leu 100 105 110 Lys Asp Gly Asn Pro Ile Pro Ser Ala Ile Ala Ala Asn Ser Gly Ile 115 120 125 Tyr <210> 13 <211> 128 <212> PRT <213> Bacteriophage PP7 <400> 13 Met Ser Lys Thr Ile Val Leu Ser Val Gly Glu Ala Thr Arg Thr Leu 1 5 10 15 Thr Glu Ile Gln Ser Thr Ala Asp Arg Gln Ile Phe Glu Glu Lys Val 20 25 30 Gly Pro Leu Val Gly Arg Leu Arg Leu Thr Ala Ser Leu Arg Gln Asn 35 40 45 Gly Ala Lys Thr Ala Tyr Arg Val Asn Leu Lys Leu Asp Gln Ala Asp 50 55 60 Val Val Asp Cys Ser Thr Ser Val Cys Gly Glu Leu Pro Lys Val Arg 65 70 75 80 Tyr Thr Gln Val Trp Ser His Asp Val Thr Ile Val Ala Asn Ser Thr 85 90 95 Glu Ala Ser Arg Lys Ser Leu Tyr Asp Leu Thr Lys Ser Leu Val Ala 100 105 110 Thr Ser Gln Val Glu Asp Leu Val Val Asn Leu Val Pro Leu Gly Arg 115 120 125 <210> 14 <211> 132 <212> PRT <213> Artificial Sequence <220> <223> Bacteriophage Qbeta 240 mutant <400> 14 Ala Lys Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Arg Asp Gly Lys 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 15 <211> 132 <212> PRT <213> Artificial Sequence <220> Bacteriophage Q-beta 243 mutant <400> 15 Ala Lys Leu Glu Thr Val Thr Leu Gly Lys Ile Gly Lys Asp Gly Lys 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 16 <211> 132 <212> PRT <213> Artificial Sequence <220> Bacteriophage Q-beta 250 mutant <400> 16 Ala Arg Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Arg Asp Gly Lys 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 17 <211> 132 <212> PRT <213> Artificial Sequence <220> Bacteriophage Q-beta 251 mutant <400> 17 Ala Lys Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Lys Asp Gly Arg 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 18 <211> 132 <212> PRT <213> Artificial Sequence <220> Bacteriophage Q-beta 259 mutant <400> 18 Ala Arg Leu Glu Thr Val Thr Leu Gly Asn Ile Gly Lys Asp Gly Arg 1 5 10 15 Gln Thr Leu Val Leu Asn Pro Arg Gly Val Asn Pro Thr Asn Gly Val 20 25 30 Ala Ser Leu Ser Gln Ala Gly Ala Val Pro Ala Leu Glu Lys Arg Val 35 40 45 Thr Val Ser Val Ser Gln Pro Ser Arg Asn Arg Lys Asn Tyr Lys Val 50 55 60 Gln Val Lys Ile Gln Asn Pro Thr Ala Cys Thr Ala Asn Gly Ser Cys 65 70 75 80 Asp Pro Ser Val Thr Arg Gln Lys Tyr Ala Asp Val Thr Phe Ser Phe 85 90 95 Thr Gln Tyr Ser Thr Asp Glu Glu Arg Ala Phe Val Arg Thr Glu Leu 100 105 110 Ala Ala Leu Leu Ala Ser Pro Leu Leu Ile Asp Ala Ile Asp Gln Leu 115 120 125 Asn Pro Ala Tyr 130 <210> 19 <211> 185 <212> PRT <213> Hepatitis B virus <400> 19 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg Ser Gln Ser Arg Glu Ser Gln Cys 180 185 <210> 20 <211> 183 <212> PRT <213> Hepatitis B virus <400> 20 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Gly Ser Gln Cys 180 <210> 21 <211> 183 <212> PRT <213> Hepatitis B virus <400> 21 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Thr 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Thr Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Cys Val Ile Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Gly Ser Gln Cys 180 <210> 22 <211> 212 <212> PRT <213> Hepatitis B virus <400> 22 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 23 <211> 212 <212> PRT <213> Hepatitis B virus <400> 23 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Asn Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 24 <211> 183 <212> PRT <213> Hepatitis B virus <400> 24 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Thr Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Cys Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 25 <211> 212 <212> PRT <213> Hepatitis B virus <400> 25 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Val Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Val Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 26 <211> 212 <212> PRT <213> Hepatitis B virus <400> 26 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Asp Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Val Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Val Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 27 <211> 212 <212> PRT <213> Hepatitis B virus <400> 27 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro Gln 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 28 <211> 212 <212> PRT <213> Hepatitis B virus <400> 28 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Lys Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Gly Ser Gln Cys 210 <210> 29 <211> 183 <212> PRT <213> Hepatitis B virus <400> 29 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Phe Arg Asp Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Asp Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Ser Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Cys Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 30 <211> 183 <212> PRT <213> Hepatitis B virus <400> 30 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 31 <211> 212 <212> PRT <213> Hepatitis B virus <400> 31 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg His Ala Ile Leu Cys Trp Gly Asp Leu Arg Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 32 <211> 212 <212> PRT <213> Hepatitis B virus <400> 32 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Asp Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Phe Arg Asp Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Ala Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Gln Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Cys 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 33 <211> 183 <212> PRT <213> Artificial sequence <220> <223> Description of Artificial Sequence: synthetic human Hepatitus B construct <400> 33 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 34 <211> 212 <212> PRT <213> Hepatitis B virus <400> 34 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Ser 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ile Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 35 <211> 183 <212> PRT <213> Hepatitis B virus <400> 35 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 36 <211> 183 <212> PRT <213> Hepatitis B virus <400> 36 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 37 <211> 183 <212> PRT <213> Hepatitis B virus <400> 37 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Ala Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Thr Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 38 <211> 212 <212> PRT <213> Hepatitis B virus <400> 38 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 39 <211> 212 <212> PRT <213> Hepatitis B virus <400> 39 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 40 <211> 212 <212> PRT <213> Hepatitis B virus <400> 40 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Thr Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ala Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 41 <211> 212 <212> PRT <213> Hepatitis B virus <400> 41 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Phe Glu Cys Ser Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 42 <211> 212 <212> PRT <213> Hepatitis B virus <220> <221> MISC_FEATURE (222) (28) .. (28) May be any amino acid <400> 42 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Xaa Asp Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Ile Thr 85 90 95 Leu Ser Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Thr Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Thr Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 43 <211> 212 <212> PRT <213> Hepatitis B virus <400> 43 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Asn Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 44 <211> 212 <212> PRT <213> Hepatitis B virus <400> 44 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Cys Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 45 <211> 212 <212> PRT <213> Hepatitis B virus <400> 45 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Pro Gln Cys 210 <210> 46 <211> 212 <212> PRT <213> Hepatitis B virus <400> 46 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Ser Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 47 <211> 212 <212> PRT <213> Hepatitis B virus <400> 47 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Leu Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 48 <211> 212 <212> PRT <213> Hepatitis B