KR20040050344A - Cancer apoptotic indication vector and cancer apoptotic expression promoter - Google Patents

Abstract

PURPOSE: A cancer apoptotic indication vector and a cancer apoptotic expression promoter are provided, thereby screening compounds selectively inducing the apoptosis of various cancer cells. CONSTITUTION: The cancer apoptotic indication vector comprises p53 DNA binding motif comprising the common DNA binding sequence of p53 having the nucleotide sequence set forth in SEQ ID NO: 1; a minimum promoter of thymine kinase gene of Herpes simplex virus at nucleotide position -81 to +52; and a detection marker bound to the promoter selected from luciferase, beta-galactosidase and green fluorescent protein, wherein the vector may further comprises a selection marker selected from zeosine, hygromycine and neomycin. The cancer apoptotic expression promoter hBubR1/hMad3 has the nucleotide sequence set forth in SEQ ID NO: 2.

Description

Cancer cell death marker vector and cancer cell death expression promoter {CANCER APOPTOTIC INDICATION VECTOR AND CANCER APOPTOTIC EXPRESSION PROMOTER}

[Industrial use]

The present invention relates to cancer cell death marker vectors, cancer cell death expression promoters and cancer cell death cell lines, and more particularly to effectively effect cancer cell killing effects of tumor suppressor candidate chemicals capable of specifically killing cancer cell death. Cancer cell death marker vectors, cancer cell death expression promoters, and cancer cell death cell lines that can be measured.

[Prior art]

At present, various methods of physicochemistry, immunology, and genetic therapy have been attempted based on studies on various developmental mechanisms. However, cancer treatment is not effective due to its effects and limitations of application.

Recent studies have shown that the formation of aneuploids, polyploids, and hyperploids (hereafter referred to as dimers, diploids, and orchards) is important in the early stages of almost all cancer cells. It has been found that most malignant tumor cells are diploid cells, and the importance of diploids has been highlighted (Cancer Biology, 1999, 9, 289-302; Nature, 1998, 396, 643-649). ; 36, 3-12; Am. J. Pathol., 1998, 152, 495-503; J. Natl. Cancer Inst., 1995, 87, 1694-1704; Nature, 1997, 386, 623-627; Cancer, 1996, 77, 315-320; Int. J. Cancer, 1989, 44, 828-832, etc.).

In particular, in a recent publication, the formation of dimers using all stored malignant tumor cells of the American Cell Line Bank (ATCC) showed that dimers that were not observed in normal cells were observed in almost all malignant tumor cells. Cancer Biology, 1999, 9, 289-302). This proves that the most representative phenomenon in the transformation of normal cells to cancer cells is the formation of a dimer.

A brief review of the causes of the diploids has shown that in vitro and in vivo experiments in many human or animal cells are directly related to neoplastic transformation and immortalization of cells. . Neoplastic transformation and immortalization of cells are induced by oncogenic viruses, chemical carcinogens, ionizing radiation and the like and are often caused by mutations in genes. Eventually, structural abnormalities and changes in cell growth of these cells have a direct effect on the genome and eventually lead to chromosomal instability (CIN), which causes dimers (Nature, 1998. 396. 643-649). Cell, 2000. 100. 57-70; PNAS, 2000. 97. 3236-3241). Recent studies have shown that chromosomal destabilized cells, caused by mitotic damage sustained in the mitosis cell cycle, escape the cell death mechanism, resulting in dimers. The resulting dimeric cells cause accelerated malignant progression of cancer.

Cancer research, on the other hand, focuses on mutations and carcinogens of specific genes and signals, cell cycle pathways, or related genetic changes caused by a variety of causes and understands these mechanisms of cancer formation over the past decades. In order to do that I have made a huge effort. Cancer formation mechanisms proceed by long-term multi-steps, not just as a result of deregulation of specific cell cycle checkpoints. In the multi-checkpoint process, cancer formation progresses due to various causes, but as mentioned above, dimers are observed in many tumor cells as a common phenomenon. Thus, dimers are emerging as new approaches for cancer treatment.

