KR20010111728A - Recombinant genome of human originated basic fibroblast growth factor having increased extracellular efficiency and expression vector thereof - Google Patents

Abstract

The present invention relates to recombinant genes and recombinant expression vectors for increasing the secretion efficiency of human-derived basic fibroblast growth factor (bFGF) to the outside of cells. More specifically, the present invention relates to 9 amino acids ranging from amino terminal 1 (methionine) to leucine amino acid of native bFGF from amino terminal 1 methionine to 8 alanine amino acid of FGF4. The present invention relates to a recombinant gene encoding a recombinant protein substituted with 8 amino acids of, a recombinant expression vector prepared containing the recombinant gene, and a recombinant microorganism and animal cell line transformed therefrom.

The recombinant bFGF protein prepared in the present invention can be secreted in an animal cell line while maintaining the biological activity of the native type bFGF protein, and thus more than the natural type bFGF protein, and ischemic cardiovascular disease due to atherosclerosis in cardiovascular disease. In patients with bFGF gene therapy therapy can promote the formation of bypass vessels around the closed vessels.

Description

Recombinant genome of human originated basic fibroblast growth factor having increased extracellular efficiency and expression vector

The present invention relates to enhancing the extracellular secretion efficiency of the human-derived basic fibroblast growth factor (hereinafter abbreviated as "bFGF"), and more specifically, the modified bFGF protein, bFGF 5 'of the bFGF amino terminus, The present invention relates to a method of increasing the secretion efficiency of bFGF in animal cells including humans using the bFGF gene whose terminal is modified, an expression vector including the same, a host cell transformed with the expression vector, and the expression vector.

Fibroblast growth factors (FGFs) were proteins isolated from bovine brain and pituitary gland by Gospodarowitz et al. (Nature 249: 123-127, 1974) in 1974 and have biological activities that promote fibroblast and endothelial cell listing. have. Since then, many types of fibroblast growth factors have been discovered, and among them, acidic fibroblast growth factor (FGF1) and basic fibroblast growth factor (FGF1), which are classified into biological activity and isoelectric point of protein. Many studies have been done on growth factor (FGF2; hereinafter abbreviated as bFGF).

Among them, bFGF is a basic protein having a molecular weight of about 18 kDa (pI 9.58), which is mainly secreted by the pituitary gland and is known to promote growth in various mesodermal derived cells. In particular, bFGF is a protein that promotes growth in vascular endothelial cells and smooth muscle cells has been developed as a therapeutic drug showing excellent efficacy in trauma treatment and vasculature. In recent years, it has been spotlighted as a candidate substance for gene therapy that can induce angiogenesis in patients with ischemic cardiovascular disease due to atherosclerosis or vascular narrowing.

The gene of bFGF was cloned by Abraham et al., The EMBO Journal 5: 2523-2523, 1986. Kurokawa et al., FEBS Letter 213: 189-194,1987. In addition, yeast (The Journal of Biological Chemistry 263, 16471-16478, 1988), animal cells (FEBS Letter 213: 189-194, 1987), and E. coli (The Journal of Biological Chemistry 263, 16297-1630, 1988) were produced by recombinant protein production techniques. Has been expressed in. There has also been developed a method for the production of mutant recombinant proteins in which at least one constituent amino acid of bFGF is replaced with another amino acid using genetic engineering techniques (Biochemical and Biophysical Research Communication 151, 701-708, 1988, European Patent Publication). 281,822, US Patent Publication 5310883A). The bFGF produced by the above-mentioned recombinant protein is being studied as a therapeutic agent for trauma and thrombosis atherosclerosis.

In recent years, the development of gene therapy development techniques has resulted in the suppression of smooth muscle cell growth associated with agiogenesis in the treatment of cancer and cardiovascular disease (Jouranl of Vascular Surgery 25 (2), 320-325). , 1977), and research and discussion on bFGF as a target substance that can control or promote (Arteiosclerosis, Thrombosis, and Vascular Biology 17 (11), 2453-2460,) is active.

