KR20020013523A - REAGENTS AND METHODS FOR IDENTIFYING AND MODULATING EXPRESSION OF GENES REGULATED BY p21 - Google Patents

Abstract

The present invention provides methods and reagents for identifying genes involved in the regulation of cell cycle progression, growth promotion, apoptosis, cell aging and old age, and methods for identifying compounds that inhibit or enhance cell senescence, regulated by p21. It is about.

Description

REAGENTS AND METHODS FOR IDENTIFYING AND MODULATING EXPRESSION OF GENES REGULATED BY p21}

p21 ^{WAF1 / CIP1 / SDI1} is an important mediator of growth arrest and senescence in mammalian cells. p21 is a gene upregulated by wild type p53 [el-Deiry et al., 1993, Cancer Res. 55 : 2910-2919] and as growth inhibitory genes overexpressed in aging fibroblasts [Noda et al., 1994, Exp. Cell. Res. 211 : 90-98] Proteins that bind and inhibit cyclin-dependent kinase (CDK) have been independently identified by various groups [Harper et al., 1993, Cell. 75 : 805-816]. Due to its central role in p53 regulated growth arrest, p21 is generally regarded as a tumor suppressor. Nevertheless, p21 mutations in human cancers are sparse [Hall & Peters, 1996, Adv. Cancer Res. 68 : 67-108], p21 knockout mice develop normally and do not indicate an increased rate of tumorigenicity [Deng et al., 1995, Cell 82 : 675-684].

The cellular level of p21 is increased in response to various stimuli, including DNA-damaging and differentiating agents. Some such responses are mediated through the transcriptional activity of the p21 gene by p53, but p21 is regulated by a variety of p53-independent factors [reviewed in Gartel & Tyner, 1999, Exp. Cell Res. 227 : 171-181. Increased p21 expression results in cell growth arrest [Noda et al., 1994, ibid.] And occurs in both G1 and G2 [Niculescu et al., 1998, Mol. Cell. Biol. 18 : 629-643], followed by the development of morphological and phenotypic markers of aging [Vogt et al., 1998, Cell Growth Differ. 9 : 139-146; McConnell et al., 1998, Curr. Biol. 8 : 351-354; Bates et al., 1998, Oncogene 17 : 1691-1703; Fang et al., 1999, Oncogene 18 : 2789-2797].

Momentary induction of p21 is not only a momentary arrest that allows cells to repair DNA damage, but also by normal DNA fibroblasts [Serrano et al., 1997, Cell 88 : 593-602] by the DNA damage or introduction of oncogenic RAS [DiLeonardo et al. , 1994, Genes Develop. 8 : 2540-2551; Robles & Adami, 1998, Oncogene 16 : 1113-1123 and tumor cells [Chang et al., 1999, Cancer Res. 59 : 3761-3767 mediates different forms of damage-induced growth arrest, including permanent growth arrest, referred to as “accelerated aging”. Elevation of p21 expression is associated with the onset of terminal growth arrest during replication senescence in older fibroblasts [Noda et al., 1994, ibid .; Alcorta et al., 1996, Proc. Natl. Acad. Sci USA 93 : 13742-13747; Stein et al., 1999, Mol. Cell. Biol. 19 : 2109-2117] and terminal differentiation of cells after mitosis [El-Diery et al., 1995, ibid .; Gartel et al., 1996, Exp. Cell Res. 246 : 280-289. Replication aging of normal fibroblasts [Brown et al., 1997, Science 277 : 831-834] and accelerated aging of tumor cells through analysis of cells that cannot express p21 (p21-/-homozygotes) [Chang et al. al., 1999, Oncogene 18 : 4808-4818, demonstrated the need for p21 for transient G1 and G2 arrests [Deng et al., 1995, ibid .; Waldman et al., 1995, Cancer Res. 55 : 5187-5190; Bunz et al., 1998, Science 282 : 1497-1501.

p21 itself is not a transcription factor, but has an indirect effect on gene expression that may play a role in cellular function. The most well known biochemical function of p21 is to inhibit CDK complexes that regulate metastasis between different phases of the cell cycle [reviewed in Gartel & Tyner, 1998, "The growth regulatory role of p21 (WAF1 / CIP1)," in INHIBITORS OF CELL GROWTH, PROGESS IN MOLECULAR AND SUBCELLULAR BIOLOGY, Vol. 20 (A. Macieir-Coelho, ed.), Springer-Verlag: Berlin Heidelberg, pp. 43-71.]. One consequence of CDK inhibition is the dephosphorylation of Rb, which in turn inhibits E2F transcription factors that regulate many genes involved in DNA replication and cell circulation progression [Nevins, 1998, Cell Growth Differ. 9 : 585-593]. Comparison of p21 expressing cells (p21 + / +) and p21 non-expressing cells (p21 − / −) is related to p21 in radiation induced inhibition of various E2F regulated cell genes [de Toledo et al., 1998, Cell Growth Differ. 9 : 887-896]. Another consequence of CD21 inhibition by p21 is the stimulation of the transcriptional cofactor p300, which enhances NFκB (Perkins et al., 1988, Science 275 : 523-527). Histone acetyltransferase p300, which enhances a number of inducible transcription factors, may have a pleiotropic effect on gene expression [Snowden & Perkins, 1988, Biochem. Pharmacol. 55 : 1947-1954. p21 can also affect gene expression through interaction with proteins other than CDK. For example, p21 has been known to inhibit the expression of keratinocyte differentiation markers; This effect is not required for CDK inhibition but depends on the C-terminal portion of p21, which is known to bind to proliferating cell nuclear antigens (Di Cunto et al., 1998, Science 280 : 1069-1072). p21 also contains JNK kinases [Shim et al., 1996, Nature 381 : 804-807], apoptosis signal regulatory kinase 1 [Asada et al., 1999, EMBO J. 18 : 1223-1234] and Gadd45 [Kearsey et al. , 1995, Oncogene 11 : 1675-1683], and this interaction may affect the expression of genes regulated by corresponding pathways.

There is a need in the art to identify genes whose expression is regulated by induction of p21 gene expression. There is also a need in the art to develop targets for assessing the effects of compounds on cell aging, carcinogenesis and age-related diseases.

The present invention relates to cellular aging and changes in cellular gene expression following aging. In particular, the present invention relates to the identification of genes whose expression is regulated by the cellular gene product, p 21, induced in cells at the onset of aging. More specifically, the present invention provides markers of cellular senescence that are genes whose expression is induced or inhibited by p21. The present invention provides a method for identifying compounds that inhibit or enhance cellular senescence by detecting the inhibition of or inhibition of such marker genes. There is also provided a reagent which is a recombinant mammalian cell containing a recombinant expression construct encoding an experimentally inducible p21 and a recombinant mammalian cell containing a recombinant expression construct expressing a reporter gene under transcriptional control of a promoter of a gene regulated by p21. do.

The present invention provides reagents and methods for identifying genes whose expression is regulated by induction of p21 gene expression. In addition, the present invention provides a compound which inhibits or enhances the effect of p21 on cellular gene expression in the design of a trial drug for preventing cell aging, carcinogenesis and age-related diseases or increasing the efficacy of anti-cancer treatment as a first step. It provides reagents and methods to confirm.

In a first aspect, the present invention provides a mammalian cell containing an inducible p21 gene. In a preferred embodiment, the mammalian cell is a recombinant mammalian cell comprising a recombinant expression construct encoding an inducible p21 gene. More preferably, the construct comprises a nucleotide sequence encoding p21, most preferably human p21, under transcriptional control of the inducible promoter. In another embodiment, the construct comprises a nucleotide sequence that encodes an amino terminal portion of p21 comprising a CDK binding domain, more preferably comprising amino acids 1 to 78 of the p21 amino acid sequence. In a more preferred embodiment, the inducible promoter can be induced by contacting the cell with an inducer that induces transcription from the inducible promoter, most preferably a physiological neutral inducer or by removing an agent that inhibits transcription from such a promoter. In a preferred embodiment, the mammalian cell is a fibrosarcoma cell.

In another embodiment of the first aspect of the present invention there is provided a recombinant mammalian cell comprising a recombinant expression preparation under which the reporter gene is under transcription control of a promoter derived from a cell gene whose expression is regulated by p21. In a preferred embodiment, the promoter is derived from a cell gene whose expression is inhibited by p21. In this embodiment, the promoter is most preferably derived from the genes identified in Table 1. Most preferably, the promoter is ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / MCM7 , CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR, or citron kinase. In another preferred embodiment, the promoter is derived from a cell gene whose expression is induced by p21. In this embodiment, the promoter is most preferably derived from the genes identified in Table 2. Most preferably, the promoter is serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, activin A, natural killer cell protein 4, prosaposin, Mac2 binding protein, galectin-3, peroxide dismutase 2, granulin / epitelin, p66 ^shc , lysosomal β-galactosidase or cathepsin B. Preferred reporter genes comprising the recombinant expression constructs of the invention include firefly luciferase, chloramphenicol acetyltransferase, beta-galactosidase, green fluorescent protein, or alkaline phosphatase.

In a further preferred embodiment, the invention relates to a first recombinant expression construct encoding a reporter gene under expression transcription control of a promoter of a mammalian gene whose expression is regulated by p21, and a second recombinant expression construct encoding a mammalian p21 gene. And mammalian cells wherein the expression of p21 is experimentally induced in mammalian cells. In a preferred embodiment, the recombinant expression construct encoding the mammalian p21 gene is under transcriptional control of an inducible heterologous promoter, and expression of p21 from the recombinant expression construct brings the recombinant cell into contact with an inducer that induces transcription from the inducible promoter. Or by removing an agent that inhibits transcription from such a promoter. Preferably, the construct comprises a nucleoside sequence encoding p21, most preferably human p21. In an alternative embodiment, the construct comprises a nucleotide sequence encoding the amino terminal portion of p21 comprising amino acids 1 to 78 of the CDK binding domain, more preferably p21 amino acid sequence. In one preferred embodiment, the promoter is from a cellular gene whose expression is inhibited by p21. In these embodiments, the promoter is most preferably derived from the genes identified in Table I. In another preferred embodiment, the promoter is from a cellular gene whose expression is inhibited by p21. In these embodiments, the promoter is most preferably derived from the genes identified in Table II. Preferred reporter genes comprising the recombinant expression constructs of the invention include firefly luciferase, chloramphenicol acetyltransferase, beta-galactosidase, green fluorescent protein or alkaline phosphatase. In one preferred embodiment, the mammalian cell is a fibrosarcoma cell.

In a second aspect, the present invention provides a conditioned cell culture medium with p21 expressing cells and a method of preparing the medium with the above conditions. In a preferred embodiment, the conditioned medium is prepared by culturing p21 expressing cells in a mammalian cell medium, most preferably in a synthetic medium that does not contain serum additives. Useful p21 expression in this aspect of the invention includes both inducible expression of endogenous p21 expression and recombinant expression constructs encoding p21 under transcriptional control of an inducible promoter. Preferred cells include mammalian cells, preferably rodent or primate cells, more preferably mouse or human cells. Particularly preferred embodiments are fibrosarcoma cells, more preferably human fibrosarcoma cells, most preferably human HT1080 fibrosarcoma cell line and derivatives thereof.

This aspect of the present invention also provides a screening method for identifying compounds that inhibit p21 induced expression of mitogenic or anti-apoptotic factors in mammalian cells. In a preferred embodiment, the method comprises inducing p21 expression in the cell in the presence or absence of the compound, and comparing the cleavage factor or anti-apoptotic compound, or many of them, in a conditioned medium. Inhibitors are identified by containing smaller amounts of fission inducing agents or anti-apoptotic compounds, or many of them, in the application medium in the presence of the compound than in the absence of the compound. In the methods provided in this aspect of the invention, p21 expressing cells are useful, and p21 expression in such cells can be achieved using cells that induce endogenous p21 or contain inducible p21 expression constructs according to the invention. . Preferred cells include mammalian cells, preferably rodent or primate cells, more preferably mouse or human cells. Particularly preferred embodiments are fibrosarcoma cells, more preferably human fibrosarcoma cells, most preferably human HT1080 fibrosarcoma cell line and derivatives thereof.

In an alternative embodiment, the present invention is a method of identifying a compound that inhibits p21 induced expression of a mitogenic or anti-apoptotic factor in a mammalian cell, wherein the cell is transcriptionally regulated by a promoter of a cellular gene that is induced by p21. Provided is a method comprising a recombinant expression construct that encodes a reporter gene. In a preferred embodiment, the promoter comprises CTGF, activin A, epitelin / granulin, galectin-3 and prosaposin. Preferred reporter genes include, but are not limited to, firefly luciferase, β-galactosidase, alkaline phosphatase and green fluorescent protein. In these embodiments, inhibition of p-21 mediated induction of reporter gene expression is used to identify compounds that inhibit the induction of fission or anti-apoptotic factors in p21 expressing cells.

In this aspect, the present invention provides a method of inhibiting the production of a mitogenic or anti-apoptotic factor or compound in a mammalian cell, wherein the method inhibits the production of a mitogenic or anti-apoptotic factor. Contacting the compound, wherein the compound is identified by the method of this aspect of the invention. In a preferred embodiment, the mammalian cell in contact with an inhibitory compound that inhibits the production of a mitogenic or anti-apoptotic factor is fibroblasts, most preferably interstitial fibroblasts.

In a third aspect, the present invention provides a method for identifying a compound that inhibits p21 mediated regulation of cellular gene expression. These methods include inducing or otherwise producing p21 in mammalian cells; Assaying the cells for changes in cellular gene expression in which expression is regulated by p21 in the presence of a compound; And identifying a compound that inhibits p21 mediated regulation of cellular gene expression when the expression of the cellular gene is changed to a lesser extent in the presence of the compound than in the absence of the compound. In a preferred embodiment, the cellular gene is inhibited by p21 and the inhibitor is detected by detecting gene expression at a level greater than that detected when p21 is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table I. In an alternative preferred embodiment, the cellular gene is induced by p21 and the inhibitor is detected by detecting gene expression at a level lower than that detected when p21 is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table II. In a further alternative embodiment, the method is performed using a recombinant mammalian cell comprising a reporter gene whose expression is controlled by transcription of a promoter derived from a gene regulated by p21. In these embodiments using constructs comprising a promoter derived from a gene inhibited by p21, the reporter gene product is produced at a greater level in the presence than in the absence of the compound when the compound is an inhibitor of p21 gene expression control. In these embodiments, the promoter is most preferably derived from the genes identified in Table I. Most preferably, the promoter is ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / MCM7 , CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or citron kinase. When using a construct comprising a promoter derived from a gene induced by p21, the reporter gene product is produced at a lower level in the presence than in the absence of the compound when the compound is an inhibitor of p21 gene expression control. In this embodiment, the promoter is most preferably derived from the genes identified in Table II. Most preferably, the promoter is serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, activin A, natural killer cell protein 4, prosaposin, Mac2 binding protein, galectin-3, peroxide dismu It is derived from Tase 2, granulin / epitelin, p66 ^shc , lysosomal β-galactosidase, or cathepsin B. Preferred reporter genes comprising the recombinant expression constructs of the invention include firefly luciferase, chloramphenicol acetyltransferase, beta-galactosidase, green fluorescent protein or alkaline phosphatase. In another preferred embodiment, the cell comprises a first recombinant expression construct that encodes a reporter gene that is under transcription control of a mammalian gene promoter whose expression is regulated by p21, and a second recombinant expression construct that encodes a mammalian p21 gene, Expression of p21 is experimentally induced in mammalian cells. The product of the reporter gene or endogenous gene induced or inhibited by p21 is detected by using immunological reagents to assay the activity of the gene product or to hybridize with the complementary nucleic acid.

In a fourth aspect, the present invention provides a method for identifying a compound that inhibits aging of mammalian cells. The method comprises treating the mammalian cells in the presence of the compound with an agent or culturing the mammalian cells under conditions that induce aging; assaying mammalian cells for inhibition or induction of genes that are inhibited or induced by p21 gene expression; And identifying the compound as an aging inhibitor if the gene inhibited by p21 in the presence of the compound is not inhibited or the gene induced by p21 is not induced. In a preferred embodiment, the cellular gene is inhibited by p21 and the aging inhibitor is identified by detecting the expression of the gene at a level greater than that detected when p21 is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table I. In an alternative preferred embodiment, the cellular gene is induced with p21 and the aging inhibitor is detected by detecting expression of the gene at a level lower than that detected when p21 is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table II. In a further alternative embodiment, the method is carried out by using a recombinant mammalian cell comprising a reporter gene under the transcriptional control of a promoter derived from a gene regulated by p21. In this embodiment, where the compound is an inhibitor of aging, production of the reporter gene is at a greater level in the presence rather than absence of the compound when using a construct comprising a promoter derived from a gene inhibited by p21. Are detected and at a lower level when using a construct comprising a promoter derived from a gene derived with p21. The promoter is preferably derived from the genes identified in Table I (for genes inhibited by p21) or Table II (for genes induced by p21). For genes inhibited by p21, promoters are ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, Most preferably, it is derived from MPP2, MPP5, CDC47 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, DHFR or sirotin kinase. For p21-induced genes, promoters are serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, activin A, natural killer cell protein 4, prosaposin, Mac2 binding protein, gelatin-3 Most preferably, it is derived from peroxide molecular displacement coenzyme 2, grenulin / epitelin, p66 ^shc , lysosomal β-galactosidase, or cathepsin B. In another preferred embodiment, the cell comprises a first recombinant expression construct encoding a reporter gene under transcriptional control of a promoter for a mammalian cell whose expression is regulated by p21, and a second recombinant expression construct encoding a mammalian p21 gene, There expression of p21 is thus experimentally induced in mammalian cells. The product of the reporter gene or endogenous gene induced or inhibited with p21 can be detected by assaying the activity of the gene product using immunological reactants and matching with complementary nucleic acids.