Regarding the methods that can be used for cancer treatment, it is important to obtain a diploid clone to screen chemical tumor suppressor candidate chemicals that can induce malignant tumor cells caused by the diploid into a cell death pathway. Although many of the existing malignant tumor cells are anueploid-prone cells, the construction of dimeric clones in which the genetic traits of dimer formation have been amplified by inducing chromosomal instability in vivo and in vitro It has the advantage of maximizing the genetic biochemical specificity of the diploid cell (FIG. 1).

Most cancer chemotherapy agents developed so far focus on the function of delaying or inhibiting the growth of cancer cells by activating the apoptosis mechanism of cancer cells. However, the development of cancer cell specific cell death inducing chemicals is very urgent because many chemotherapy agents have a serious side effect of inducing artificial cell death mechanisms not only specific to cancer cells but also causing normal cell death.

It is an object of the present invention to provide a cancer cell killing marker vector which specifically expresses only cancer cells using a cell killing mechanism required for developing cancer cells, in particular, cell death inducing chemicals.

Another object of the present invention is to provide a novel cancer cell death expression promoter that induces cell death marker expression.

1 is a schematic diagram of a system for screening chemical tumor suppression candidate chemicals that treat blast cells and pluripotent stem cells with chemical tumor suppression candidate chemicals to selectively induce only apoptotic cells into apoptosis pathways.

2 is a diagram showing a cancer cell death marker vector according to one embodiment of the present invention.

FIG. 3A shows an actinomycine D (actinomycine D: Act D, nocodazole: HL-p53pα cell line including the cell death marker vector of the present invention), which is an apoptosis-inducing chemical (existing chemical anticancer agent). Noco) and paclitaxel, followed by measurement of luciferase activity.

FIG. 3B shows luciferase activity after treatment of M-p53pα cell line comprising the cell death marker vector of the present invention with actinomycin D and nocodazole, which are apoptosis-inducing chemicals (existing chemical anticancer agents). FIG. Graph shown by.

FIG. 3C shows luciferase activity after treatment of HG-p53p cell line comprising the cell death marker vector of the present invention with actinomycin D and nocodazole, which are apoptosis-inducing chemicals (existing chemical anticancer agents). Graph shown by.

4 shows a sequence of a hBubR1 / hMad3 promoter according to another embodiment of the present invention.

5A shows a cell death marker vector comprising a hBubR1 / hMad3 promoter according to another embodiment of the present invention.

Figure 5b is a graph showing the luciferase activity of a cell death marker vector comprising the hBubR1 / hMad3 promoter of the present invention and a cell death marker vector comprising the SV40 promoter and a control without a promoter.

FIG. 5C shows apoptosis marker vector comprising the SV40 promoter used in FIG. 5B and a promoter-free control. FIG.

FIG. 6 is a cell death pathway following the injection of a cell death marker vector comprising a caspase-3 cleavage site in the gene encoding luciferase and comprising the hBubR1 / hMad3 promoter, and treatment of tumor suppressor candidate chemicals. Fig. Explains a mechanism for investigating the degree of cell death by measuring the activity of apoptosis markers by inducing the active kespase-specific cleavage of the luciferase protein by the activation of.

7A is a graph showing luciferase activity of a cell line comprising the hBubR1 / hMad3 promoter of the present invention.

Figure 7b shows the luciferase activity measured by selecting a clone comprising a luciferase gene whose expression is regulated by the hBubR1 / hMad3 promoter using a cell line comprising the hBubR1 / hMad3 promoter of the present invention as a selector graph.

Figure 8 is a graph showing the number of dimeric cell lines formed by cell culture of each cell line prepared by transfecting the cell death marker of the present invention and treated with various concentrations of anti-microtuble agent.

9 is a map showing a pXP2 vector used in an embodiment of the present invention.

In order to achieve the above object, the present invention provides a p53 DNA binding motif comprising the consensus DNA binding sequence of p53 of SEQ ID NO: 1; Minimal promoter; And it provides a cancer cell death marker vector comprising a marker coupled to the promoter.

The invention also provides a hBubR1 / hMad3 cancer cell death marker expression promoter of SEQ ID NO: 2.

The present invention also provides a cancer cell killing marker vector comprising the expression promoter and a marker bound to the promoter.

Hereinafter, the present invention will be described in more detail.

The present invention relates to cancer cell killing marker vectors that can be usefully used to screen whether tumor suppressor candidate chemicals to be used as anticancer agents selectively kill cancer cells.

