KR20010088793A - The use of glial cell line-derived neurotrophic factor family-related compounds for regulating spermatogenesis and for preparing male contraceptives - Google Patents

Abstract

The present invention relates to GDNF-like neurotrophic factor (GDNF), ferretin, GDNF-like factors such as atemin and neutrin or other compounds that act in a similar manner to GDNF in its signaling receptors, namely cRet receptor tyrosine Or regulating and studying spermatogenesis, inhibiting cell differentiation, development of male contraceptive methods, or the use of male contraceptives, or the manufacture of the male contraceptives, as well as their use with reciprocal receptors such as the GDNF receptor α: s (GFRα1-4) (GDNF) < / RTI > and related compounds. ≪ Desc / Clms Page number 2 >

Description

[0001] The present invention relates to the use of neurotrophic factor family-related compounds for regulating sperm production and the use of related compounds of the synovial cell line derived neurotrophic factor family for preparing male contraceptive pills and for preparing male contraceptives.

Sperm production is a complex and sequential process involving hormonal regulation and local interactions between sitolytes and germ cells. (Bellve AR & Zhang, WJ, Reprod Fertil 85, 771-793 (1989);.. Skinner, MK, Endocr Rev. 12, 45-72 (1991);... Pescovitz, OH, et al, Trends Endocrinol Metab . 5, 126-131 (1994). Parvinen, M., et al., J. Cell. Biol. 117, 629-41 (1992). Djakiew, D., etal .., Biol. Reprod. 51, 214 6, 298-304 (1996); Zhao (1996), Cancer, B. & Risbriger, GP, Biol. Reprod. 58 , 1138-45 (1998); Bitgood, M. J et al., Curr. , GQ, et al., Genes Dev. 10 , 1657-1669 (1996); Zhao, GQ, et al., Development 125 , 1103-1112 (1998)). Differentiation of spermatids or spermatogenesis can be divided into three stages. In the first step of sperm production, spermatogonial cells, which are undifferentiated hepatocytes, are isolated from the reproductive system into mitosis and differentiated into chimeric cells. Spermatogonial cells are very resistant to various types of damage, and spermatogenesis begins in these cells after injury. At present, the mechanism by which spermatids are retained and the signals by which spermatogonial cells are differentiated into spermatids are not known. The spermatogonial cells are located in the peripheral part of the tubule, and they are in contact with the Sertoli cells, which represent regulatory cells of the tubules and are classified as somatic cells of the organism.

In the next step of sperm production, they first differentiate into primary chimeric cells and then differentiate into secondary chimeric cells, thereby calling them sperm cells and dividing them into two meiotic cells, and their chromosomes become half-life. In the third stage, sperm cells develop into sperm or mature sperm cells.

Luteinizing hormone, follicle stimulating hormone and testosterone are the most important hormonal regulators of sperm production. The gonadal cells in the testis tubules are not a direct object of hormonal regulation, but hormonal regulation is mediated by Sertoli cells. The cytolytic cells express the hormone signal as a signal molecule and three factors such as hepatocyte factor (c-Kit ligand), insulin such as 1 -generative factor, β-transduction factor and family (β- Factor, active hormone, inhibitory hormone) and to change the paracrine hormone to be a factor. (Bellve AR Zhang WJ, Reprod Fertil 85, 771-793 (1989);.. Skinner, MK, Endocr Rev. 12, 45-72 (1991);... Pescovitz, OH, et al, Trends Endocrinol Metab 5. , 126-131 (1994)). All of the above ligands are expressed in sitolytes, and their receptors are located in the reproductive cells. The functional evidence of the controller is surprising. The best experimental evidence of paracrine modulation in sperm production is desert hedgehog-deficient transgenic mice. (Bitgood, MJ, et al., Curr. Biol. 6 , 298-304 (1996)). Desert hedgehog is a signal molecule expressed in the cytolytic cells. Its paced receptors are located, for example, in radic cells, such as testosterone, which produce testicular gland cells. When the Desert Hedgehog molecule loses the differentiation of sperm stops, no cell is formed and all male rats are sterile.