The mature protein of native bFGF consists of 155 amino acids. In general, growth factors and cytokines have secretory signal peptides at the amino terminus of proteins to promote extracellular secretion of mature proteins. After immature protein polypeptides synthesized in the cytoplasm have undergone posttranslational modification After secretion signal peptide is transferred to the cell membrane, it is secreted out of the cell in the form of mature protein. In many cases, secretory signal peptides and mature proteins are cleaved off by the action of specific signal peptidase, and the mature protein is released to the outside of the cell. As regards the extracellular secretion of such a general protein, the type and function of the signal peptide is determined by McGeoch et al Virus Research 3,271,1985 and Heine et al., Nucleic Acid Research., 14,4683, 1986. These conditions are proposed, which include the length and net charge of the N-region, positively charged region at the amino terminus of the protein, and the central hydrophobic region at the center of the signal protein. Eukaryotic secretion signaling peptides can be predicted by the presence or absence of cleavage sites that can cause cleavage reactions by the presence or absence of H-regions and proteolytic enzymes specifically recognized under the H-regions. . Among the FGFs, bFGF (FGF2) and acid fibroblast growth factor (acid FGF1) have been found to have no amino terminal region sequence that specifically meets the conditions of the secretory signal peptides mentioned above. In contrast, in the case of blast growth factor 4 (FGF4), a typical eukaryotic secretion signal protein is composed at the amino terminal 1-22 amino acid sequence (Cell 50 (5), 729-737, 1987). ). In the case of FGF9, 33 amino-terminal amino acid sequences were reported to be involved in the effective secretion of proteins without the cleavage reaction by protein cleavage enzymes (The Journal of Biological Chemistry 275, 11, 8083-8090, 2000).

On the other hand, there have been attempts to increase the secretion efficiency of FGF1 or bFGF to the outside of cells, and among them, NIH3T3 cell line expresses recombinant expression of human growth hormone secreted signaling protein to bFGF. It has been reported that cell culture fluids stimulated the release of bFGF (Oncogene 2, 129-136, 1988). In addition, the recombinant gene encoding the recombinant protein combining 22 amino acids of FGF4 with the amino terminal of FGF1 protein (The Journal of Biological Chemistry 270, 29, 17457-17467) and amino terminal 22 of FGF4 at the amino terminal of bFGF protein Expression of recombinant genes (Arterosclerosis, Thrombosis, and Vascular Biology 17 (11), 2453-2460) encoding a recombinant protein conjugated with two amino acids has been reported to increase the secretion of FGFs compared to the natural form.

Under this background, the inventors of the present invention, in order to prepare a new bFGF with increased secretion to the outside of cells while maintaining the same biological activity as the native bFGF, the amino acid sequence of amino terminus 1-9 of the natural bFGF protein is It was found that there was no effect on the activity, and by using a recombinant gene in which the non-affecting site was replaced with the secreted protein leader sequence of FGF4, it was possible to increase the extracellular secretion while maintaining the same biological function as that of the native bFGF. The present invention has been completed.

Accordingly, it is an object of the present invention to provide a mutant bFGF gene and an expression vector comprising the gene, in which extracellular secretion efficiency is significantly increased.

Figure 1 shows the procedure for cloning the cDNA of human basic fibroblast growth factor (bFGF) used in Example 1.

Figure 2 shows the nucleotide sequence of the bFGF cDNA cloned through the process of Example 1 and the amino acid sequence of the protein encoded therefrom.

Figure 3 shows a process for modifying the nucleotide sequence encoding the bFGF amino terminal through Example 2.

Figure 4 shows the nucleotide sequence of the PCR primers used in the substitution process of the bFGF amino terminal of Example 2.

Figure 5 shows the nucleotide sequence of the cDNA nucleotide sequence modified from the amino end of bFGF through the process of Example 2 and the amino acid sequence of the protein encoded therefrom.

FIG. 6 shows a procedure of cloning a cDNA modified with an amino terminal of bFGF into an animal cell line expression vector through the procedure of Example 3.