The cancer cell death marker vector is bound to the p53 DNA binding motif, the minimum promoter and the promoter comprising the consensus DNA binding sequence of p53 of SEQ ID NO: 1, as shown in FIG. Contains markers.

The p53 gene used in the present invention is a tumor suppressor gene, and in many studies, a gene known to activate p53, a tumor suppressor gene under cell death conditions, inhibits cell cycle progression and further promotes cell death. In fact, however, in many tumor cells, the p53 gene is mutated or inactivated. However, some mutant p53 genes have been reported to be able to function normally in cell death mechanisms, and p53 analogues of p63 and p73, which are p53 analogues, are down-stream target gene expression in tumor cells in which p53 is inactivated. Is reported to play a similar role to p53.

Based on the above, in the present invention, p53 was considered to be a preferable gene as a cell death marker for screening tumor suppression candidate chemicals that induce cell death and was used as a common DNA sequence for inducing cell death in p53. The present invention was completed by identifying the sequence of SEQ ID NO: 1.

As the promoter, a minimal promoter having only the minimum element necessary for initiation of transcription is used. As a representative example, a minimal promoter of the herpes simplex virus thymidine kinase gene (HSV-tk) (-81 to +52).

As the marker, luciferase, β-galactosidase, or green fluorescence protein, which are mainly used as marker genes, may be used.

The vector of the present invention may further include a selectable marker selected from the group consisting of Geosine, Hygromycine and Neomycin.

The cancer cell death marker vector of the present invention having such a configuration can be used for screening tumor suppressor candidate chemicals depending on the expression of the p53 gene.

The initial cell line was prepared by transplanting the cancer cell death marker vector into parental cells such as HeLa, MCF-7 and HepG2.

Dimeric cell lines comprising the vectors can be usefully used for screening dimeric cell specific cell death induction candidate chemicals (tumor inhibition candidate chemicals). The dimer cell line is first treated with various concentrations of anti-microtuble agent during the somatic cell division of the initial cell line. As the antimicrobial agent, nocodazole, vincristine, vinblastine or paclitaxel can be used.

Such treatment with antimicrobial agents causes mitotic defects in the cells and most cells are selectively removed by inducing apoptosis, but some cells are missing somatic cell divisions observed in many malignant tumor cells. Adaptation occurs with the function retained. In order to increase the screening efficiency of cells in which such adaptation has occurred, the survival rate of abnormal somatic cell division of cells was increased by treating with a caspase inhibitor, and the vector of the vector was obtained by selectively separating and culturing the clones of surviving cells. Produces a dimeric cell line comprising.

The promoter inducing cell death expression of the present invention is the hBubR1 / hMad3 promoter of SEQ ID NO: 2. In SEQ ID NO: 2, the nucleotide sequence of human genomic DNA located at 5 of the hBubR1 / hMad3 coding exon was cloned using the PCR method, and the arrow in FIG. 4 showing SEQ ID NO: 2 indicates a tentative transcription start site. This promoter can analyze target proteins that increase the level of transcription of hBubR1 / hMad3 , can screen compounds that increase the level of transcription of hBubR1 / hMad3 , and can be applied as a new promoter to induce expression of cell death markers. have.

Bub / Mad mitotic checkpoint protein plays an important role in monitoring the separation of chromosomes that cause dimer formation. In particular, BubR1 / Mad3 is known to play an important role in the activation of somatic cell checkpoints, as reported in recent literature (J. Cell Biol., 1999, 146, 941-954, J. Cell Biol). , 1998, 142, 1-11, J. Cell Biol., 1998, 143, 9-13, Dev. Cell, 2001, 1, 227-237). In addition, inactivation of BubR1 / Mad3 was observed in malignant tumor cells (Nature, 1998, 392, 300-303), and recently, transcription of BubR1 / Mad3 (Cancer Res., 2002, 62, 13-17). It was observed that the regulation of activity was directly related to dimer formation.

In addition, according to our study, it was observed that the regulation of activity at the post-translational level is directly related to dimer formation. In addition, the present inventors have found that BubR1 / Mad3 is an important regulator of induction of apoptosis of dimeric cells after somatic cell division checkpoint, and BubR1 / Mad3 is produced by dimertic cells because it has a function in inducing strong apoptosis. The researchers also found that they also have the effect of inhibiting tumors in nude mice.