Sperm-producing cells also pass the signal back to the cytolytic cells. Rev. 12, 45-72 (1991), Pescovitz, OH, et al., Trends Endocrinol. Metab. 5 , 126-131 (1994)). For example, neurogenic factors and 1-fibroblast-producing factor receptors are expressed in reproductive cells, and the p75 neurogenic factors and 1-fibroblastogenic factor receptors are located in the cytolytic cells. There is an implication of self-regulation of sperm production. Bone morphogenic proteins 8a and 8b, and their receptors, are expressed in the same sperm-producing cells. (Zhao, GQ, et al, Gene Dev 10, 1657-1669 (1996);.... Zhao, GQ, et al, Dev 125, 1103-1112 (1998)). The functional evidence for autocrine regulation is still deficient.

(GDNF) is a factor of the superfamily of β-transgenesis (Lin, LF, et al., Science 260, 1130-1132 (1993)). GDNF maintains dopamine, noradrenergic, cholinergic and motor neurons in the nervous system, and also protects the ciliary and sensory neurons of the peripheral parasympathetic nerves. (Lin, LF, Neural Notes. 2, 3-7, (1996). During the mammal occurs, GDNF is expressed in other tissues such as the fetal kidney and testis. (Suvanto, P., et al ., European Journal of Neuroscience 8, 816-822, ( 1996);.. Trupp M. et AL, Journal of Cell Biology 130, 137-148, (1996)) the role of GDNF as a sphere adjustment of height differentiation gene knockout in mice ( knockout and gene deletion techniques (Pichel, JG, et al., Nature 382 , 73-75 (1996)). The mice die from newbone, It was impossible to study the function of GDNF in sperm production, which began only long after the model was born.

Different model system studies suggest that there are several ways to inhibit sperm production and to develop male contraception. So far, the limited method is very unfavorable to serious side effects to male patients. Therefore, the problem to be solved is how to control multiple hormonal regulators that provide a system that can effectively and specifically target the testes and, at the same time, regulate sperm production without adverse effects and negatively interfere with male mating behavior It is to choose.

The present invention solves the problem by studying transgenic mice that incorporate human GDNF into their testes. Rats with high levels of human GDNF show that they can breed females. Therefore, the solution to the problem is to use the synoviocyte-derived neurotrophic factor as defined in the claims of the present invention, which produces a composition useful for male contraception which modulates, inhibits or inhibits sperm production, causes infertility and is effective as an active ingredient and without severe side effects family related compounds.

Therefore, a first object of the present invention is to provide an effective male contraceptive method using severe and undesirable side effects using GDNF- and related compounds for male pacing.

Another object of the present invention is to use GDNF- and related compounds as an active ingredient to produce a composition useful for male contraception.

Another object of the present invention is to provide a method of regulating and studying sperm production, which is achieved by inhibiting the differentiation of sperm cells.

A third object of the present invention is to provide an effective method of infertility caused by inhibition of cell differentiation.

It is also an object of the present invention to provide a method for regulating and studying sperm production and inhibiting the differentiation of sperm cells.

In addition, it is an object of the present invention to provide a transgenic animal, particularly a mouse, wherein the GDNF- and related compounds targeted to testes provide a useful method for studying sperm production.

SUMMARY OF THE INVENTION

The characteristics of the invention are defined in the claims. The present invention enables a sterility study caused by inhibition of spermatogonial differentiation, and then describes a method for providing a system for inhibiting the differentiation of spermatogonia in a male infertility contraceptive organ. The GDNF-transgenic, GDNF-t mouse strain, which carries the strain of transgenic mice, is a model of infertility caused by the inhibition of cell differentiation. Compounds that act similar to GDNF, GDNF, other cRet receptors, other GDNF-receptors that activate compounds or compounds that activate cRet receptor signaling conduits in spermatids are characterized in that they are suitable for male contraception, and GDNF t-rats The model is characterized as an animal model for sperm production regulation and sperm production studies.

The present invention relates not only to the regulation and study of sperm production, the inhibition of cell differentiation, the use of male contraceptives or the manufacture of male contraceptive compositions, but also of the gonadotropin-derived neurotrophic factor (GDNF) for male contraceptive methods, Lt; RTI ID = 0.0 > (GDNF) < / RTI > such as other compounds that act similar to GDNF in the recipient receptor.

1a. Formation of 3 weeks old wild-type mouse testes. Scale bar 100 탆

1b. Formation of three major genetically modified rat testes. Scale 100 탆

Note the undifferentiated spermatogonial cells forming the cell mass.