virus <400> 48 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Lys Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 49 <211> 212 <212> PRT <213> Hepatitis B virus <400> 49 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ala 50 55 60 Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Thr Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 50 <211> 183 <212> PRT <213> Hepatitis B virus <400> 50 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Ser Met Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Tyr Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Thr Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Gly Asn Leu Gln Asp Pro Thr 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Val Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Val Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Gln Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Cys Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 51 <211> 183 <212> PRT <213> Hepatitis B virus <400> 51 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg His Val Phe Leu Cys Trp Gly Asp 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Thr 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 52 <211> 212 <212> PRT <213> Hepatitis B virus <400> 52 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Thr Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 53 <211> 212 <212> PRT <213> Hepatitis B virus <400> 53 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Ile Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 54 <211> 183 <212> PRT <213> Hepatitis B virus <400> 54 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Val 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Val Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Ala Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 55 <211> 212 <212> PRT <213> Hepatitis B virus <400> 55 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Asn 85 90 95 Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Val Ser Arg Asp 100 105 110 Leu Val Val Gly Tyr Val Asn Thr Thr Val Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 56 <211> 183 <212> PRT <213> Hepatitis B virus <400> 56 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Thr Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 57 <211> 212 <212> PRT <213> Hepatitis B virus <400> 57 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Ala Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Ile Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 58 <211> 212 <212> PRT <213> Hepatitis B virus <400> 58 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Thr Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Val Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 59 <211> 212 <212> PRT <213> Hepatitis B virus <400> 59 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Arg Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Thr Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 60 <211> 212 <212> PRT <213> Hepatitis B virus <400> 60 Met Gln Leu Phe His Leu Cys Leu Val Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ala 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys Ile Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 61 <211> 212 <212> PRT <213> Hepatitis B virus <400> 61 Met Gln Leu Phe His Leu Cys Leu Ile Ile Ser Cys Ser Cys Pro Thr 1 5 10 15 Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Gly Met Asp Ile 20 25 30 Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu Ser Phe Leu 35 40 45 Pro Ser Ala Phe Phe Pro Ser Val Arg Asp Leu Leu Asp Thr Ala Ser 50 55 60 Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys Ser Pro His 65 70 75 80 His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp Leu Met Thr 85 90 95 Leu Ala Thr Trp Val Gly Val Asn Leu Glu Asp Pro Ala Ser Arg Asp 100 105 110 Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys Phe Arg Gln 115 120 125 Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg Glu Thr Val 130 135 140 Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Pro Ala 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu Thr Thr 165 170 175 Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr Pro Ser Pro 180 185 190 Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser Gln Ser Arg 195 200 205 Glu Ser Gln Cys 210 <210> 62 <211> 183 <212> PRT <213> Hepatitis B virus <400> 62 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ala Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Glu Ser Gln Cys 180 <210> 63 <211> 183 <212> PRT <213> Hepatitis B virus <400> 63 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Gly Asn Leu Glu Asp Pro Ile 65 70 75 80 Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Ile Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Cys Val Val Arg Arg Arg Gly Arg Ser Pro Arg Arg Arg Thr 145 150 155 160 Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg Arg Ser 165 170 175 Gln Ser Arg Gly Ser Gln Cys 180 <210> 64 <211> 188 <212> PRT <213> Hepatitis B virus <400> 64 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ser Ser Tyr Gln Leu Leu 1 5 10 15 Asn Phe Leu Pro Leu Asp Phe Phe Pro Asp Leu Asn Ala Leu Val Asp 20 25 30 Thr Ala Thr Ala Leu Tyr Glu Glu Glu Leu Thr Gly Arg Glu His Cys 35 40 45 Ser Pro His His Thr Ala Ile Arg Gln Ala Leu Val Cys Trp Asp Glu 50 55 60 Leu Thr Lys Leu Ile Ala Trp Met Ser Ser Asn Ile Thr Ser Glu Gln 65 70 75 80 Val Arg Thr Ile Ile Val Asn His Val Asn Asp Thr Trp Gly Leu Lys 85 90 95 Val Arg Gln Ser Leu Trp Phe His Leu Ser Cys Leu Thr Phe Gly Gln 100 105 110 His Thr Val Gln Glu Phe Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Ala Pro Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu His Thr Val Ile Arg Arg Arg Gly Gly Ala Arg Ala Ser Arg Ser 145 150 155 160 Pro Arg Arg Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro 165 170 175 Arg Arg Arg Arg Ser Gln Ser Pro Ser Thr Asn Cys 180 185 <210> 65 <211> 217 <212> PRT <213> Hepatitis B virus <400> 65 Met Tyr Leu Phe His Leu Cys Leu Val Phe Ala Cys Val Pro Cys Pro 1 5 10 15 Thr Val Gln Ala Ser Lys Leu Cys Leu Gly Trp Leu Trp Asp Met Asp 20 25 30 Ile Asp Pro Tyr Lys Glu Phe Gly Ser Ser Tyr Gln Leu Leu Asn Phe 35 40 45 Leu Pro Leu Asp Phe Phe Pro Asp Leu Asn Ala Leu Val Asp Thr Ala 50 55 60 Ala Ala Leu Tyr Glu Glu Glu Leu Thr Gly Arg Glu His Cys Ser Pro 65 70 75 80 His His Thr Ala Ile Arg Gln Ala Leu Val Cys Trp Glu Glu Leu Thr 85 90 95 Arg Leu Ile Thr Trp Met Ser Glu Asn Thr Thr Glu Glu Val Arg Arg 100 105 110 Ile Ile Val Asp His Val Asn Asn Thr Trp Gly Leu Lys Val Arg Gln 115 120 125 Thr Leu Trp Phe His Leu Ser Cys Leu Thr Phe Gly Gln His Thr Val 130 135 140 Gln Glu Phe Leu Val Ser Phe Gly Val Trp Ile Arg Thr Pro Ala Pro 145 150 155 160 Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro Glu His Thr 165 170 175 Val Ile Arg Arg Arg Gly Gly Ser Arg Ala Ala Arg Ser Pro Arg Arg 180 185 190 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 195 200 205 Arg Ser Gln Ser Pro Ala Ser Asn Cys 210 215 <210> 66 <211> 262 <212> PRT <213> Hepatitis B virus <400> 66 Met Asp Val Asn Ala Ser Arg Ala Leu Ala Asn Val Tyr Asp Leu Pro 1 5 10 15 Asp Asp Phe Phe Pro Lys Ile Glu Asp Leu Val Arg Asp Ala Lys Asp 20 25 30 Ala Leu Glu Pro Tyr Trp Lys Ser Asp Ser Ile Lys Lys His Val Leu 35 40 45 Ile Ala Thr His Phe Val Asp Leu Ile Glu Asp Phe Trp Gln Thr Thr 50 55 60 Gln Gly Met His Glu Ile Ala Glu Ala Ile Arg Ala Val Ile Pro Pro 65 70 75 80 Thr Thr Ala Pro Val Pro Ser Gly Tyr Leu Ile Gln His Asp Glu Ala 85 90 95 Glu Glu Ile Pro Leu Gly Asp Leu Phe Lys Glu Gln Glu Glu Arg Ile 100 105 110 Val Ser Phe Gln Pro Asp Tyr Pro Ile Thr Ala Arg Ile His Ala His 115 120 125 Leu Lys Ala Tyr Ala Lys Ile Asn Glu Glu Ser Leu Asp Arg Ala Arg 130 135 140 Arg Leu Leu Trp Trp His Tyr Asn Cys Leu Leu Trp Gly Glu Ala Thr 145 150 155 160 Val Thr Asn Tyr Ile Ser Arg Leu Arg Thr Trp Leu Ser Thr Pro Glu 165 170 175 Lys Tyr Arg Gly Arg Asp Ala Pro Thr Ile Glu Ala Ile Thr Arg Pro 180 185 190 Ile Gln Val Ala Gln Gly Gly Arg Lys Thr Ser Thr Ala Thr Arg Lys 195 200 205 Pro Arg Gly Leu Glu Pro Arg Arg Arg Lys Val Lys Thr Thr Val Val 210 215 220 Tyr Gly Arg Arg Arg Ser Lys Ser Arg Glu Arg Arg Ala Ser Ser Pro 225 230 235 240 Gln Arg Ala Gly Ser