FIG. 7 shows a procedure of cloning a cDNA modified with an amino terminus of bFGF into an adenovirus shuttle vector through the procedure of Example 3.

Figure 8 shows the process of forming a recombinant adenovirus using the amino terminal substituted shuttle vector and adenovirus of bFGF through the process of Example 3.

9 shows the quantitative and qualitative analysis of the expression-secreted bFGF after infection of the finished bFGF vectors in the animal cell line through the process of Example 4.

10 shows a graph quantifying the amount of bFGF secreted through the process of Example 5 by ELISA method.

Figure 11 shows the purification of the secreted bFGF through the procedure of Example 5 and Western blot results.

12 shows the results of comparative analysis of gene expression effects of biological activity of growth factors by treating amino terminal substituted bFGF and native bFGF purified through the process of Example 6 to human smooth muscle cells.

Hereinafter, the present invention will be described in more detail.

The present invention utilizes human skin epidermal fibroblast cultures to produce genes encoding bFGF proteins with enhanced extracellular secretion.

Specifically, cDNA is synthesized by extracting RNA from a human epidermal fibroblast culture, and the primer corresponding to the bFGF gene upstream: 5'-GGA CCATGGCAGCCGGG-3 '(hereinafter, abbreviated as' primer 1') as a template. A primer corresponding to the downstream bFGF gene: 5'-CCCGTAAAATCAGCTCTTAGCAG-3 '(hereinafter referred to as' primer 2') was synthesized and subjected to a polymerase chain reaction (hereinafter, referred to as' PCR '). Native bFGF cDNA was isolated.

The cDNA obtained by the above process is inserted into the plasmid vector pGEMT, and can be substituted with the Met Ser Gly Pro Gly Thr Ala Ala sequence corresponding to amino terminal 1-8 of FGF4 using pGEMT / bFGF as a template. Oligonucleotide primers (fgN1: 5'-GGGACGGCCGCGCCCGCCTTGCCCGAGGATGGCGGC-3 '(hereinafter abbreviated as' fgN1 ') capable of PCR reaction at 438 bp encoding protein Pro9-Ser155 "5'-ATGTCGGGGCCCGGGACCCGA-3CCTTGCCGGCCCC' fgC: 5'-TTATCAGCTCTTAGCAGACATTGGAAG-3 '(hereinafter, abbreviated as' fgC ') was designed, synthesized, and subjected to a PCR reaction to modify the modified bFGF 5' region of native bFGF. Gene was prepared.

The vector of pK4sbFGF of the present invention is prepared by inserting the mutant bFGF gene obtained in the above process into pBluescript KS (+). The vector pK4sbFGF of the present invention was transformed into Escherichia coli XL-1 -Blue strain, and the Escherichia coli transformant was deposited on the Korea Microbiological Conservation Center (KCCM), which was established by the Korea Deposit Association of Korea, an international depositing institution, on May 26, 2000 ( Accession No .: KCCM-10189).

The present invention also provides an expression vector pcDNA / 4sbFGF in which the mutant bFGF gene is inserted into an expression vector for animal cells so that the mutant bFGF protein can be stably produced in mammals including humans.

When the expression vector pcDNA / 4sbFGF of the present invention was infected with an animal cell line, the secretion of recombinant bFGF protein having the same biological function as that of native bFGF was three times higher.

In addition, the present invention is a recombinant adenovirus ad / CMV / 4sbFGF prepared by homologous recombination of the adenovirus known to be harmless and stable to the human body so that the recombinant bFGF protein of the present invention can be used as a therapeutic agent in the human body and the mutant bFGF gene of the present invention. To provide.

In the recombinant adenovirus expression vector ad / CMV / 4sbFGF of the present invention, the secretion of recombinant bFGF protein was more than three times higher in mammals, including humans, as in the case of PCDNA / 4sbFGF infection with animal cell lines.