Since the regulation of transcriptional activity of BubR1 / Mad3, the regulation of activity at post-translational level, and the degree of protein stabilization are important regulators of dimer formation that may be directly related to the initiation of tumor formation, the operation of the BubR1 / Mad3 promoter is a new promoter. In addition to the characteristics of the cloned to operate the system for inducing the expression of apoptosis markers by increasing the transcriptional activity of BubR1 / Mad3 has a dual action to search for candidate chemicals having the effect of increasing the apoptosis function.

According to this theoretical cause, the cloned hBubR1 / hMad3 promoter of about 600 base pairs has a very strong transcriptional activity (Figs. 4, 5A, 5B).

The vector comprising the promoter includes the promoter and a marker gene linked to the promoter (FIG. 5A). As marker genes, luciferase, β-galactosidase or green fluorescent genes can be used. This vector can be usefully used to screen for tumor suppressor candidate chemicals that can activate hBubR1 / hMad3 .

In addition, when preparing a vector including the promoter, introducing a site (common binding sequence: DEVD) that can be cleaved by caspase-3 into a marker gene is sensitive to the tumor suppression candidate chemical. It is preferable to increase the. Kespase-3 is an enzyme that has been shown to be directly functionally related to the activity of kespase-3 in somatic cell apoptosis, according to several recent reports and our experiments (Shin and Lee et al. , unpubished observation, Cancer Cell Int, 2001, 1, 1-7, Genes Dev. 1996, 10, 2621-2631). In addition, when the kespase-3 activation pathway was blocked in cells that abnormally escaped mitotic arrest, damaged cells and abnormal cells escaped from the apoptosis pathway. This suggests that activated kespase-3 is an important regulator of apoptosis in damaged or abnormal cells following activation of the somatic division checkpoint. Therefore, cloning a site cleaved by kespase-3 in an apoptosis marker activates a case where the tumor suppressor candidate chemical is used to screen for tumor suppressor candidate chemicals that can induce apoptosis pathways of dimeric cells in the future. Since the cleavage of the marker gene protein by Faze-3 can be induced, it can be applied as a cell death marker by measuring the marker gene activity.

A method for measuring the activity of tumor suppressor candidate chemicals using a marker vector comprising a marker gene having a site cleaved by kespase-3 and a hBubR1 / hMad3 promoter is shown schematically in FIG. 6. That is, a plasmid DNA is prepared by inserting a sequence encoding a site cleaved by kespase- 3 (DEVD) into a marker gene in which transcriptional activity is induced by the cloned hBubR1 / hMad3 promoter. After infecting the DNA with the parental cells, the clones are selected using geocin to obtain stably expressed clones, which are in turn formed into dimeric cell lines, which are then cultured and treated with candidate tumor suppressor chemicals. In this case, the compound that induces the dimer cell line to the cell death pathway causes the cleavage of the DEVD motif in the marker gene protein by activated kespase-3, resulting in very low luciferase activity.

The method for producing a dimeric cell line comprising the hBubR1 / hMad3 promoter of the present invention is the same as the method for producing a cell line comprising the p53 related vector.

Hereinafter, preferred embodiments of the present invention will be described. However, the following examples are only preferred embodiments of the present invention, and the present invention is not limited thereto.

Example 1 Construction of Cell Line Including p53-response Element

The HSV1-tk promoter (140 bp) was cloned into BamHI and BglII in BglII, one of the multicloning sites ahead of the luciferase gene in the pXP2 vector (FIG. 9). 13 copies of the p53 binding element sequence (5'-CCTGCCTGGACTTGCCTGG-3 ') synthesized in front of this promoter was cloned using the multicloning sites HindIII and SmaI sites of pXP2 to prepare a pTG13 vector. .

As a selection marker for making a stable cell line in the pTG13 vector thus prepared, PCR amplified the geocin portion of pVgRXR (Invitrogen) (S: 5'-agtaagcttttagggtgtggaaagtccccagg-3 ', AS: 5'agtaagcttggatccagacatgataagata3') The pTG13-Zeo vector was prepared by cleavage with HindIII made on both sides of the PCR product and insertion at the HindIII site in front of the p53 binding element sequence of the pTG13 vector.