Pro Leu Pro Arg Ser Ser Ser Ser His His Arg 245 250 255 Ser Pro Ser Pro Arg Lys 260 <210> 67 <211> 305 <212> PRT <213> Hepatitis B virus <400> 67 Met Trp Asp Leu Arg Leu His Pro Ser Pro Phe Gly Ala Ala Cys Gln 1 5 10 15 Gly Ile Phe Thr Ser Ser Le Leu Leu Phe Leu Val Thr Val Pro Leu 20 25 30 Val Cys Thr Ile Val Tyr Asp Ser Cys Leu Cys Met Asp Ile Asn Ala 35 40 45 Ser Arg Ala Leu Ala Asn Val Tyr Asp Leu Pro Asp Asp Phe Phe Pro 50 55 60 Lys Ile Asp Asp Leu Val Arg Asp Ala Lys Asp Ala Leu Glu Pro Tyr 65 70 75 80 Trp Arg Asn Asp Ser Ile Lys Lys His Val Leu Ile Ala Thr His Phe 85 90 95 Val Asp Leu Ile Glu Asp Phe Trp Gln Thr Thr Gln Gly Met His Glu 100 105 110 Ile Ala Glu Ala Leu Arg Ala Ile Ile Pro Ala Thr Thr Ala Pro Val 115 120 125 Pro Gln Gly Phe Leu Val Gln His Glu Glu Ala Glu Glu Ile Pro Leu 130 135 140 Gly Glu Leu Phe Arg Tyr Gln Glu Glu Arg Leu Thr Asn Phe Gln Pro 145 150 155 160 Asp Tyr Pro Val Thr Ala Arg Ile His Ala His Leu Lys Ala Tyr Ala 165 170 175 Lys Ile Asn Glu Glu Ser Leu Asp Arg Ala Arg Arg Leu Leu Trp Trp 180 185 190 His Tyr Asn Cys Leu Leu Trp Gly Glu Pro Asn Val Thr Asn Tyr Ile 195 200 205 Ser Arg Leu Arg Thr Trp Leu Ser Thr Pro Glu Lys Tyr Arg Gly Lys 210 215 220 Asp Ala Pro Thr Ile Glu Ala Ile Thr Arg Pro Ile Gln Val Ala Gln 225 230 235 240 Gly Gly Arg Asn Lys Thr Gln Gly Val Arg Lys Ser Arg Gly Leu Glu 245 250 255 Pro Arg Arg Arg Arg Val Lys Thr Thr Ile Val Tyr Gly Arg Arg Arg 260 265 270 Ser Lys Ser Arg Glu Arg Arg Ala Pro Thr Pro Gln Arg Ala Gly Ser 275 280 285 Pro Leu Pro Arg Thr Ser Arg Asp His His Arg Ser Pro Ser Pro Arg 290 295 300 Glu 305 <210> 68 <211> 185 <212> PRT <213> Hepatitis B virus <400> 68 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg Ser Gln Ser Arg Glu Ser Gln Cys 180 185 <210> 69 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CyCpG <400> 69 tccatgacgt tcctgaataa t 21 <210> 70 <211> 594 <212> DNA <213> Hepatitis B virus <220> <221> CDS (222) (1) .. (594) <400> 70 atg gac att gac cct tat aaa gaa ttt gga gct act gtg gag tta ctc 48 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 tcg ttt ttg cct tct gac ttc ttt cct tcc gtc aga gat ctc cta gac 96 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 acc gcc tca gct ctg tat cga gaa gcc tta gag tct cct gag cat tgc 144 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 tca cct cac cat act gca ctc agg caa gcc att ctc tgc tgg ggg gaa 192 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 ttg atg act cta gct acc tgg gtg ggt aat aat ttg gaa gat cca gca 240 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 tcc agg gat cta gta gtc aat tat gtt aat act aac atg ggt tta aag 288 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 atc agg caa cta ttg tgg ttt cat ata tct tgc ctt act ttt gga aga 336 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 gag act gta ctt gaa tat ttg gtc tct ttc gga gtg tgg att cgc act 384 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 cct cca gcc tat aga cca cca aat gcc cct atc tta tca aca ctt ccg 432 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 gaa act act gtt gtt aga cga cgg gac cga ggc agg tcc cct aga aga 480 Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 aga act ccc tcg cct cgc aga cgc aga tct caa tcg ccg cgt cgc aga 528 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 aga tct caa tct cgg gaa tct caa tgt ctt ctc ctt aaa gct gtt tac 576 Arg Ser Gln Ser Arg Glu Ser Gln Cys Leu Leu Leu Lys Ala Val Tyr 180 185 190 aac ttc gct acc atg taa 594 Asn Phe Ala Thr Met 195 <210> 71 <211> 197 <212> PRT <213> Hepatitis B virus <400> 71 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg Ser Gln Ser Arg Glu Ser Gln Cys Leu Leu Leu Lys Ala Val Tyr 180 185 190 Asn Phe Ala Thr Met 195 <210> 72 <211> 9 <212> PRT <213> Homo sapiens <400> 72 Lys Thr Trp Gly Gln Tyr Trp Gln Val 1 5 <210> 73 <211> 9 <212> PRT <213> Homo sapiens <400> 73 Ile Thr Asp Gln Val Pro Phe Ser Val 1 5 <210> 74 <211> 9 <212> PRT <213> Homo sapiens <400> 74 Tyr Leu Glu Pro Gly Pro Val Thr Ala 1 5 <210> 75 <211> 10 <212> PRT <213> Homo sapiens <400> 75 Leu Leu Asp Gly Thr Ala Thr Leu Arg Leu 1 5 10 <210> 76 <211> 10 <212> PRT <213> Homo sapiens <400> 76 Val Leu Tyr Arg Tyr Gly Ser Phe Ser Val 1 5 10 <210> 77 <211> 9 <212> PRT <213> Homo sapiens <400> 77 Ala Ala Gly Ile Gly Ile Leu Thr Val 1 5 <210> 78 <211> 9 <212> PRT <213> Homo sapiens <400> 78 Ile Leu Thr Val Ile Leu Gly Val Leu 1 5 <210> 79 <211> 9 <212> PRT <213> Homo sapiens <400> 79 Met Leu Leu Ala Val Leu Tyr Cys Leu 1 5 <210> 80 <211> 9 <212> PRT <213> Homo sapiens <400> 80 Tyr Met Asp Gly Thr Met Ser Gln Val 1 5 <210> 81 <211> 9 <212> PRT <213> Homo sapiens <400> 81 Val Leu Pro Asp Val Phe Ile Arg Cys 1 5 <210> 82 <211> 9 <212> PRT <213> Homo sapiens <400> 82 Phe Leu Trp Gly Pro Arg Ala Leu Val 1 5 <210> 83 <211> 9 <212> PRT <213> Homo sapiens <400> 83 Tyr Leu Ser Gly Ala Asn Leu Asn Leu 1 5 <210> 84 <211> 9 <212> PRT <213> Homo sapiens <400> 84 Arg Met Pro Glu Ala Ala Pro Pro Val 1 5 <210> 85 <211> 9 <212> PRT <213> Homo sapiens <400> 85 Ser Thr Pro Pro Pro Gly Thr Arg Val 1 5 <210> 86 <211> 9 <212> PRT <213> Homo sapiens <400> 86 Leu Leu Gly Arg Asn Ser Phe Glu Val 1 5 <210> 87 <211> 9 <212> PRT <213> Homo sapiens <400> 87 Lys Ile Phe Gly Ser Leu Ala Phe Leu 1 5 <210> 88 <211> 9 <212> PRT <213> Homo sapiens <400> 88 Ile Ile Ser Ala Val Val Gly Ile Leu 1 5 <210> 89 <211> 8 <212> PRT <213> Homo sapiens <400> 89 Thr Leu Gly Ile Val Cys Pro Ile 1 5 <210> 90 <211> 131 <212> PRT <213> Bacteriophage AP205 <400> 90 Met Ala Asn Lys Pro Met Gln Pro Ile Thr Ser Thr Ala Asn Lys Ile 1 5 10 15 Val Trp Ser Asp Pro Thr Arg Leu Ser Thr Thr Phe Ser Ala Ser Leu 20 25 30 Leu Arg Gln Arg Val Lys Val Gly Ile Ala Glu Leu Asn Asn Val Ser 35 40 45 Gly Gln Tyr Val Ser Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu Gly 50 55 60 Cys Ala Asp Ala Cys Val Ile Met Pro Asn Glu Asn Gln Ser Ile Arg 65 70 75 80 Thr Val Ile Ser Gly Ser Ala Glu Asn Leu Ala Thr Leu Lys Ala Glu 85 90 95 Trp Glu Thr His Lys Arg Asn Val Asp Thr Leu Phe Ala Ser Gly Asn 100 105 110 Ala Gly Leu Gly Phe Leu Asp Pro Thr Ala Ala Ile Val Ser Ser Asp 115 120 125 Thr Thr Ala 130 <210> 91 <211> 3635 <212> DNA <213> Artificial Sequence <220> <223> Plasmid, pAP283-58, encoding RNA phage AP205 coat protein <400> 91 cgagctcgcc cctggcttat cgaaattaat acgactcact atagggagac cggaattcga 60 gctcgcccgg ggatcctcta gaattttctg cgcacccatc ccgggtggcg cccaaagtga 120 ggaaaatcac atggcaaata agccaatgca accgatcaca tctacagcaa ataaaattgt 180 gtggtcggat ccaactcgtt tatcaactac attttcagca agtctgttac gccaacgtgt 240 taaagttggt atagccgaac tgaataatgt ttcaggtcaa tatgtatctg tttataagcg 300 tcctgcacct aaaccggaag gttgtgcaga tgcctgtgtc attatgccga atgaaaacca 360 atccattcgc acagtgattt cagggtcagc cgaaaacttg gctaccttaa aagcagaatg 420 ggaaactcac aaacgtaacg ttgacacact cttcgcgagc ggcaacgccg gtttgggttt 480 ccttgaccct actgcggcta tcgtatcgtc tgatactact gcttaagctt gtattctata 540 gtgtcaccta aatcgtatgt gtatgataca taaggttatg tattaattgt agccgcgttc 600 taacgacaat atgtacaagc ctaattgtgt agcatctggc ttactgaagc agaccctatc 660 atctctctcg taaactgccg tcagagtcgg tttggttgga cgaaccttct gagtttctgg 720 taacgccgtt ccgcaccccg gaaatggtca ccgaaccaat cagcagggtc atcgctagcc 780 agatcctcta cgccggacgc atcgtggccg gcatcaccgg cgccacaggt gcggttgctg 840 gcgcctatat cgccgacatc accgatgggg aagatcgggc tcgccacttc gggctcatga 900 gcgcttgttt cggcgtgggt atggtggcag gccccgtggc cgggggactg ttgggcgcca 960 tctccttgca tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac ctactactgg 1020 gctgcttcct aatgcaggag tcgcataagg gagagcgtcg atatggtgca ctctcagtac 1080 aatctgctct gatgccgcat agttaagcca actccgctat cgctacgtga ctgggtcatg 1140 gctgcgcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 1200 gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 1260 ccgtcatcac cgaaacgcgc gaggcagctt gaagacgaaa gggcctcgtg atacgcctat 1320 ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg 1380 gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc 1440 tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta 1500 ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg 1560 ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg 1620 gttacatcga actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac 1680 gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtattg 1740 acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt 1800 actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg 1860 ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac 1920 cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt 1980 gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag 2040 caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc 2100 aacaattaat agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc 2160 ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta 2220 tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg 2280 ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga 2340 ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac 2400 ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa 2460 tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 2520 cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 2580 taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 2640 gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc 2700 acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 2760 ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg 2820 ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 2880 cgacctacac cgaactgaga tacctacagc gcgagcattg agaaagcgcc acgcttcccg 2940 aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga 3000 gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 3060 gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 3120 gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgttctttc 3180 ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga gctgataccg 3240 ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc 3300 caatacgcaa accgcctctc cccgcgcgtt ggccgattca ttaatgcagc tgtggtgtca 3360 tggtcggtga tcgccagggt gccgacgcgc atctcgactg catggtgcac caatgcttct 3420 ggcgtcaggc agccatcgga agctgtggta tggccgtgca ggtcgtaaat cactgcataa 3480 ttcgtgtcgc tcaaggcgca ctcccgttct ggataatgtt ttttgcgccg acatcataac 3540 ggttctggca aatattctga aatgagctgt tgacaattaa tcatcgaact agttaactag 3600 tacgcaagtt cacgtaaaaa gggtatcgcg gaatt 3635 <210> 92 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> vector pQb185 <400> 92 tctagattaa cccaacgcgt aggagtcagg ccatg 35 <210> 93 <211> 131 <212> PRT <213> Artificial Sequence <220> <223> Bacteriophage AP205 mutant <400> 93 Met Ala Asn Lys Thr Met Gln Pro Ile Thr Ser Thr Ala Asn Lys Ile 1 5 10 15 Val Trp Ser Asp Pro Thr Arg Leu Ser Thr Thr Phe Ser Ala Ser Leu 20 25 30 Leu Arg Gln Arg Val Lys Val Gly Ile Ala Glu Leu Asn Asn Val Ser 35 40 45 Gly Gln Tyr Val Ser Val Tyr Lys Arg Pro Ala Pro Lys Pro Glu Gly 50 55 60 Cys Ala Asp Ala Cys Val Ile Met Pro Asn Glu Asn Gln Ser Ile Arg 65 70 75 80 Thr Val Ile Ser Gly Ser Ala Glu Asn Leu Ala Thr Leu Lys Ala Glu 85 90 95 Trp Glu Thr His Lys Arg Asn Val Asp Thr Leu Phe Ala Ser Gly Asn 100 105 110 Ala Gly Leu Gly Phe Leu Asp Pro Thr Ala Ala Ile Val Ser Ser Asp 115 120 125 Thr Thr Ala 130 <210> 94 <211> 3613 <212> DNA <213> Artificial Sequence <220> <223> Plasmid, pAP281-32, encoding RNA phage AP205 coat protein <400> 94 cgagctcgcc cctggcttat cgaaattaat acgactcact atagggagac cggaattcga 60 gctcgcccgg ggatcctcta gattaaccca acgcgtagga gtcaggccat ggcaaataag 120 acaatgcaac cgatcacatc tacagcaaat aaaattgtgt ggtcggatcc aactcgttta 180 tcaactacat tttcagcaag tctgttacgc caacgtgtta aagttggtat agccgaactg 240 aataatgttt caggtcaata tgtatctgtt tataagcgtc ctgcacctaa accggaaggt 300 tgtgcagatg cctgtgtcat tatgccgaat gaaaaccaat ccattcgcac agtgatttca 360 gggtcagccg aaaacttggc taccttaaaa gcagaatggg aaactcacaa acgtaacgtt 420 gacacactct tcgcgagcgg caacgccggt ttgggtttcc ttgaccctac tgcggctatc 480 gtatcgtctg atactactgc ttaagcttgt attctatagt gtcacctaaa tcgtatgtgt 540 atgatacata aggttatgta ttaattgtag ccgcgttcta acgacaatat gtacaagcct 600 aattgtgtag catctggctt actgaagcag accctatcat ctctctcgta aactgccgtc 660 agagtcggtt tggttggacg aaccttctga gtttctggta acgccgttcc gcaccccgga 720 aatggtcacc gaaccaatca gcagggtcat cgctagccag atcctctacg ccggacgcat 780 cgtggccggc atcaccggcg ccacaggtgc ggttgctggc gcctatatcg ccgacatcac 840 cgatggggaa gatcgggctc gccacttcgg gctcatgagc gcttgtttcg gcgtgggtat 900 ggtggcaggc cccgtggccg ggggactgtt gggcgccatc tccttgcatg caccattcct 960 tgcggcggcg gtgctcaacg gcctcaacct actactgggc tgcttcctaa tgcaggagtc 1020 gcataaggga gagcgtcgat atggtgcact ctcagtacaa tctgctctga tgccgcatag 1080 ttaagccaac tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa 1140 cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 1200 tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 1260 ggcagcttga agacgaaagg gcctcgtgat acgcctattt ttataggtta atgtcatgat 1320 aataatggtt tcttagacgt caggtggcac ttttcgggga aatgtgcgcg gaacccctat 1380 ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata 1440 aatgcttcaa taatattgaa aaaggaagag tatgagtatt caacatttcc gtgtcgccct 1500 tattcccttt tttgcggcat tttgccttcc tgtttttgct cacccagaaa cgctggtgaa 1560 agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac tggatctcaa 1620 cagcggtaag atccttgaga gttttcgccc cgaagaacgt tttccaatga tgagcacttt 1680 taaagttctg ctatgtggcg cggtattatc ccgtattgac gccgggcaag agcaactcgg 1740 tcgccgcata cactattctc agaatgactt ggttgagtac tcaccagtca cagaaaagca 1800 tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa 1860 cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa ccgctttttt 1920 gcacaacatg ggggatcatg taactcgcct tgatcgttgg gaaccggagc tgaatgaagc 1980 cataccaaac gacgagcgtg acaccacgat gcctgtagca atggcaacaa cgttgcgcaa 2040 actattaact ggcgaactac ttactctagc ttcccggcaa caattaatag actggatgga 2100 ggcggataaa gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc 2160 tgataaatct ggagccggtg agcgtgggtc tcgcggtatc attgcagcac tggggccaga 2220 tggtaagccc tcccgtatcg tagttatcta cacgacgggg agtcaggcaa ctatggatga 2280 acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt aactgtcaga 2340 ccaagtttac tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat 2400 ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt 2460 ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct 2520 gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc 2580 ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc 2640 aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc 2700 gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc 2760 gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg 2820 aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata 2880 cctacagcgc gagcattgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta 2940 tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc 3000 ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg 3060 atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct ttttacggtt 3120 cctggccttt tgctggcctt ttgctcacat gttctttcct gcgttatccc ctgattctgt 3180 ggataaccgt attaccgcct ttgagtgagc tgataccgct cgccgcagcc gaacgaccga 3240 gcgcagcgag tcagtgagcg aggaagcgga agagcgccca atacgcaaac cgcctctccc 3300 cgcgcgttgg ccgattcatt aatgcagctg tggtgtcatg gtcggtgatc gccagggtgc 3360 cgacgcgcat ctcgactgca tggtgcacca atgcttctgg cgtcaggcag ccatcggaag 3420 ctgtggtatg gccgtgcagg tcgtaaatca ctgcataatt cgtgtcgctc aaggcgcact 3480 cccgttctgg ataatgtttt ttgcgccgac atcataacgg ttctggcaaa tattctgaaa 3540 tgagctgttg acaattaatc atcgaactag ttaactagta cgcaagttca cgtaaaaagg 3600 gtatcgcgga att 3613 <210> 95 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> HBcAg peptide <400> 95 Gly Gly Lys Gly Gly 1 5 <210> 96 <211> 152 <212> PRT <213> Artificial Sequence <220> <223> HBcAg variant <400> 96 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ala Ala Leu Tyr Arg Asp Ala Leu Glu Ser Pro Glu His Cys 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Asp 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Thr Asn Leu Glu Asp Gly Gly 65 70 75 80 Lys Gly Gly Ser Arg Asp Leu Val Val Ser Tyr Val Asn Thr Asn Val 85 90 95 Gly Leu Lys Phe Arg Gln Leu Leu Trp Phe His Ile Ser Cys Leu Thr 100 105 110 Phe Gly Arg Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp 115 120 125 Ile Arg Thr Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser 130 135 140 Thr Leu Pro Glu Thr Thr Val Val 145 150 <210> 97 <211> 185 <212> PRT <213> Artificial Sequence <220> <223> HBcAg variant <400> 97 Met