Vector pcDNA / 4sbFGF and ad / CMV / 4sbFGF comprising the recombinant bFGF gene of the present invention can be transiently or stably transfected into cultured cells to produce biologically active recombinant bFGF protein.

The present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention, it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Example 1. cDNA Cloning of bFGF

In order to clone cDNA of native bFGF, the whole RNA was isolated by treatment with Ultraspec II RNA Isolation Kit (Biotecx, USA) reagent from 2 × 10 ⁹ cells from human epidermal fibroblasts. After purification, 5 μg of the RNA was used as a template, and the oligo dT primer was reacted with AMV reverse transcriptase (Promega, USA) to synthesize a single strand of cDNA complementary to mRNA (FIG. 1). Again, the primer corresponding to the bFGF gene upstream with 5 μg of this cDNA template: 5'-GGA CCA TGG CAG CCG GG-3 'and the primer corresponding to the bFGF gene downstream: 5'-CCC GTA AAA TCA GCT CTT AGC AG-3 Polymerase chain reaction by Taq DNA polymerase (hereinafter, referred to as PCR). PCR reactions consisted of 1 cycle of 94 ° C denaturation, 1 minute 55 ° C of primer and primer annealing, and 1 minute primer extension 72 ° C. The cycler (Robocycler ^™ , Stratagen USA) was used. DNA fragments of about 480 base pairs (hereinafter bp) amplified from the reaction were identified by 1% agarose gel electrophoresis. The fragments were separated and purified to pGEM-Teasy (3.01 kdp, Promega. USA), a cloning plasmid for PCR products. E. coli strain XL1Blue was transformed by reaction with T4 DNA ligase (Ligase). Plasmid DNA pGEMT / bFGF (3.5kbp) was extracted from transgenic E. coli strains that form white colonies on Luria Botani (LB,) plate medium to which 150 μg / ml of antibiotic ampicillin was added. As a result of DNA sequencing (ALF system, Amersham Phamacia Biotech), it was confirmed that the fragment of 480bp amplified by PCR reaction was cDNA of human basic fibroblast growth factor (FIG. 2).

Example 2. Modification of bFGF cDNA

The amino acid sequence of Met Ala Ala Gly Ser Ile Thr Thr Leu, corresponding to amino terminus 1-9 of the native bFGF, was used to modify the amino terminus of the bFGF protein to increase the secretion efficiency. Oligonucleotide primers designed to be substituted with the amino acid sequence of Met Ser Gly Pro Gly Thr Ala Ala corresponding to terminal 1-8. These primers were PCR primers fgN1: 5'-GGGACGGCCGCGCCCGCCTTGCCCGAGGATGGCGGC-3 ', primer fgN2: 5'ATGTCGGGGCCCGGGACCGGCCGGGCCGCCCC' It is three kinds of: 5'-TTATCAGCTCTTAGCAGACATTGGAAG-3 '. Vector pGEMT / bFGF (3.5kbp) containing the cDNA of bFGF cloned from Example 1 was used as a template for the first PCR reaction by adding fgN1 and fgC as primers. 30 cycles of reaction was carried out using 52 ° C. for 1 minute and primer extension for 72 min. For 1 minute. DNA fragments amplified therefrom were identified and separated by agarose cryophoresis. The secondary PCR was subjected to secondary denaturation at 94 ° C. for 1 minute, template and primer annealing at 52 ° C. for 1 minute, and primer extension by adding primers fgN2 and fgC as a template. 30 cycles of reaction was carried out at 72 ° C. for 1 minute. DNA fragments amplified therefrom were identified and separated by agarose electrophoresis. 2 hr PCR was performed by adding primers fgN2 and fgC to the template from approximately 423 bp DNA fragment isolated therefrom for 1 min of denaturation at 94 ° C for 1 minute, 52 ° C for 1 minute for primer and primer annealing, and primer extension. The reaction of 30 cycles was carried out at 1 cycle (72 ° C.) for 1 minute (FIGS. 3 and 4). The 465 bp DNA fragment amplified from the above-described second PCR reaction was transformed into E. coli strain XL-1-Blue by reacting the EcoRV restriction enzyme locus of the pBluescript KS (+) vector with T4 DNA ligase (Ligase). It was. Plasmid DNA (pK4sbFGF) was extracted from transfected Escherichia coli on LB plated medium containing the antibiotics ampicillin, X-gal and isopropyl thiogalactopyranoside (hereinafter referred to as IPTG). As a result of DNA sequencing analysis, the 465bp fragment amplified by PCR reaction showed that the recombinant DNA in which amino acid sequence 1-9 of human basic fibroblast growth factor was replaced with amino terminal sequence 1-8 of FGF4 (FIG. 5). It was confirmed that.