The pTG13-Zeo vector thus constructed was transfected with HeLa, HepG2, and MCF-7 using lipofectamine (Invitrogen), followed by 400 g / ml (HeLa cell) and 80 g / ml of invitrogen, respectively. (Mcf7 cell), 200 g / ml (HepG2) was treated for about a month to obtain a cell line containing the p53-response factor. This cell line is shown in Table 1 below.

Obtained Cell Line Blast Marker HL-p53pα HeLa Luciferase HL-p53pβ HeLa Green fluorescent protein M-p53p MCF-7 Luciferase HG-p53p HepG2 Luciferase

Colonies were harvested, transferred to 24 wells, incubated and subdivided into 12 wells for treatment of luciferase by treatment with actimomycin D (20 ng / ml), nocodazole and paclitaxel to induce p53 expression the next day. Luciferase activity was measured and the results are shown in FIGS. 3A, 3B and 3C, respectively. Actimomycin D, nocodazole and paclitaxel used to induce expression are chemical anticancer agents known to have many side effects due to excessive cell death. According to the results shown in Figures 3A, 3B and 3C, the luciferase activity increases with increasing use of actimomycin D, nocodazole and paclitaxel, so these conventionally used anticancer agents increase p53 gene expression to kill cancer cells. It can be seen that it is an anticancer agent.

Example 2 hBub R1 / hMad3 promoter

By combining the primers (S: 5'-ctagctagcatgtaacccatttcctcaggcctcagacct-3 ', AS: 5'-ctaagatctcctctgggccacagaccgcctgggctttct-3') with 293 cells, the 5 'upstream region of hBub R1 / hMad3 was found using the Gene Bank. Obtained by amplifying both sequences. The promoter of SEQ ID NO: 2 was prepared by cloning the amplified sequence of hBub R1 / hMad3 using HindIII and SmaI sites, which are multicloning sites of the pXP2 vector.

PCR product was used to amplify the geocin portion of pVgRXR (Invitrogen) by PCR as a selection marker for making stable cell lines on the prepared hBub R1 / hMad3 promoter (S: 5'-agtaagcttttagggtgtggaaagtccccagg-3 ', AS: 5'agtaagcttggatccagacatgataagata3') PCR product Using both HindIII sites, we cloned geocin into HindIII at the hBub R1 / hMad3 promoter and HindIII site at pXP2. The truncated upstream region of 1.7 kb showed no promoter activity.

Divide the cells into 2 x 10 ⁵ cells in a 60 mm dish the next day with a 1.3Kb sized 5 'upstream site containing the hBub R1 / hMad3 promoter region, a luciferase gene whose expression is regulated, and geosine, an optional marker. The vector was infected. Infection used the calcium phosphate method. After 14 hours, the medium was washed and treated with trypsin after 36 hours, and then divided into 1 × 10 ⁵ pieces in a 100 mm dish and selected as 400 g / ml of geocin for 15 days. When colonies were generated, each was divided into 24 wells, cultured, and collected to obtain a cell line. The cell lines obtained are shown in Table 2 below.

Blast Marker HL-M3p HeLa Sites cleaved by luciferase w / kespase-3 M-M3p MCF-7 Side cleaved by luciferase w / kespase-3

Luciferase activity of the obtained cell line was measured and the results are shown in FIG. 5B. The method of measuring transcriptional activity was performed by inserting the promoter into a luciferase plasmid containing no hBubR1 / hMad3 promoter and performing transient transfection to HeLa and MCF-7 cells, respectively, followed by β, which is an internal control of infection. As a relative value for galactosidase activity, this value allows a relative comparison of the effectiveness of infection of luciferase expression vectors expressed by apoptosis inducing marker gene promoters. As shown in FIG. 5C, the control group used a luciferase plasmid without a promoter and a luciferase plasmid with an SV40 promoter. According to the results shown in FIG. 5B, the cloned hBubR1 / hMad3 promoter of the present invention has a very strong transcriptional activity.

In addition, the luciferase activity of the cell lines shown in Table 2 was measured and the results are shown in FIG. 7A. Also, the cell lines shown in Table 2 were regulated by the hBubR1 / hMad3 promoter using geocin , the selection marker. Clones containing the lase gene were selected to measure luciferase activity, and the results are shown in FIG. 7B. According to the results shown in FIGS. 7A and 7B, one can predict that the cell lines shown in Table 2 can be used to screen for cancer cell death candidate chemicals.

