KR20030088888A - A method for immobilizing molecules with physiological activity - Google Patents

Abstract

PURPOSE: A method for immobilizing molecules with physiological activity whose active sites are masked is provided, thereby effectively maintaining the physiological activity of the molecule. CONSTITUTION: A method for immobilizing molecules with physiological activity whose active sites are masked comprises the steps of: (a) incubating a physiologically active molecule with a compound selectively binding to active sites of the molecule for masking; (b) introducing a linker capable of binding to the masked molecule of the step (a) on the surface of a substrate to form a support; (c) controlling the rate of the reaction that the masked molecule of the step (a) binds to the linker on the surface of the support formed in the step (b); and (d) binding the masked molecule of the step (a) to the linker on the surface of the support of the step (b) for immobilizing the physiologically active molecule. It may further comprises the step of (e) removing a compound selectively bound to the active sites of the molecule from the immobilized molecule.

Description

A method for immobilizing molecules with physiological activity

Recently, efforts to discover the activity of physiologically active molecules such as nucleic acids, proteins, enzymes, antigens, antibodies and the like by combining biotechnology and semiconductor manufacturing technology are spreading around the world. By using semiconductor processing technology on small silicon chips, you can easily obtain useful information by immobilizing the desired bioactive molecules in specific microscopic areas and biochemically searching them. There is a need for an efficient immobilization method of bioactive molecules not only for the development of such a small diagnostic chip or a reaction chip (Lab-on-a-chip) or isolation or suppression of bioactive molecules, but also for the design and development of a drug.

Conventional methods of immobilizing bioactive molecules currently in use include introducing a linker having a plurality of reactive functional groups to a substrate to form a support, and an unspecific chemical bond between the functional group and the bioactive molecule of the linking substance. It is a method of fixing the bioactive molecules to the support by inducing. A bioactive molecule is a amine group, a carboxyl group, an alcohol group, an aldehyde group, a thiol group, etc., present on the surface of the biomolecule, and bonds various bonds such as covalent bonds, ionic bonds, coordination bonds, hydrogen bonds, and packing in the immobilization reaction. It is formed and fixed on the support. These bioactive molecules also have single or multiple active sites for forming complexes with specific compounds such as substrates, coenzymes, corresponding antibodies or antigens.

As an example of the immobilization method, a coupling material including immobilized reactive functional groups is bonded to a support by physical adsorption, chemical adsorption by covalent or coordination bonds, or the like, and then a chemical reactive functional group, such as a carboxyl group, present on the surface of the coupling material. 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC),

Method of immobilizing amine bonds by reacting an amine group on a bioactive molecular surface with an activated carboxyl group on a support by introducing a bioactive molecule onto the surface of a support activated with N-hydroxysuccinimide (EDC-NHS), SOCl _2, or the like. (Anal. Biochem., Vol 185, pp 131-135 (1990); Anal. Chem., Vol 66, p 1369-1377 (1994): Biosens. Bioelectron., Vol 11, p 757-768 ( 1996): Biosens. Bioelectron., Vol 12, p 977-989 (1997): Science vol 289, p 1760-1763 (2000)).

However, when fixing the bioactive molecules to the support by the non-specific chemical bonds as described above has the following problems. First, since the bioactive molecule to be immobilized has several reactive functional groups on the surface, and also several reactive functional groups exist on the surface of the support for immobilization, several chemical bonds are generated between the bioactive molecule and the immobilized support. As such, the immobilized bonds occur unspecifically at various sites of the bioactive molecule, resulting in structural modification and destruction of the immobilized bioactive molecule, leading to a sharp decrease in its activity. Second, due to the non-specificity of the immobilization reaction, i.e., no selective reaction with respect to several reactive functional groups of the bioactive molecule, the active site of the bioactive molecule, or the position close to the molecular level of the active site The immobilization reaction occurs directly. Direct chemical bonding around the active site causes direct damage to the active site, thereby lowering the active retention rate of the fixed bioactive molecule.

The immobilization method by the unspecific chemical bonding causes the active site disorder and the change in the molecular form of the bioactive molecule, and thus the activity of the bioactive molecule is rapidly lost during the actual immobilization process. As a result, the retention rate of the bioactive molecule per unit area decreases. Activity is reduced.

Therefore, there is a need to develop a method of immobilizing a bioactive molecule that improves the activity per unit area of a fixed bioactive molecule by avoiding direct damage to the active site by direct chemical bond formation at or near the active site and increasing the activity retention rate. .

Technical problem to be invented

It is an object of the present invention to provide a method for immobilizing a bioactive molecule which does not cause steric hindrance or structural modification of the active site through masking of the active site of the bioactive molecule to be immobilized.

Another object of the present invention is to provide a method of immobilizing a bioactive molecule that increases the activity per unit area of the bioactive molecule by improving the activity retention rate.

Still another object of the present invention is to provide a method for immobilizing bioactive molecules useful for developing DNA chips or biochips.

It is another object of the present invention to provide a fixed bioactive molecule having excellent activity retention rate.

An efficient immobilization method capable of preserving the physiological activity of the physiologically active molecule of the present invention comprises the steps of: a) reacting the physiologically active molecule with a compound that selectively binds to the active site to mask the active site of the bioactive molecule; b) introducing a linking material on the surface of the substrate to bond with the masked bioactive molecule of step a) to form a support; c) controlling the reaction rate at which the masked bioactive molecule of step a) is bonded to the linking material on the surface of the support formed in step b); And d) reacting the masked bioactive molecule of step a) with the linking material on the support surface formed in step b) to fix the bioactive molecule to the support surface.

