KR20030095891A - Method for the crystallization of phosphoserine phosphatase and crystalline phosphoserine phosphatase prepared thereby - Google Patents

Abstract

PURPOSE: A method for preparing a crystalline phosphoserine phosphatase and a crystalline phosphoserine phosphatase prepared therefrom are provided. The phosphoserine phosphatase is an important target protein for treatment of dementia and brain diseases, and the crystalline phosphoserine phosphatase can be easily X-ray analyzed and has improved degree of crystallinity. CONSTITUTION: A method for preparing a crystalline phosphoserine phosphatase comprises crystallization of phosphoserine phosphatase according to a hanging-drop vapor diffusion method using a reservoir solution containing polyethylene glycol as a precipitating agent, wherein the hanging-drop vapor diffusion method is carried out under the temperature of 18 to 22 deg. C and pH of 7.2 to 7.6; the reservoir solution is a sodium cacodylate buffer solution; and the reservoir solution contains 0.08 to 0.10 M of sodium cacodylate buffer solution, 22 to 26% of polyethylene glycol and 0.7 M of calcium chloride.

Description

Crystallization method of phosphoserine phosphatase and crystalline phosphoserine phosphate prepared by the present invention TECHNICAL FIELD

The present invention relates to a method for crystallizing human phosphoserine phosphatase and to crystalline phosphoserine phosphatase prepared thereby.

Human phosphoserine phosphatase (PSP) is an enzyme that forms serine and phosphoric acid by hydrolyzing L-phosphoserine in the biosynthetic pathway of serine (L-serine). It is known that it has a homology of about 30% with microorganisms PSP and the like, and magnesium is required for the hydrolysis reaction of phosphoserine and phosphorylation of enzyme itself ( FEBS Letters , 408 , 281, 1997).

PSP is known to be linked to Alzheimer's disease, a dementia that causes beta amyloid proteins to precipitate in the brain and degenerate brain cells. Recent studies have reported that beta amyloid activates phosphoserine phosphatase in brain cells to promote degeneration of brain cells, with interleukin II inhibiting the activity of phosphoserine phosphatase ( Neuroscience Letters , 288 ,). 37, 2000).

PSP is also associated with this disease in relation to the fact that the amount of serine in the brain tissues of patients with Williams syndrome, which causes symptoms such as neurological impairment and muscle weakness due to brain injury, is reduced. Known.

The inhibitors of phosphoserine phosphatase studied so far can be divided into two types: phosphoserine mimetics that bind to phosphoserine phosphate competitively with phosphoserine and the other site other than the phosphoserine binding site. To inhibit the activity of phosphoserine phosphatase ( European Journal of Pharmacology, 315 , 337, 1997).

To address the problem of dementia and brain disease worldwide, a more effective and systematic approach to the development of therapeutics is possible by elucidating the structure and reaction principles of target proteins, rather than the conventional randomized approach of screening new drug candidates on a large scale. Will be adopted (Trias J. et al . , Curr. Opin. Biotechnol. , 8 , 757, 1997). In addition, in order to develop a new therapeutic agent, it is essential to reveal the tertiary structure of the protein, and in order to know the tertiary structure of the protein, it is necessary to first make a protein having good physical properties.

X-ray crystallography is used to identify the three-dimensional structure of the target protein for the development of a new therapeutic agent, and various crystallization methods are performed as a pretreatment step for using such x-ray crystallization. do. Among them, a crystallization method by a hanging-drop vapor diffusion method (Jancarik J. et al. , J. Appl. Cryst ., 24 , 409-411, 1991) is mainly used. Same as

When small droplets of mother liquor and a much larger reservoir solution coexist in an enclosed space, the movement of water or other volatiles occurs between them.

There is a super saturation in the solution condition of the protein. In such thermodynamic metastable state, the protein precipitates according to the change of the precipitant, and at this time, it becomes a stable crystallization state with a slow progress. Known precipitants can reduce the solubility of concentrated protein solutions. In order to reduce the relative adsorption layer around the protein molecules, the proteins gather together and form crystals. The reservoir solution is a mixture of such precipitants, buffers, salts, and detergents in various concentrations, the protein solution and the reservoir solution of these various conditions is usually mixed in a ratio of 1: 1 to form a drop. The droplets thus obtained are obtained on a glass slide coated with silicon and placed on an inverted state to seal the prepared plate. Initially, the concentration of protein in the droplets differs from that of the reservoir solution, so that the protein does not exist in the crystalline state. When left in this sealed state, equilibrium is gradually achieved. At this time, crystals are formed under specific conditions by the above-described principle.