In a fifth aspect, the present invention provides a method for inhibiting cell aging, aging-related diseases or aging-related gene products, the method for inhibiting senescence as determined using the methods provided in the aspects of the invention described above. Contacting the compound.

In a sixth aspect, the invention provides a method for identifying a compound that enhances senescence in mammalian cells. The method comprises inducing p21 in mammalian cells in the presence and absence of a compound; assaying mammalian tumor cells for inhibition or induction inhibited or induced by p21 gene expression; And identifying the compound as an enhancer of aging if the gene inhibited by p21 in the presence of the compound is inhibited to a greater extent or the gene induced by p21 is induced to a greater extent. In a preferred embodiment, the cell gene is inhibited by p21 and the enhancer can be detected by detecting the expression of the cell gene to a lesser extent than that detected when p21 is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table I. In an alternative preferred embodiment, the cell gene is derived from p21 and the enhancer can be detected by detecting the expression of the cell gene to a lesser extent than if it was detected in the absence of the compound. In a preferred embodiment, the genes are identified in Table II. In a further alternative embodiment, the method is performed using a recombinant mammalian cell comprising a reporter gene under the transcriptional control of a promoter whose expression is derived from a gene regulated by p21. There, the cell comprises a construct having a reporter gene under transcriptional control of a promoter derived from a gene whose expression is regulated by p21. In this embodiment, where the compound is a potentiator of aging, the production of the reporter gene is detected at a lower level in the presence of the compound than the absence of the compound when using a construct comprising a promoter derived from a gene inhibited by p21. Or using a construct comprising a promoter derived from a gene derived from p21, is detected at a greater level in the presence than in the absence of the compound. In a preferred embodiment, the promoter is derived from a gene whose expression is inhibited by p21, most preferably the gene identified in Table I. Most preferably, the promoter is ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / MCM7 Most preferably, it is derived from CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or citron kinase. In an alternative preferred embodiment, the promoter is expressed from a gene whose expression is derived from a p21 promoter, most preferably from the genes identified in Table II. Promoters include serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, activin A, natural killer protein 4, prosaposin, Mac2 binding protein, gelatin-3, peroxide molecular displacement coenzyme 2, grease Most preferably, it is derived from inulin / epitelin, p66 ^shc , lysosomal β-galactosidase, or cathepsin B. In another preferred embodiment, the cell comprises a first recombinant expression construct encoding a reporter gene under transcriptional control of a promoter for a mammalian cell whose expression is regulated by p21, and a second recombinant expression construct encoding a mammalian p21 gene, There expression of p21 is thus experimentally induced in mammalian cells. The product of the reporter gene or endogenous gene induced or inhibited by p21 can be detected by using immunological reactants, assaying the activity of the gene product and matching with complementary nucleic acids.

In a seventh aspect, the present invention provides a method of promoting or enhancing cellular senescence in a tumor cell, proliferative cell or any cell that is pathological or causing disease due to excessive proliferation, the method further comprising the cell described above. Contacting with a compound that enhances aging as determined using the methods provided in terms of.

In an eighth aspect, the present invention provides compounds identified using any of the methods of the invention disclosed herein.

In a ninth aspect, the invention provides a method of obtaining an increased number of nucleic acid species for genes associated with cell cycle progression. The method comprises inducing the expression of p21 in mammalian cells; Acquiring cellular mRNA before p21 induction from mammalian cells and after p21 is induced and cell growth is stopped; And obtaining an increased number of nucleic acid species for the genes involved in cell cycle progression. In a preferred embodiment, an increased number of nucleic acid species for cell cycle progression genes are obtained with a deduction conformation method known in the art, with low expression of nucleic acid species selectively expressed in cells expressing p21.

In a tenth aspect, the present invention provides a method for obtaining an increased number of nucleic acid species for genes encoding hidden proteins with lateral secretory function and proteins associated with aging and aging-related diseases. The method comprises inducing the expression of p21 in mammalian cells; acquiring cellular mRNA from mammalian cells before and after p21 is induced; And acquiring an increased number of nucleic acid species for the gene with increased expression in the cell after p21 is induced. In a preferred embodiment, the lateral secretory function of the protein is a mitogenic and anti-apoptotic effect. In a preferred embodiment, an increased number of nucleic acid species for hidden proteins with lateral secretory function and genes encoding proteins related to aging and aging-related diseases are obtained with deduction conformance methods known in the art, wherein p21 Highly expressed nucleic acid species are selectively increased in expressing cells.

In an eleventh aspect, the present invention provides a method for identifying a gene that is a marker of cellular senescence, which method induces senescence by generating p21 expression in first generation mammalian cells and induces quiescence in second generation mammalian cells. Making; Obtaining mRNA from each generation of cells; Comparing the intracellular gene expression form before and after the production of intracellular p21 with the intracellular gene expression form before and after the cell is at rest; comparing the plurality of genes strongly induced in the cell with the plurality of genes strongly induced at rest after p21 is induced; And identifying the genes that are strongly induced in the cells that produce p21 without being strongly induced in the stationary state.

In a twelfth aspect, the present invention provides a method for detecting aging in mammalian cells. These methods include detecting the expression of a gene that is a marker for aging. In a preferred embodiment, the preferred marker for aging is connective tissue growth factor (CTGF), serum amyloid A, integrin β-3, activin A, natural killer cell protein 4, Mac2 binding protein, or tissue transglutaminase. Include.

In a thirteenth aspect, the invention provides a method for identifying a compound that promotes induction of senescence in mammalian cells. These methods include treating mammalian cells with an agent or culturing the mammalian cells under conditions that induce aging in the presence of a compound; assaying mammalian tumor cells for inhibition or induction of genes that are inhibited or induced by p21 gene expression; And identifying the compound as an enhancer if the gene inhibited by p21 in the presence of the compound is further inhibited, ie, to a greater extent, or if the gene induced by p21 is further induced, ie, induced to a greater degree. Steps. In a preferred embodiment, the cell gene is inhibited by p21, and a compound that promotes induction of senescence is detected when p21 is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table I. In another preferred embodiment, the cell gene is induced by p21 and is detected by detecting the expression of a higher level of cell gene than that detected when p21, which promotes the induction of senescence, is expressed in the absence of the compound. In a preferred embodiment, the genes are identified in Table II. In yet another embodiment, the method is performed using a recombinant mammalian cell comprising a reporter gene whose expression is under transcriptional control of a promoter derived from a gene whose expression is regulated by p21, wherein the cell is expressed in p21. And constructs having a reporter gene under transcriptional control of a promoter from a gene regulated by. In these embodiments, when using a construct comprising a promoter derived from a gene inhibited by p21, the production of a lower level of the product of the reporter gene in the presence of the compound than in the absence of the compound, or induced by p21 In the case of using a construct comprising a promoter derived from a gene, the production of a higher level of the product of the reporter gene in the presence of the compound than in the absence of the compound is detected when the compound promotes the induction of aging. In a preferred embodiment, the promoter is derived from a gene whose expression is inhibited by p21, with the most preferred genes as identified in Table I. The promoter is ORC1, PRC1, XRCC9, CDC2, Cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / MCM7, CDC21 / Most preferably derived from MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or citron kinase. In another preferred embodiment, the promoter is derived from a gene whose expression is induced by p21, with the most preferred genes as identified in Table II. Promoters include serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, actinbin A, natural killer cell protein 4, prosaposin, Mac2 binding protein, galectin-3, superoxide dismutase 2, Most preferred are granulin / epidelin, p66 ^shc , lysosomal β-galactosidase, or kadipsin B. In another preferred embodiment, the cell comprises a first recombinant expression construct encoding a reporter gene under transcriptional control of a promoter for a mammalian gene whose expression is regulated by p21, and a second recombinant expression construct encoding a mammalian p21 gene. Wherein expression of p21 in mammalian cells is experimentally induced by expression constructs. The product of the reporter gene or endogenous gene induced or inhibited by p21 can be detected by assaying the activity of the gene product using immunological reagents or by hybridizing with complementary nucleic acids.

In a fourteenth aspect, the present invention provides a method for identifying a compound that induces aging in mammalian cells. These methods include assaying mammalian cells in the presence or absence of a compound for inhibition or induction of a gene that is inhibited or induced by p21 gene expression; And identifying a compound that induces aging when a gene inhibited by p21 in the presence of the compound is inhibited or a gene induced by p21 is induced. In a preferred embodiment, the cell gene is inhibited by p21 and the compound that induces senescence can be measured by detecting the expression of the cell gene at a lower level than that detected in the absence of the compound. In a preferred embodiment, the genes are as identified in Table I. In another preferred embodiment, the cell gene is induced by p21 and the compound that induces aging can be measured by detecting expression of the cell gene at a higher level than that measured in the absence of the compound. In a preferred embodiment, the genes are as identified in Table II. In yet another embodiment, the methods of the invention are performed using a recombinant mammalian cell comprising a reporter gene under the transcriptional control of a promoter whose expression is derived from a gene whose expression is regulated by p21, wherein the cell is including a construct having a reporter gene under transcriptional control of a promoter from a gene regulated by p21). In these embodiments, when using a construct comprising a promoter derived from a gene inhibited by p21, the production of the product of the reporter gene at a lower level in the presence of, or induced by, p21 than in the absence of the compound In the case of using a construct comprising a promoter derived from a gene, the production of the product of the reporter gene at a higher level in the presence than in the absence of the compound is detected when the compound induces aging. In a preferred embodiment, the promoter is derived from a gene whose expression is inhibited by p21, with the most preferred genes as identified in Table I. Promoters include ORC1, PRC1, XRCC9, CDC2, Cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, Timopoietin α, MPP2, MPP5, CDC47 / MCM7, CDC21 / MCM4 Most preferably, it is derived from DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or kinase. In another preferred embodiment, the promoter is derived from a gene whose expression is induced by p21, with the most preferred genes as identified in Table II. Promoters include serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, actinbin A, natural killer cell protein 4, prosaposin, Mac2 binding protein, galectin-3, superoxide dismutase 2, Most preferred are granulin / epidelin, p66 ^shc , lysosomal β-galactosidase, or kadipsin B. The product of the reporter gene or endogenous gene induced or inhibited by p21 can be detected by assaying the activity of the gene product or hybridizing with complementary nucleic acids using immunological reagents.

Particularly preferred embodiments of the invention are apparent from the more detailed description of the preferred embodiments and the claims.

Brief description of the drawings

1 is a schematic of the IPTG-regulated retroviral vector LNp21CO3 used in the production of human HT1080 fibrosarcoma cell line variant p21-9.

2A is a graph over time of induction of p21 after addition of 50 μM IPTG, with p21 levels measured by ELISA.

2B is a graph over time of degeneration of p21 after removal of IPTG.

3A is a graph showing the change over time of the ³ H-thymidine labeling index (measured by autoradiography) after addition of 50 μM IPTG.

3B is a graph showing the change over time of mitotic index (measured by microscope after DAPI staining) after addition of 50 μM IPTG.

3C is a graph showing the change over time of cell cycle distribution (measured with propidium iodine followed by fluorescence labeled cell separator (FACS)) after addition of 50 μM IPTG; -●-: phase G1 cells of the cell cycle; Cells in the G2 / M phase of the cell cycle; -▼-: S phase cells of the cell cycle.

4A is a graph showing the sustained effects of treatment with different doses of IPTG on the formation of colonies by p21-9; -: 0.5 μM IPTG; -: 5 μM IPTG; ▼-: 50 μΜ IPTG.

4B is a graph showing the change over time of ³ H-thymidine labeling index (measured by autoradiography) after removal of 50 μM IPTG; -1-: 1 day; -○-: 5 days.

Figure 4c is a graph showing the change in mitosis index over time after removing 50μM IPTG (-●-: 1 day;-○-: 5 days).

4D is a graph showing the percentage change of suspended cells over time after removal of 50 μM of IPTG after 1 day or 3 days of treatment (− •-: untreated;-○-: 1 day; ▼-: 3 days).

FIG. 5A is a bar graph depicting PKH2 fluorescence profiles measured by FACS for untreated cells (left) and treated with 50 μM of IPTG for 5 days and cells released in IPTG free medium (right).

5B shows DNA of PKH2 ^lo SS ^lo (thin lines) and PKH2 ^hi SS ^hi (thick lines) cell subjects isolated by FACS after 5 days of treatment with 50 μM IPTG, PKH2 labeling and after 6 days without IPTG It is a graph showing the FACS profile of the content.

5C is a graph showing the FACS profile of the DNA content of suspended cells collected from treatment (left) for 3 days with 50 μM IPTG and 48 hours after release from untreated cells (right).

FIG. 5D is a graph showing the FACS profile of the DNA content of adherent cells 0, 12, 24, 28, 36 and 48 hours after release from IPTG treatment for 1 day.

Figure 6 is a micrograph showing examples of normal (left) and abnormal (right) mitotic shapes observed 1-2 days after release from IPTG (DAPI staining; micrographs at 1,000 × magnification).

7A is a photograph of gel electrophoresis pattern of an immunoblotting assay for RT-PCR experiments (left), Norton blot analysis of cellular mRNA expression (middle) and IPTG induced changes in expression of indicated genes ( C: control untreated p21-9 cells; I: cells treated for 3 days with 50 μM IPTG). β2-microglobulin (β2-M) was used as the standard control for RT-PCR and the S14 ribosomal protein gene for Norton hybridization.

7B is a photograph of gel electrophoresis of the RT-PCR experiment (left) and immunoblotting analysis (right) showing changes over time in the expression of the indicated p21 inhibited gene upon IPTG addition and release.

FIG. 7C is a photograph of the electrophoretic pattern of RT-PCR experiment (left) and Norton hybridization analysis (right) of the change over time of expression of the p21 induced gene indicated upon IPTG addition.

FIG. 7D is a comparison of gene expression in untreated controls, p 21-9 cells (C), serum deficient stop cells (Q) and IPTG treated senescent cells (I).

FIG. 8A shows conditioned medium and conditioned from fresh medium (F), IPTG treated (I) or untreated p21-9 cells (U) for ³ H-thymidine incorporation by HS 15.T cells. Bar graph showing the effect of a 1: 1 mixture of fresh medium (I / F and U / F) (supplemented with 1% or 2% serum).

8B shows 24 or 48 hours in 10% serum (control), in low serum fresh medium (F) or in conditioned medium from IPTG treated (I) or untreated (U) p21-9 cells. After incubation, a graph showing the FACS profile of the DNA content of combined attached and floating C8 cells. The relative number of attached cells (determined by methylene blue staining) after incubation for 48 hours in the same medium is listed below each set of histograms.

9 is a histogram of luciferase activity in cells containing constructs with luciferase under the transcriptional control of the promoter from genes whose expression is regulated by p21. Absence of p21 expression for constructs prepared according to Example 6 containing a promoter from polo-like kinase (PLK 1), natural killer cell protein 4 (NK4), and serum amyloid A (SAA) (no IPTG None, shown by white bars) and absence (addition of 50 μM IPTG, shown by black bars) is shown; Each promoter construct was tested using two independent construct clones.

Detailed Description of the Preferred Embodiments

The present invention provides reagents and methods for identifying genes involved in mediating p21 induced cell senescence, and compounds that can inhibit or enable aging or arrest of mammalian cells.

For the purposes of the present invention, the term "single cell" or "cells" has the same meaning and is intended to include in vitro cultures of mammalian cells that are grown and maintained as is particularly known in the art. .

For the purposes of the present invention, the plural term “cellular genes” is intended to include not only one gene but also two or more genes. In addition, those skilled in the art can detect the regulatory effect of reporter constructs under cellular gene expression, or transcriptional control of promoters derived from cellular genes, the effect of which may be a second or any number of additional genes. Or by repeating the reporter gene construct. Alternatively, expression of two or more genes or reporter gene constructs can be assayed simultaneously within the scope of the present invention.