In the present invention, a), which is a masking step of the active site of the bioactive molecule, is a step of forming a complex by reacting a compound selectively binding to the active site (s) of the bioactive molecule with the bioactive molecule or an active site thereof. . This masking step may be performed before the immobilization reaction of the physiologically active molecule, or may be added simultaneously with the immobilization reaction by adding the masking compound to the immobilization reaction solution.

Examples of such bioactive molecules include proteins, enzymes, antigens, antibodies, and the like. Compounds used for masking the active site include substrates, inhibitors, cofactors or chemical modifications, analogs or derivatives thereof for masking enzymes, and corresponding antibodies and antigens and antigens for masking antigens or antibodies It may be selected from the group consisting of. For example, DNA, RNA or derivatives or analogs thereof can be used to mask the active sites of enzymes based on them, and antigens, antibodies or derivatives or analogs thereof, DNA, RNA or derivatives or analogs thereof. Can be used to mask the antibody or antigen corresponding to them.

These compounds bind to one or more active sites or cofactor sites of the bioactive molecule to form a complex. The complex may be formed by a covalent bond, an ionic bond, a coordinating bond, a hydrogen bond, a dipole-dipole bond, an overlap, or a combination of two or more thereof. The reaction time of complex formation takes several seconds to 1 day in some cases, the pH of the reaction is not particularly limited within a range that does not destroy physiological activity, it is preferable that the range suitable for complex formation for masking the active site. It is preferable that the protection rate (masking rate) of a bioactive molecule is about 5 to 100%.

Masking step a) by forming a complex of a bioactive molecule with a substrate or an inhibitor that selectively binds to the active site of the bioactive molecule, and thus, the active site of the bioactive molecule or its surrounding functional groups are directly linked to the immobilized reactive group of the support. Chemical bonding can be prevented.

Bioactive molecules masked with the active site may be immobilized on a substrate into which multiple immobilized reactive functional groups are introduced. The term substrate herein refers to a substance capable of introducing several reactive functional groups into the substrate surface region corresponding to the size of the bioactive molecule to be immobilized. Such immobilized reactive functional groups are introduced to the substrate by forming a thin film of a connecting material including them on the substrate surface. The substrate is bonded to a reactive functional group-containing linking material that forms a thin film on the surface of the substrate by covalent bonds, ionic bonds, coordination bonds, hydrogen bonds, overlapping or two or more of them. Examples of reactive functional groups of the linking material reacting with the substrate include silane groups such as thiol groups, sulfide groups, disulfide groups, alkoxysilane groups, halogensilane groups, carboxyl groups, amine groups, alcohol groups, epoxy groups, aldehyde groups, thiol groups, alkyl halides, and the like. Groups, alkyl groups, alkenes, alkyne groups, aryl groups or combinations of two or more of these.

Substrates usable in the present invention include metals such as Au, Ag, Pt, Cu, non-metals such as silicon wafers, glass, silica, fused silica, semiconductors, oxides of these elements, organic or inorganic polymers, dendrimers ( dendrimers), solid or liquid phase polymers, and mixtures thereof. Substrates can be shaped into planar, spherical, linear, porous forms, microfabricated gel pads, nanoparticles, and the like, and have a variety of sizes greater than or equal to nm that allow multiple introduction of reactive functional groups for immobilization reactions. Included herein are materials of shape. The reason for having the size of nm is that the distance between atoms is the region of Å, and the size of the physiologically active molecules to be immobilized is in the range of several nm to several tens of nm, so that any substrate capable of introducing a large number of reactive functional groups in this size region is applicable.

Examples of the immobilized reactive functional group of the linking material reacting with the bioactive molecule include carboxyl group, amine group, alcohol group, epoxy group, aldehyde group, thiol group, sulfide group, disulfide group, alkyl halide group, alkyl group, alkene group, alkyne group, aryl group Or combinations of two or more of these functional groups. These reactive functional groups can be linkages for anchoring the masked bioactive molecules to the support.

Covalent bonds, ionic bonds, coordination bonds, hydrogen bonds, or a combination thereof are also used for the linkage between the reactive functional group and the bioactive molecule of the linking material. An amide bond, an imine bond, a sulfide bond, a disulfide bond, an ester bond, an ether bond, an amine bond or two or more of these bonds are formed between the linking material of the support and the bioactive molecule. For example, the amine group of the bioactive molecule is linked by an amide bond, the carboxyl group of the bioactive molecule is linked by an amide bond, and the amine group of the bioactive molecule is linked by an amide bond. The aldehyde group of the bioactive molecule and the amine group of the linking material are connected by imine bond, and the thiol group of the bioactive molecule and the thiol group of the support are connected by disulfide bond.

Although the active sites of the bioactive molecules are masked by a compound that selectively binds them, the structural modification of the bioactive molecules is severe when the immobilized reactive functional groups and the immobilized chemical bonds are formed. May cause damage or destruction of the activity of the bioactive molecule. This can be prevented from lowering activity through kinetic down-kinetic-regulation to lower the probability of the immobilization reaction. However, if such kinetic down-regulation is excessive, the activity per unit area of the physiologically active molecule may be lowered due to the lowering of the immobilization probability. Therefore, it is necessary to optimize the reaction rate, that is, the optimization of the kinetic variables that can reduce the probability of multiple immobilized chemical bonds and at the same time maximize the activity retention rate. In the present invention, the mole fraction of the reactive functional groups present on the surface of the immobilized substrate is adjusted in order to optimize the reaction rate, or the concentration of physiologically active molecules, the pH of the reaction solution, the reaction time, the reaction temperature, and the coupling reagent Adjust the type.