In this drop-mixed vapor equilibrium, the type and titration of salts, buffers and detergents, as well as the precipitants in the reservoir solution, the pH, and the experimental temperature of the solution are chosen differently depending on the type of protein and in some cases the determination of the protein. It is a very important factor in its formation.

Therefore, the present inventors have prepared the unity of this enzyme to identify the tertiary structure of human phosphoserine phosphatase, which is an important target protein related to the treatment of dementia and brain disease, and the three-dimensional structure using x-ray. Was completed.

It is an object of the present invention to provide a method for crystallizing human phosphoserine phosphatase, which is a target protein for the treatment of brain diseases.

Another object of the present invention is to provide crystalline human phosphoserine phosphatase crystallized by the above method.

Another object of the present invention is to provide a method for protecting the human phosphoserine phosphatase crystals in the determination of tertiary structure using x-rays.

1 is a schematic of the droplet mixing vapor equilibrium method for crystallization of human phosphoserine phosphatase,

Figure 2 shows a crystallization picture of human phosphoserine phosphatase protein,

3A and 3B show photographs of scattered images obtained by directly exposing the crystal of FIG. 2 to x-rays in Pohang radiation.

In accordance with the above object, the present invention is characterized in that the human phosphoserine phosphate crystallized by a hanging-drop vapour diffusion method using a reservoir solution containing polyethylene glycol as a precipitant. Provides a patase crystallization method.

It is preferable that the human phosphoserine phosphatase used for this invention does not remove the amino acid residue of an amino acid terminal at all.

In addition, human phosphoserine phosphatase can be produced in microorganisms in the form of a his-tag fusion protein for ease of purification.Histec fused to phosphoserine phosphate affects crystallization. In order to obtain high resolution crystals, it is preferable to remove the histec portion from the purified fusion protein.

The reservoir solution in the method of the present invention may comprise a precipitant and a buffer. As a buffer, cacodylate buffer is preferably used, and the concentration of the buffer is 0.05 M to 0.15 M, preferably 0.10 M. In addition, the pH of the reservoir solution may range from 6.5 to 6.7, with a pH of 6.6 being preferred.

Precipitants for precipitating proteins include ammonium sulfate, polyethylene glycol, and the like, preferably polyethylene glycol 1500 precipitant, and the concentration of the precipitant is 22% to 26%, preferably 23 to 24%.

The reservoir solution may also further comprise a salt selected from sodium chloride, potassium chloride, citrate, lithium ammonium, calcium chloride, preferably calcium chloride, for the purpose of promoting crystal formation, wherein the salt concentration is between 0.65 M and 0.8 M, Preferably 0.72 M.

The crystallization reaction can be carried out at a temperature of 16 to 26 ° C., preferably at 22 ° C. for 1 day to 1 month, preferably 1 week to 2 weeks, to crystallize human phosphoserine phosphatase (FIG. 1).

The crystalline human phosphoserine phosphatase produced by the above-described preparation of the present invention has the following characteristics.

Spatial group of crystals: tetragonal space group (tetragonal I4)

Lattice unit: a = b = 106.213, c = 87.812 Hz, α = β = γ = 90 °

Number of shooting points: 34,211

Number of grid points required: 13,014

Lattice volume of the crystal: 990,624.9 Å ³

Rsym: 3.8%

Form: Two human phosphoserine phosphatase proteins contained in the subunit lattice (dimer).

X-rays can be used to analyze the structure of the prepared crystalline human phosphoserine phosphatase. However, crystals exposed to the high energy of x-rays have shorter lifetimes and weaker data, which affects structural analysis. To avoid this drawback, it is desirable to nitrogen cool the human phosphoserine phosphatase crystals at high speed prior to x-ray analysis.