1C. Formation of 8-week-old wild-type mouse testes. Scale 100 탆

1d. Formation of 8 week old transgenic rat testes. Scale 100 탆

Note the remainder of the bulk of the A type garden cell mass in the young rat.

1E. Formation of 6 month old wild-type mouse testes. Scale 100 탆

1F. Formation of six month old transgenic rat testes. Scale 100 탆

Notice the progression of germ cell atrophy and abnormal proliferation of radic cells (asterisk).

1g. Formation of testes in 8 - week wild - type mouse sperm tube. Scale 100 탆

1h. Formation of testis in 8 week old transgenic rat seminiferous tubules. Scale 100 탆.

Note the absence of sperm. Scale 100 탆

2a. Northern blotting on GDNF mRNAs in wild-type rats of various ages.

GDNF levels decrease markedly after one week to two weeks after birth.

2b. Northern blotting for testicle retraction of wild-type rats of various ages.

GDNF mRNA levels are markedly reduced after one week to two weeks after birth

2c. Northern blotting on GFRα1 mRNAs of wild-type mice of various ages.

GFR [alpha] l mRNA levels are markedly reduced after one week to two weeks after birth

2d. Northern blotting on GDNF mRNAs of transgenic rat testes of various ages.

The level of hGDNF remains high after one week to two weeks after birth.

2E. Northern blotting on Ret mRNAs of transgenic mouse testes of various ages.

2f. Northern blotting on GFRα1 mRNAs of transgenic rat testes of various ages.

The level of GFRα1 mRNA in transgenic mice is high at all stages of analysis.

2g. Immunoprecipitation of GDNF from 3-week and 6-week wild-type (WT) and transgenic (TG) testes

Show strong reactions. No GDNF protein was found in wild-type testes. Control, 25 ng of recombinant human GDNF protein appears on the right.

3A. Distribution of GDNF Radiation in Testes of Wild Type (WT) Rats by cRNA in Self-Hybridization. Sensory control did not show high density in the background. One-week wild-type testes. Scale 100 탆.

3b. Distribution of GDNF Radiation in 8-week Testes of Wild Type (WT) Rats by cRNA in Self-Hybridization. Sensory control did not show high density in the background. Scale 100 탆.

3c. Genetic modification by cRNA in self-hybridization (TG) GDNF copy in mouse testis

Distribution. Sensory control did not show high density in the background. 8 week wild testes. Note that transgenic mice constantly express high amounts of human GDNF, but the number of these cells is significantly reduced at 8 weeks. Scale 100 탆.

FIG. Distribution of Ret Rad in testis of wild-type (WT) rats by cRNA in self-hybridization

Two-week wild-type testes. At 2 weeks, the expression of Ret appears in some spermatids in the basal layer of the tubules.

3E. Distribution of Ret Rad in testis of wild-type (WT) rats by cRNA in self-hybridization

8 week wild testes. At 8 weeks, Ret is expressed in some sperm cells and sperm.

3f. Genetic modification by cRNA in self-hybridization (TG)

Distribution. 8-week transgenic testes. Note that transgenic mice constantly express high amounts of human GDNF, but the number of these cells is significantly reduced at 8 weeks. In transgenic mice, Ret is expressed in spermatogonial cells. Scale 100 탆.

3g. Distribution of GFR [alpha] l radiation in wild-type (WT) rat testes. 1 to 2 weeks of wild type

small. GFRα1 is expressed by some spermatogonial cells morphologically similar to those of Ret (arrow).

3h. GFR [alpha] l copy in wild-type (WT) rat testis by cRNA in self-hybridization

Distribution. 8 week wild testes. The GFRα1 mRNA distribution follows that of Ret, but is also highly expressed by chimeric cells. Scale 100 탆.

3I. Genetic modification by cRNA in self-hybridization (TG) Distribution of GFRα1 radiation in testes of rats. 8-week transgenic testes. Note that transgenic mice constantly express high amounts of human GDNF, but the number of these cells decreases significantly at 8 weeks. In transgenic mice, GFR [alpha] l is expressed in spermatogonial cells. Scale 100 탆.

4a. Cell proliferation in wild type rat testis. BrdU labeling of S-phase cells only appears in the distal part of the wild type tubule. BrdU labeling of S-phase cells (asterisk) Note the absence of the label at some intersection of the tube showing partial distribution during spermatogenesis.