For example, in the present invention, the mole fraction of the immobilized reactive functional groups present on the immobilized substrate surface is controlled by introducing two thiol molecules having different end groups as immobilized reactive functional linkers on the support surface to form a thin film. It is preferable that one of the thiol molecules has a relatively long alkyl chain having an immobilized reactive functional group and the other thiol molecule has an unreactive end group and is used to mask the support. The former thiol molecules include mercaptocarboxylic acids such as 11-mercaptoundodecanoic acid, mercaptoaminoalkanes, mercaptoaldehydes, dimercaptoalkanes, and carboxyl groups, thiol groups, alcohol groups, and aldehyde groups. , Selected from the group consisting of sulfides and disulfides having reactive functional groups such as amine groups, and the latter thiol molecules include mercaptoalkanes such as 6-mercapto-1-hexanol, mercaptoalkanes such as 1-heptane thiol, In addition, sulfides or disulfides having non-reactive end groups may be used. Thiol molecules having immobilized reactive functional groups are mercaptocarboxylic acids or mercaptoaminoalkanes and thiol molecules having non-reactive end groups are mercaptoalcohols or mercaptoalkanes; Thiol molecules having an immobilized reactive functional group are mercaptoaldehyde and thiol molecules having non-reactive end groups are mercaptoalcohol or mercaptoalkane; It is preferable that the thiol molecule having an immobilized reactive functional group is a dimercaptoalkane and the thiol molecule having a non-reactive end group is a mercaptoalcohol or mercaptoalkane.

The linking material for introducing the immobilized reactive functional group is about 0.05 to 50% of the total linking material introduced to the support, more preferably about 0.05 to 30%.

If the molar fraction of the immobilized reactive functional group is higher than 50%, the activity of the immobilized bioactive molecule is impaired due to the formation of several chemical bonds between the bioactive molecule and the immobilized support, and if it is lower than 0.05%, the activity retention rate is reduced. The activity per unit area is thus reduced.

The immobilized reactive functional groups introduced to the support are 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC),

Activated by a coupling agent such as N-hydroxysuccinimide (EDC-NHS), SOCl _2, and the like, and then linked to the masked bioactive molecule.

The concentration of the bioactive molecules for the optimization of the immobilization reaction rate is 0.1 µg / ml-1 mg / ml, the pH of the immobilization reaction is in the range of 4 to 10 and the immobilization reaction time is in the range of several seconds to 24 hours.

The method of immobilizing the bioactive molecule of the present invention may further comprise the step e) of removing the masking compound that selectively binds to the active site in the fixed bioactive molecule. The masking compound may be removed to expose the active site of the bioactive molecule, thereby minimizing the modification of the active site to increase the activity retention rate. The masking compound may be removed by heating, hydrolysis, dilution, dialysis, pH change, and the like.

In the present invention, by using the bioactive molecules masked by the active site, and also by controlling the immobilization reaction rate to minimize the number of bonds between the bioactive molecules and the immobilization surface of the support to prevent or minimize the damage of the activity of the bioactive molecules In addition, the activity retention rate is increased to maximize the activity of fixed bioactive molecules per unit area.

The present invention relates to a method for immobilizing a bioactive molecule to a support material surface and to a bioactive molecule immobilized to a support material. More specifically, the present invention relates to an efficient immobilization method and thus a fixed bioactive molecule capable of preserving the physiological activity of the molecule by masking the active site (active site) of the bioactive molecule.

Figure 1a shows the change in activity of Taq DNA polymerase immobilized on the surface of the support by the masking immobilization method (PIM) and conventional random immobilization method (RIM) according to the present invention And agarose gel fluorescence showing the change of activity according to the mole fraction of 11-mercaptoundodecanoic acid in the mixed solution of thiol molecules used to introduce the carboxyl group.

Figure 1b is a graph showing the relative activity according to the mole fraction of 11-mercaptoundodecanoic acid in the mixed thiol solution used to introduce the carboxyl group of Taq DNA polymerase immobilized on the support surface by the PIM of the present invention and the conventional RIM .

Figure 2a is agarose gel fluorescence of the PCR product used to determine the activity of the fixed Taq DNA polymerase according to the active site protection rate when forming the DNA- Taq DNA polymerase complex.

Figure 2b is a graph showing the change in activity of the fixed Taq DNA polymerase according to the active site protection rate when the partial double-stranded DNA and Taq DNA polymerase to form a 1: 1 complex.

3A is agarose gel fluorescence photographs of PCR products showing the activity of immobilized Taq DNA polymerase with pH of immobilization reaction.

Figure 3b is a graph showing the change in activity of the immobilized Taq DNA polymerase according to the pH of the immobilization reaction.

4A is agarose gel fluorescence photographs of PCR products showing the activity of immobilized Taq DNA polymerase over immobilization reaction time.

Figure 4b is a graph showing the change in activity of the immobilized Taq DNA polymerase with the immobilization reaction time.

Figure 5a is agarose gel fluorescence picture of the PCR product comparing the activity of the fixed Taq DNA polymerase and solution phase Taq DNA polymerase according to the number of PCR reaction cycles.

5B is a graph comparing the activity of fixed Taq DNA polymerase and solution phase Taq DNA polymerase according to the number of PCR reaction cycles.