Nitrogen cooling effectively protects human phosphoserine phosphatase crystals by cooling the solution for high-speed cooling containing crystallization buffer, calcium chloride and polyethylene glycol 1500, and then immersing in paraffin N within 1 second. can do. In the solution for high speed cooling, the concentration of cacodylate buffer is 0.05 to 0.10 M, preferably 0.10 M, and the concentration of calcium chloride is 0.65 to 0.72 M, preferably 0.7 M. Paraffin N may be used at a concentration of 100%, and it is most preferable to soak it within 1 second and to extract the sample. The temperature of the fast nitrogen cooling method is preferably carried out at 100 K.

Hereinafter, the specific configuration and operation of the present invention will be described with reference to Examples, but the scope of the present invention is not limited only to the following Examples.

Reference Example 1: Amplification and Expression of Human Phosphoserine Phosphate Gene

Step 1: Amplification of the Phosphoserine Phosphate Gene

Synthesis and Amplification of Human Phosphoserine Phosphate (Collet JF et al., J. FEBS Lett., 408 (3), 281-284, 1997), including histidine tags, by polymerase chain reaction (PCR) In order to synthesize each of the following primer oligonucleotides using a nucleic acid synthesizer.

SEQ ID NO: 1: 5'-AATT GGATCC ATGGTCTCCCACTCAGAGCTGAGGA -3 '

A primer having a nucleotide sequence of SEQ ID NO: 1 includes a nucleotide sequence corresponding to a BamHI restriction enzyme recognition site (underlined), and a primer having a nucleotide sequence of SEQ ID NO: 2 is a stop codon (box), a restriction enzyme XhoI recognition site. Contains the nucleotide sequence corresponding to (underscore).

PCR was performed using the human fetal liver cDNA library as a template with the following procedure.

1 μl human fetal liver cDNA library, 2 μl of 10 mM dNTP (final concentration: 0.2 mM), 3 μl each of 5 uM SEQ ID NO: 1 and primers of SEQ ID NO: 2 (final concentration: 0.3 uM), EXT DNA polymerization The reaction solution was prepared by adding 80.5 μl of distilled water to 0.5 μl of enzyme (5 units / μl, DyNAzyme, USA) and 10 μl PCR buffer (DyNAzyme). The reaction solution was repeated 30 times at 95 ° C. for 15 minutes, at 94 ° C. for 1 minute 30 seconds, at 55 ° C. for 1 minute, and at 72 ° C. for 1 minute 30 seconds.

The obtained reaction solution was separated by electrophoresis on 1% agarose gel to elute about 500 base pairs of phosphoserine phosphatase cDNA. 16 µl of this eluate was added 2 µl of 10-fold restriction enzyme reaction buffer and 1 µl of restriction enzymes BamHI and XhoI, respectively, and reacted for 2 hours at 37 ℃ by electrophoresis on 1% agarose gel. After separation, the desired DNA fragments were extracted and dissolved in 50 ul of distilled water solution (hereinafter referred to as PSP B / X).

Step 2: Preparation of an Expression Vector Containing Phosphoserine Phosphate Gene

Plasmid pET21b (5 units / μl, Novagen, U.S.A.) was cut completely using restriction enzymes BamHI and XhoI and separated on 1% agarose gel (hereinafter pET21b B / X). 6 μg of PSP B / X was added to the reaction tube with 3 μg of the plasmid vector pET21b B / X obtained above, followed by 2 μl of a 10-fold ligation solution (500 mM Tris-HCl, pH 7.8, 100 mM magnesium chloride, 100 mM). DTT, 10 mM ATP) and 10 units of T4 DNA ligase were added and distilled water was added so that the total volume was 20 μl, followed by reaction at 16 ° C. for 12 hours. The resulting reaction solution was added to E. coli DH5α competent cells, transformed, and plated in LB medium (1% bactotriptone, 0.5% yeast extract, 1% sodium chloride) containing LB-ampicillin at a concentration of 50 µg / ml. E. coli transformants were selected. The plasmids were extracted from these and the pET21b-PSP was obtained by restriction enzyme and sequencing.

The sequencing of the phosphoserine phosphatase gene cloned into the recombinant plasmid obtained above was performed according to the method of Sanger et al. (Sanger, F., et al . , Proc. Natl. Acad. Sci. USA , 74 , 5463, 1977). It was performed using a Big-Dye Cycle Sequencing System (Applied Biosystems, USA) and analyzed by an ABI 377 DNA sequencer.