Example 3. Composition of bFGF Expression Vectors

To verify the expression and secretion efficiency of the bFGF variant, bFGF cDNA substituted in pK4sbFGF prepared in Example 2 was prepared using restriction enzymes EcoRI and Xhoi 465bp fragments and animal vector expression vector pcDNA3.1 (In Vitrogen USA) was isolated from the restriction enzyme fragment vector (5.4kbp) obtained by treatment with EcoRI and Xho I , and mixed with each other. Animal cells substituted with bFGF amino terminus through T4 DNA-linking enzyme reaction and E. coli transformation and selection. Expression vector pcDNA / 4sbFGF (5.9kbp) was constructed (FIG. 6). In addition, pcDNA / bFGF containing a natural type of cDNA was prepared for use as a comparative control of expression and secretion efficiency of the natural type of bFGF.

In addition, bFGF cDNA was inserted into pCA14 (6.95kbp, Microbix; Ontario, Canada), which is a vector of a vector containing adenovirus genes, and the natural pCA14 / 4sbFGF (FIG. 7) substituted with the 5 'terminal of bFGF. PCA14 / bFGF into which a type bFGF cDNA was inserted was also prepared. These vectors can be used for Gene Therapy through homologous recombination with adenovirus vectors.

Example 4. bFGF Expression Vector Infection of Animal Cell Lines

After bFGF expression vectors of Example 3 were transfected into 293 cell lines, bFGF expression and secretion efficiency comparative analysis was performed.

First, to confirm the efficiency of the vector derived from the animal cell expression vector pcDNA3.1, the amino-terminal substitution type pcDNA / 4sbFGF DNA, the secretion efficiency control native pcDNA / bFGF, and beta-galactosidase were expressed. 1 μg of each of the possible pcDNA / LacZ DNAs was infected by treatment with lipofectamine (Gifco BRL, USA) in a 293 cell line grown to about 70-80% confluency. After 3 hours of incubation at room temperature, Dulbecco's modified Eagle culture medium (hereinafter referred to as DMEM) medium was replaced, and after 48 hours, the pcDNA LacZ (betagalactosidase) control was used to correct the infection efficiency according to each vector type. When quantifying bFGF amount, it was converted proportionally.

Second, amino-terminal substituted pCA14 / 4sbFGF and secretion efficiency control pCA14 / bFGF prepared as a carrier vector to verify the expression and secretion of bFGF by adenovirus from human adenovirus type5 Co-transfection of the E. coli strain BJ5183 after co-transfection and linearization with the restriction enzymes XmnI and BastI to induce a homologous recombination reaction with the derived E1 / E3 deleted-replication defective adenovirus pHRLd1324Bst -transformation). Through this reaction, the newly recombined adenovirus Ad / CMV / 4sbFGF was composed of bFGF Ad / CMV / bFGF was composed of a recombinant virus containing the 5 'end (amino terminus) of the native bFGF gene (Fig. 8). In addition, Ad / CMV / LacZ virus capable of expressing beta galactosidase was prepared for control of infection efficiency. Proliferation and purification of these recombinant adenoviruses was performed by the standard method of Hitte et al. 1994 in 293 cell lines. After incubating the 293 cell line at 90% saturation, the recombinant adenovirus vectors were each infected with 10moi, and after 2 to 3 hours, virus inoculation was removed from the cell culture and cultured at 37 ° C. for 2 to 3 days. Centrifuge the cell culture and the culture and repeat the cooling / thawing three times in order to drain the virus, and again mix with the obtained precipitate to centrifuge to recover the virus. The recovered virus was determined by limiting dilution assay on 293 cell lines.