Figure 6a is a photograph of an agarose gel fluorescent PCR product was used for fixing the Taq activity determination of the DNA polymerase according to the total amount of the Taq DNA polymerase used in the immobilization reaction.

Figure 6b is a graph showing the change in activity according to the total amount of Taq DNA polymerase used in the immobilization reaction.

7 is a graph showing the activity of the immobilized anti-DNA antibody according to the mole fraction of 11-mercaptoundodecanoic acid in the mixed thiol solution used to introduce the carboxyl group.

8 is a graph showing the activity of the anti-DNA antibody according to the number of moles of double-stranded DNA.

The present invention will be described in more detail with reference to the following examples. However, the examples are only for illustrating the present invention and are not limited thereto.

Example 1 Immobilization of Taq DNA Polymerase

a) Masking the active site of Taq DNA polymerase

Taq DNA polymerase was purchased from AmkinTaq GoldTM DNA Polymerase produced by Perkin Elmer. This polymerase is an enzyme having a molecular weight of 94 kDa consisting of 832 amino acids and is chemically modified to be activated by heat by standing at 95 ° C for 10 minutes.

A buffered aqueous solution containing 65 base single-stranded DNA (ss-DNA) and KS primer in a 1: 1 molar ratio as shown below is left at 94 ° C. for 10 minutes, and then cooled slowly until it reaches 35 ° C. or less. (Takes about 1-2 hours). At this time, 65 base ss-DNA and KS primers are annealed to generate partially double stranded DNA. 72 ℃ drying bath insert the Taq DNA polymerase in appropriate molar amount to the solution (dry bath) for 10 minutes allowed to stand after, 50 ℃ drying bath by moving 20 minutes left to the active region masking Taq DNA polymerase reaction was performed for over The solution was prepared. In this case, Taq DNA polymerase is bound to the 3 'terminal site where the structure of the DNA is changed from double strands to single strands (SH Eom, J. Wang, TA Steitz, Nature, vol. 382, pp. 278-281, 1996). Active site is protected. The 65 base ss-DNA and KS primers used in this process were synthesized using a DNA synthesizer. The optimal pH for active site masking is 8.3, the highest activity of Taq DNA polymerase.

KS Primer

5 ' CGAGGTCGACGGTATCG 3'

3 '

CCAGCTGCCATAGCTATTTTCTTTTCTTTCTTAAGTTCTTTTCTTTTCCT

AGGTGATCAAGATCT 5 '

b) Formation of thiol molecular monolayers on the surface of Au substrates and introduction of immobilized reactive functional groups

As the Au substrate, a slice having a size of about 1000 mm by vacuum deposition on a glass surface having a size of 3.0 mm x 5.0 mm was used. In order to ensure the cleanliness of the Au thin film surface, it was placed in a Piranha solution immediately before use at 60-70 ° C. for 10-15 minutes and then washed with deionized water followed by absolute ethanol.

In order to introduce an immobilized reactive functional group on the Au surface, a thiol molecular monolayer film was introduced on the Au surface by using a thiolate formation reaction between the linking material having a thiol group and Au, that is, an Au-S bond formation reaction to form a support ( CB Bain, EB Troughton, Y.-T. Tao, J. Evall, GM Whitesides, and RG Nuzzo, J. Am . Chem. Soc., Vol. 111, pp. 321-335, 1989). In this case, a solution in which two thiol molecules having an immobilized reactive functional group and a non-reactive end group are mixed is used, and the mole fraction of the thiol molecule having an immobilized reactive functional group is adjusted to 0 to 100% to introduce the immobilized reactive functional group into the substrate surface. The mole fraction was adjusted. As a thiol molecule for introducing a carboxyl group as an immobilized reactive functional group, 11-mercaptoundodecanoic acid having a relatively long alkyl chain is used, and 6-mercapto-1-hexanol is used as a thiol molecule having an unreactive end group. Used. The Au thin film was added to 100 µl of ethanol solution having a total thiol molecule concentration of 2 mM, reacted at room temperature for 2 hours, and the Au thin film was taken out and washed with absolute ethanol to introduce carboxyl groups onto the Au thin film surface.

As such, the reactive functional groups are spatially separated and protruded from the terminal groups of the substrate on the thiol molecular monolayer to allow free movement of the immobilized bioactive molecules and to reduce the effects of the intermolecular action generated from the thiol molecular monolayer. It is possible to increase the activity retention rate of the bioactive molecules.

c) carboxyl activation of thiol molecular monolayers

A carboxyl-introduced Au thin film was placed in 120 μl of an ethanol solution containing 10 mM 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) and 5 mM N-hydroxysuccinimide (NHS). The reaction was carried out at room temperature for 2 hours. The carboxyl group was activated by reaction with NHS in the presence of EDC to form NHS-ester (Z. Grabarek and J. Gergely, Anal. Biochem., Vol. 185, pp. 131-135, 1990).

d) Immobilization of Taq DNA Polymerase

After activating the carboxyl group of the thiol molecular monolayer film, the Au substrate was taken out and reacted with Taq DNA polymerase solution in which the active site was masked. At this time, an amide bond (-CO-NH-) is formed by the reaction between the activated carboxyl group (NHS-ester) of the thiol molecular monolayer and the primary amine group (-NH ₂ ) of the protein (Z. Grabarek and J. Gergely, Anal.Biochcm., Vol, 185, pp. 131-135, 1990; VM Mirsky, M. Riepl, and OS Wolfbeis, Biosens.Bioelectron., Vol, 12, pp.977-989, 1997) Taq DNA polymerase It is fixed to the substrate. The immobilization reaction was carried out while changing the concentration of polymerase, pH, reaction time, reaction temperature and the like.