Step 3: Expression of E. coli of Phosphoserine Phosphate

The expression vector pET21b-PSP obtained in step 2 was transformed into E. coli BL21 (DE3) (Novagen Inc.), which is an expression host.

The transformed E. coli strains were shaken for 12 hours in an LB medium containing 100 μg / ml ampicillin, and then 1 ml was taken and added to 100 ml LB medium (containing 100 ug / ml ampicillin) and 37 ° C. Incubated at 600 nm until the absorbance of the culture medium was about 0.5. The incubation temperature was then lowered to 18 ° C. and IPTG was added to a final concentration of 1 mM. 1 ml of each was added before and 4 hours after the addition of IPTG, and the cell precipitates were collected by centrifugation at 10,000 g for 2 minutes. The collected precipitate was suspended in PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na ₂ HPO ₄ , 1.8 mM KH ₂ PO ₄ ), and then the cells were crushed using an ultrasonic disruptor (Sonic Dismembrator, Fisher, USA). And then centrifuged again at 10,000 g for 2 minutes. The separated supernatant and precipitate were analyzed by 15% SDS-polyacrylamide gel electrophoresis according to the method of Laemmli et al . (Laemmli et al ., Nature , 227 , 680, 1970) and stained with CoomasieBrilliant Blue. As a result, the expression of phosphoserine phosphatase protein was confirmed.

Reference Example 2 Purification of Phosphoserine Phosphate Protein Including Histidine Tag

Step 1: Cultivate and Disintegrate E. Coli Cells

E. coli cells expressing phosphoserine phosphatase prepared in Reference Example 1 were cultured 2 L in the same manner as in Step 3 of Reference Example 1, and then centrifuged at 6,000 rpm for 10 minutes using a centrifuge to precipitate E. coli cell precipitate. The cells were harvested and suspended in a buffer solution of 50 mM Tris pH 8.0, 0.2 mM 150 mM sodium chloride composition, and then cells were disrupted in an ice bath using an ultrasonic grinder (Sonic Dismembrator, Fisher, USA). The crushed solution was centrifuged at 16,000 rpm for 30 minutes to obtain a supernatant, which was used for the next procedure.

Step 2: Purification of Phosphoserine Phosphate

The supernatant obtained in step 1 was bound to a nickel-nitrilotriacetic acid (Ni-NTA) column (Pharmacia, USA) previously equilibrated with the above buffer, and the same buffer as the above was used as eluent, and 0-0.5 M already After elution using a dozol concentration gradient, the fractions containing phosphoserine phosphatase protein were identified by SDS-PAGE, and the fractions were collected. Gel filtration column (Superdex) equilibrated with 5 ml of phosphoserine phosphatase protein obtained above and then equilibrated with buffer solution (50 mM Tris pH 7.5, 150 mM sodium chloride, 10% glycerol, 3 mM DTT) 75, 26/60, Pharmacia), and separated by the molecular weight of the protein was confirmed by electrophoresis and phosphoserine phosphatase was collected.

The concentration of the obtained phosphoserine phosphatase protein was adjusted to 5 mg / ml, and thrombin was added in an amount of 50 units per mg of protein and reacted for 48 hours at 4 ° C. After confirming that, the nitrate-nitrotriacetic acid (Ni-NTA) column, which was previously equilibrated with the buffer solution, was hung to completely remove the fusion protein in which the histec portion was not cut.

Example 1 Crystallization of Human Phosphoserine Phosphate by Droplet Mixed Vapor Equilibrium

The human phosphoserine phosphatase protein obtained in Reference Example 2 was crystallized by the following drop mixed vapor equilibrium method.

Human phosphoserine phosphatase was added to a solution consisting of 100 mM sodium cacodylate (pH 6.6), 100 mM NaCl, and 10 mM DTT to prepare a protein solution by adjusting the protein concentration to 39 mg / ml. Final protein concentration was determined by the Bradford method.