For the purposes of the present invention, the term "stop" will be understood to include temporary disruption of cell growth and DNA replication, such as occurs in mammalian cells cultured under conditions of serum deficiency.

For the purposes of the present invention, the term “aging” refers to DNA replication that cannot be countered by growth factors, such as occurs at the end of the proliferative life of normal cells or abnormal or tumor cells in response to cytotoxic drugs, DNA damage or other cellular damage. And permanent interruption of cell growth.

Aging can be caused in mammalian cells in a number of ways. First is the natural ending of normal cell growth in vivo or in vitro; There is a limited number of cell divisions, passages or generations that normal cells may experience before aging. The exact number varies depending on the cell type and the species of origin [Ref. Hayflick & Moorhead, 1961, Exp. Cell Res . 25 : 585-621]. Another method of causing aging in certain cell types is the treatment with cytotoxic drugs such as most anticancer drugs, radiation and cell differentiators [Chang et al., 1999, Cancer Res. 59: 3761-3767. Aging can also be rapidly induced in any mammalian cell by transducing a tumor suppressor gene (such as p53, p21, p16 or Rb) into the mammalian cell and expressing the gene therein . See Sugrue et al. , 1997, Proc. Natl. Acad. Sci. USA 94 : 9648-9653; Uhrbom et al. , 1997, Oncogene 15 : 505-514; Xu et al ., 1997, Oncogene 15 : 2589-2596; Vogt et al ., 1998, Cell Growth Differ . 9 : 139-146.

The reagents of the present invention may be any mammalian cell, preferably a rodent or primate cell, more preferably a mouse cell, most preferably capable of causing expression of the p21 gene, an endogenous or exogenous gene introduced by genetic processing. Includes human cells. Although the examples describe recombinant mammalian cells comprising recombinant expression constructs that encode genes such as the inducible p21 gene, these embodiments are directed only to experimental design selection and convenience and the present invention is directed to induction of endogenous p21. It should be understood to include completely.

In a preferred embodiment, the invention provides a mammalian cell containing a recombinant expression construct encoding an inducible mammalian p21 gene. In a preferred embodiment, the p21 gene is U.S. cited herein by reference. Human p21 with nucleotide and amino acid sequences, as described in patent 5,424,400. In an alternative embodiment, the p21 gene is the amino terminal portion of the human p21 gene, preferably in US Pat. No. 5,807,692, comprising amino acid residues 1-78 of the natural human p21 protein (incorporated herein by reference). As described), more preferably humans comprising a CDK binding domain comprising amino acids 21-71 of a natural human p21 protein (Nakanishi et al., 1995, EMBO J. 14: 555-563). p21 is the amino terminal portion of the gene. Preferred host cells include mammalian cells, preferably rodent or primate cells, more preferably mouse or human cells. Particularly preferred embodiments are fibrosarcoma cells, more preferably human fibrosarcoma cells, most preferably human HT1080 fibrosarcoma cell lines and derivatives thereof. Most Preferred Cell Lines By U.S.A. HT1080 fibrosarcoma cell line derivative, identified as p21-9, deposited on April 6, 2000 in the American Type Culture Collection of Virginia Manassas.

Recombinant expression constructs can be incorporated into a suitable mammalian host as would be understood by those skilled in the art. Preferred embodiments of such constructs can be produced as deliverable vectors, more preferably viral vectors, very preferably retroviral vectors, adenovirus vectors, adeno-associated viral vectors and vaccinia virus vectors as known in the art. MAMMALIAN CELL BIOTECHNOLOGY: A PRACTICAL APPROACH, (Butler, ed.), Oxford University Press: New York, 1991, pp. 57-84.

In a further preferred embodiment, the recombinant cells of the invention contain constructs encoding the inducible p21 gene under the transcriptional control of the inducible promoter. In a more preferred embodiment, the inducible promoter is responsive to trans action factors whose effects can be controlled by inducers. The inducer can be any factor that can be manipulated experimentally, including temperature and very preferably the presence or absence of the inducer. Preferably, the inducer is a compound, very preferably a physiologically neutral compound that is specific for the trans action factor. In the use of constructs comprising inducible promoters as described herein, the expression of p21 from the recombinant expression construct may contact the recombinant cell with an inducer that induces transcription from the inducible promoter or inhibits transcription from such a promoter. Adjusted by removing the agent. Various inducible promoters and cognate trans agonists are known in the art, such as heat shock promoters that can be activated by increasing the temperature of a cell culture, and more preferably tet promoters and fusions thereof with mammalian transcription factors. Promoter / factor pairs (US Pat. Nos. 5,654,168, 5,851,796 and 5,968,773) and bacterial lac promoters of lactose operon and their cognate lac I inhibitory proteins. In a preferred embodiment, said recombinant cell expresses a recombinant expression construct encoding human p21 and a lac I inhibitory protein under the control of a promoter comprising one or multiple lac reactive elements, wherein expression of p21 is a physiological neutral inducer. Can be induced by contact with isopropylthio-β-galactoside. In this preferred embodiment, the lac I inhibitor is encoded by a recombinant expression construct identified as 3'SS (commercially available from Stratagene, LaJolla, Calif.).

The invention also provides recombinant expression constructs wherein the reporter gene is under transcriptional control of the promoter of the gene whose expression is regulated by p21. Such genes include genes whose expression is induced by p21 and genes whose expression is inhibited by p21. In a preferred embodiment, the promoter is derived from the gene identified in Table 1, where expression is inhibited by p21. Very preferably, the promoter is ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / Derived from MCM7, CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or citron kinase. In a further preferred embodiment, the promoter is derived from a gene whose expression is induced by or otherwise increased by p21, these genes are identified in Table II. Very preferably, the promoter is serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, actinbin A, natural lethal cell protein 4, prosaposin, Mac2 binding protein, galectin-3, superoxide disulfide. Mutase 2, guranulin / epitelin, p 66 ^she , lysosomal β-galactosidase or catethecin B. This reporter gene is then used as a sensitive and convenient indicator of the p21 inducing effect, allowing compounds to be easily identified that inhibit or enable the effect of p21 expression in mammalian cells. Host cells for such constructs include any cell from which p21 gene expression can be induced and preferably include cells containing recombinant expression constructs containing inducible p21 genes as described above. Reporter genes useful in practicing one aspect of the invention include, but are not limited to, firefly luciferase, chloramphenicol acetyltransferase, beta-galactosidase, green fluorescent protein, and alkaline phosphatase.

In a preferred embodiment, the cell according to the invention comprises a first recombinant expression construct which encodes a reporter gene under the transcriptional control of a promoter for a mammalian gene whose expression is regulated by p21, and a mammal in which p21 expression is experimentally inducible in the mammalian cell. both of the second recombinant expression constructs encoding the p21 gene.

In another embodiment, the invention provides a mammalian cell comprising a recombinant expression construct that encodes a reporter gene under the transcriptional control of a promoter for a mammalian gene whose expression is inhibited by p21, wherein the promoter comprises genes ORC1, PRC1, XRCC9, CDC2, Cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / MCM7, CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or citron kinase. In another embodiment, the invention provides a mammalian cell comprising a recombinant expression construct that encodes a reporter gene under the transcriptional control of a promoter for a mammalian gene whose expression is induced by p21, wherein the promoter is a gene connective tissue growth factor. , Serum amyloid A, complement C, integrin β-3, actibin A, natural lethal cell protein 4, prosaposin, Mac2 binding protein, galectin-3, superoxide dismutase 2, guranulin / epitelin, p 66 ^she , lysosomal β-galactosidase or catethecin B.

The present invention provides a conditioned cell medium in which the medium is conditioned by cells expressing p21 and a method of producing such conditioned medium. As used herein, the term “conditioned medium” is intended to include a cell medium conditioned by the growth of p21 expressing cells containing mitogenic or anti-apoptotic factors. The conditioned medium is produced in a preferred medium by culturing p21 expressing cells in a mammalian cell medium, very preferably containing no serum additives. Any p21 expressing cell is useful for the production of such conditioned media, and p21 expression in such cells may be directed to inducing endogenous p21 (by treating DNA damage, by irradiation), or to inducible p21 expression constructs according to the present invention. This can be achieved by culturing the cells in physiologically neutral inducers using the containing cells. Preferred cells are mammalian cells, preferably rodent or primate cells, very preferably mouse or human cells. Particularly preferred embodiments are fibrosarcoma cells, more preferably human fibrosarcoma cells, very preferably human HT 1080 fibrosarcoma cell lines and derivatives thereof.

The invention also provides a screening method for identifying compounds that inhibit p21 induced expression of mitogenic or anti-apoptotic factors in mammalian cells. In a preferred embodiment, p21 expression is induced in mammalian cell medium in the presence or absence of a compound to be identified as an inhibitor of p21 induced expression of mitogenic or anti-apoptotic factors. Compounds induce expression of p21 in cells and mitogenic or anti-apoptotic factors in the presence of the compound, or mito, in the presence of the compound, as inhibitors, by comparing the expression levels in the absence of the compound It is identified as an inhibitor identified as a genetic or anti-apoptotic factor, or a compound having a reduced amount of these multiple expressions. p21 expressing cells are useful for the production of such conditioned media and can be induced by inducing p21 in such cells (as treated by DNA damaging agents and other cytotoxic compounds, and by irradiation), or according to the present invention. This can be achieved by culturing the cells in physiologically neutral inducers using cells containing the p21 expression construct. Preferred cells are mammalian cells, preferably rodent or primate cells, very preferably mouse or human cells. Particularly preferred embodiments are fibrosarcoma cells, more preferably human fibrosarcoma cells, very preferably human HT 1080 fibrosarcoma cell lines and derivatives thereof. Examples of cell lines according to this particularly preferred embodiment of the invention are described in p21-9 (ATCC (Manassas, Virginia U.S.A), dated 2000.4.6. HT 1080 fibrosarcoma cell line derivatives identified as "

In an alternative embodiment, the present invention provides p21 induction of fission or anti-apoptotic factor in mammalian cells comprising a recombinant expression construct that encodes a reporter gene that is under transcriptional control of a promoter of an intracellular gene induced by p21. Provided are methods for identifying compounds that inhibit the expressed expression. In a preferred embodiment, the promoters are promoters for CTGF, activin A, epitelin / granulin, galectin-3 and prosaposin. Preferred reporter genes include, but are not limited to, firefly luciferase, β-galactosidase, alkaline phosphatase and green fluorescent proteins (all commercially available). In this embodiment, p21 expression is induced intracellularly and the extent of expression of the reporter gene is compared to expression in the presence of the compound and in the absence of the compound. Inhibitors are identified as compounds that provide for reduced expression of the reporter gene in the presence of the compound. Any p21 expressing cell is useful in this aspect of the invention, and p21 expression in such cells can induce endogenous p21 (eg, by treatment with DNA damaging agents or other cytotoxic compounds or by radiation), This can be achieved by using a cell containing an inducible p21 expression construct according to the invention and culturing the cell in the presence of a physiologically neutral inducer. Preferred cells are mammalian cells, preferably rodent or primate cells, more preferably mouse or human cells. Particularly preferred embodiments are fibrosarcoma cells, more preferably human fibrosarcoma cells, most preferably human HT1080 fibrosarcoma cell line and derivatives thereof.

The present invention provides a method for identifying a compound that inhibits or promotes aging, wherein the effect of the compound is assayed by determining whether the compound inhibits or enhances the induction or inhibition of a gene whose expression is regulated by p21. . In the practice of the methods of the present invention, cultured mammalian cells from which p21 can be induced are treated to induce p21 by, for example, radiation treatment or treatment with a cytotoxic drug, or a delivery vector encoding p21. Transduced using. More preferably, p21-9 cells are used in which p21 can be induced by contacting the cells with IPTG. Typically, cells are grown in a suitable culture medium (eg, DMEM supplemented with 10% fetal bovine serum (FCS) for p21-9 cells). p21 gene expression is induced in p21-9 cells by adding IPTG to the culture medium at a concentration of about 50 μM. Typically, p21 is derived in these cells in the presence or absence of the compound to be tested according to the methods of the present invention. Thereafter, mRNA is isolated from the cell from which p21 is induced and expression of the gene regulated by p21 is analyzed. Expression is compared with expression in cells in which p21 is induced in the presence of the compound and in the absence of the compound, and this difference is used to identify compounds that affect intracellular gene expression according to the methods described herein. Used. In certain embodiments, intracellular gene expression is assayed using, for example, commercially available (Genome Systems, Inc., St. Louis, MO) oligonucleotides or microarrays of intracellular cDNA. In alternative embodiments, genes known to be induced or inhibited by p21 are assayed. Gene expression can be assayed by analyzing intracellular mRNA or protein for one or multiple p21 regulated genes. Most preferably, the genes used in this assay are the genes identified in Tables I and II.

In alternative embodiments, such compounds are identified independent of p21 directed experimental manipulations. In such assays, cells are treated to induce aging by any of the methods described above, which include but are not limited to treatment with cytotoxic drugs, radiation or cell differentiation, or introduction of tumor suppressor genes. It is not limited to. Expression of genes inhibited or induced by p21 is analyzed in the presence or absence of test compounds. Most preferably, the genes used in these assays are the genes identified in Tables I and II when using the mRNA and protein assays of the types discussed above for gene expression analysis.

In an alternative embodiment, the cell from which p21 is derived further comprises a recombinant expression construct that encodes a reporter gene under transcriptional control of a promoter of an intracellular gene that is induced or inhibited by p21. In a preferred embodiment, the intracellular gene is a gene that is inhibited by p21 and the promoter is derived from the genes identified in Table I. Examples of known promoters for these genes include ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5 , CDC47 / MCM7, CDC21 / MCM4, DNA ligase I, DNA polymerase α, RAD54, HEX1 / RAD2, PLK1, DHFR or citron kinase. In a preferred embodiment, the intracellular gene is a gene induced by p21 and the promoter is derived from the genes identified in Table II. Examples of known promoters for such genes include connective tissue growth factor, serum amyloid A, complement C3, integrin β-3, activin A, natural color cell protein 4, prosaposin, Mac2 binding protein, galectin-3, Peroxide dismutase 2, granulin / epitelin, p66 ^shc , lysosomal β-galactosidase, or cathepsin B. Preferred reporter genes include but are not limited to firefly luciferase, β-galactosidase, alkaline phosphatase and green fluorescent proteins (all of which are commercially available).

The invention also provides a method for identifying genes that mediate the effects of p21 induced cell aging. Induction of p21 turns out to be an integral part of cell growth arrest associated with senescence, terminal differentiation and response to cell damage. As described in the Examples below, cDNA array hybridization was used to investigate whether this effect was due to p21 induced gene expression changes. This analysis showed that p21 selectively inhibits many genes involved in the regulation of mitosis, DNA replication, isolation and repair. Many of the proteins induced by p21 in these experiments have been associated with aging and age related diseases including atherosclerosis, Alzheimer's disease, amyloidosis and arthritis. These results suggest that the cumulative effects of p21 induction may contribute to the etiology of cancer and age related diseases. In addition, many p21 activated genes encode secretory proteins with potential paracrine effects on cell growth and apoptosis. Consistent with these results, adaptation media from p21 induced cells exhibited mitogenic and anti-apoptotic activity.

The analysis described in the Examples below showed that inhibition of cell cycle progression genes was not simply the result of p21 induced growth arrest. Blocking of some of these genes occurred with cell growth arrest, and re-expression of all tested genes upon release from p21 occurred prior to cell cycle reentry of the cells. Properties of immediate-responsive genes such as ORC1 (needed for initiation of DNA replication), topoisomerase II (which plays a central role in DNA secretion in G2) and PLK1 (involved in the initiation of mitosis) It was suggested that inhibition could actually play a causal role in the induction of growth arrest by p21. These results form the basis for one aspect of the method of the present invention, which provides a method for identifying genes involved in cell cycle progression in mammalian cells.

In addition, the biological function of both immediate- and early-response genes indicates that their blocking functions to maintain p21 induced growth arrest. Using the reagents and methods of the present invention demonstrated that release from p21 induced growth arrest results in endoreduplication and mitosis abnormalities. DNA replication and mitosis did not resume until release of all p21 inhibited genes after release from IPTG and DNA replication was significantly resumed before mitosis. The results described in the Examples below show that delayed p21 induction results in the disruption of a number of proteins involved in cell cycle progression, including a number of proteins involved in "quality control" of replication or mitosis. Abnormal replication and abnormal mitosis occurred by failing to regenerate pools of these proteins after release from p21 until the cells reenter the cell cycle. For example, production of polyfloid cells was observed after release from delayed p21 induced cell growth arrest. Endoriduplications, an action that results in polyfloodation of cells , may be the result of the abolition of cleavage-induced checkpoint control (Hixon et al ., 1998, Mol. Cell Biol . 18 : 6224-37), which is MAD2 And lack of p21 inhibited checkpoint control proteins such as BUBR1. In addition, polyfloid cells can be produced due to the failure of cytoplasmic division, which can be caused by the lack of cytoplasmic related proteins Prc1, Aim1 and citron kinase, which we found to be inhibited by p21.