Example 3 Preparation of Dimeric Cell Line

The initial cell lines shown in Tables 2 and 3, respectively, were placed in a cell culture dish, and then treated with various concentrations of nocodazole anti-microtubules after 24 hours during somatic division to cause abnormal microtuble function. The preliminary experimental results showed that the antimicrobial agent was removed and the cells were washed with fresh medium at the time when the population of dimeric cells increased.

As such, treatment with antimicrobial agents results in mitotic defects in the cells and most cells are selectively removed by inducing apoptosis mechanisms, but some cells have a defective somatic division observed in many malignant tumor cells. Adaptation occurred and survived.

Cultivate the cells until some of the surviving cells are formed into colonies and, depending on the cell line, in the case of cell lines with faster cell death rate than colony formation, the caspase inhibitors (z-DEVD, z-VAD, z-IETD or z-LEHD, Cell culture was continued by increasing the viability of cells by commercially available from Calbiochem) and collecting single colonies that eventually formed. Some of the cultured cells were collected and stained with propidium iodide, and then the dimer cells were selected by examining the DNA content using fluorescence cytometry. The measured DNA content results are shown in FIG. 8. As shown in Figure 8, the DNA content of the cell line obtained from the parental cells can be seen that double the dimer was formed.

The resulting dimer cell lines and screening markers of each cell line are shown in Table 3 below.

Cell line Blast Screening markers DNA Content AHL-p53p HL-p53pa Luciferase 4N / 8N: 2N / 4N AM-p53p M- p53pa Luciferase 4N / 8N: 2N / 4N AHG-p53p HG-p53 Luciferase 4N / 8N: 2N / 4N AHL-M3p HL-M3p Luciferase w / DEVD motif 4N / 8N: 2N / 4N AM-M3p M-M3p Luciferase w / DEVD motif 4N / 8N: 2N / 4N AHG-M3p HG-M3p Luciferase w / DEVD motif 4N / 8N: 2N / 4N

p53: p53-DNA binding motif with thymidine kinase minimal promoter

M3: hBubR1 / hMad3 promoter

DEVD motif: site cleaved by kespase-3

Cancer cell death vectors and promoters of the present invention can be applied for the screening of compounds (tumor inhibition candidate chemicals) that can selectively induce apoptosis of various malignant tumor cells. In addition, the apoptotic cell lines including the vector and the promoter may be used to evaluate cell killing efficacy of the dimeric cell lines using chemical anticancer agents used in the past or so far. In addition, the present invention applies the candidate chemicals in common to a dimeric cell line containing a p53-response factor, to a cell line whose apoptosis is assessed by the hBubR1 / hMad3 promoter and kespase- 3 activity. The screening effect can be obtained. In addition, it is possible to search for apoptosis-inducing compounds that specifically act on dimeric cell lines since the parental cell line before the dimer cell line production is used as a control.

Claims (8)

A p53 DNA binding motif comprising the consensus DNA binding sequence of p53 of SEQ ID NO: 1; Minimal promoter; And Marker bound to the promoter Cancer cell death marker vector comprising a. The cancer cell death marker vector according to claim 1, wherein the promoter is a minimal promoter of the herpes simplex virus thymidine kinase gene at the positions -81 to +52. The cancer cell death marker vector of claim 1, wherein the marker is selected from the group consisting of luciferase, β-galactosidase, and green fluorescent protein. The cancer cell death marker vector of claim 1, wherein the vector further comprises a selection marker selected from the group consisting of geocin, hygromycin, and neomycin. HBubR1 / hMad3 cancer cell death marker expression promoter of SEQ ID NO: 2. The hBubR1 / hMad3 promoter of SEQ ID NO: 2; And Marker bound to the promoter Cancer cell death marker vector comprising a. 7. The cancer cell death marker vector according to claim 6, wherein the marker is selected from the group consisting of luciferase, β-galactosidase and green fluorescent protein. 7. The cancer cell death marker vector according to claim 6, wherein the marker further comprises a site that can be cleaved by kespase-3.