Asp Ile Asp Pro Tyr Lys Glu Phe Gly Ala Thr Val Glu Leu Leu 1 5 10 15 Ser Phe Leu Pro Ser Asp Phe Phe Pro Ser Val Arg Asp Leu Leu Asp 20 25 30 Thr Ala Ser Ala Leu Tyr Arg Glu Ala Leu Glu Ser Pro Glu His Ser 35 40 45 Ser Pro His His Thr Ala Leu Arg Gln Ala Ile Leu Cys Trp Gly Glu 50 55 60 Leu Met Thr Leu Ala Thr Trp Val Gly Asn Asn Leu Glu Asp Pro Ala 65 70 75 80 Ser Arg Asp Leu Val Val Asn Tyr Val Asn Thr Asn Met Gly Leu Lys 85 90 95 Ile Arg Gln Leu Leu Trp Phe His Ile Ser Ser Leu Thr Phe Gly Arg 100 105 110 Glu Thr Val Leu Glu Tyr Leu Val Ser Phe Gly Val Trp Ile Arg Thr 115 120 125 Pro Pro Ala Tyr Arg Pro Pro Asn Ala Pro Ile Leu Ser Thr Leu Pro 130 135 140 Glu Thr Thr Val Val Arg Arg Arg Asp Arg Gly Arg Ser Pro Arg Arg 145 150 155 160 Arg Thr Pro Ser Pro Arg Arg Arg Arg Ser Gln Ser Pro Arg Arg Arg 165 170 175 Arg Ser Gln Ser Arg Glu Ser Gln Cys 180 185 <210> 98 <211> 10 <212> PRT <213> Homo sapiens <400> 98 Glu Ala Ala Gly Ile Gly Ile Leu Thr Val 1 5 10 <210> 99 <211> 10 <212> PRT <213> Homo sapiens <400> 99 Glu Leu Ala Gly Ile Gly Ile Cys Thr Val 1 5 10 <210> 100 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer p1.44 <220> <221> misc_feature (222) (1) .. (2) <223> n can be any nucleotide, preferably a <400> 100 nnccatggca aataagccaa tgcaaccg 28 <210> 101 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer p1.45 <220> <221> misc_feature (222) (1) .. (2) <223> n can be any nucleotide, preferably a <400> 101 nntctagaat tttctgcgca cccatcccgg 30 <210> 102 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer p1.46 <220> <221> misc_feature (222) (1) .. (2) <223> n can be any nucleotide, preferably a <400> 102 nnaagcttaa gcagtagtat cagacgatac g 31 <210> 103 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer p1.47 <400> 103 gagtgatcca actcgtttat caactacatt ttcagcaagt ctg 43 <210> 104 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> p1.48 <400> 104 cagacttgct gaaaatgtag ttgataaacg agttggatca ctc 43 <210> 105 <211> 10 <212> DNA <213> Artificial Sequence <220> Oligonucleotide ISS <400> 105 gacgatcgtc 10 <210> 106 <211> 19 <212> DNA <213> Artificial Sequence <220> Oligonucleotide G3-6 <400> 106 ggggacgatc gtcgggggg 19 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> Oligonucleotide G4-6 <400> 107 gggggacgat cgtcgggggg 20 <210> 108 <211> 21 <212> DNA <213> Artificial Sequence <220> Oligonucleotide G5-6 <400> 108 ggggggacga tcgtcggggg g 21 <210> 109 <211> 22 <212> DNA <213> Artificial sequence <220> Oligonucleotide G6-6 <400> 109 gggggggacg atcgtcgggg gg 22 <210> 110 <211> 24 <212> DNA <213> Artificial sequence <220> Oligonucleotide G7-7 <400> 110 ggggggggac gatcgtcggg gggg 24 <210> 111 <211> 26 <212> DNA <213> Artificial sequence <220> Oligonucleotide G8-8 <400> 111 ggggggggga cgatcgtcgg gggggg 26 <210> 112 <211> 28 <212> DNA <213> Artificial Sequence <220> Oligonucleotide G9-9 <400> 112 gggggggggg acgatcgtcg gggggggg 28 <210> 113 <211> 30 <212> DNA <213> Artificial sequence <220> Oligonucleotide G6 <400> 113 ggggggcgac gacgatcgtc gtcggggggg 30 <210> 114 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CpG-2006, deoxynucleotides connected via phosphorothioate bonds <400> 114 tcgtcgtttt gtcgttttgt cgt 23 <210> 115 <211> 12 <212> PRT <213> Artificial Sequence <220> P223 peptide containing CGG n-terminal <400> 115 Cys Gly Gly Lys Ala Val Tyr Asn Phe Ala Thr Met 1 5 10 <210> 116 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CyCpGpt, deoxynucleotides connected via phosphorothioate bonds <400> 116 tccatgacgt tcctgaataa t 21 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> B-CpGpt, deoxynucleotides connected via phosphorothioate bonds <400> 117 tccatgacgt tcctgacgtt 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> B-CpG <400> 118 tccatgacgt tcctgacgtt 20 <210> 119 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NKCpGpt, deoxynucleotides connected via phosphorothioate bonds <400> 119 ggggtcaacg ttgaggggg 19 <210> 120 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NKCpG <400> 120 ggggtcaacg ttgaggggg 19 <210> 121 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CyCpG-rev-pt, deoxynucleotides connected via phosphorothioate bonds <400> 121 attattcagg aacgtcatgg a 21 <210> 122 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> g10gacga-PO (G10-PO) <400> 122 gggggggggg gacgatcgtc gggggggggg 30 <210> 123 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> g10gacga-PS (G10-PS), deoxynucleotides connected via phosphorothioate bonds <400> 123 gggggggggg gacgatcgtc gggggggggg 30 <210> 124 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> (CpG) 20OpA <400> 124 cgcgcgcgcg cgcgcgcgcg cgcgcgcgcg cgcgcgcgcg aaatgcatgt caaagacagc 60 at 62 <210> 125 <211> 61 <212> DNA <213> Artificial Sequence <220> Cy (CpG) 20 <400> 125 tccatgacgt tcctgaataa tcgcgcgcgc gcgcgcgcgc gcgcgcgcgc gcgcgcgcgc 60 g 61 <210> 126 <211> 83 <212> DNA <213> Artificial Sequence <220> Cy (CpG) 20-OpA <400> 126 tccatgacgt tcctgaataa tcgcgcgcgc gcgcgcgcgc gcgcgcgcgc gcgcgcgcgc 60 gaaatgcatg tcaaagacag cat 83 <210> 127 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> CyOpA <400> 127 tccatgacgt tcctgaataa taaatgcatg tcaaagacag cat 43 <210> 128 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> CyCyCy <400> 128 tccatgacgt tcctgaataa ttccatgacg ttcctgaata attccatgac gttcctgaat 60 aat 63 <210> 129 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> Cy150-1 <400> 129 tccatgacgt tcctgaataa ttccatgacg ttcctgaata attccatgac gttcctgaat 60 aattggatga cgttggtgaa taattccatg acgttcctga ataattccat gacgttcctg 120 aataattcca tgacgttcct gaataattcc 150 <210> 130 <211> 253 <212> DNA <213> Artificial Sequence <220> <223> dsCyCpG-253 <400> 130 ctagaactag tggatccccc gggctgcagg aattcgattc atgacttcct gaataattcc 60 atgacgttgg tgaataattc catgacgttc ctgaataatt ccatgacgtt cctgaataat 120 tccatgacgt tcctgaataa ttccatgacg ttcctgaata attccatgac gttcctgaat 180 aattccatga cgttcctgaa taattccatg acgttcctga aaattccaat caagcttatc 240 gataccgtcg acc 253 <210> 131 <211> 12 <212> PRT <213> Artificial Sequence <220> P223 peptides containing a C-terminal GGC <400> 131 Lys Ala Val Tyr Asn Phe Ala Thr Met Gly Gly Cys 1 5 10

Claims (121)

(a) virus-like particles; (b) immunostimulatory substances that bind to virus-positive particles (a); And (c) A composition for enhancing an immune response in an animal comprising an antigen mixed with a virus-positive particle (a). The composition of claim 1, wherein the immunostimulatory material is a toll-like receptor activating material. The composition of claim 1, wherein the immunostimulatory material is a cytokine secretion inducing material. The toll-positive receptor activating material according to claim 2, wherein: (a) immunostimulatory nucleic acids; (b) peptidoglycan; (c) lipopolysaccharides; (d) lipothenic acid; (e) imidazoquinoline compounds; (f) flagellin; (g) lipoprotein; (h) immunostimulatory organic substances; (i) unmethylated CpG-containing oligonucleotides; (j) a group consisting of a mixture of at least one of (a), (b), (c), (d), (e), (f), (g), (h) and / or (i) Composition selected from. The method of claim 4 wherein the immunostimulatory nucleic acid is (a) ribonucleic acid; And (b) deoxyribonucleic acid, and (c) chimeric nucleic acid; And (d) a composition selected from the group consisting of a mixture of at least one nucleic acid of (a), (b) and / or (c). 6. The composition of claim 5, wherein the ribonucleic acid is poly- (I: C) or a derivative thereof. The method of claim 5 wherein the deoxyribonucleic acid (a) unmethylated CpG-containing oligonucleotides; (b) a composition selected from the group consisting of oligonucleotides lacking an unmethylated CpG motif. The composition of claim 1, wherein the immunostimulatory material is an unmethylated CpG-containing oligonucleotide. The oligonucleotide of claim 8, wherein the unmethylated CpG-containing oligonucleotide is represented by the sequence: 5'X ₁ X ₂ CGX ₃ X ₄ 3 'wherein X ₁ , X ₂ , X ₃ , and X ₄ are all nucleotides. The composition of claim 9, wherein at least one of the nucleotides X ₁ , X ₂ , X ₃ , and X ₄ has a backbone modification. The method of claim 8, wherein the unmethylated CpG-containing oligonucleotide is A composition comprising, alternatively essentially consisting of or alternatively consisting of a sequence selected from the group consisting of: The composition of claim 11, wherein the non-methylated CpG-containing oligonucleotide comprises one or more phosphorothioate modifications of the phosphate backbone, or wherein each phosphate site in the phosphate backbone of the oligonucleotide is phosphorothioate modification. 