Different mitotic abnormalities observed after release from p21 include products of p21-suppressed genes, such as MAD2, BUBR1, PLK1, AIK-1, CENP-A, CHL1 and MCAK, to control proper chromosomal alignment and separation It has been previously found to be due to mutation or inhibition of Li & Benezra, 1996, Proc. Natl. Acad. Sci. USA 93 : 10436-10440; Glover et al ., 1998, Genes Develop. 12 : 3777-3787 Chan et al ., 1999, J. Cell Biol . 146 : 941-954). The role of these proteins in p21-induced mitosis abnormalities is supported by an analysis of the course of disruption and resynthesis of mitotic control proteins. Thus, at the time of resumed mitosis (36 hours after release), the pools of Cdc2 and Plk1 required for initiation of mitosis are regenerated to levels similar to untreated cells (as shown in FIG. 7B). . In contrast, MAD2, which functions to prevent late stages when chromosomes are not properly attached to mitotic spindles, is inefficiently resynthesized (FIG. 7B). In addition, MAD2 levels remaining one day after IPTG treatment were much higher than after three days or more (FIG. 7B), consistent with the low frequency of abnormal mitosis in cells released one day after p21 induction.

p21 overexpression has been reported to inhibit DNA repair (Pan et al., 1995, J. Biol. Chem . 270 : 22008-22016; Umar et al ., 1996, Cell 87 : 65-73). In addition, in light of our results, this effect of p21 may contribute to the inhibition of DNA repair genes such as XRCC9, RAD54, HEX1 / RAD21 homolog and DNA ligase I. Inhibition of DNA repair is also likely to increase the frequency of mutations in cells recovering from p21-induced growth arrest, which contributes to the overall genetic instability of the cells.

In addition, p21-induced gene destabilization in normal cells may have potential carcinogenic effects. Growth arrest of senescent cells is caused by transient p21 induction, while another CDK inhibitor, p16, seems to be responsible for maintaining growth arrest after disruption of p21 (Alcorta et al., 1996, Proc. Natl. Acad.Sci . USA 93 : 13742-13747). p16 (in contrast to p21) is frequently mutated in human tumors, including the HT1080 fibrosarcoma used in this study (Hall & Peters, 1996, Adv. Cancer Res . 68 : 67-108). If the primary carcinogenic effect of the p16 mutation is dysfunctional aging, cells expressing the mutated p16 will undergo prolonged p21 induction. Consistent with the results described herein, reentry into the cell cycle under these conditions is expected to result in the development of karyotype abnormalities. Unlike p16, p21 acts as an oncogene rather than as a tumor suppressor in this process.

Thus, the present invention provides a method for identifying compounds having antitumoral effects by inhibiting p21-induced cell cycle arrest. The compounds produced by this method are expected to minimize the development of cells with karyotype abnormalities, which is expected to reduce the likelihood that the cells will develop into malignant diseases.

The present invention also provides a method for identifying a compound that induces or promotes aging. In this aspect, the present invention provides compounds that increase the inhibition of genes that are inhibited by p21 expression. It has been found herein that inhibition of cell division and cell cycle progression control genes results in irreversible growth arrest by preventing cells from reentering the cell cycle after p21 induction. Thus, compounds that induce or enhance p21-induced inhibition of these genes are effective in promoting cell senescence and final growth arrest. Thus, the present invention provides a method for identifying compounds that inhibit intracellular genes that control cell cycle progression, most preferably the genes identified in Table I. In a preferred embodiment, the compounds are used to promote aging of mammalian cells, most preferably tumor cells, proliferative cells or any cell type that is pathological or disease-induced due to overgrowth. In a preferred embodiment of this aspect of the invention, the method comprises inducing p21 in mammalian cells in the presence or absence of a compound; assaying the cells for expression of the genes inhibited by p21; And identifying the compound as an enhancer with the furnace when the gene is inhibited to a greater extent in the presence of the compound than in the absence of the compound. In another aspect of the methods of the invention, compounds that promote aging of mammalian cells are independently identified by p21-treated experimental manipulations, for example, by inducing senescence of cells by any of the methods described above. Aging can be induced even in p21-deficient cells (Chang et al ., 1999, Oncogene 18 : 4808-4818 and Pantoja et al ., 1999, Oncogene 18 : 4974-4982) and MCF using all transretinoic acid Some aging-induced treatments, such as treatment of -7 cells (Chang et al ., 1999, Cancer Res . 59 : 3761-3767), are associated with a decrease rather than an increase in intracellular levels of p21 (Zhu et al . , 1997, Exp. Cell Res . 234 : 293-299) are known in the art.

The invention also provides a method of enhancing aging of mammalian cells, comprising contacting the cells with a compound identified by the method of the invention. In a preferred embodiment, the mammalian cell is any cell type that is pathological or disease-induced due to tumor cells, proliferative cells or excessive proliferation. In another embodiment, the method includes the additional step of contacting the cell with a radiation or anticancer, cytotoxic or antiproliferative drug.

The observed effects of p21 induction on gene expression correlated significantly with changes associated with cellular and organismal aging. Some of these correlations have emerged from the analysis of p21-suppressed genes. Thus, aging fibroblasts have been reported to express low levels of Rb, as we observed for p21 induction (Stein et al ., 1999, Mol. Cell. Biol . 19 : 2109-2117). . Interestingly, also three p21-inhibited genes (CHL1, CDC21 and RAD54) were encoding elements of the helicase family. Defects in another protein of the helicase group have been identified at the premature and cellular level as a cause of Werner's syndrome, a clinical disease associated with accelerated aging of cells in culture (Grey et al ., 1997, Nature). Genet . 17 : 100-103).

However, the strongest correlation with the aging phenotype was found from the identification of p21-derived genes, many of which were found to increase their levels during replication aging or organismal aging. Overexpression of ECM proteins is a known hallmark of replicative aging, and two p21-derived genes, fibronectin 1 and plasminogen activator inhibitor 1 (PAI-1), in this group are frequently associated with cell aging. Related (reviewed in Crisofalo & pignolo, 1996, Exp. Gerontol . 31 : 111-123). In addition, other p21-induced genes reported to be overexpressed in aging fibroblasts include tissue-type plasminogen activator (t-PA) (West et al ., 1996, Exp. Gerontol . 31 : 175-193). , Cathepsin B (diPaolo et al ., 1992, Exp. Cell Res . 201 : 500-505), integrin β3 (Hashimoto et al ., 1997, Biochem. Biophys. Res. Commun . 240 : 88- 92) and APP (Adler et al ., 1991, Proc. Natl. Acad. Sci. USA 88 : 16-20). t-PA and PAI-1 (Hashimoto et al ., 1987, Thromb. Res . 46 : 625-633), cathepsin B (Bernstein et al ., 1990, Brain Res. Bull . 24 : 43- 549), activin A (Loria et al ., 1998, Eur. J. Endocrinol . 139 : 487-492), prosaposin (Mathur et al ., 1994, Biochem. Mol. Biol. Int . 34 : 1063-1071), APP (Ogomori et al ., 1988, J. Gerontol . 43 : B157-B162), SAA (Rosenthal & Franklin, 1975, J. Clin. Invest . 55 : 746-753 ) And t-TGase (see Singhal et al ., 1997, J. Investig. Med . 45 : 567-575), the expression of several p21-derived proteins found to be correlated with organism aging. lost.

The most commonly used marker for cell aging is SA-β-gal activity (Dimri et al ., 1995, Proc. Natl. Acad. Sci. USA 92 : 9363-9367). This gene is strongly enhanced in IPTG-treated p21-9 cells (Chang et al ., 1999, Oncogene 18 : 4808-4818). SA-β-gal has been suggested to represent the increased activity and altered position of lysosomal β-galactosidase (Cristofalo & Kabakijan, 1975, Mech. Aging Dev . 4 : 19-28). Five lysosomal enzymes, including N-acetylgalactosamine-6-sulfate sulfatase (GALNS), cathepsin B, acid α-glucosidase, acid lipase A and lysosomal pepstatin-insensitive protease, are listed in Table II. Indicated. P21 also upregulated genes for mitochondrial proteins SOD2, metazin, and 2,4-dienoyl-CoA reductase, which correlated with reports of different mitochondrial genes overexpressed in senescent cells (Doggett et al . , 1992, Mech Aging Dev 65: .. 239-255; Kodama et al, 1995, Exp Cell Res 219:...... 82-86; Kumazaki et al, 1998, Mech Aging Dev 101: 91-99) .

As described in the Examples below, there are many similarities between the effects of p21 induction in p21-9 cells and the changes associated with aging of normal fibroblasts. In particular, senescent cells have been found to overproduce different growth factors and ECM proteins that may promote metastasis (Camisi et al ., 1998, J. Investig. Dermatol. Symp. Proc . 3 : 1-5). . Several growth factors and growth factor receptors were identified among genes induced by irradiation with p53-dependent means under conditions of strong p21 induction (Komarova et al ., 1998, Oncogene 17 : 1089-1096). Interestingly, most of these genes did not have p53-binding sites in their promoters. Our conclusions suggest that the induction of growth factors by p53 may be an indirect effect mediated through p21 induction.

Accordingly, the present invention provides a method for identifying genes associated with cellular senescence, particularly genes induced during aging, in particular by p21 expression. The present invention also provides a method for identifying compounds capable of inhibiting p21-mediated induction of such genes. Such compounds are expected to exhibit the ability to reduce, inhibit or reverse cell senescence by their effect on p21-mediated induction of gene expression.

Notably, the products of many of the genes we have found to be induced by p21 are associated with age-related diseases, including Alzheimer's disease, amyloidosis, atherosclerosis and arthritis. Thus, APP generates β-amyloid peptide, which is the main component of Alzheimer's amyloid plaques. Complement C3 (Verhuis et al ., 1995, Virchows Arch . 426 : 603-610) and AMP deaminase (Sims et al ., 1998, Neurobiol. Aging 19 : 385-391) also play a role in Alzheimer's. It was proposed to. Particularly interesting is t-TGase (Park et al ., 1999, J. Gerontol. A Biol. Sci . 54) , which is most rapidly induced by p21 and described as a pleiotropic medium of cell differentiation, cancer development, apoptosis and old age. B78-B83) was associated with the formation of plaques associated with both Alzheimer's disease and amyloidosis (Dudek & Johnson, 1994, Brain Res . 651 : 129-133). The latter disease is caused by the deposition of another p21-derived gene product, SAA, which is also associated with atherosclerosis, osteoarthritis and rheumatoid arthritis (Jensen & Whitehead, 1998, Biochem. J. 334 : 489). -503). Two other p21-upregulated secreted proteins, connective tissue growth factor (CTGF) and galectin 3 are associated with atherosclerosis (Oemar et al., 1997, Circulation 95: 831-839; Nachtigal et. al ., 1998, Am. J. Pathol . 152 : 1199-1208). Also, cathepsin B (Howie et al., 1985, J. Pathol. 145: 307-314), PAI-1 (Cerinic et al ., 1998, Life Sci . 63 : 441-453), fibronectin (Chevalier, 1993, Semin. Arthritis Rheum . 22 : 307-318), GALNS and Mac-2 binding proteins (Seki et al ., 1998, Arthritis Rheum . 41 : 1356-1364) are osteoarthritis and / or It is associated with rheumatoid arthritis. In addition, aging-related changes in ECM proteins, such as increased PAI-1 expression, have been suggested to result in age-specific degradation in the structure of skin and other tissues (Camisi, 1998, J. Investig). .. Dermatol Symp Proc 3:. . 1-5). In addition, increased fibronectin production by aged cells has been suggested to increase the density of the fibronectin network in ECM, which may contribute to slower healing in older individuals (Albini et al ., 1988, Coll. Relat. Res . 8 : 23-37).

The results described herein indicate that p21 induction affects intracellular gene expression in a way that can increase the likelihood of developing cancer or age-related diseases. Large changes in p21 expression did not occur in response to cellular damage as well as in normal replicative aging; In both cases, it is expected that undesirable effects of p21 induction will accumulate in age-dependent means. The description of specific molecular interactions and regulatory pathways responsible for this influence of p21 on gene expression may suggest new approaches to the prevention of cancer and age-related diseases.

Accordingly, the present invention provides a method for identifying genes associated with age-related diseases. The present invention also provides a method for identifying a compound capable of inhibiting p21-mediated induction of the gene. Such compounds are expected to show therapeutic ability to prevent, delay or reverse age-related diseases.

The methods of the present invention are directed to identifying genes whose expression is regulated by p21, which has the advantage of experimentally inducing p21 expression. Cells provided by the present invention containing inducible p21 genes can be used to isolate intracellular mRNAs that reflect the expression status of genes induced, inhibited and unchanged by p21 expression. Intact cells that did not induce p21 provide a control source for comparison of intracellular mRNAs. A plurality of nucleic acids, most preferably cDNA copies of intracellular mRNAs, can be obtained as specific for genes derived or inhibited by constructing differential cDNA libraries using subtractive hybridization methods. See Diatchenko et al ., 1996, Proc. Natl. Acad. Sci. USA 93 : 6025-6030. mRNA or cDNA isolated before and after p21 induction can also be used as probes for hybridization assays, using aligned or unaligned cDNA libraries, and differentially expressed genes can be identified from such hybridizations. In general, see Sambrook et al., 1990, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: New York. In addition, differential display of subtracted cDNA populations can be performed to obtain a set of genes that are upregulated or downregulated by p21 expression.

In additional embodiments, genes that are upregulated or downregulated by p21 expression can be isolated using molecular cloning techniques well known in the art. See Sambrook et al., Ibid . Differential cDNA libraries generated as described above can be screened using probes specific for genes that are induced or inhibited by p21 by using subtractive hybridization methods that incubate probes for suitable cDNA populations. In addition, such probes are configured to maximize the percentage of colonies comprising a full length cDNA or a length close to the full length cDNA to facilitate cloning of p21-regulated genes, particularly new genes, identified using the methods of the invention. Conventionally prepared cDNA libraries can be used for screening. It is also intended to include such genes within the scope of the present invention.

The following examples are intended to further illustrate certain preferred embodiments of the present invention and do not limit it in any way.

Example 1

Inducible p21 gene Generation of mammalian cells containing

P21-9, a recombinant derivative of the human fibrosarcoma cell line HT1080, was essentially generated according to the literature of Chang et al. (1999, Oncogene 18 : 4808-4818, incorporated herein by reference). This cell line contained a p21 coding sequence under transcriptional control of a promoter regulated by isopropyl-β-thiogalactoside (IPTG). Expression of p21 can be induced by culturing these cells in the presence of a sufficient amount of IPTG, whereby the sequelae of p21 expression have been studied without any additional effect that the induction of the endogenous p21 gene is stimulated. The cell line was deposited on April 6, 2000 in the American Type Culture Collection (ATCC) (Manassas, VA) and was assigned accession number ________.

In summary, a subline of HT1080 expressing the co-host retroviral receptor and altered bacterial lac I receptor encoded by plasmid 3'SS (Stratagene) (Chang & Roninson, 1996, Gene 33 : 703-709). (Incorporated by reference) were infected with retroviral particles comprising the recombinant retrovirus LNp21CO3, the structure shown in FIG. 1. This retroviral vector contains the bacterial neomycin resistance gene neo under the transcriptional control of the long term repeat promoter of the retrovirus. The p21-encoding sequence was cloned in the opposite direction to the transcription direction of the neo gene and subjected to the control of the altered human cytomegalovirus promoter. Specifically, the CMV promoter contains a three-fold repeat of the bacterial lac operator sequence expressed from a promoter sensitive to lac I repressor expressed in a cell. LNp21CO3 was constructed by cloning a 492bp fragment of DNA containing the p21 coding sequence into the Not I and Bgl II sites of the parent vector LNXCO3 (Chang & Roninson, ibid ).

After infection, cells infected with the LNp21CO3X vector were selected by culturing the cells in the presence of 400 μg / mL G418 (obtained from BRL-GIBCO (Gaithersburg, MD)). Clone line p21-9 was derived from LNp21CO3 transduced, G418-resistant cell line by endpoint dilution until clone cell line was obtained.

Example 2

Cell growth assay

The p21-9 cells produced as described in Example 1 were used in a cell growth assay to determine what changes in cell growth occur when p21 is expressed in the cells.

p21 expression from LNp21CO3 in p21-9 cells was induced by culturing the cells in DMEM medium containing 10% fetal bovine serum (Hyclone, Logan, UT) and IPTG. The results of this assay are shown in FIGS. 2A and 2B. 2A shows the time course of p21 protein production in cells cultured in the presence of 50 μM IPTG. p21 gene expression increased from 6 to 12 hours after the introduction of IPTG into the growth medium, the expression peaked about 24 hours after introduction. As soon as cells were removed from the IPTG-containing medium, p21 expression dropped as fast as it rose, returning to pre-induction levels about 24 hours after removal of IPTG (FIG. 2B).