4b. Cell proliferation in transgenic mouse testes. In the three main transgenic testes, many BrdU-labeled cells appear in bright areas of the tubules showing abnormal distribution of spermatogonial cells. (arrow). The partial distribution of S-phase cells does not appear in the genotypic duct. Scale 100 탆.

4c. Distribution of cell proliferation indices in wild type and genotypic testes. The number of BrdU-labeled cells / 100 sperm cells is calculated as 100 cross-sections of wild-type and genetically modified tubules.

4d. Examination in wild type mouse testis. TUNER-cover for the test of 4 weeks of testimony. Only a few dead cells are found. Scale (c) 100 탆.

4E. Death in genetically modified rat testes. TUNER-cover for the test of 4 weeks of testimony.

Notice the increase in the label of the spermatogonial cell mass in the wild type (Fig. 4d) compared to the sperm tube (Fig. 4e). Scale 100 탆.

4f. A live form that appears in both wild-type (WT) and transgenic (TG) taxis. Live production of the 15-week-old wild-type (WT) and transgenic (TG) mice. Note the reduced diameter of the graft tube and the increase in radial cells (arrows) around the tube. Scale 200 μm.

4g. Live forms in transgenic testes. High magnification of genetically modified tubule-derived cells in the manufacture of unfixed squashes (arrows) representing numerous dead cells (arrows) resembling type A shed cells in sitolytes (arrowheads). Scale 10 μm.

Justice

The term used in the present invention has a general meaning in the fields of biochemistry, pharmacology, recombinant DNA technology including genetically modified animal production, etc., but some terms are somewhat deviated from the usual context or more broadly Is used. Accordingly, in order to avoid ambiguity due to terminology including ambiguous meanings used in the description of the invention and claims, it is defined in more detail below.

The term & quot ; GDNF and family related compounds ", such as GDNF and related compounds, refers to synovial cell-derived neurotrophic factor (GDNF), neutrin, , But have the same effect as compounds similar to GDNF in GDNF-receptors or mutual receptors. The receptor or mutual receptor includes Ret tyrosine kinase and GDNF and receptor alpha: s, respectively.

The term & quot ; colloid cell-derived neurotrophic factor (GDNF) " refers to a neurotrophic factor (GDNF) derived from a germline cell system belonging to the? GDNF maintains dopamine, noradrenergic, cholinergic and motor neurons in the nervous system and also protects the ciliary and sensory neuronal cells of the peripheral parasympathetic nerves (Lin, LF, et al., Science 260 , 1130-1132 and. (Lin, LF, Neural Notes . 2, 3-7, (1996)). during the mammal occurs, GDNF is expressed in other tissues such as the fetal kidney and testis. (Suvanto, P., et al ., European Journal of Neuroscience 8, 816-822, (1996);.. Trupp M. et AL, Journal of Cell Biology 130, 137-148, (1996)) and structural properties, amino acid sequence is Lin, LF, et al., Science 260 , 1130-1132 (1993). The protein is encoded by the gene characterized in the GDNF cDNA sequence deposited with the gene bank accession number L15306.

The term & quot ; factor analogous to GDNF & quot ; or a compound similar to GDNF refers to a causative agent that is similar in structure or functions similar to GDNF in its receptor or recipient. The term " GDNF-like factor " or the term " a compound similar to GDNF " refers, among other things, to Milbrandt, J., et al., Neuron 20 , 1-20 (1998); Kotzbauer PT, et al., Nature 384 , 467- 470 (1996)), which are similar to those of GDNF.

GDNF and all four factors are similar in structure and are similar to the cRet receptor tyrosine kinase (Durbec, P., et al., Nature 381 , 789-793 (1996); Buj-Bello, A., et al., Nature 387 , 721-724 (1997)) serves as a conventional signal transduction receptor for GDNF, neutrin, perseffin, and atemin.

By " a compound acting in a similar manner to GDNF ", it is meant to act similarly to GDNF in a receptor that carries a signal of GDNF or in its recipient receptors.

The term & quot ; receptor & quot ; means a substance or compound that belongs to a substance that binds to GDNF, such as GDNF and related compounds capable of signaling a signal of GDNF and related compounds. Above all, the term & quot ; receptor & quot ;, which refers to GDNF and signal mediator receptors, is the cRet receptor tyrosine kinase.