9. The composition of claim 8, wherein the CpG motif of the unmethylated CpG-containing oligonucleotide is part of a back and forth sequence. The composition of claim 13, wherein the palindromic sequence is GACGATCGTC (SEQ ID NO: 105). The composition of claim 8, wherein the unmethylated CpG-containing oligonucleotide comprises, alternatively consists essentially of, or alternatively consists of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 122). The composition of claim 13, wherein the unmethylated CpG-containing oligonucleotide comprises one or more phosphorothioate modifications of the phosphate backbone, or wherein each phosphate portion of the phosphate backbone of the oligonucleotide is phosphorothioate modification. The composition of claim 1, wherein the immunostimulatory material, and preferably the unmethylated CpG-containing oligonucleotides are noncovalently bound to the virus-positive particles. The composition of claim 1 wherein the immunostimulatory material, and preferably the unmethylated CpG-containing oligonucleotides, are packed in virus-positive particles. The composition of claim 13, wherein the front and rear reverse homologous sequences are located at their 3′-end and 5′-end side thereof by less than 10 guanosine entities. The composition of claim 19, wherein the front and back reverse homology sequence is GACGATCGTC (SEQ ID NO: 105). 20. The method of claim 19, wherein the anteroposterior and reverse homologous sequences are flanked by their at least 3 and up to 9 guanosine entities at their N-terminus and the anteroposterior and reverse homologous sequences are at least 6 and up to 9 guanosine entities A composition located on the C-terminal side. The oligonucleotide of claim 19 wherein the unmethylated CpG-containing oligonucleotide is A composition having a nucleic acid sequence selected from the group consisting of. 20. The method of claim 19, wherein the anteroposterior and reverse homologous sequences are flanked by at least 4 and up to 9 guanosine entities at their 5'-end flanks and the anteroposterior and reverse homologous sequences are at least 6 and up to 9 guanosine entities. Located on its 3'-terminal side, preferably, the back and forth reverse homologous sequence is located on its 5'-end side by at least 5 and up to 8 guanosine entities and the back and forth reverse homologous sequence is at least 6 and up to 8 A composition positioned at its 3'-terminal side by two guanosine entities. The composition of claim 19, wherein the unmethylated CpG-containing oligonucleotide has the nucleic acid sequence of SEQ ID 111. The method of claim 1 wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably an unmethylated CpG-containing oligonucleotide, is from about 6 to about 300 nucleotides, preferably from about 6 to about 100 nucleotides, And even more preferably from about 6 to about 40 nucleotides. The method of claim 1 wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably an unmethylated CpG-containing oligonucleotide, is from about 20 to about 300 nucleotides, preferably from about 20 to about 100 nucleotides, And even more preferably from about 20 to about 40 nucleotides. The composition of claim 1 wherein the immunostimulatory material is an immunostimulatory nucleic acid, and the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide, comprises about 10 to about 30 nucleotides. The method of claim 1 wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably an unmethylated CpG-containing oligonucleotide (a) recombinant oligonucleotides; (b) gene oligonucleotides; (c) synthetic oligonucleotides; (d) plasmid-derived oligonucleotides; (e) PCR products; (f) single-stranded oligonucleotides; And (g) a composition selected from double-strand oligonucleotides. The composition of claim 1 wherein the immunostimulatory material is an immunostimulatory nucleic acid and the immunostimulatory nucleic acid, and preferably the unmethylated CpG-comprising oligonucleotide (b) is surrounded by virus-positive particles (a). The method of claim 1 wherein the immunostimulatory material is an immunostimulatory nucleic acid and the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide, is a virus-selected from the group consisting of oligonucleotide binding site, DNA binding site and RNA binding site. A composition that is both particle sites. 33. The composition of claim 30, wherein the oligonucleotide binding site is a naturally occurring oligonucleotide binding site. 31. The composition of claim 30, wherein the virus-positive particle site comprises arginine-rich repeats. The oligonucleotide of claim 1, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide (b) comprises a phosphorothioate modification of at least one of the phosphate backbones, or the oligonucleotide A composition wherein each phosphate moiety in the phosphate backbone of (b) is a phosphorothioate modification. The composition of claim 1, wherein the virus-positive particles (a) lack a lipoprotein-containing envelope. The composition of claim 1, wherein the virus-positive particle (a) is a recombinant virus-positive particle. The method of claim 35, wherein (a) a recombinant polypeptide of hepatitis B virus; (b) recombinant polypeptides of measles virus; (c) a recombinant polypeptide of Sindbis virus; (d) recombinant polypeptides of rotaviruses; (e) recombinant polypeptides of bovine disease virus; (f) recombinant polypeptides of retroviruses; (g) recombinant polypeptides of Norwalk virus; (h) recombinant polypeptides of alphaviruses; (h) recombinant polypeptides of human papilloma virus; (i) recombinant polypeptides of the polyoma virus; (j) recombinant polypeptides of the bacteriophage; (k) RNA-phage recombinant polypeptides; (l) Qβ-phage recombinant polypeptides; (m) GA-phage recombinant polypeptides; (n) fr-phage recombinant polypeptides; (o) a recombinant polypeptide of AP 205-phage; (p) Ty's recombinant polypeptide; And (q) a composition selected from the group comprising fragments of any of the recombinant proteins from (a) to (p). 36. The composition of claim 35, wherein the virus-positive particles are hepatitis B virus core protein or BK virus VP1 protein. The method of claim 1 wherein the virus-positive particles are a) bacteriophage Qβ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage M11; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; l) bacteriophage PP7; m) A composition comprising a recombinant protein of RNA-phage, or a fragment thereof, selected from the group consisting of bacteriophage AP25. The composition of claim 1, wherein the virus-positive particle comprises a recombinant protein of RNA-phage, or a fragment thereof, wherein the RNA-phage is Qβ. The composition of claim 1, wherein the virus-positive particle comprises a recombinant protein of RNA-phage, or a fragment thereof, wherein the RNA-phage is fr or AP205. The method of claim 1, wherein the antigen or antigenic determinant is further (i) a binding portion that is not naturally occurring with the antigen or antigenic determinant; (ii) a composition comprising at least one second binding moiety selected from the group consisting of naturally occurring binding moieties with antigens or antigenic determinants. 