Example 5. Quantitative and Qualitative Analysis of bFGF Expressed in Animal Cell Lines

Quantitative and qualitative analysis of bFGF secreted out of the cells was carried out by culturing the culture medium from the culture of the animal cell line infected with Example 4 (FIG. 9). To this end, in the same manner as in Example 4, the pcDNA / 4sbFGF vector or a control native vector was infected with a COS cell line not expressing bFGF, and the amount of bFGF secreted into the cell culture was analyzed by enzyme reaction immunoassay (hereinafter, ELISA). To quantitatively, cultures of native bFGF and amino-substituted 4sbFGF recombinants were compared and quantified using Quantikine ELISA kit of R & D system (USA). As a result, among the bFGF recombinants infected with the 293 cell line and the COS cell line, DNAs encoding 4sbFGF in which the amino terminal was substituted with the amino terminal of FGF4 were approximately 3 compared to the native form under the control of the same cytomegalovirus (CMV) promoter. It was confirmed that the secretion of bFGF was increased about twice (FIG. 10). In addition, for qualitative analysis of the bFGF protein secreted from the COS cell line, the purified bFGF was separated and purified by heparin Sepharose column chromatography. The culture and the culture were centrifuged from the cell culture and the culture supernatant was administered to a heparinsepharose column. The column was washed with sodium phosphate buffer (pH7.4) five times the volume of the column, and sodium chloride (hereafter NaCl) was added at a concentration gradient of 0.5 to 1.5 M to elute the adsorbed proteins on the column, and the fractions were separated. . SDS-polyacrylamide gel electrophoresis (4-12% gradient) was used to compare these fractions with a bFGF standard sample and 10% bovine serum used for cell culture and culture of animal cell lines without bFGF vector as a control. Gel, Novex USA) was performed and the protein was adsorbed onto nitrocellulose paper and Western blot was performed using an antibody against bFGF (Upstate Biotechnology USA). As a result, bFGF bound to heparin sepharose was recovered as NaCl fraction of about 1-1.5M, and it was confirmed that bFGF was not secreted in the culture containing no bFGF vector. Figure 11 shows the results of Western blot lane 1 cell disruption supernatant, lane 2 cell disruption precipitate, lane 3 lane molecular weight standard sample, lane 4 heparin elution sodium chloride 0 M fraction, lane 5 heparin elution sodium chloride 0.5 M fraction, lane 6 heparin eluted sodium chloride 0.75 M fraction, lane 7 heparin eluted sodium chloride 1.0M fraction, lane 8 heparin eluted sodium chloride 1.25M fraction, lane 9 heparin eluted sodium chloride 1.5M fraction, lane 10 Silver bFGF standard sample 100ng, lane 11 COS culture supernatant, lane 12 represents the DMEM culture. In addition, it was confirmed that there was bGFG synthesized intracellularly even in the fraction of cells that cultured bFGF-secreting cells, and the amino terminal substituent of bFGF increased the secretion efficiency outside the cell compared to the native bFGF by CMV promoter regulation. Confirmed. In addition, to compare the properties of bFGF secreted outside the cells and the bFGF protein present in the cell was compared with the recombinant standard sample (18kDa) of bFGF protein. Since the expression of bFGF expressed in cells and bFGF secreted outside the cell did not decrease as compared to the bFGF standard sample, the secretion signal peptide by the classical type of protease was released in the process of secretion outside the cell after bFGF expression. It was found not to involve the tire cutting process. This confirms that the amino acid-substituted bFGF is secreted out of cells through the non-cleavable secretion mode reported in the FGF analog population (The Joumal of Biological Chemistry 275 (11): 8083-90, 2000). That is, the recombinant 4sbFGF with a native bFGF and an amino-terminal substitution, secreted bFGF with a molecular weight equal to that of the natural type to the outside of the cell was not attacked by a signal peptidase despite the amino-terminal substitution. Nevertheless, the secretion efficiency is significant compared to the natural form, and the charged state of the protein according to the substituted bFGF amino terminal sequence and the exposure state of the hydrophobic patch on the structure of the bFGF increased the protein secretion efficiency. Judging.