Cell growth in the presence of IPTG was assayed in three ways: by measuring ³ H-thymidine incorporation (called "label index"); A method of observing the number of mitotic cells in culture by a microscope (called "mitosis index") and a method of determining the distribution of cultured cells at different parts of the cell cycle (called "cell cycle distribution"). These results are shown in FIGS. 3A-3C.

^{The 3} H-thymidine incorporation assay was carried out substantially as described in Dimri et al . , 1995, Proc. Natl. Acad. Sci. USA 92 : 9363-9367. Cells were incubated for 3 hours in the presence of ³ H-thymidine and analyzed by autoradiography. DNA replication was completely stopped until 9 hours after addition of IPTG to the culture medium as determined by autoradiography (see FIG. 3A). The mitotic index is stained with 5 μg / mL 4,6-diamino-2-phenylindole (DAPI), followed by microscopic observation of the cells, counting the number of mitotic cells, and the image of the Leica (Leica) were collected using a DMIRB fluorescence microscope and a Baytek (Fairfield, Iowa) imaging system. Microscopically detected mitotic cells disappeared from these cultures in the presence of IPTG in two steps: first occur 0 to 4 hours after IPTG addition (where mitotic index is about 15% of untreated cells) Dropped to about 5% of IPTG-treated cells, then rose again about 10-14 hours after IPTG addition (where mitotic index dropped to zero at about 13 hours after IPTG addition) ) (See Figure 3B).

The cell cycle distribution was stained with propidium iodine as described by Jordan et al. (1996, Cancer Res . 56 : 816-825) using Becton Dickinson FACSort. It was determined using FACS analysis on DNA content. 24 hours after IPTG treatment, the cell cycle distribution was stabilized (shown in FIG. 3C). At this time, 42-43% of IPTG-treated cells were stopped at G1 and G2, respectively, and about 15% of the cells were stopped at S-phase DNA content.

The effect of p21 expression was also investigated by releasing cells from the effect of p21 by removing IPTG from cell culture medium. It is known that IPTG-treated p21-9 cells display morphological aging markers (Chang et al ., 1999, ibid ). As shown in FIG. 2B, p21 gene expression levels in p21-9 cells were restored to baseline levels within 24 hours after IPTG removal. Here, it was determined what loss of IPTG-treated p21-9 cells showed for clonality capacity after removal of IPTG. The results of this experiment are shown in FIGS. 4A-4D.

Colony assays for recovery from IPTG treatment were performed by plating about 2,000 p21-9 cells per 10 cm culture dish with or without DMEM / 10% FCS and IPTG. The cells were allowed to form colonies for 10 days before their clonal capacity was determined. p21-9 cells were treated with three concentrations of IPTG: 0.5 μM, 5 μM and 50 μM. These treatments resulted in unmeasurable increases (0.5 μM), half of the maximum increase (5 μM) or maximum increase (50 μM) above the baseline p21 level, respectively, in p21 gene expression. As shown in FIG. 4A, treatment of p21-9 cells with 0.5 μM IPTG did not inhibit colony formation. In contrast, continuous exposure of cells to 5 μM or 50 μM IPTG reduced the clonality of p21-9 cells by 80% and 100%, respectively. When IPTG was removed after 12 or 14 hours, cells treated with 5 μM IPTG showed substantially uncollected colony formation. However, 50 μM IPTG-treated cells showed a decrease in clonality of 58-63%. Three to five days after treatment, cells cultured in 5 μM IPTG showed reduced clonality by 95-99%. These results indicate that the ability of cells to recover after p21 gene expression is inversely correlated with the level of p21 induced and the duration of p21 induction. These results were consistent with those obtained by others in other cell culture systems (Fang et al., 1999, Oncogene 18 : 2789-2797).

The causes of clonal damage were investigated as follows. Resumption of DNA replication was initially detected about 20 hours after release from IPTG using the ³ H-thymidine incorporation assay as described above. These results are shown in FIG. 4B. Resumption of mitosis in these cells was initially detected about 30 hours after IPTG release, as determined from the mitotic index as described above. These results are shown in FIG. 4C. The percentage of cells entering the S or M phase of the cell cycle was higher in cells treated with IPTG for 1 day than for 5 days (see curves for each in FIGS. 4B and 4C). Comparison) The difference was not significant enough to account for the corresponding difference in clonality recovery as shown in FIG. 4A.

Microscopic examination of the culture plates from the clonality assay revealed that the plates treated with 50 μM IPTG for 3 days or more contained numerous single cell and small cell populations that failed to develop into colonies. In addition, release from IPTG was associated with the appearance of suspended cells during the first 2 days after IPTG release, and the number of these cells was higher when cells were released on day 3 after IPTG induction than after day 1 (FIG. 4D Shown). Most of these floating cells were killed, as indicated by trypan blue staining and a 100-1,000 fold reduction in clonality.

The effect of p21 induction in these cells was further studied by examining the DNA content of growth-delayed and dead cells that appeared after release from prolonged IPTG treatment. Growth-delayed cells were isolated using FACS based on increased retention of PKH2, a lipophilic fluorophore stably incorporating into the cell membrane and eventually separated from daughter cells; This resulted in a proportional decrease in cell fluorescence with each round of cell division and no reduction in non-dividing or dead cells (Horan & Slezak, 1989, Nature 340: 167-168). This assay was performed as described in Chang et al., 1999, Cancer Res . 59 : 3761-3767. Untreated p21-9 cells and cells treated with 50 μm IPTG for 5 days were labeled with PKH2, plated in IPTG-free medium, and their PKH2 fluorescence was analyzed on successive days. As shown in FIG. 5A, IPTG-treated cells started to divide later than control cells and resulted in a heterogeneous PKH2 profile with neoplastic peaks of proliferative cells and a shoulder of growth-delayed cells with high PKH2 fluorescence. I was. Growth-delayed cells also showed elevated lateral variance, characteristic of senescent cells (Chang et al ., 1999, ibid .). Proliferative (PKH2 ^lo SS ^lo ) and growth-delayed (PKH2 ^hi SS ^hi ) cell populations were separated by FACS 6 days after release from IPTG and their DNA content was analyzed by PI staining. Growth-delayed fractions differed from proliferative cells in that they had numerous cells with higher G2 / M fractions and more than 4C DNA content (shown in FIG. 5B). Multiploidy properties of the latter cells were confirmed by in situ fluorescent hybridization (FISH) of interphase nuclei using probes specific for chromosomes 18 and 21; This experiment was performed as described in Chang et al., 1999, ibid . High ploidy and G2 / M fractions were also observed between suspended killer cells collected after release from IPTG (shown in FIG. 5C); Microscopic analysis showed that many of these dead cells are in mitosis.

To investigate the origin of multiploid cells, the time course of the change in the DNA content of the entire cell population after release from IPTG was determined. The number of multiploid cells increased significantly 24 to 28 hours after release, simultaneously with resumption of DNA synthesis (comparative, FIG. 4B) (as shown in FIG. 5D). These results indicate that many of the cells released underwent duplication, an unscheduled round of DNA replication. However, the time course and magnitude of the redundancy were nearly similar between cells released on day 1 (FIG. 5D) or days 3 to 5 after IPTG inhibition.

However, when examining the morphology of the attached mitotic cells rising 1 to 2 days after release from IPTG, the major differences were compared between cells inhibited by IPTG for one day and cells inhibited for 5 days. These results are shown in FIG. While most of the mitotic features in the untreated cells were found to be morphologically normal (Figure 6, left), most of the mitotic features in cells released after IPTG treatment showed multicentric mitosis, irregular chromosomal distribution, and electrostatic arrest. It showed a number of abnormalities, including (Fig. 6, right). The percentages of normal mitosis in cells 1 and 5 after IPTG treatment were 45% and 2%, respectively, which were close to the corresponding values (38% and 1%) for clonality recovery. These results, along with the redundancy, suggest that abnormal mitosis is responsible for the loss of clonality after release from p21.

These results indicate that during the induced expression of p21 it not only exerts a severe effect on the cells, but also has the effect of delaying and inhibiting normal recovery of the cells into the cell cycle and growth.

Example 3

p21 gene expression Analysis of gene expression regulated by

The results described in Example 2 suggested that the morphological and cell cycle results of p21 induction may be the result of the refresh of genes that control cell cycle progression. The effect of p21 induction on gene expression was examined as follows.

Reverse transcriptase polymerase chain reaction (RT-PCR) analysis was performed to investigate the expression of known genes associated with control of cell cycle checkpoint progression. Preliminary RT-PCR analysis of 27 genes involved in cell cycle control and DNA replication revealed that 8 of these genes were inhibited by IPTG in p21-9 cells. Total RNA was extracted from p21-9 cells collected at different times during IPTG treatment and release. RT-PCR analysis of changes in gene expression for downregulated genes was described in Nonan et al. (1990, Proc. Natl. Acad. Sci. USA 87 : 7160-7164). It was essentially performed together.

A more comprehensive assay was performed by isolating poly (A) ⁺ RNA from untreated p21-9 cells and cells treated for 3 days with 50 μM IPTG. cDNA was prepared from poly (A) ⁺ RNA and used as a probe for differential hybridization using human UniGEM V cDNA microarrays (Genome Systems, Inc., St. Louis, MO ), It contained more than 4,000 sequence-proven known human genes and 3,000 EST. Genes greater than 2,500 and EST showed measurable hybridization signals with probes from both untreated cells and IPTG-treated p21-9 cells. Downregulated (≧ 2.5) genes using balanced differential expression or upregulated (≧ 2.0) using balanced differential expression are described in Tables I and II, respectively.

Expression of 69 of these genes was tested separately by Northern hybridization using probes derived from RT-PCR or insertion of cDNA clones present in the microarray; These cDNAs were obtained from Genome Systems, Inc. In addition, enzyme-linked antibody (ELISA) measurements of the p21 protein were also described in the Chang et al., 1999, Oncogene 18 : 4808-4818, WAF1 ELISA kit (Oncogene Science, Uniondale, Obtained from NY). The following primary antibodies were used for immunoblotting: mouse monoclonal antibodies against Cdc2 (Santa Cruz), Cyclin A (NeoMarkers), Plk 1 (Zymed) and Rb (PharMingen); MAD2 (BadCo), p107 (Santa Cruz), CTGF (Fisp-12; a gift of Dr. L. Lau), Prc 1 (a gift of Drs. W. Jiang and T. Hunter), and topoisomerase IIα Rabbit polyclonal antibody against (Ab0284; a gift of Dr. WT Beck), and positive polyclonal antibody to SOD2 (Calbiochem). The hose radish peroxidase (HRP) -conjugated secondary antibodies used were goat antimouse and goat antirabbit IgG (Santa Cruz) and rabbit anti sheep IgG (KPL). Protein concentrations in all samples were identified after determination using the BioRad protein assay kit. Immunoblotting was performed by standard methods and signals were detected by chemiluminescence using LumiGlo (KPL).

These results are shown in FIGS. 7A-7C. Changes in gene expression predicted by the microarray assay described above were confirmed for 38/39 downregulated genes and 27/30 upregulated genes. Signal differences observed in Northern hybridization or RT-PCR for most of the tested genes (FIGS. 7A-7C) were higher than values of balanced differential expression determined from cDNA arrays (Tables I and II). This suggests that cDNA array hybridization tends to underestimate the magnitude of the p21 impact on gene expression. Changes in the expression of 6 downregulated genes and 4 upregulated genes were also tested at the protein level by immunoblotting (FIG. 7B) or geography (data presented) and confirmed in all cases tested. It was.

It is recognized that p21-mediated changes in gene expression include short-term and long-term effects that follow p21-induced cell growth arrest. For this purpose, the time course of change in the RNA levels of the subsets of the p21-inhibited gene (FIG. 7B) and the p21-induced gene (FIG. 7C) after addition and removal of IPTG was determined. Immunoblotting was used to determine the time course of p21-induced changes in Rb phosphorylation (as indicated by electrophoretic mobility) and intracellular levels of Rb and several proteins inhibited by p21 according to cDNA arrays. Analyzed; These results are shown in FIG. 7B. Rb was found to dephosphorylate 6 hours after IPTG addition. In addition, Rb protein levels were markedly reduced between 12 and 24 hours (shown in FIG. 7B), but no significant change in RB mRNA levels was detected (data suggested). Similar reductions were observed for Rb-related protein p107 (shown in FIG. 7A).

1. Gene expression inhibited by p21 .

All p21-inhibited genes tested showed a rapid response to p21 induction and release. Five of these genes (topoisomerase IIα, ORC1, PLK1, PRC1 and XRCC9) showed significant inhibition at both RNA and protein levels 4-8 hours after IPTG addition (FIG. 7B). This pattern was called "immediate response", which was comparable to the kinetics of cell growth arrest and Rb dephosphorylation. Other p21-inhibited genes (such as CDC2 or DHFR) have a slightly slower "initial response" pattern after stopping DNA replication and mitosis, with a major decrease in detectable mRNA levels only 12 hours after IPTG addition. Showed. However, all p21-inhibited genes resumed 12-16 hours after removal of IPTG, if the cells were still growing-stopped, before DNA replication and mitosis resumed (FIG. 7B). This analysis indicates that changes in the expression of p21-inhibited genes are short-term effects of p21 induction and release and are not the result of cell growth arrest and recovery.

In summary, 69 genes and 3 ESTs were identified by cDNA microarray when downregulated in p21-induced cells with balanced differential expression of 2.5-12.6 (Table 1A); Five additional genes identified by the previous assay when downregulated in IPTG-treated cells are listed in Table 1B. Surprisingly, a high percentage of downregulated genes (43 out of 69) identified by cDNA arrays were involved in mitosis, DNA replication, isolation and repair, and chromatin assembly, which was highly associated with p21-mediated inhibition of gene expression. It points to an optional property.

The largest group of p21-downregulated genes is associated with the signaling, execution and control of mitosis. These genes include CDC2 and cyclin B1, which form mitotic initiation complexes, polo-like kinases (PLK1), which play a role in initiation of mitosis, mitotic checkpoint control, and cytoplasm (see Glover et al ., 1998, Genes Develop). 12 : 3777-3787) and CDC2-interacting protein CKsHs1 (Hixon et al ., 1998, Mol. Cell Biol . 18 : 6224-37), which are targets for mitosis checkpoint control. Other genes in this group include homologs of the Xenopus condensine protein XCAP-H, sister chromosomal adhesion (Lossada et al ., 1998, Genes Develop . 12 : 1986-1997) and mitotic recombination (see : McKay et al ., 1996, Genomics 36 : 305-315), homologues of Rad21 repair proteins, centroids associated with spindle formation (Kimura et al ., 1997, J. Biol. Chem . 272 : 13766-13771). -MAD2 and BUBR1 proteins that play a central role in spindle checkpoint control, as well as the bound kinase AIK1, the conformer proteins CENP-A and CENP-F (see Li and Benezra, 1996, Science 274 : 246-248; Chan et al . , 1999, J. Cell Biol . 146 : 941-954), mitotic isotope-linked kinesin (MCAK), kinesin-like proteins HSET, CHL1 helicase (located on mitotic spindles and appropriate chromosomes during mitosis) Homologues of yeast proteins that play a role in distribution; see Gerring et al ., 1990, EMBO J. 9 : 4 347-4358), and three proteins involved in cell division: Prc1, Aim1 / Aik2 and citron kinase (Jiang et al ., 1998, Mol. Cell 2 : 877-885; Terada et al ., 1998, EMBO J. 17 : 667-676; Madaule et al ., 1988, Nature 394 : 491-494). P21 also inhibits the genes encoding the envelope proteins Lamin B1 and Lamin B2 of the nucleus involved in the assembly of the nucleus, the lamin-bound polypeptide α (timophoetin α), and the M phase phosphoproteins MPP2 and MPP5. Deficiencies in many of these proteins are known to result in abnormal chromosomal segregation and multiploidy, which are identically observed in p21-9 cells after release from IPTG.

Many p21-inhibited genes are involved in DNA replication and isolation, chromatin assembly and DNA repair. Some of these genes encode enzymes involved in nucleotide biosynthesis, including ribonucleotide reductase subunits M1 and M2, thymidine kinase, thymidylate synthase, uridine phosphorylase and dihydrofolate reductase. Doing. Other proteins include components of the replication authorization factor Cdc47 / Mcm4, Cdc45 homologue, Orc1 protein of the origin recognition complex, DNA polymerase α, B-Myb, 37-kD subunit of replication factor C, and DNA ligase I Involved in DNA replication. This group also includes genes involved in the isolation of replicated DNA (topoisomerase IIα), inherited chromosomal inheritance (p60 subunit of chromatin assembly factor-I), and highly mobile group proteins 1 and 2 Other chromatin components, such as: Several p21-inhibited genes include XRCC9 (which is repair after DNA replication or control of cell cycle checkpoint (deWinter et al., 1998, Nat Genet. 20: 281-283)), Rad54 recombinant repair protein, exonuclea DNA repair, including Hex1 / Rad2, and Rad21 homolog and DNA ligase I.