Terms"Reciprocal receptors"Refers to receptors that activate receptors that carry signals of GDNF and related compounds, rather than signals of GDNF and related compounds. Such compounds are, above all, GDNF and receptor α: s (GFRα), a new water reservoir, a component called GDNF and receptor α: s (GFRα). These also belong to GDNF, neutrin, perceptin, and atemin, which also signal receptor complexes. Currently four components (GFRa 1-4) are known (Jing, S., et al., Cell85, 9-10 (1996), Jing, S. Q., et al., J. Biol. Chem.272, ≪ / RTI > 33111-3311 7 (1997); Treanor, J. J., et al., Nature.382, ≪ / RTI > 80-83, (1996); Suvanto, P., et al., Human Molecular Genetics.6, 1267-1273, (1997)). They deliver signals independently, but are required for ligand binding and cRet activation.

The term " a certain amount of concentration of GDNF and related compounds that inhibits differentiation of spermatocytes, regulates sperm production, inhibits the differentiation of spermatocytes and causes infertility, or prevents men from conceiving a female " Means a concentration of GDNF and related compounds of about 50 to 5000, preferably 50 to 500, and most preferably 50 to 100 times higher than the GDNF concentration. This amount can be calculated from the results obtained by measuring the amount of GDNF mRNA in transgenic mice shown in the Northern blot (FIG. 2), and the mRNA increased from the amount of the expressed protein that can be calculated. From these results, it is concluded that the amount of GDNF in transgenic mice is 50 to 500 times higher than that of 3 to 6 weeks old rats but only when the GDNF level is maintained to the maximum and spermatogenesis does not occur, Can be obtained. From this result it is possible for a person skilled in the art to calculate the amount needed to achieve the intended effect in the male.

The term & quot ; derivative & quot ; means isomers of GDNF and related compounds. It also includes the compound GDNF, neutrin, perceptin, not only the truncated forms but also the hybrid molecules due to the structure of the complex and part of the compound. The only requirement for such a compound is that the above-described compounds determined by the methods described herein have substantially the same properties and effects. The term " derivative " is used in more conventional meaning, for example, for the free radicals in the abovementioned compounds such as carboxy amino or hydroxy groups to be substituted by alkylation, esterification, etherification and amidation with an alkyl group comprising methyl, ethyl, And derivatives of the above-described compounds. The only requirement in this case is that substitutions are made without substantially altering the properties and effects of the molecules or compounds described in this section.

General description of the invention

(GDNF) is an efficacious survival factor for a variety of neuronal cells and regulates renal differentiation (Lin, LF, et al., Science 260 , 1130-1132 (1993); Tomac, A .., et al, Mature 373 , 335-339 (1995);... Winker, C., et al, J. Neurosci 16, 7206-7215 (1996), Oppenheim, RW, et al, Nature 373, 334 -346 (1995), Nguyen, QT , et al, Science 279, 1725-1729 (1998);. Trupp, M., et al, J. Cell Biol 130, 137-148 (1995);.. Hellmich, HL , et al, Mech Dev 54, 95-105 (1996);... Schuchardt, A., et al, Nature 367, 380-383 (1994);.. Pichel, JG, et al, Nature 382, 73- 75 (1996)). (Trupp, M., et al, J. Cell Biol 130, 137-148 (1995) l Hellmich, HL, et al, Mech Dev 54, 95-105 (1996);..... Suvanto, P., et al., European Journal of Neuroscience 8 , 816-822 (1996)). However, its function is unknown.