42. The composition of claim 41, further comprising an amino acid linker comprising or alternatively consisting of a second binding moiety. The method of claim 1, wherein the antigen (c) is (a) a polypeptide; (b) lipoprotein; And (c) a composition selected from the group consisting of glycoproteins. The composition of claim 1, wherein antigen (c) is a recombinant antigen. The composition of claim 1, wherein the antigen (c) is isolated from a naturally occurring source. The method of claim 1 wherein the naturally occurring source is (a) pollen extract; (b) dust extracts; (c) dust mite extracts; (d) fungal extracts; (e) mammalian epidermal extracts; (f) feather extracts; (g) insect extracts; A composition selected from the group consisting of (h) food extracts, (i) hair extracts; (j) saliva extracts, and (k) serum extracts. The method of claim 1, wherein the antigen (c) is (a) a virus; (b) bacteria; (c) parasites; (d) prions; (e) tumors; (f) self-molecules; (g) non-peptidic hapten molecules; (h) allergens; And (i) hormones. The composition of claim 1, wherein the antigen (c) is an antigen. 49. The method of claim 48, wherein the tumor antigen is (a) Her2; (b) GD2; (c) EGF-R; (d) CEA; (e) CD52; (f) human melanoma protein gp 100; (g) human melanoma protein melan-A / MART-1; (h) tyrosinase; (i) NA17-A nt protein; (j) MAGE-3 protein; (k) p53 protein; (l) HPV16 E7 protein; (m) analogs of any of the antigens of (a) to (l); And (n) an anti-fraction fragment of any of the tumor antigens of (a)-(m). The composition of claim 1 wherein the antigen is an allergen. 49. The method of claim 48, wherein the allergen is (a) pollen extract; (b) dust extracts; (c) dust mite extracts; (d) fungal extracts; (e) mammalian epidermal extracts; (f) feather extracts; (g) insect extracts; And (h) food extracts; A composition derived from the group consisting of (i) hair extract; (j) saliva extract, and (k) serum extract. 51. The method of claim 50, wherein the allergen is (a) wood; (b) grass; (c) house dust; (d) house dust mites; (e) aspergillus; (f) animal hair; (g) animal feathers (h) bee venom; (i) animal products; And (j) a composition derived from the group consisting of plant products. The method of claim 1 wherein the antigen is (a) bee venom phospholipase A2; (b) Urticaria pollen Amb a 1; (c) birch pollen Bet vI; (d) white faced bumblebee bee venom 5 Dol m V; (e) house dust mite Der p 1; (f) house dust mites Der f 2; (g) house dust mite Der 2; (h) dust mites Lep d; (i) fungal allergen Alt a 1; (j) fungal allergen Aspf 1; (k) fungal allergens Aspf 16; And (l) a peanut allergen. The composition of claim 1, wherein the antigen (c) is a cytotoxic T cell epitope, Th cell epitope or a combination of at least two of said epitopes, wherein at least two epitopes bind directly or by a linking sequence. The method of claim 42, wherein the cytotoxic T cell epitope is selected from (a) a viral epitope; (b) tumor epitopes; And (c) an allergen epitope. (a) virus-positive particles; (b) immunostimulatory substances that bind to virus-positive particles (a); And (c) A method of enhancing an immune response in an animal comprising introducing into the animal a composition comprising an antigen mixed with the virus-positive particle (a). 59. The method of claim 56, wherein the immunostimulatory material is a toll-like receptor activating material. 59. The method of claim 56, wherein the immunostimulatory agent is a cytokine secretion inducer. 59. The toll-positive receptor activating material of claim 57, wherein: (k) immunostimulatory nucleic acids; (l) peptidoglycan; (m) lipopolysaccharides; (n) lipothenic acid; (o) imidazoquinoline compounds; (p) flagellin; (q) lipoprotein; (r) immunostimulatory organic substances; (s) unmethylated CpG-containing oligonucleotides; (t) a group consisting of a mixture of at least one of (a), (b), (c), (d), (e), (f), (g), (h) and / or (i) Selected from. 60. The method of claim 59, wherein the immunostimulatory nucleic acid is (a) ribonucleic acid; And (b) deoxyribonucleic acid, and (c) chimeric nucleic acid; And (d) selected from the group consisting of a mixture of at least one nucleic acid of (a), (b) and / or (c). 61. The method of claim 60, wherein the ribonucleic acid is poly- (I: C) or a derivative thereof. 61. The method of claim 60, wherein the deoxyribonucleic acid is (a) unmethylated CpG-containing oligonucleotides; (b) selected from the group consisting of oligonucleotides lacking an unmethylated CpG motif. The method of claim 56, wherein the immunostimulatory material is an unmethylated CpG-containing oligonucleotide. 64. The oligonucleotide of claim 63, wherein the unmethylated CpG-containing oligonucleotides comprise: 5'X ₁ X ₂ CGX ₃ X ₄ 3 ', wherein X ₁ , X ₂ , X ₃ , and X ₄ are all nucleotides. The method of claim 64, wherein at least one of the nucleotides X ₁ , X ₂ , X ₃ , and X ₄ has a backbone modification. 66. The method of claim 63, wherein the unmethylated CpG-containing oligonucleotide is A method comprising, alternatively essentially consisting of, or alternatively consisting of, a sequence selected from the group consisting of: 67. The method of claim 66, wherein the unmethylated CpG-containing oligonucleotide comprises one or more phosphorothioate modifications of the phosphate backbone, or wherein each phosphate site in the phosphate backbone of the oligonucleotide is a phosphorothioate modification. 64. The method of claim 63, wherein the CpG motif of the unmethylated CpG-containing oligonucleotide is part of a forward and backward homologous sequence. The method of claim 68, wherein the forward and backward reverse homology sequence is GACGATCGTC (SEQ ID NO: 105). 64. The method of claim 63, wherein the unmethylated CpG-containing oligonucleotide comprises, alternatively consists essentially of, or alternatively consists of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 122). The method of claim 68, wherein the non-methylated CpG-containing oligonucleotide comprises one or more phosphorothioate modifications of the phosphate backbone, or wherein each phosphate site in the phosphate backbone of the oligonucleotide is a phosphorothioate modification. 59. The method of claim 56, wherein the immunostimulatory material, and preferably the unmethylated CpG-containing oligonucleotides are noncovalently bound to the virus-positive particles. The method of claim 56, wherein the immunostimulatory material, and preferably the unmethylated CpG-containing oligonucleotides, are packed in virus-positive particles. 69. The method of claim 68, wherein the front and back reverse homologous sequences are located on their 3'-end and their 5'-end sides by less than 10 guanosine entities. 75. The method of claim 74, wherein the forward and backward reverse homology sequence is GACGATCGTC (SEQ ID NO: 105). 75. The method of claim 74, wherein the anteroposterior reverse homologous sequence is flanked by its at least 3 and at most 9 guanosine entities at its N-terminus and the anteroposterior reverse homologous sequence is at least 6 and at most 9 guanosine entities Located on the C-terminal side. 75. The method of claim 74, wherein the unmethylated CpG-containing oligonucleotide is A method having a nucleic acid sequence selected from the group consisting of. 75. The method of claim 74, wherein the anteroposterior and reverse homologous sequences are flanked by at least 4 and at most 9 guanosine entities at their 5'-end flanks and the anteroposterior and reverse homologous sequences are at least 6 and at most 9 guanosine entities. Located on its 3'-terminal side, preferably, the back and forth reverse homologous sequence is located on its 5'-end side by at least 5 and up to 8 guanosine entities and the back and forth reverse homologous sequence is at least 6 and up to 8 Located on its 3'-terminal side by two guanosine entities. 75. The method of claim 74, wherein the unmethylated CpG-containing oligonucleotide has the nucleic acid sequence of SEQ ID 111. 57. The method of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably an unmethylated CpG-containing oligonucleotide, is from about 6 to about 300 nucleotides, preferably from about 6 to about 100 nucleotides, And even more preferably from about 6 to about 40 nucleotides. 59. The method of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably an unmethylated CpG-containing oligonucleotide, is from about 20 to about 300 nucleotides, preferably from about 20 to about 100 nucleotides, And even more preferably from about 20 to about 40 nucleotides. The method of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide comprises about 10 to about 30 nucleotides. 