Example 2: Immobilization of Anti-DNA Antibodies

a) Masking Active Sites of Anti-DNA Antibodies

The anti-DNA antibody is a monoclonal antibody of IgG2b isotype produced by calf thymus DNA as an immunogen in the abdominal cavity of a mouse produced by Chemicon International Inc. (cat. No. MAB3032). And double-stranded DNA. This antibody solution is a solution with a total protein concentration of 25 g / L, of which about 10% is an anti-DNA antibody.

The active site masked anti-DNA antibody solution was prepared by adding 68 bp double-stranded DNA (dS-DNA) and anti-DNA antibody labeled with ³⁵ S shown below at an appropriate molar ratio and standing at 37 ° C. for 30 minutes. . In this case, the amount of anti-DNA antibody used was about 33 fmol, and the amount of 68 bp ds-DNA used for masking active sites was about 2 to 120 fmol. The buffer used for this reaction is pH 6.0 MES buffer. 68 bp ds-DNA was labeled as beta nuclide by adding α- ³⁵ S-dATP at a molar ratio of about 2% to dNTP during PCR.

KS Primer

5 ' CGAGGTCGACGGTATCG ATAAAAGAAAAGAAAGAATTCAAGAAAAGAAAAGGATCCACTAGTTCTAGA 3'

3 'GCTCCAGCTGCCATAGCTATTTTCTTTTCTTTCTTAAGTTCTTTTCTTTTC CTAGGTGATCAAGATCT 5'

SK primer

b) Formation of thiol molecular monolayers on the surface of Au substrates and introduction of immobilized reactive functional groups

As the Au substrate, a 12.7 mm x 12.7 mm sized piece was vacuum deposited on the glass surface with a thickness of about 1000 mm 3. In order to ensure the cleanliness of the Au thin film surface, it was placed in a Piranha solution immediately before use at 60-70 ° C. for 10-15 minutes and washed with deionized water followed by absolute ethanol.

1-heptane thiol was used as a thiol molecule having a non-reactive end group, and a mixed monolayer film of 11-mercaptoundodecanoic acid and 1-heptane thiol was formed on the Au surface in the same manner as in Example 1. An immobilized carboxyl group was introduced by exposing only 9 mm diameter portion of Au thin film to 300 μl of ethanol solution having a total titer molecular concentration of 2 mM and reacting at room temperature for 2 hours.

c) carboxyl activation of thiol molecular monolayers

The Au substrate to which the carboxyl group was introduced was subjected to a buffered aqueous solution containing 10 mM 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) and 5 mM N-hydroxysulfosuccinimide (sulfo-NHS) ( pH 6.0 MES buffer) was added to 300 μl and reacted at room temperature for 2 hours while the Au fragment was exposed to a diameter of 9 mm. The carboxyl group is reacted with sulfo-NHS in the presence of EDC to form sulfo-NHS-esters (JV Staros, RW Wright, and DM Swingle, Anal. Biochem., Vol. 156, pp. 220-222, 1986). It became.

d) Immobilization of Anti-DNA Antibodies

After activating the carboxyl group of the thiol molecular monolayer membrane, the reaction solution was removed, and the reaction site was immobilized in a protein solution masked with an active site. The total amount of anti-DNA antibody used was about 33 fmol. At this time, an amide bond (-CO-NH-) is formed by the reaction of the activated carboxyl group (sulfo-NHS ester) on the surface of the immobilization support with the primary amine group (-NH ₂ ) of the protein (JV Staros, RW Wright, and DM Swingle, Anal. Biochem. , Vol. 156, pp. 220-222, 1986; VM Mirsky, M. Riepl, and OS Wolfbeis, Biosens. Bioelectron., Vol. 12, pp. 977-989, 1997) It is fixed. At 10 ℃ conditions in pH 6.0 MES buffer solution containing the ds-DNA with the ³⁵ S-labeled for masking the active sites for 2 hours to carry out immobilization reaction. About 33 fmol of anti-DNA antibody and 68 bp ds-DNA for masking about 30 fmol active site were added to 100 µl immobilization reaction solution.

Example 3 Activity Measurement of Immobilized Taq DNA Polymerase

In order to measure the activity of the immobilized Taq DNA polymerase, a PCR reaction was performed and the amount of DNA amplified was amplified. PCR reactions were performed using a Model 480 PCR apparatus from Perkin Elmer. As a template in the PCR reaction, 65 base ss-DNA shown above was used, and primers were KS primer and SK primer. The volume of the PCR reaction solution used was 50 μl, and 25 fmol of ss-DNA of 65 bases and 10 pmol of KS primer and SK primer were added. The buffer solution was diluted 10 times with pH 8.3, 10X buffer purchased from Perkin Elmer. The temperature setting in the PCR reaction is as follows:

Hot start step: 94 ° C., 10 min

PCR cycle (20-45 cycles): 94 ° C, 30s; 50 ° C, 60s; 72 ° C, 30s

To quantify the DNA amplified by the PCR method, 20 μl of the PCR reaction solution was taken, developed using agarose gel electrophoresis, stained with ethidium bromide dye, and the PCR product was visualized by fluorescence appearing upon UV irradiation. This was quantified by a densitometer.