More than 60% of p21-inhibited genes in the cDNA array are involved in mitosis, DNA replication, isolation and repair. This biological selectivity was unprecedented in large scale expression profiling studies. A direct inference for this observation is that p21-inhibited genes whose function is currently unknown are likely to play a role in cell cycle progression. Indeed, six p21-inhibited genes were originally described in the cDNA array as ESTs or genes with unknown functions, but database searches link three of their products with cell division of DNA repair. In one case, the originally identified EST was found by mapping in genome clone 3 'to the coding sequence of citron kinase; Inhibition of the citron kinase gene by p21 was then demonstrated by RT-PCR based on its coding sequence. Cloning of additional p21-inhibited users appeared to produce new genes that play a role in mammalian cell division.

These results also present additional opportunities to discover components of the intracellular program of p21-induced aging that are targets for therapeutic intervention. It has been suggested that p21-mediated inhibition of gene expression is the result of E2F inhibition (de Toledo et al., 1998, Cell Growth Differ . 9 : 887-896). Consistent with this interpretation, a subset of our p21-suppressed genes (eg, CDC2, ORC1, DHFR, cyclin A1) includes E2F sites in their promoters. On the other hand, no E2F site could be found in the promoter of some p21-suppressed genes (eg, cyclin B1), and some E2F-dependent genes (eg, cyclin E) were not affected by p21 induction. (Suggested material). In addition to E2F, some not yet identified regulatory factors may be involved in p21-mediated inhibition of gene expression. These additional factors represent targets for novel agents, presence, and identification of targets useful for explanation using the methods and reagents provided by the present invention.

2. Gene Expression Induced by p21

In addition to the genes that are inhibited by p21 expression, the assay described above was used to detect genes induced by p21. The pattern of gene expression of the p21-derived genes is shown in Figure 7C. In contrast to p21-suppressed genes, p21-upregulated genes increased their expression only 48 hours after IPTG addition, ie after the onset of growth arrest in all cells. Tissue trans, one tested gene Only glutaminase (t-TGase) showed a detectable increase at 12 hours after addition of IPTG, but its expression peaked at 48 hours (as shown in FIG. 7C). In addition, elevated expression of all tested genes (except t-TGase) lasted for at least 3 days after release from IPTG and was significant after resumption of the cell cycle (data suggested). This "late response" kinetics indicates that the p21 induction of the genes was a delayed effect with respect to p21-mediated growth arrest.

48 known genes and 6 EST or genes with unknown functions were identified when upregulated in p21-induced cells, with balanced differential expression of 2.0-7.8 (Table II). Very high fractions (20/48) of identifiable genes in this group include extracellular matrix (ECM) components (eg fibronectin 1, laminin α2, Mac-2 binding protein), other secreted proteins (eg activin). A, connective tissue growth factor, serum amyloid A) or ECM receptor (such as integrin β3) is encoded. Some of these secreted proteins as well as large groups of p21-induced intracellular proteins (Table II) are known to be induced by different forms of stress response or play a role in stress related signal transduction. Notably, many of the genes we have found to be induced by p21 have also been upregulated in cell aging, organism aging, or different age-related diseases.

In contrast to p21-inhibited genes, the genes found to be induced by p21 did not have any known function that could lead to cell growth arrest. Induction of these genes was also a late response that slowed down after the onset of growth arrest. Interestingly, the number of the gene is induced p21- peroxide dismutase 2 (SOD2) (reference:. Jones et al, 1997, Mol Cell Biol 17:... 6970-6981), t-TGase ( see: Mirza et al ., 1997, Amer. J. Physiol . 272 : G281-G288), Alzheimer β-amyloid precursor protein (APP) (Grilli et al ., 1996, J. Biol. Chem . 271 : 15002-15007) and Positively regulated by NFκB, including inflammatory protein serum amyloid A (SAA) (Jensen and Whitehead, 1998, Biochem J. 334 : 489-503). Since p21 activates NFκB-dependent transcription through its effect on the transcription cofactor p3000 (Perkins et al ., 1997, Science 275 : 523-527), the activation of p300 or related transcriptional cofactors is upregulated. It is likely that p21 is responsible for some of the genes. However, the delayed kinetics of p21-mediated induction of gene expression suggests that this induction occurs far downstream from the direct effects of p21.

These results, and the characteristics of the genes described in Table II, indicate that expression of these genes is not related to the growth arrest function of p21. However, the large amount of secreted protein we found between the products of p21-activated genes has important physiological significance. As described in Example 5 below, the conditioned media from p21-derived cells showed two biological effects predicted by the nature of the p21-upgraded genes: stimulation of cell growth and inhibition of apoptosis. . Together with the genetic destabilization described above in p21-induced cells, this finding suggests that the "paracrine" effect of p21 may contribute to cancer development through tumor-promoting effects on adjacent cells. This provides a way for the inhibition of p21-mediated gene induction to achieve anticarcinogenic effects and raises the possibility that the p21-mediated gene induction pathway is the target of rational drug design for a new generation of cancer-preventing drugs.

The observed paracrine, anti-apoptotic effect of p21 induction is consistent with the reported activity of prosaposin and galectin-3, secreted protein, which we have found to be induced by p21. Anti-apoptotic activity is also indicated by p21-induced intracellular protein SOD2 (Manna et al ., 1998, J. Biol. Chem . 273 : 13245-13254) and R-Ras (Suzuki et al ., 1998, FEBS Lett . 437 : 112-116). Paradoxically, p21-induced t-TGase and cathepsin B (see Singhal et al ., 1997, J. Investig. Med . 45 : 567-575) are called pro-apoptotic action. In some systems, p21 overexpression induces apoptosis (Prahu et al ., 1996, Clin. Cancer Res . 2 : 1221-1229; Tsao et al ., 1999, J. Virol . 73 : 4983-4990). In other studies, p21 protected cells from apoptosis induced by several types of treatments (Gorospe et al., 1997, Oncogene 14: 929-935; Lu et al ., 1998, Oncogene 16 : 705-). 712; Bissonnette & Hunting, 1998, Oncogene 16 : 3461-3469). The results described herein that p21 induces both anti-apoptotic and pro-apoptotic genes may explain the conflicting reports of the effect of p21 on apoptosis.

Example 4

IPTG-treated and Serum-Depleted p21-9 Cells Confirmation of specificity of p21 induction by comparison

Confirmation of p21-induced changes in intracellular gene expression likely to be the result of cell growth arrest was determined as follows. Similar experiments were performed using the truncated form of p21 (including amino acids 1-90) and the same results were obtained.

Growth arrest (silence) was induced by 21 p31-9 cells by serum gagged produced by culturing the cells in serum-free medium for 4 days. In serum starved cells, unlike IPTG-treated p21-9 cells, these cells did not develop aging morphology and only showed very weak SA-β-gal expression. P21 levels in serum-gagged cells increased only about two-fold, as opposed to the 15-20-fold increase observed in IPTG-treated cells. 7D shows RT- performed as described above for the expression of p21-suppressed genes and p21-derived genes in growth arrested p21-9 cells after 4 days or 3 days in the presence of 50 μM IPTG in serum-free medium. PCR analysis is shown. In addition, genes that were completely inhibited in p21-9 cells when the culture medium contained 50 μM IPTG were inhibited in serum-gagged cells, but most of these genes were inhibited to a lesser extent in IPTG-treated cells.

Genes whose expression is induced by p21 exhibited three distinct patterns. The first group is genes whose expression is as strongly induced in silent cells as in senescent cells. This includes galectin-3, peroxide dismutase 2, complement C3 and prosaposine, indicating that their induction was a result of cell growth arrest or was sensitive to a slightly elevated p21 level of the gene. The second group is genes that are upregulated in silent cells but not as strong as in senescent cells. This gene includes fibronectin-1, Mac2 binding protein and Alzheimer's precursor protein serum amyloid A. The third group is genes that are not detectably induced in silent cells but are strongly induced in senescent cells. This gene includes CTGF, plasminogen activator inhibitor 1, tissue transglutaminase or natural killer cell marker protein NK4, integrin beta 3 and activin A.

Differences between silencing by serum gig and response of specific genes to induction of cellular senescence through IPTG-induced overexpression of p21 identified these genes as diagnostic markers of aging. In addition, current novel aging markers can be identified by comparing their expression between p21-expressing cells and silent cells.

Example 5

Production of media conditioned to contain fission-inducing factors and Fission-Induced Activity Assay

Several p21-upregulated secreted proteins include CTGF (Bradham et al ., 1991, J. Cell Biol . 114 : 1285-1294), activin A (Sakurai et al ., 1994, J. Biol Chem . 269 : 14118-14122), epithelin / granulin (Shoyab et al ., 1990, Proc. Natl. Acad. Sci. USA 87 : 7912-7916) and galectin-3 (Inohara et. al ., 1998, Exp Cell Res . 245 : 294-302), and to a lesser extent Clusterin (Koch-Brandt & Morgans, 1996, Prog. Mol. Subcell. Biol . 16 : 130-149), pro Stacyclin-stimulating factor (PSF; see Yamauchi et al ., 1994, Biochem. J. 303 : 591-598), Vascular endothelial growth factor-C (VEGF-C; see Joukov et al ., 1996, EMBO J 15 : 290-298), gelsolin (Ohtsu et al , 1997, EMBO J. 16 : 4650-4656) and metalloproteinase-1 (TIMP-1; see Hayakawa et al ., 1992, FEBS Lett . 298 : 29-32). These results suggested that p21 induction could cause paracrine-induced effects. In addition, galectin-3 (Akahani et al ., 1997, Cancer Res . 57 : 5272-5276) and prosaposin (Hairaiwa et al ., 1997, Proc. Natl. Acad. Sci. USA 94) : 4778-4781) have been shown to have anti-apoptotic activity. Conditioned media from IPTG-treated p21-9 cells were tested to see if they had an effect on cell growth and apoptosis.

In these experiments, conditioned media was prepared by plating 10 ⁶ p21-9 cells per 15 cm plate in the presence of DMEM / 10% FCS. The following day, IPTG was added at a final concentration of 50 μM and this medium was placed for 3 days using DMEM supplemented with 0.5% FCS and 50 μM IPTG. After 2 days (3 to 5 days of IPTG treatment), media with this condition were collected and stored at 4 ° C. until 15 days before use. Control medium was prepared by adding IPTG-free DMEM / 0.5% FCS to untreated cells grown to the same density as IPTG-treated cells and the medium was collected on day 2 thereafter.

Cleavage-inducing activity in conditioned media was detected using the slow-growing human fibrosarcoma cell line HS 15.T. In the cleavage-inducing assay, cleavage-inducing activity was tested using a 1: 1 mixture of fresh medium and conditioned medium and fresh medium as well as both types of conditioned medium. In these experiments, conditioned media was supplemented with 1% or 2% FCS. In summary, HS 15.T cells were plated in 12-well plates at 15,000 cells per well. Two days later, these cells were cultured in different types of media. These cells were grown for 60 hours in conditioned medium, ³ H-thymidine was added at a concentration of 3.13 μCi / mL and incubated for 24 hours. Cells were then collected and their ³ H-thymidine incorporation was determined as described by Mosca et al . , 1992, Mol. Cell. Biol . 12 : 4375-4383.

Addition of IPTG to fresh medium had no effect in this assay (data presented). As shown in FIG. 8A, there was no significant difference between cell growth in fresh and conditioned media from untreated p21-9 cells. In contrast, conditioned media from IPTG-treated cells increased up to 3 fold in ³ H-thymidine incorporation (FIG. 8A). In addition, growth stimulation of HS 15.T with conditioned media from IPTG-treated cells was detected by methylene blue staining (data presented).

The influence of media with these conditions on apoptosis was also determined. These experiments used mouse embryonic fibroblast line C8 immortalized by E1A. This cell line contains different stimuli (Lowe et al ., 1994, Science 266 : 807), including serum gagged (Lowe et al ., 1994, Proc. Natl. Acad. Sci. USA 91 : 2026-2030). -810; Nikiforov et al ., 1996, Oncogene 13 : 1709-1719), very sensitive to apoptosis induced by. Apoptosis was analyzed by plating 3 × 10 ⁵ C8 cells per 6-cm plate and placing it on fresh or supplemented medium supplemented with 0.4% serum the next day without fresh medium. DNA content analysis and DAPI staining were performed after 24 and 48 hours, and the relative cell number was measured by methylene blue staining after 48 hours in low serum medium (Perry et al ., 1992, Mutat. Res . 276 : 189-197). Measured by

As evidenced by detectable cell isolation and apoptosis morphology in most cells after DAPI staining (suggested data), addition of low serum fresh medium or conditioned medium from IPTG-treated or untreated cells was performed in C8 cells. Apoptosis was induced rapidly. However, conditioned media from IPTG-treated cells significantly increased cell viability compared to fresh and conditioned media from untreated cells, as measured by methylene blue staining of remaining cells attached after 48 hours. (Shown in Figure 8B). The effect of conditioned media from p21-derived cells was more evident in FACS analysis of intracellular DNA content, which was performed on mixed adherent cells and suspended C8 cells 24 and 48 hours after medium exchange (FIG. 8B). . Unlike many other cell lines, apoptosis of C9 cells produced only a few cells with reduced (sub-G1) amounts of DNA and is characterized by the selective disappearance of cells with G2 / M DNA content. Niki forov et al ., 1996, ibid .). Serum-depleted cells in conditioned media from IPTG-treated cells maintained the G2 / M fraction and showed a similar cell cycle profile to the growing control cells in serum-rich media (FIG. 8B). The addition of IPTG by itself had no effect on apoptosis in C8 cells (data presented). Thus, p21 induction in HT1080 cells results in the secretion of mitogenic and anti-apoptotic factors, as predicted by the nature of p21 unregulated genes.

Example 6

Reporter gene expressed by p21-responsive promoter Generation of recombinant expression constructs comprising

Promoter-reporter constructs were prepared from human PLK1, NK4 and SAA promoters as follows. Polymerase chain reaction (PCR) of promoter-specific DNA was performed using genome DNA from HT1080 p21-9 as a template. PCR was performed using PfuTurbo DNA polymerase (Stratagene) and the primer sets described in Table IIIa. PCR conditions for each primer set are described in Table IIIb. PCR products were obtained and cloned into the TOPO TA cloning vector pCR2.1 / TOPO (for PLK1 and SAA) or pCRII / TOPO (for NK4). These constructs were verified by sequencing, and then the Kpn I- Xho I fragments containing the promoter in the correct orientation were transferred to the luciferase-reporter vector pGL2 basic (Promega) using standard recombinant gene technology (Sambrook et al., Ibid .). , Madison, WI) into the Kpn I and Xho I sites.

Two separately isolated plasmid clones of each promoter construct were tested for p21-regulation by an instant transfection assay. Each promoter-luciferase construct was mixed in a 1: 1 ratio with the pCMV-β-gal (Promega) plasmid and introduced into HT1080 p21-9 cells by LIPOFECTAMINE 2000 (Life Technologies, Inc., Gaithersburg, MD). After 6-8 hours, medium with or without 50 μM IPTG was added to the transfected cells, and after 60-72 hours cell extracts were prepared and luciferase activity (Luciferase Assay System, Promega) Was assayed for. β-galactosidase assay was used as a normalization control for transfection efficacy.

9 shows the results of these experiments. In p21-derived in transfected cells, expression from promoter constructs made from p21-suppressed gene PLK1 was reduced (3-5 fold) and from promoter constructs made from p21-derived genes NK4 and SAA Expression increased (7-10 fold for NK4, 20-30 fold for SAA). These results indicate that p21 upregulates or downregulates the expression of these genes by regulating their promoters and that promoter constructs of these genes can be used to assay for p21-mediated regulation of gene expression.

Table IIIa. Primer sequence

Promoter Sense primer (5 '-> 3') Antisense Primer (5 '-> 3') PLK1 CCTGTAATCCCAGCATTTGG (SEQ ID No. 1) AGACCTCGATCCGAGCAGA (SEQ ID No. 2) NK4 TGGAGCTAGAAGAGCCCGTAGG (SEQ ID No. 3) GCCAAAAGTTCAAGGAGCCAA (SEQ ID No. 4) SAA CAGAGTTGCTGCTATGTCCACCA (SEQ ID No. 5) CACTCCTTGTGTGCTCCTCACC (SEQ ID No. 6)

Table IIIb. PCR conditions

Promoter denaturalization Annealing kidney cycle Product size PLK1 94 ° C, 1 minute 68 ° C., 1 minute 72 ° C., 1 minute 40 seconds 32 990 bp NK4 94 ° C, 1 minute 65 ° C., 1 minute 72 ° C., 1 minute 40 seconds 32 877 bp SAA 94 ° C, 1 minute 68 ° C., 1 minute 72 ° C., 1 minute 40 seconds 32 1000 bp

It is to be understood that the foregoing description highlights specific embodiments of the invention and that all variations or alternative equivalents are within the spirit and scope of the invention as set forth in the claims.