Example 6 Growth Promoting Effect of Secreted Purified bFGF on Smooth Muscle Cells

In order to confirm the biological activity of the bFGF proteins purified in Example 5, the cells were treated and cultured in smooth muscle cells to analyze proliferation induction. Rat Aortic Smooth Muscle Cell (RASMC) isolated from rats was depleted in serum for 72 hours in the serum for 72 hours, and then the amino terminal of COF-derived bFGF purified from heparin Sepharose in Example 5 Substituted bFGF protein was quantified by ELISA and the same amount of standard recombinant bFGF protein was added to the medium without bovine serum at a concentration of 20 ng / ml, respectively. Was observed. In order to confirm that the amino-terminal substitution bFGF and the native type bFGF show a proliferative effect on the smooth muscle cell proliferation through this culture, the pattern of genes expressed by the biological activity of FGF was verified by reverse transcription PCR reaction. Comparing the expression level of proto-oncogene that causes expression when cell proliferation is stimulated by signal transducton mechanism through stimulation of growth factor, it is possible to confirm the cell proliferation effect of bFGF. RNA was treated with ultra-spec RNA purification kit (Ultraspec II RNA Isolation kit, Biotecx, USA) reagent to isolate and purify total RNA, and then the oligo-dT primer and AMV reverse transcriptase (Promega, USA) Treatment was performed to synthesize complementary single-stranded cDNA for mRNA. Again, the primer corresponding to the upstream of the c-Myc gene, where 1 μg of this cDNA is expressed as a stimulus of growth factor, is: 5'-GTC ACG ACG ACTG ATG CCC CTC AAC GTG-3 'and downstream of c-Myc gene. Primer: 5'-AAG TCC AAG TTC TGT CAG AAG GAA-3 'was subjected to a chain reaction (hereinafter PCR) by Taq DNA polymerase. The PCR panel was used for 1 cycle of 94 ° C denaturation, 1 ° C for primer and primer annealing, and 1 ° C for primer extension 72 ° C. Robocycler ^™ (Stratagen USA) was used. About 1.3 kbp of c-Myc gene amplified from this reaction was amplified. As shown in FIG. 12, the substituents 4sbFGF and the native type bFGF were found to have the same biological activity with high expression of c-Myc gene compared to the control group treated with COS cell culture supernatant.

As a result, the mutant bFGF gene, which substituted the amino end of native bFGF with the amino end of bFGF4, was able to secrete a higher amount of bFGF protein than that of native bFGF in animal cell lines, while maintaining the same biological activity. When used for a carrier carrier can provide a method that can efficiently increase the neovascularization in vivo.

Claims (8)

Nucleic acid having a nucleotide sequence of SEQ ID NO: 1 encoding human basic fibroblast growth factor (bFGF) or a nucleic acid having 70% or more sequence homology to the nucleotide sequence Recombinant vector consisting of the nucleic acid and the expression vector of claim 1 The recombinant vector of claim 2, wherein the expression vector is an animal cell line expression vector. The recombinant vector of claim 2, wherein the expression vector is an adenovirus expression vector. Transformant transformed with the recombinant vector of any one of claims 2 to 4 The transformant of claim 5, wherein the transformant is an animal cell line. The transformant of claim 5, wherein the transformant is a bacterium. Human basic fibroblast growth factor (bFGF) having the amino acid sequence of SEQ ID NO: 1 or an analogue having an amino acid sequence having at least 70% homology to the amino acid sequence of SEQ ID NO: 1