Example 4: Activity of immobilized Taq DNA polymerase according to mole fraction of carboxyl groups The immobilization reaction was performed at 50 ° C. for 30 minutes in a pH 8.3 phosphate buffer solution. 0.75 pmol Taq DNA polymerase and 1.5 pmol active site masking DNA were added to the 50 μl immobilization reaction solution. 0.75 pmol Taq DNA polymerase is an amount capable of forming three monolayer films in an area of 3 mm x 5 mm of the Au fragment used as the immobilization substrate. Activity was measured by performing a 35 cycle PCR reaction.

Agarose gel fluorescence results of PCR products are shown in Figure 1a. The leftmost lane is a marker of ds-DNA size, and the rightmost lane is the result of amplification using a solution of Taq DNA polymerase corresponding to one monolayer amount, and the other lanes are fixed Taq DNA polymerase. Amplified using. The numbers below indicate the mole fraction of 11-mercaptodecanoic acid relative to the total number of moles of thiol molecules used to introduce the carboxyl groups.

The activity shown in the fluorescence picture of Figure 1a is shown graphically in Figure 1b. The x-axis represents the mole fraction of the total thiol molecular moles of 11-mercaptodecanoic acid used for the introduction of the carboxyl group. The y-axis is the relative activity of the fixed Taq DNA polymerase, which is relative to the activity measured using Taq DNA polymerase corresponding to the amount of one monolayer in solution. Is the immobilization reaction while masking the active site (PIM), Is the immobilization reaction (RIM) without masking the active site.

In the case of the PIM masking the active site in the mole fraction range of the entire carboxyl group, the activity of the PIM is higher than that of the RIM where the active site is not masked.

It can also be seen that the activity of the masked polymerase is highest when the mole fraction of the carboxyl group is about 5%. This shows that by controlling the mole fraction of carboxyl groups on the surface of the immobilized substrate, the preservation of the activity of the masked polymerase can be maximized kinetically. That is, the activity of the enzyme after immobilization can be maximized by kinetically controlling the increase in activity retention rate and prevention of activity deterioration due to multiple bond formation in the state of masking the active site.

Example 5 Activity of Fixed Taq DNA Polymerase According to Active Site Protection Rate

The activity of the fixed Taq DNA polymerase was measured while varying the number of moles of partial double-stranded DNA for masking the active site in the range of 0 to 2 with respect to the total number of Taq DNA polymerase used in the immobilization reaction. This result is shown in FIG. 2A and FIG. 2B. In FIG. 2A, the leftmost lane and the rightmost lane are the same as in FIG. 1A, and the other lanes are the result of amplification using fixed Taq DNA polymerase while changing the protection rate. The lower number is the percentage of protection (masking rate), ie the number of moles of partial double-stranded DNA used for masking active sites relative to the number of moles of Taq DNA polymerase.

The activity of the immobilized enzyme was expressed as relative activity based on the solution phase as shown in FIG. The mole fraction of 11-mercaptodecanoic acid relative to the total number of moles of thiol molecules used to introduce the carboxyl group to the Au surface was 5.0%. The total amount of Taq DNA polymerase used in the immobilization reaction was 0.75 pmol corresponding to three monolayer membranes as shown in FIG. 1B, and other immobilization reaction conditions and PCR reaction conditions were the same as in Example 4. 2A and 2B show a partial complex of partial double-stranded DNA and Taq DNA polymerase (SH Eom, J. Wang. TA Steitz, Nature , vol. 382, pp. 278-281, 1996). Show that masking occurs.

Example 6: Activity of Immobilized Taq DNA Polymerase with pH of Immobilization Reaction

The mole fraction of the total thiol molecular moles of 11-mercaptodecanoic acid used to introduce the carboxyl group to the Au surface was fixed at 5.0% and measured while changing the pH. Other immobilization reaction conditions and PCR reaction conditions are the same as in Example 4. This result is shown in FIGS. 3A and 3B. In FIG. 3A, the leftmost lane and the rightmost lane are the same as in FIG. 1A, and the other lanes are the result of amplification using fixed Taq DNA polymerase while changing pH. The pH value of the buffer used for the immobilization reaction is indicated at the bottom of each lane. 3A and 3B show that the active site masking efficiency is optimized at pH 8.3 where the binding activity of Taq DNA polymerase is maximal.

Example 7: Activity of immobilized Taq DNA polymerase with immobilization reaction time

The molar fraction was fixed at 5.0% relative to the total number of moles of thiol molecules of 11-mercaptodecanoic acid used to introduce the carboxyl group to the Au surface, and measured while changing the immobilization reaction time. Other immobilization reaction conditions and PCR reaction conditions are the same as in Example 4. This result is shown in FIGS. 4A and 4B. In FIG. 4A, the left and right lanes are the same as in FIG. 1A, and the other lanes are amplified using fixed Taq DNA polymerase while changing the immobilization reaction time. Immobilization reaction time was expressed in minutes at the bottom of each lane.

In FIG. 4A and FIG. 4B, the rapid increase in the short reaction time region within 10 minutes means an increase in the yield of the immobilization reaction occurring in a state where the probability of multiple binding is small, and the slow decrease in the long time region of 10 minutes or more indicates a multiple bond. It means a decrease in activity due to the formation of a and a decrease in activity due to spatial constraints due to an increase in the mole fraction of the immobilized enzyme. That is, by optimizing the immobilization reaction time, which is an important kinetic variable, it is shown that the activity per unit area of the immobilized enzyme can be maximized by maintaining the probability of multiple bonds below an appropriate level and maximizing the yield of immobilization reaction simultaneously.