GDNF, a component distant from the superfamily and the? -transforming factor (TGF-β) (Lin, L. F., et al., Science260, 1130-1132 (1993)) is a potent survival factor for a series of dopamine neurons and a series of neurons in the central and peripheral nervous system. (Lin, L. F., et al., Science260, 1130-1132 (1993)); Tomac. A., et al., Nature373, 335-339 (1995); Winkler, C., et al., J. Neurosci.16, 7206-7215 (1996), Oppenheim, R. W., et al., Nature373, 344-346 (1995), Nguyen, Q. T., et al., Science279, 1725-1729 (1998); Trupp, M., et al., J. Cell Biol.130, 137-148 (1995); Hellmich, H. L., et al., Mech. Dev.54, 95-105 (1996); Schuchardt, A., et al., Nature367, 380-383 (1994); Pichel, J. G., et al., Mature382, 73-75 (1996)). GDNF also acts as a signaling molecule in ureteric branching during kidney morphogenesis. (Schuchardt, A., et al., Nature367, 380-383 (1994); Pichel, J. G., et al., Nature382, 73-75 (1996)). GDNF is synthesized in a number of neurons and nonneuronal endogenous organs, including prenatal and postnatal testes. (Trupp, M., et al., J. Cell Biol.130, 137-148 (1995); Hellmich, H. L., et al., Mech. Dev.54, 95-105 (1996); Suvanto P., et al., European Journal of Neuroscience8, 816-822 (1996)). Signaling receptors for GDNF complexes have been described by Ret. Receptor tyrosine kinase (Durbec, P., et al., Nature381, 789-793 (1996); Trupp, M., et al., Nature381, 785-789 (1996)) and many glyphosylphosphatidylinositol-binding reciprocal receptors, GDNF and receptor α: s (GFRα1-4). (Jing, S., et al., Cell85, 9-10 (1996); Jing, S. Q., et al., J. Biol. Chem.272, ≪ / RTI > 33111-3311 7 (1997); Enokido, Y., et al., Curr. Biol.18, ≪ / RTI > 1019-1022 (1998)). Rats without GDNF-, GFRα1, Ret exhibit severe defects in the nerve distribution of highly similar phenotypic tumors in non-existing or forming disorder kidneys. (Schuchardt, A., et al., Nature367, 380-383 (1994); Pichel, J. G., et al., Nature382, 73-75 (1996)). On the first day of life, they died and sperm production could not be analyzed in this mutant mouse.

To address the role of GDNF in sperm production, the present inventors have studied transgenic mice for overexpression of GDNF in testis cells. Transgenic males were infertile and showed early inhibition of differentiation of spermatogonial and type A spermatogonial cells. They eventually formed a lump in the cleaning chamber that caused the decline of the testicles. The obtained data showed a new function of GDNF as a paracrine inhibitory signal during the initial sperm production.

In wild-type mice, GDNF is believed to regulate spermatocyte centralization, which gradually causes spermatogenesis. This infertile transgenic mouse is suitable for male infertility models due to deficiency of sperm production. Activation of the GDNF signaling cascade provides a way to develop male contraception. When a molecule similar to GDNF is used in clinical trials for neurodegenerative diseases such as Parkinson's disease, the effect of GDNF on sperm production should also be considered.

A novel function of GDNF was discovered by studying transgenic mice overexpressing human GDNF under a 1-human transcription factor (EF-1) promoter for the purpose of expressing species-specific transgenes in testicular germ cells. (Mizushima, S. & Nagata, S., Nucleic Acids Res. 18 , 5322 (1990); Furuchi, T., et al., Development 122 , 1703-1709 (1996)). Inhibition of spermatogenesis in transgenic testis for overexpression of GDNF suggested that GDNF acts as a specific inhibitory signal in spermatogonial differentiation. The gradual decline of sperm cells and the abnormal proliferation of the lymphocytes in transgenic mice necessarily follow the deficiency of spermatogenesis, since the cytolytic cells remove abnormal germ cells that are less differentiated and interfere with the interaction between cell morphology . Thus, GDNF targeting testis provides a new animal model for male infertility. Activation of the GDNF signaling cascade by GDNF, Ret agonists or downstream substances provides a way to inhibit male sperm production and to develop male contraception. When GDNF-like molecules are used in clinical trials for neurodegenerative diseases such as Parkinson's disease, the effect of GDNF on sperm production should be considered.

In order to study the function of GDNF in testes, the inventors have developed transgenic mice that overexpress human GDNF under the 1-human transcription factor (EF-1) promoter for the purpose of expressing species-specific transgenes in testicular germ cells We found new functions of GDNF. (Mizushima, S. & Nagata, S., Nucleic Acids Res. 18 , 5322 (1990); Furuchi, T., et al., Development 122 , 1703-1709 (1996)). Other coenzymes may be used for the purpose of expressing the gene-specific genetic modification in the germ cells of the gene testis.