Table I

genes downregulated by p21 induction

A. p21-inhibited genes identified by UniGemV array:

gene Accession number Balance discrimination experiment Technique ^a Confirmed by Mitosis related: CDC2 X05360 2.5 R, W CKsHs1 (CDC2 Kinase) X54941 5.5 R PLK1 (polo-like kinase) U01038 5.1 R, W XCAP-H Condensine Homolog D38553 6 R CENP-A (Atolog Protein A) U14518 5.3 R CENP-F (lotoprotein F) U30872 2.5 R MAD2 U65410 6.6 R, W BUBR1 AF053306 5.9 R MCAK (mitotic isotope-binding kinesin) U63743 3.8 R HSET Kinesin-like Protein AL021366 3.6 R CHL1 helicase U75968 3.3 R AIK-1 (Aurora / IPL1-Related Kinases) D84212 4.6 R AIM-1 (AIK-2; Aurora / IPL1-Related Kinases) AF004022 10.2 R PRC1 (cytoplasmic regulatory protein 1) AF044588 12.6 R, W Citron Kinase H10809 2.7 R Lamin B1 L37747 7 Lamin B2 M94362 2.7 LAP-2 (Lamin-binding Protein 2) U18271 4.6 R MPP2 (M-based Phosphoprotein 2) U74612 3.7 R MPP5 (M-phase Phosphoprotein 5) X98261 3.7

Related to DNA replication, isolation and chromatin assembly: Thymidine Kinase 1 K02581 2.9 R Thymidylate synthase X02308 3.9 R Uridine phosphorylase X90858 2.5 Ribonucleotide Reductase M1 X59543 4.6 R Ribonucleotide Reductase M2 X59618 10.7 R CDC47 homologue (MCM7) D55716 9.6 R CDC21 homologue (MCM4) X74794 2.7 R CDC45 homologue (Porc-PI) AJ223728 4.1 R HsORC1 (origin recognition complex 1) U40152 2.7 R DNA polymerase α X06745 2.8 R Replication factor C (37-kD subunit) M87339 2.6 B-MYB X13293 9.1 HPV16 E1 Protein Binding Protein U96131 3.7 R Topoisomerase IIα J04088 8.6 R Chromatin assembly factor-I (p60 subunit) U20980 2.7 R High Mobility Group Chromosome Protein 2 X62534 3.7 R High mobility group chromosome protein 1 D63874 3.6 R Histone H2A.F / Z variants AA203494 2.8

DNA repair related: XRCC9 U70310 3.6 R RAD54 homologue X97795 5.4 R HEX1 5'-3 'exonuclease (RAD2 homologue) AF042282 5.2 R ATP-dependent DNA Ligase I M36067 2.5 R RAD21 homologue D38551 2.9 R

Transcription and RNA Processing Related: Putative transcription factor CA150 AF017789 2.8 Transcription Aid ALY AF047002 3.3 WHSC1 / MMSET (SET Domain Protein) AA401245 2.9 NN8-4AG (SET domain protein) U50383 2.8 EZH2 (Enhancer 2 of Zeste Homolog) U61145 2.8 PTB-bound Splicing Factor X70944 2.5 AU-enriched element RNA-binding protein AUF1 U02019 2.8 U-snRNP-linked cyclophilin AF016371 2.8

Other genes: 3-phosphoglycerate dehydrogenase AF006043 4.8 L-type amino acid transporter, subunit LAT1 M80244 4.1 R Hyaluronan-mediated motility receptors U29343 4 Porboline I (PKC-induced) U03891 3.9 PSD-95 binding family protein D13633 3.7 R HTRIP (TNF Receptor Component) U77845 3.6 NAD-dependent methylenetetrahydrofolate dehydrogenase X16396 3.4 Membrane Glycoprotein 4F2 Antigen Heavy Chain J02939 3.2 Mucin-like protein D79992 3.2 MAC30 (expressed differentially in meningioma) L19183 2.9 P52rIPK (modulator of interferon-induced protein kinases) AF007393 2.8 Putative phosphoserine aminotransferase AA192483 2.8 Glucose 6-Phosphate Translocase Y15409 2.7 Calcycline Binding Protein AF057356 2.6 Ornithine Dicarboxylase 1 X16277 2.6 R Trophine Supplement Protein (Tastin) U04810 2.5 Acyl-Coenzyme A Cholesterol Acyltransferase L21934 2.5 Pinin / SDK3 Y10351 2.5

Genes with unknown function: EST AA975298 2.7 EST AA034414 2.5 EST AA482549 2.5

B. p21-inhibited genes identified by RT-PCR:

gene Accession number UniGemV results ^b Cyclin A1 U66838 IS Cyclin B1 M25753 IS CDC25A NM_001789 A Dihydrofolate reductase J00140 1.5 ING1 NM_005537 A

^a Abbreviation: R, RT-PCR; W, western blotting

^b Abbreviation: IS, insufficient signal; A, absent from the array

Table II

Genes Upregulated by p21 Induction

gene Accession number Balanced differential experiment Next technology ^a Confirmed by Proteins secreted and bound to the extracellular matrix: Fibronectin 1 X02761 5.7 R Plasminogen Activator Inhibitor, Type I M14083 3.7 R, N Plasminogen Activator, Tissue Type M15518 2.8 Z Laminin β2 X79683 2.1 Desmocholine 2a / bb X56807 3.5 Staphylococcus-like Protein U97519 2 Activin A (Inhibin βA) J03634 2 R Galectin 3 (Mac-2) AB006780 2.4 N Mac-2 binding protein L13210 2 R, N Prosaposin J03077 2.9 N CTGF (Connective Tissue Growth Factor) M92934 3.3 N Granulin / Epitelin AF055008 2.1 N Cathepsin B L04288 2.4 N Tissue Transglutaminase M55153 2.5 R, N, W P37NB (Slit Homolog) U32907 2.1 Serum Amyloid A Protein Precursor M26152 4 R, N, W Alzheimer's Disease Amyloid A4 Protein Precursor D87675 2 R, N Complement C3 Precursor K02765 5.9 R, N Testican X73608 2.1 N Integrin β3 M35999 2.1 R, N

Lysosomal Protein: N-acetylgalactosamine-6-sulfate sulfatase U06088 2.3 N Acid alpha-glucosidase X55079 2.4 N Acid Lipase A (cholesterol esterase) X76488 2.1 N Lysosomal Pepstatin-Responsive Protease (CLN2) AF017456 2.5

Mitochondrial Proteins: Peroxide Dismutase 2 X07834 3.5 R, N, W Metacin J03060 3.4 2,4-dienol-CoA reductase U78302 2

Other genes related to stress response and signaling: Ubiquitin-conjugating enzyme (UbcH8) AF031141 2 Ubiquitin-specific Protease 8 D29956 2 RTP / Cap43 / Drg1 / Ndr1 (induced by nickel, retinoids, homocysteine and ER stress) D87953 2.5 C-193 Muscle Ankyrin-Repeat Nuclear Protein (Cytokine-Induced) X83703 3 LRP major ceiling protein associated with combination drug resistance X79882 2.2 N β-arrestin related HHCPA78 homologue (upregulated by vitamin D3) S73591 4.1 N R-RAS M14949 2.4 RAB 13 Small GTPase X75593 2.2 P66 SHC (ski oncogene) U73377 2 N MK-STYX (MAP kinase phosphatase-like protein) N751168 2 H73 nuclear antigen / MA-3 apoptosis-related / TIS (inhibited topoisomerase-inhibitor) U96628 2.4

Other genes: Natural Killer Cell Protein 4 M59807 4.4 R TXK tyrosine kinase (T-cell specific) L27071 3.8 X-coupled PEST-containing transporter U05321 2.1 AMP Deaminase 2 M91029 2 N FIP2 / HYPL huntingtin-interacting protein AF061034 2 DNASE I homologue X90392 2.5 N Transcription factor 11 X77366 2 Histone H2A.2 L19779 2.8 Histone H2B AL021807 2.4

Genes with unknown function: 23808 AF038192 2.1 CGI-147 AA307912 2.1 N EST W89120 2.8 EST AI026140 2.5 EST AA218982 2.4 EST W63684 2

^a Abbreviation: R, RT-PR; N, northern hybridization; W, western blotting; Z, Geography

Claims (168)