57. The method of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably an unmethylated CpG-containing oligonucleotide (a) recombinant oligonucleotides; (b) gene oligonucleotides; (c) synthetic oligonucleotides; (d) plasmid-derived oligonucleotides; (e) PCR products; (f) single-stranded oligonucleotides; And (g) a method selected from double-strand oligonucleotides. 59. The method of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide (b) is surrounded by virus-positive particles (a). 57. The virus-binding compound of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, and the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide, is selected from the group consisting of an oligonucleotide binding site, a DNA binding site and an RNA binding site. Method of positive particle site. 86. The method of claim 85, wherein the oligonucleotide binding site is an naturally occurring oligonucleotide binding site. 86. The method of claim 85, wherein the virus-positive particle site comprises arginine-rich repeats. The oligonucleotide of claim 56, wherein the immunostimulatory material is an immunostimulatory nucleic acid, the immunostimulatory nucleic acid, and preferably the unmethylated CpG-containing oligonucleotide (b) comprises a phosphorothioate modification of one or more of the phosphate backbones, or wherein said oligonucleotide wherein each phosphate moiety in the phosphate backbone of (b) is a phosphorothioate modification. The method of claim 56, wherein the virus-positive particle (a) lacks a lipoprotein-containing envelope. The method of claim 56, wherein the virus-positive particle (a) is a recombinant virus-positive particle. The method of claim 35, wherein (a) a recombinant polypeptide of hepatitis B virus; (b) recombinant polypeptides of measles virus; (c) a recombinant polypeptide of Sindbis virus; (d) recombinant polypeptides of rotaviruses; (e) recombinant polypeptides of bovine disease virus; (f) recombinant polypeptides of retroviruses; (g) recombinant polypeptides of Norwalk virus; (h) recombinant polypeptides of alphaviruses; (h) recombinant polypeptides of human papilloma virus; (i) recombinant polypeptides of the polyoma virus; (j) recombinant polypeptides of the bacteriophage; (k) RNA-phage recombinant polypeptides; (l) Qβ-phage recombinant polypeptides; (m) GA-phage recombinant polypeptides; (n) fr-phage recombinant polypeptides; (o) a recombinant polypeptide of AP 205-phage; (p) Ty's recombinant polypeptide; And (q) a method comprising a fragment of any of the recombinant proteins from (a) to (p). The method of claim 35, wherein the virus-positive particles are hepatitis B virus core protein or BK virus VP1 protein. The method of claim 56, wherein the virus-positive particles are a) bacteriophage Qβ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage M11; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; l) bacteriophage PP7; m) A method comprising a recombinant protein of RNA-phage, or a fragment thereof, selected from the group consisting of bacteriophage AP25. The method of claim 56, wherein the virus-positive particle comprises a recombinant protein of RNA-phage, or a fragment thereof, wherein the RNA-phage is Qβ. The method of claim 56, wherein the virus-positive particle comprises a recombinant protein of RNA-phage, or a fragment thereof, wherein the RNA-phage is fr or AP205. The method of claim 56, wherein the antigen or antigenic determinant is further (i) a binding portion that is not naturally occurring with the antigen or antigenic determinant; (ii) a method comprising at least one second binding moiety selected from the group consisting of naturally occurring binding moieties with antigens or antigenic determinants. 97. The method of claim 96, further comprising an amino acid linker comprising or alternatively consisting of a second binding moiety. The method of claim 56, wherein the virus-positive particles are produced in a bacterial expression system, yeast expression system or mammalian expression system. The method of claim 56, wherein the antigen (c) is (a) a polypeptide; (b) lipoprotein; And (c) a method selected from the group consisting of glycoproteins. The method of claim 56, wherein the antigen (c) is a recombinant antigen. The method of claim 56, wherein the antigen (c) is isolated from a naturally occurring source. 102. The method of claim 101, wherein the naturally occurring source is (a) pollen extract; (b) dust extracts; (c) dust mite extracts; (d) fungal extracts; (e) mammalian epidermal extracts; (f) feather extracts; (g) insect extracts; (h) food extract, (i) hair extract; (j) saliva extract, and (k) serum extract. The method of claim 56, wherein the antigen (c) is (a) a virus; (b) bacteria; (c) parasites; (d) prions; (e) tumors; (f) self-molecules; (g) non-peptidic hapten molecules; (h) allergens; And (i) a hormone. The method of claim 56, wherein the antigen (c) is an antigen. 83. The method of claim 82, wherein the tumor antigen is (a) Her2; (b) GD2; (c) EGF-R; (d) CEA; (e) CD52; (f) human melanoma protein gp 100; (g) human melanoma protein melan-A / MART-1; (h) tyrosinase; (i) NA17-A nt protein; (j) MAGE-3 protein; (k) p53 protein; (l) HPV16 E7 protein; (m) analogs of any of the antigens of (a) to (l); And (n) an anti-fragment fragment of any of the tumor antigens of (a)-(m). The method of claim 56, wherein the antigen is an allergen. 107. The method of claim 106, wherein the allergen is (a) pollen extract; (b) dust extracts; (c) dust mite extracts; (d) fungal extracts; (e) mammalian epidermal extracts; (f) feather extracts; (g) insect extracts; And (h) food extracts; A method derived from the group consisting of (i) hair extract; (j) saliva extract, and (k) serum extract. 107. The method of claim 106, wherein the allergen is (a) wood; (b) grass; (c) house dust; (d) house dust mites; (e) aspergillus; (f) animal hair; (g) animal feathers (h) bee venom; (i) animal products; And (j) derived from the group consisting of plant products. The method of claim 56, wherein the antigen is (a) bee venom phospholipase A2; (b) Urticaria pollen Amb a 1; (c) birch pollen Bet vI; (d) white faced bumblebee bee venom 5 Dol m V; (e) house dust mite Der p 1; (f) house dust mites Der f 2; (g) house dust mite Der 2; (h) dust mites Lep d; (i) fungal allergen Alt a 1; (j) fungal allergen Aspf 1; (k) fungal allergens Aspf 16; And (l) peanut allergens. The method of claim 56, wherein the antigen (c) is a cytotoxic T cell epitope, Th cell epitope or a combination of at least two of said epitopes, wherein at least two epitopes bind directly or by a linking sequence. 112. The method of claim 110, wherein the cytotoxic T cell epitope is selected from (a) viral epitopes; (b) tumor epitopes; And (c) an allergen epitope. The method of claim 56, wherein the immune response is an enhanced B cell response, an enhanced T cell response, or a CTL response. 112. The method of claim 112, wherein the T cell response is a Th cell response. 116. The method of claim 113, wherein the Th cell response is a Th1 cell response. The method of claim 56, wherein the animal is a mammal, preferably a human. The method of claim 56, wherein the composition is introduced into the animal subcutaneously, intramuscularly, intravenously, intranasally or lymph node directly. A vaccine comprising an immunologically effective amount of the composition of claim 1 together with a pharmaceutically acceptable diluent, carrier or excipient. 118. The vaccine of claim 117, further comprising an adjuvant. A method of immunizing or treating an animal comprising administering to the animal an immunologically effective amount of the vaccine of claim 117. 119. The method of claim 119, wherein the animal is a mammal, preferably a human. Use of the composition of claim 1 or the vaccine of claim 117 in the manufacture of a medicament for treating a disease or condition comprising allergy, tumors, chronic diseases and chronic viral diseases, preferably consisting of groups.