Example 8: Comparison of activity of solution phase and immobilized Taq DNA polymerase according to the number of PCR reaction cycles

The total tee of 11-mercaptodecanoic acid used to introduce the carboxyl group to the Au surface was fixed at 5.0% of the mole fraction relative to the number of moles of the molecule, and the enzyme was fixed in the conditions of the immobilization reaction as in Example 4, followed by the number of PCR reaction cycles. The activity was measured while changing. This result is shown in FIGS. 5A and 5B. In FIG. 5A, the number of PCR cycles is displayed at the bottom of each lane.

5A and 5B show that the activity pattern of the fixed Taq DNA polymerase observed through the PCR reaction is almost the same as that of the solution phase. In other words, the retention rate of activity per unit molecule is maximized.

Example 9: Activity of Taq DNA polymerase in accordance with a fixed amount of Taq DNA polymerase

The mole fraction was fixed at 5.0% with respect to the total number of thiol molecules of 11-mercaptodecanoic acid used to introduce the carboxyl group to the Au surface, and the amount of Taq DNA polymerase used for the immobilization reaction was 0 to 10 monolayer film relative to the Au surface area. It measured while changing in the range. The number of moles of partial double-stranded DNA used for masking active sites is twice that of Taq DNA polymerase. Other immobilization reaction conditions and PCR reaction conditions are the same as in Example 4. This result is shown in FIGS. 6A and 6B. In FIG. 6A, the leftmost lane and the rightmost lane are the same as in FIG. 1A, and the other lanes are PCR amplification results obtained by performing an immobilization reaction while varying the amount of Taq DNA polymerase used. The amount of Taq DNA polymerase used for the immobilization reaction was expressed in monolayers at the bottom of each lane.

6A and 6B show that the activity of the immobilized enzyme can be enhanced by controlling the amount of Taq DNA polymerase used in the immobilization reaction.

Example 10 Measurement of Activity of Immobilized Anti-DNA Antibodies

Activity measurements of immobilized anti-DNA antibodies were performed by measuring beta-ray release from 68 bp ds-DNA labeled with ³⁵ S that was used for active site masking using a beta counter (Beckman, Model LS6500). Beta-ray emission was measured by placing the Au fragment fixed with the antibody in 2 mL of the scintillation cocktail solution.

Example 11: Activity of Immobilized Anti-DNA Antibodies According to Mole Fraction of Carboxyl Groups on Immobilized Substrate

As in the case of Taq DNA polymerase, the immobilization method (PIM) in which the active site is masked in the entire carboxyl mole fraction range showed higher activity than the immobilization method (RIM) in which the active site is not masked. In addition, it can be seen that the activity of the masked antibody is the highest when the mole fraction of the carboxyl group is about 8%. This shows that by controlling the mole fraction of carboxyl groups on the immobilized substrate surface, the preservation of the activity of the masked antibody can be maximized kinetically. That is, by kinetically controlling the increase in activity retention rate and the prevention of activity deterioration due to multiple bond formation in the state of masking the active site, the activity of the antibody after immobilization can be maximized.

In FIG. 7, the x-axis is the same as FIG. 1b, and the y-axis is the activity of the antibody measuring the beta-ray released from the ^35s -labeled ds-DNA, an antibody selectively bound to the immobilized anti-DNA antibody. Is the result obtained by performing immobilization reaction (PIM) while masking the active site. Is the result of the immobilization reaction (RIM) without masking the active site.

Example 12 Activity of Fixed Anti-DNA Antibodies According to Concentration of Anti-DNA Antibodies

^The change in activity of the immobilized anti-DNA antibody according to the number of moles of 68 bp ds-DNA, an antigen labeled with ³⁵ S, is shown in FIG. 8. The activity of immobilized anti-DNA antibodies was measured while varying the number of moles of 68 bp ds-DNA for masking active sites. The total amount of anti-DNA antibody used for the immobilization reaction was about 33 fmol. The mole fraction was 10% based on the total number of moles of thiol molecules of 11-mercaptodecanoic acid used to introduce the carboxyl group to the Au surface. The immobilization reaction conditions were the same as in Example 11 except for the number of moles of 68 bp ds-DNA.

In Figure 8 Is the case for PIM, Is the case for RIM. It can be seen that PIM shows much higher activity than RIM. In the case of PIM, the saturation phenomenon in which the molar ratio of the anti-DNA antibody and the 68 bp ds-DNA used for masking the active site is observed in the range of 1: 1 to 1: 2 or more is caused by the formation of the antigen-antibody complex. It shows that the active part is masked.

Claims (34)