A recombinant mammalian fibrosarcoma cell comprising a recombinant expression construct encoding a mammalian p21 gene, wherein the recombinant mammalian fibrosarcoma cell in which p21 is expressed within the fibrosarcoma cell. A recombinant mammalian fibrosarcoma cell comprising a recombinant expression construct encoding a mammalian p21 gene that is transcriptionally controlled by an inducible heterologous promoter, wherein expression of p21 from the recombinant expression construct induces transcription of the recombinant cell to induce transcription from an inducible promoter A recombinant mammalian fibrosarcoma cell mediated by contacting with or removing an agent that inhibits transcription from such a promoter. The recombinant mammalian fibrosarcoma cell according to claim 1 or 2, which is human HT1080. The recombinant mammalian fibrosarcoma cell according to claim 1 or 2, wherein the mammalian p21 gene is a human p21 gene or a CDK-binding fragment thereof. The method of claim 2, further comprising a recombinant expression construct encoding a bacterial lactose repressor, the transcription of which is controlled by a mammalian promoter, and wherein the recombinant expression construct encoding a mammalian p21 gene comprises a lactose repressor-reactive promoter element. And transcription of p21 is controlled by a lactose-repressor reactive promoter element, wherein expression of p21 from the recombinant expression construct is mediated by contacting the recombinant cell with a lactose repressor-specific inducer. 6. The recombinant mammalian fibrosarcoma cell of claim 5, wherein the cell is a human HT1080 fibrosarcoma cell. 7. The recombinant mammalian fibrosarcoma cell of claim 5, wherein the recombinant expression construct encoding the bacterial lactose refresher is 3'SS. The recombinant mammalian fibrosarcoma cell of claim 5, wherein the mammalian p21 gene is a human p21 gene or a CDK-binding fragment thereof. The recombinant mammalian fibrosarcoma cell of claim 5, wherein the second expression construct is LNp21CO3. 6. The recombinant mammalian fibrosarcoma cell of claim 5, wherein the lactose repressor-specific inducer is β-galactosid. The method of claim 5 wherein the A.T.C.C. Accession number Recombinant mammalian fibrosarcoma cell characterized by the identification (p21-9). (a) expressing p21 in mammalian cells; (b) assaying the cells for changes in expression of intracellular genes whose expression is regulated by p21 in the presence of the compound; And (c) identifying the compound as an inhibitor of p21-mediated regulation of intracellular gene expression when the expression of the intracellular gene of step (b) is changed to a lesser extent in the presence of the compound. A method for identifying compounds that inhibit p21-mediated regulation of a. 13. The method of claim 12, wherein the mammalian cell is a cell according to claim 2, wherein p21 expression occurs by contacting the cell with an inducer that induces transcription from an inducible promoter or by removing an agent that inhibits transcription from the promoter. How to. The method of claim 12, wherein expression of the intracellular gene is inhibited by p21. 15. The method of claim 14, wherein the intracellular genes are identified in Table I. The method of claim 12, wherein the expression of the intracellular gene is induced by p21. The method of claim 16, wherein the intracellular genes are identified in Table II. The method of claim 12, wherein the expression of the intracellular gene is detected using immunological reagents. The method of claim 12, wherein the expression of the intracellular gene is detected by assaying for the activity of the intracellular gene product. 13. The method of claim 12, wherein expression of the intracellular gene is detected by hybridization with complementary nucleic acids. A mammalian cell comprising a first recombinant expression construct encoding a reporter gene under expression transcription control of a promoter of a mammalian gene whose expression is regulated by p21, and a second recombinant expression construct encoding a mammalian p21 gene, wherein expression of p21 is Mammalian cells induced experimentally in mammalian cells. The recombinant expression construct of claim 21, wherein the recombinant expression construct encoding the mammalian p21 gene is subjected to transcriptional control of an inducible heterologous promoter, wherein expression of p21 from the recombinant expression construct brings the recombinant cell into contact with an inducer that induces transcription from the inducible promoter. Or by removing an agent that inhibits transcription from such a promoter. The mammalian cell of claim 21, wherein the reporter gene encodes a firefly luciferase, chloramphenicol acetyltransferase, beta-galactosidase, green fluorescent protein or alkaline phosphatase. The mammalian cell of claim 21, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 25. The mammalian cell of claim 24, wherein the mammalian gene promoter is a promoter of a mammalian gene identified in Table I. The mammalian cell of claim 21, wherein the reporter gene is under transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. 27. The mammalian cell of claim 26, wherein the mammalian gene promoter is a promoter of a mammalian gene identified in Table II. A mammalian cell comprising a recombinant expression construct encoding a reporter gene that is under transcription control of a promoter of a mammalian gene whose expression is inhibited by p21, wherein the promoter is a gene ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A , CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, CDC47 / MCM7, CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 Mammalian cells derived from / RAD2, PLK1, DHFR or citron kinase. A mammalian cell comprising a recombinant expression construct that encodes a reporter gene whose expression is controlled by the transcription of a promoter of a mammalian gene whose expression is p21, wherein the promoter is a gene serum amyloid A, complement C3, connective tissue growth factor, integrin β-3 From activin A, natural killer cell protein 4, prosaponin, Mac2 binding protein, galectin-3, peroxide dismutase 2, granulin / epitelin, p66 ^shc , lysosomal β-galactosidase or cathepsin B Derived mammalian cells. (a) expressing p21 in a mammalian cell according to claim 21 in the presence or absence of a compound; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of p21-mediated regulation of intracellular gene expression when the expression of the reporter gene is changed to a lesser extent in the presence of the compound, including p21-mediated regulation of intracellular gene expression How to identify compounds that inhibit. 31. The method of claim 30, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 32. The method of claim 31, wherein the mammalian gene promoter is a promoter of a mammalian gene identified in Table I. 31. The method of claim 30, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. 34. The method of claim 33, wherein the mammalian gene promoter is a promoter of a mammalian gene identified in Table II. 31. The method of claim 30, wherein expression of the reporter gene is detected using immunological reagents. 31. The method of claim 30, wherein expression of the reporter gene is detected by assaying for the activity of the reporter gene product. 31. The method of claim 30, wherein expression of the reporter gene is detected by hybridization with complementary nucleic acids. (a) expressing p21 in a mammalian cell according to claim 28 in the presence or absence of a compound; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of p21-mediated regulation of intracellular gene expression when the expression of the reporter gene is changed to a lesser extent in the presence of the compound, including p21-mediated regulation of intracellular gene expression How to identify compounds that inhibit. (a) expressing p21 in a mammalian cell according to claim 29 in the presence or absence of a compound; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of p21-mediated regulation of intracellular gene expression when the expression of the reporter gene is changed to a lesser extent in the presence of the compound, including p21-mediated regulation of intracellular gene expression How to identify compounds that inhibit. (a) treating the mammalian cells with an agent in the presence and absence of the compound or culturing the mammalian cells under conditions that induce aging; (b) assaying mammalian cells for inhibition or induction of genes that are inhibited or induced by p21 gene expression; And (c) identifying the compound as an inhibitor of aging if the gene inhibited by p21 is inhibited to a lesser extent in the presence of the compound than in the absence of the compound, or if the gene induced by p21 is induced to a lesser extent. To identify compounds that inhibit aging of mammalian cells. The method of claim 40, wherein the mammalian cell is assayed for the gene induced by p21. The method of claim 41, wherein the gene is identified in Table II. 41. The method of claim 40, wherein the mammalian cell is assayed for genes that are inhibited by p21. 44. The method of claim 43, wherein the gene is identified in Table I. 41. The method of claim 40, wherein expression of the intracellular genes is detected using immunological reagents. 41. The method of claim 40, wherein expression of the intracellular gene is detected by assaying for activity of the intracellular gene product. 41. The method of claim 40, wherein expression of the intracellular gene is detected by hybridization with complementary nucleic acids. (a) culturing a mammalian cell under conditions that contact the mammalian cell with an agent in the presence or absence of a compound or induce senescence, wherein the cell is subjected to transcriptional control of a promoter of a mammalian gene whose expression is regulated by p21 The reporter gene); (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying a compound that inhibits aging of mammalian cells, including identifying the compound as an inhibitor of aging when the expression of the reporter gene is changed to a lesser extent in the presence of the compound than in the absence of the compound. 49. The method of claim 48, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. The method of claim 49, wherein the mammalian gene promoter is a promoter of a mammalian gene identified in Table II. 49. The method of claim 48, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 49. The method of claim 48, wherein the mammalian gene promoter is a promoter of a mammalian gene identified in Table I. 49. The method of claim 48, wherein expression of intracellular genes is detected using immunological reagents. 49. The method of claim 48, wherein expression of intracellular genes is detected by assaying for activity of intracellular gene products. 49. The method of claim 48, wherein expression of the intracellular gene is detected by hybridization with complementary nucleic acids. (a) culturing the mammalian cell under conditions which contact the mammalian cell according to claim 28 with the agent in the presence or absence of a compound or induce aging; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of aging when the expression of the reporter gene is changed to a lesser extent in the presence of the compound than in the absence of the compound. (a) culturing the mammalian cell under conditions such as contacting the mammalian cell according to claim 29 with the agent or inducing aging in the presence or absence of a compound; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of aging when the expression of the reporter gene is changed to a lesser extent in the presence of the compound than in the absence of the compound. A method of inhibiting cellular aging, comprising contacting a cell with a compound produced according to the method of claim 12. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 30. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 38. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 39. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 40. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 48. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 56. A method of inhibiting cell aging, comprising contacting a cell with a compound produced according to the method of claim 57. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 12. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 30. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 38. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 39. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 40. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 48. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 56. A method of inhibiting the production of a disease-related gene product in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 57. (a) expressing p21 in a mammalian cell; (b) assaying cells in the presence and absence of compounds for changes in expression of intracellular genes induced or inhibited by p21; And (c) identifying the compound as an enhancer of p21-mediated regulation of expression of intracellular genes when the expression of the intracellular gene of step (b) is induced or inhibited to a greater extent in the presence of the compound than in the absence of the compound. Comprising a compound that enhances the effect of p21-mediated regulation of intracellular gene expression. 75. The method of claim 74, wherein the mammalian cell is the cell according to claim 2, wherein p21 expression occurs by contacting the cell with an inducer that induces transcription from an inducible promoter. 75. The method of claim 74, wherein expression of intracellular genes is inhibited by p21. 77. The method of claim 76, wherein the intracellular genes are identified in Table I. 75. The method of claim 74, wherein expression of the intracellular gene is induced by p21. 80. The method of claim 78, wherein the intracellular genes are identified in Table II. 75. The method of claim 74, wherein expression of the intracellular gene is detected using immunological reagents. 75. The method of claim 74, wherein the expression of the intracellular gene is detected by assaying for the activity of the intracellular gene product. 75. The method of claim 74, wherein expression of the intracellular gene is detected by hybridization with complementary nucleic acids. 75. The method of claim 74, wherein p21 is produced intracellular to an extent that its effect is less than the maximum effect of p21 expression in the cell. (a) culturing a mammalian cell under conditions that contact the mammalian cell with an agent in the presence or absence of a compound or induce senescence, wherein the cell is subjected to transcriptional control of a promoter of a mammalian gene whose expression is regulated by p21 The reporter gene); (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying a compound that enhances aging, including identifying the compound as an enhancer of aging when expression of the reporter gene changes to a greater extent in the presence of the compound than in the absence of the compound. 85. The method of claim 84, wherein the mammalian cell is a cell according to claim 2, wherein aging occurs by contacting the cell with an inducer that induces p21 transcription from an inducible promoter. 85. The method of claim 84, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. 87. The method of claim 86, wherein the gene is identified in Table II. 85. The method of claim 84, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 89. The method of claim 88, wherein the gene is identified in Table I. 85. The method of claim 84, wherein expression of the reporter gene is detected using immunological reagents. 85. The method of claim 84, wherein expression of the reporter gene is detected by assaying for activity of the intracellular gene product. 85. The method of claim 84, wherein expression of the reporter gene is detected by hybridization with complementary nucleic acids. (a) treating a mammalian cell with an agent in the presence of a compound or culturing it under conditions that induce aging; (b) assaying mammalian cells for inhibition or induction of genes that are inhibited or induced by p21 gene expression; And (c) identifying a compound that promotes induction of senescence in the presence of the compound, further identifying a gene that is inhibited by p21 in the presence of the compound or further inducing a gene induced by p21; How to identify compounds that promote the induction of. 95. The method of claim 93, wherein the mammalian cell is assayed for the gene induced by p21. 95. The method of claim 94, wherein the gene is identified in Table II. 95. The method of claim 93, wherein the mammalian cell is assayed for genes that are inhibited by p21. 97. The method of claim 96, wherein the gene is identified in Table I. 94. The method of claim 93, wherein expression of the intracellular gene is detected using immunological reagents. 95. The method of claim 93, wherein the expression of the intracellular gene is detected by assaying for the activity of the intracellular gene product. 95. The method of claim 93, wherein expression of the intracellular gene is detected by hybridization with complementary nucleic acids. (a) culturing a mammalian cell under conditions that contact the mammalian cell with an agent in the presence or absence of a compound or induce senescence, wherein the cell is subjected to transcriptional control of a promoter of a mammalian gene whose expression is regulated by p21 Include reporter genes); (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying a compound that promotes induction of senescence in mammalian cells, including identifying a compound that promotes induction of senescence when expression of the reporter gene changes to a greater extent in the presence of the compound than in the absence of the compound How to. 102. The method of claim 101, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. 107. The method of claim 102, wherein the gene is identified in Table II. 102. The method of claim 101, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 107. The method of claim 104, wherein the gene is identified in Table I. 102. The method of claim 101, wherein expression of intracellular genes is detected using immunological reagents. 102. The method of claim 101, wherein expression of the intracellular gene is detected by assaying for activity of the intracellular gene product. 102. The method of claim 101, wherein expression of the intracellular gene is detected by hybridization with complementary nucleic acids. (a) culturing the mammalian cell under conditions which contact the mammalian cell according to claim 28 with the agent in the presence or absence of a compound or induce aging; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying a compound that promotes induction of senescence in mammalian cells, including identifying a compound that promotes induction of senescence when expression of the reporter gene changes to a greater extent in the presence of the compound than in the absence of the compound How to. (a) culturing the mammalian cell under conditions such as contacting the mammalian cell according to claim 29 with the agent or inducing aging in the presence or absence of a compound; (b) assaying the cells for changes in expression of the reporter gene; and (c) identifying a compound that promotes induction of senescence in mammalian cells, including identifying a compound that promotes induction of senescence when expression of the reporter gene changes to a greater extent in the presence of the compound than in the absence of the compound How to. A method of promoting aging of a cell, comprising contacting the cell with a compound produced according to the method of claim 74. 117. The method of claim 111, wherein the cells are pathological or disease-causing cells due to tumor cells, proliferative cells or excessive proliferation. A method of promoting aging of a cell, comprising contacting the cell with a compound produced according to the method of claim 84. 117. The method of claim 113, wherein the cells are pathological or disease-causing cells due to tumor cells, proliferative cells, or excessive proliferation. A method of promoting aging of a cell, comprising contacting the cell with a compound produced according to the method of claim 93. 116. The method of claim 115, wherein the cells are tumor cells, proliferative cells, or pathological or disease-causing cells due to overgrowth. A method of promoting aging of a cell, comprising contacting the cell with a compound produced according to the method of claim 101. 118. The method of claim 117, wherein the cells are tumor cells, proliferative cells, or pathological or disease-causing cells due to overgrowth. A method of promoting aging of a cell, comprising contacting the cell with a compound produced according to the method of claim 109. 119. The method of claim 119, wherein the cells are tumor cells, proliferative cells or pathological or disease-causing cells due to overgrowth. A method of promoting aging of a cell, comprising contacting the cell with a compound produced according to the method of claim 110. 126. The method of claim 121, wherein the cells are pathological or disease-causing cells due to tumor cells, proliferative cells, or excessive proliferation. Compounds that inhibit p21 regulation of intracellular gene expression, (a) inducing the expression of p21 in mammalian cells; (b) assaying the cells for changes in expression of intracellular genes whose expression is regulated by p21 in the presence or absence of a compound; And (c) identifying the compound as an inhibitor of p21-mediated regulation of intracellular gene expression when the expression of the intracellular gene of step (b) is changed to a lesser extent in the presence of the compound than in the absence of the compound. Compound produced by the method. Compounds that inhibit p21 regulation of intracellular gene expression, (a) expressing p21 in a mammalian cell according to claim 21 in the presence or absence of a compound; (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of p21-mediated regulation of intracellular gene expression when the expression of the reporter gene is changed to a lesser extent in the presence of the compound. Compounds that inhibit the aging of mammalian cells, (a) treating the mammalian cells with an agent in the presence of the compound or culturing the mammalian cells under conditions that induce aging; (b) assaying mammalian cells for inhibition or induction of genes that are inhibited or induced by p21 gene expression; And (c) identifying the compound as an inhibitor of aging if, in the presence of the compound, the gene inhibited by p21 is inhibited to a lesser extent or the gene induced by p21 is induced to a lesser extent. The resulting compound. Compounds that inhibit the aging of mammalian cells, (a) culturing a mammalian cell under conditions that contact the mammalian cell with an agent in the presence or absence of a compound or induce senescence, wherein the cell is subjected to transcriptional control of a promoter of a mammalian gene whose expression is regulated by p21 The reporter gene); (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an inhibitor of aging when the expression of the reporter gene is changed to a lesser extent in the presence of the compound. Compounds that enhance the aging of mammalian cells, (a) expressing p21 in a mammalian cell; (b) assaying the cells for changes in expression of intracellular genes whose expression is induced or inhibited by p21; And (c) identifying the compound as an enhancer of aging when the expression of the intracellular gene of step (b) is induced or inhibited to a greater extent in the presence of the compound than in the absence of the compound. Compounds that enhance the aging of mammalian cells, (a) treating the mammalian cells with an agent in the presence of the compound or culturing the mammalian cells under conditions that induce aging; (b) assaying mammalian cells for inhibition or induction of genes that are inhibited or induced by p21 gene expression; And (c) generating a method comprising the step of identifying the compound as an enhancer of aging when the gene inhibited by p21 in the presence of the compound is inhibited to a greater extent or the gene induced by p21 is induced to a greater extent. compound. Compounds that enhance the aging of mammalian cells, (a) culturing a mammalian cell under conditions that contact the mammalian cell with an agent in the presence or absence of a compound or induce senescence, wherein the cell is subjected to transcriptional control of a promoter of a mammalian gene whose expression is regulated by p21 The reporter gene); (b) assaying the cells for changes in expression of the reporter gene; And (c) identifying the compound as an enhancer of aging when the expression of the reporter gene changes in a greater extent in the presence of the compound than in the absence of the compound. A method of producing an anti-apoptotic or mitogenic factor from a mammalian cell, comprising culturing the cells in cell culture medium for a time sufficient to express p21 in the mammalian cell and produce an anti-apoptotic or mitogenic factor. . 131. The method according to claim 130, wherein the mammalian cell is the mammalian cell according to claim 2, and wherein p21 expression comprises the step of culturing the mammalian cell in a culture medium containing an inducer that induces transcription from an inducible promoter or inhibiting transcription from such a promoter. Characterized in that it is induced by removing the agent. 133. The method of claim 130, wherein the anti-apoptotic or cleavable compound produced by the mammalian cell is a compound whose expression is induced by p21. Mammalian cell culture medium in which a mammalian cell expressing p21 is grown. 134. The method according to claim 133, wherein the mammalian cell is the mammalian cell according to claim 2, wherein p21 expression is used to culture mammalian cells in a culture medium containing an inducer that induces transcription from an inducible promoter or to inhibit electrons from such a promoter. Mammalian cell culture medium, characterized in that it is induced by removing an agent. (a) inducing the expression of p21 in mammalian cells; (b) obtaining intracellular mRNA from mammalian cells before and after p21 induction according to step (a); (c) comparing the expression of intracellular mRNA obtained from the cell before p21 is induced with the expression of intracellular mRNA after p21 is induced; And (d) obtaining a plurality of nucleic acid species enriched for genes involved in cell cycle progression, including obtaining a plurality of nucleic acid species enriched for genes whose expression is inhibited intracellularly after p21 expression is induced. How to. (a) inducing the expression of p21 in mammalian cells; (b) obtaining intracellular mRNA from mammalian cells before and after p21 is induced; And (c) obtaining a plurality of nucleic acid species enriched for the genes in which expression is induced in the cell after p21 expression is induced, and are involved in secreted proteins and aging and age-related diseases To obtain a plurality of nucleic acid species enriched for the gene encoding the protein. (a) inducing expression of P21 in a first population of mammalian cells and inducing quiescence in a second population of mammalian cells; (b) obtaining mRNA from each population of cells; (c) comparing the pattern of gene expression of the cells in the first population before and after p21 is induced with the pattern of gene expression of the cells in the second population before and after the cells are stopped; (d) comparing the plurality of genes strongly induced in p21-derived cells with the plurality of genes strongly induced in stationary cells; And (e) identifying a plurality of intracellular genes that are markers of cellular senescence, including identifying genes that are strongly induced in p21 induced cells that are not strongly induced in stationary cells. Detecting the expression of a gene selected from the group consisting of connective tissue growth factor, serum amyloid A, integrin β-3, activin A, natural killer cell protein 4, Mac2 connective protein or tissue transglutaminase. How to detect aging of cells. (a) assaying mammalian cells for expression of genes whose expression is regulated by p21 in the presence and absence of a compound; And (b) in the presence of the compound, identifying a compound that induces aging when the expression of a gene inhibited by p21 is inhibited intracellularly or when the expression of a gene induced by p21 is increased intracellularly; , A method for identifying compounds that induce aging of mammalian cells. 141. The method of claim 139, wherein the gene is induced by p21. 141. The method of claim 140, wherein the gene is identified in Table II. 141. The method of claim 139, wherein the gene is inhibited by p21. 145. The method of claim 142, wherein the gene is identified in Table I. 141. The method of claim 139, wherein expression of the gene is detected using immunological reagents. 139. The method of claim 139, wherein the expression of the gene is detected by assaying for the activity of the gene product in the cell. 139. The method of claim 139, wherein expression of the gene is detected by hybridization with complementary nucleic acids. 141. The method of claim 139, wherein the assay in step (a) is performed in the presence of an anticancer drug. 141. The gene of claim 139, wherein the mammalian cell comprises an inducible p21 gene and the assay in step (a) is performed in the presence of an amount of agonist that induces p21 expression, thereby reducing the extent of p21 induction by the gene. Characterized by insufficient for complete inhibition. (a) contacting a mammalian cell with a compound, wherein the cell comprises a reporter gene under transcriptional control of a promoter of a mammalian gene whose expression is regulated by p21; (b) assaying the cells for changes in expression of the reporter gene; And (c) when the cell contacts the compound, expression of the reporter gene is reduced when subjected to transcriptional control of a promoter derived from a gene that is inhibited by p21, or expression of the reporter gene is controlled by transcription of the gene induced by p21. When increasing upon receipt, identifying a compound that induces senescence in a mammalian cell, including identifying the compound that induces senescence. 149. The method of claim 149, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. 161. The method of claim 150, wherein the gene is identified in Table II. 149. The method of claim 149, wherein the reporter gene is subjected to transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 153. The method of claim 152, wherein the gene is identified in Table I. 149. The method of claim 149, wherein expression of the reporter gene is detected using immunological reagents. 149. The method of claim 149, wherein expression of the reporter gene is detected by assaying for activity of the intracellular gene product. 149. The method of claim 149, wherein expression of the reporter gene is detected by hybridization with complementary nucleic acids. A recombinant expression construct that encodes a reporter gene that is under transcriptional control of a promoter of a mammalian gene whose expression is inhibited by p21. 158. The promoter of claim 157, wherein the promoter is a gene ORC1, PRC1, XRCC9, CDC2, cyclin B1, AIK1, CENP-A, CENP-F, MAD2, BUBR1, MCAK, HSET, CHL1, thymopoietin α, MPP2, MPP5, Recombinant expression construct, characterized in that it is derived from CDC47 / MCM7, CDC21 / MCM4, DNA ligase I, DNA polymerase α, Rad54, exonuclease HEX1 / RAD2, PLK1, DHFR or citron kinase. A recombinant expression construct that encodes a reporter gene whose expression is under transcriptional control of a promoter of a mammalian gene whose expression is induced by p21. 159. The promoter of claim 159, wherein the promoter is gene serum amyloid A, complement C3, connective tissue growth factor, integrin β-3, activin A, natural killer cell protein 4, prosaponin, Mac2 binding protein, galectin-3, peroxide disulfide. A recombinant expression construct characterized in that it is derived from mutase 2, granulin / epitelin, p66 ^shc , lysosomal β-galactosidase or cathepsin B. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 12. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 30. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 38. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 39. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 40. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 48. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 56. A method of inhibiting the production of a fissile or anti-apoptotic compound in a mammalian cell, comprising contacting the cell with a compound produced according to the method of claim 57.