Crystallization conditions were searched step by step with the final protein solution and initial screen solution (Hampton research Inc.) obtained, using a reservoir solution (C) consisting of 0.1 M cacodylate buffer (pH 6.6) and 24% polyethylene glycol 1500 precipitant. Got the best decision. Specifically, 2 µl of human phosphoserine phosphatase protein solution and 2 µl of reservoir solution (B) were brought into contact with the surface of the glass slide (A) coated with silicon, and 0.5 ml of the reservoir solution (C) Covered the plate was stored at 22 ℃ constant temperature (Fig. 1). After 5 days, seed crystals were formed, and after one week, the crystals grew to 0.1 × 0.2 × 0.2 mm, and the shape of the cube was a cuboid, and the space group showed a tetragonal space group. A photograph taken with a Nikon camera is shown in FIG. 2.

Example 2: Crystallization of Human Phosphorine Phosphate by Nitrogen Rapid Cooling Method

In order to solve the problem caused when the human phosphoserine phosphate crystal obtained in Example 1 is directly exposed to x-rays, the human phosphoserine phosphate crystal was cooled by fast nitrogen cooling as follows. After searching for the optimum conditions of the fast nitrogen cooling method, paraffin was cooled within 1 second after cooling the solution for fast cooling composed of 0.10 M cacodylate buffer (pH 6.6), 26% polyethylene glycol 1500 and 0.75 M calcium chloride containing crystals. Soaking in N 100% and withdrawing was shown to best tolerate a 100 K liquid nitrogen stream without harming human phosphoserine phosphatase crystals. In addition, the watering phenomenon that occurs frequently during the experiment (water freezing when high-speed nitrogen cooling is incomplete) was not seen.

Example 3: X-ray Data Collection and Analysis of Human Phosphoserine Phosphate Crystals by Radiation Accelerator

Experiments were performed using the human phosphoserine phosphatase crystals obtained in Example 2 to collect data on a radiation accelerator (Macromolecular Beam Line PL-6B) from Pohang University of Korea. The detector of the accelerator was DIP2030 (MAC SCIENCE, Japan), and the data limit of the crystal was 2.8 Hz.

As a result, the space group of the phosphoserine phosphatase crystal was a tetragonal space group, and the lattice unit was a = b = 106.213, c = 87.812 Å, α = β = γ = 90 °. The total number of grid points is 34,211, of which 13,014 is the required grid point, representing about three times the multiplicity. A photograph of the scattered image is shown in FIG. 3.

As a result of analyzing the data obtained above, the crystal lattice volume was 990,624.9 9 ³ , and it was calculated that the lattice was in the form of a dimer containing two human phosphoserine phosphatase proteins in a subunit lattice. As a result of processing the data, Rsym showed a value of 3.8%.

Crystalline human phosphoserine phosphatase produced by the method of the present invention can be usefully used for the development of novel resistant antibiotics for the treatment of dementia and brain disease because of its easy x-ray analysis and excellent crystallinity.

Claims (7)

Human phosphoserine, characterized in that the crystallization of human phosphoserine phosphatase (hangose-drop vapour diffusion method) using a reservoir solution containing polyethylene glycol as a precipitant, human phosphoserine Crystallization Method of Phosphate. The method of claim 1, Droplet mixed vapor equilibration is carried out at 18 to 22 ° C. The method of claim 1, The buffer of the reservoir solution is sodium cacodylate buffer. The method of claim 1, Drop mixed vapor equilibration is performed under a crystallization pH of 7.2 to 7.6. The method of claim 1, Wherein the reservoir solution consists of 0.08 to 0.10 M sodium cacodylate buffer, 22 to 26% polyethylene glycol 1500 and 0.7 M calcium chloride. Crystalline human phosphoserine phosphatase having the following properties, produced by the method of claims 1 to 4; Spatial group of crystals: tetragonal space group (tetragonal I4) Lattice unit: a = b = 106.213, c = 87.812 Hz, α = β = γ = 90 ° Number of shooting points: 34,211 Number of grid points required: 13,014 Lattice Volume of the Crystal: 990624.9 Å ³ Rsym: 3.8% Form: Two human phosphoserine phosphatase proteins in subunit lattice (dimer). In a solution for fast cooling comprising 0.08 to 0.10 M sodium cacodylate buffer, 22 to 26% polyethylene glycol 1500 and 0.7 M calcium chloride, the sixth human phosphoserine phosphatase was immersed in paraffin N 100% within 1 second. A method for cooling human phosphoserine phosphatase crystals, which comprises cooling by a high-speed nitrogen cooling method to be taken out.