In the method of fixing the bioactive molecules to the substrate (substrate), a) reacting the bioactive molecule with a compound that selectively binds the active site to mask the active site of the bioactive molecule; b) introducing a linker to the surface of the substrate to bind the masked bioactive molecule of step a) to form a supporting material; c) controlling the reaction rate at which the masked bioactive molecule of step a) is bonded to the linking material on the surface of the support formed in step b); And d) reacting the masked bioactive molecule of step a) with a linking material on the support surface formed in step b) to fix the bioactive molecule to the support surface. The method of claim 1, wherein the step of forming the support b) includes forming a thin film of the linking material on the surface of the substrate, wherein the ratio of the linking material having the immobilized reactive functional group to the linking material having the non-reactive end group is provided. And controlling the mole fraction of the immobilized reactive functional groups on the support surface by adjusting the molar fraction. The method of claim 1, wherein adjusting the rate of reaction comprises adjusting the concentration of bioactive molecules. The method of claim 1 wherein adjusting the reaction rate c) comprises adjusting the pH. The method of claim 1, wherein adjusting the reaction rate c) comprises controlling the reaction time. 2. The method of claim 1 wherein adjusting the reaction rate c) comprises adjusting the reaction temperature. The method of claim 1, wherein the immobilization method comprises activating an immobilized reactive functional group of the linking material using a coupling reagent. The method of claim 1, wherein the bioactive molecule is a protein, enzyme, antigen, or antibody. The method of claim 1, wherein the selectively binding compound comprises a substrate, an inhibitor, a substrate, an inhibitor, a cofactor, chemical modifications, analogs or derivatives thereof, and their corresponding counterparts for masking the active site. Immobilization method selected from the group consisting of antibodies or antigens and variants thereof. The method of claim 1, wherein the active site is one or more active sites, or cofactor sites, of the bioactive molecule. The compound of claim 1, wherein the compound that selectively binds the bioactive molecule is bound by covalent bonds, ionic bonds, coordination bonds, hydrogen bonds, dipole-dipole bonds, packing, or a combination of two or more of these bonds. Immobilization Method. The method of claim 1 wherein the masking rate of the bioactive molecule is from 5 to 100%. The method of claim 1, wherein the substrate is a metal, a nonmetal, a semiconductor, or an oxide of these elements, an organic or inorganic polymer, a dendrimer, or a mixture of two or more thereof, and has a planar, spherical, linear, porous form, An immobilization method, which is a substrate formed of microfabricated gel pads or nanoparticles. The method of claim 1, wherein the connecting material of the support forming step b) forms a thin film of the connecting material on the surface of the substrate by forming a covalent bond, an ionic bond, a coordination bond, a hydrogen bond, an overlap, or two or more of these bonds with the substrate surface. Immobilization method. The method according to claim 14, wherein the functional group of the linking material reacting with the substrate surface is thiol group, sulfide group, disulfide group, silane group, carboxyl group, amine group, alcohol group, aldehyde group, epoxy group, thiol group, alkyl halide group, alkyl group, al Immobilization method which is a ken group, an alkyn group, an aryl group, or a combination of 2 or more of these functional groups. The method of claim 1, wherein the immobilized reactive functional group of the linking substance reacting with the bioactive molecule is a carboxyl group, amine group, alcohol group, aldehyde group, epoxy group, thiol group, sulfide group, disulfide group, alkyl halide group, alkyl group, alkene group, alkyne A method of immobilizing a group, an aryl group, or a combination of two or more functional groups thereof. The method of claim 1, wherein the immobilized reactive functional group of the bioactive molecule and the linking material is linked by a covalent bond, an ionic bond, a coordination bond, a hydrogen bond, an overlap, or a bond of two or more thereof. The method of claim 1, wherein the immobilized reactive functional group of the bioactive molecule and the linking material is connected to the support by an amide bond, an imine bond, a sulfide bond, a disulfide bond, an ester bond, an ether bond, an amine bond, or a bond of two or more thereof. Immobilization Method. 19. The method of claim 18, wherein the amine group of the bioactive molecule and the carboxyl group of the linking material are linked by an amide bond. The method of claim 18 wherein the carboxyl group of the bioactive molecule and the amine group of the linking material are linked by an amide bond. The immobilization method according to claim 18, wherein the amine group of the bioactive molecule and the aldehyde group of the linking material are linked by imine bonds. The method of claim 18, wherein the aldehyde group of the bioactive molecule and the amine group of the linking material are linked by an imine bond. The method of claim 18, wherein the thiol group of the bioactive molecule and the thiol group of the linking material are linked by disulfide bonds. The linking material having an immobilized reactive functional group is a reactive functional group such as mercaptocarboxylic acid, mercaptoaminoalkane, mercaptoaldehyde, dimercaptoalkane and carboxyl group, thiol group, alcohol group, aldehyde group, amine group, etc. Wherein the branch is selected from the group consisting of sulfides and disulfides, and the linking material having a non-reactive end group is selected from the group consisting of mercaptoalkane, mercaptoalcohol, sulfides, and disulfides. The method of claim 24 wherein the linking material having an immobilized reactive functional group is mercaptocarboxylic acid or mercaptoaminoalkane and the linking material having a non-reactive end group is mercaptoalcohol or mercaptoalkane. The method of claim 24, wherein the linking material having an immobilized reactive functional group is mercaptoaldehyde and the linking material having a non-reactive end group is mercaltoalcohol or mercaptoalkane. The method of claim 24, wherein the linking material having an immobilized reactive functional group is dimercaptoalkane and the linking material having a non-reactive end group is mercaptoalcohol or mercaptoalkane. The method of claim 24, wherein the mercaptocarboxylic acid is 11-mercaptoundodecanoic acid. The method of claim 24, wherein the mercaptoalcohol is 6-mercapto-1-hexanol and the mercaptoalkane is 1-heptanethiol. The immobilization method according to claim 3, wherein the linking substance having an immobilized reactive functional group is 0.05 to 50% of the total linking substances. 31. The method of claim 30 wherein the linking material having immobilized reactive functional groups is from 0.05 to 30% of the total linking material. The method of claim 1, wherein the immobilization method further comprises e) removing the selectively bound compound from the immobilized bioactive molecule. A masked bioactive molecule immobilized on a support according to the method of claim 1. A bioactive molecule immobilized on a support from which a compound selectively bound according to the method of claim 32 is removed.