Four independent genetically modified female founders, C10 and C12, and two female S6 and E19, each with genotypic copy number 10, 3, 20 and 4, are analyzed. Further C10 and C12 males are infertile, and further analysis of male phenotypes is performed by the offspring of the two female males S6 and E19. Transgenic mice usually grow into adults and exhibit the same phenotype. Body weight is normal, and there are no defects in the weight or shape of a real organ (data not shown) except for testes. Testosterone weight loss is observed in the transgenic mice compared to wild type rat control after 4 weeks. (Table 1). Among the offspring of the female phalaenopsis S6 and E19, all of the transgenic males were infertile. During 6 months of continuous breeding, three transgenic males and wild-type FVB and NMRI females are placed in 3-4 day intervals. As shown in the pre-vaginal morphology, wild-type females crossed a standard frequency with transgenic males, but none were pregnant. Twenty of the transgenic male transgenic mice will follow wild-type FVB and NMRI females in a short-term reproductive test. During the two-week sustained breeding, she crossed with 200 females of both species, but was not pregnant. Genetic dependence of the infertile phenotype was excluded by cross-breeding transgenic FVB rats under NMRI. As with the transgenic males of the FVB genus, males of the F1 generation also become infertile.

The testis tissues of one - week - old transgenic mice were found to be normal. The mice showed morphologically similar cell masses with partially separated type A spermatogonial cells in basal membranes of the tubules (Fig. 1a, 1b). These cells undergo gradual degeneration over the next few weeks, while the ten week old tubules have already shown progression of celery's cells and only the sperm cell degeneration. (Fig. 1C-1F) Laryngeal cells, testis gland cells show gradual abnormal proliferation from 4 weeks of age. (Figs. 1D and 1F). Sometimes germ cells outside the lump of spermatocytes were mature spermatozoa that developed further into spermatids and almost did not become spermatids, but were suppressed after meiosis and degenerated. Although occlusion was not found in the microtubules carrying the spermatozoa from the testes to the testes, mature sperm were not observed in the tubules or seminiferous tubules. (Fig. 1g, 1h).

Neutrin (NTN) is a GDNF-related molecule that uses the same multi-component receptor complex as GDNF, but adopts GFRα2 as a homologous reciprocal receptor rather than GFRα1 (Klein, RD, et al., Nature 387 , 717-721 )). Both MTN and GFRα2 radiation are expressed by postnatal testis (Widenfalk, J., et al., J. Neurosci. 17, 8506-8519) 1997). Fermentin (Milbrabdt, J. et al., Neuron 20 , 1-20 (1998)), the third element with GDNF, binds to chicken GFRα4, a homologue not found in homologues to date. (Enokido, Y., et al., Curr. Biol., 18 , 1019-1022 (1998))

Northern blot, a specific method of human GDNF mRNA, shows that gene modification is expressed only in testes, not in other organs of both sexes, such as the ovaries, penis, brain, liver, kidneys, lungs and skin (data not shown). In contrast to a decrease in the amount of GDNF mRNA in wild-type mice, the expression of transgenic GDNF mRNA remains high in testes from newborn to adult. (Fig. 2d). Ret and GFRα1 mRNA are also high in all ages. (Figs. 2e and 2f). GDNF protein levels were significantly increased in transgenic testes compared to wild-type testes in immuno-precipitation reactions of wild-type and transgenic testes at 3 to 6 weeks. (Fig. 2g)

Previously, endogenous Sertoli cells and the cytolytic system were shown to express GDNF. (Hellmich, HL, et al., Mech. Dev. 54 , 95-105 (1996); Trupp, M., et al., J. Cell Biology 130 , 138-148, (1995)). By self-internalization, GDNF mRNA can be detected in wild-type tubules for one week after birth, but not thereafter (Fig. 3a, 3b) and GDNF mRNA labeling is distributed to sitolytes. The transgenic testis shows a consistently high expression of human GDNF mRNA by the A type spermatogonial mass from 2 weeks to adult. (Figure 3c). Ret mRNA was expressed in spermatogonial cells and spermatogonial cells of wild-type testes (Fig. 3d, 3e) and in spermatogonial masses of transgenic testis (Fig. 3f). GFR [alpha] l mRNA is markedly expressed by spermatogonial cells, spermatocytes, round sperm cells of wild-type testes (Fig. 3g, 3h) and by spermatogonial cells in transgenic testes (Fig. 3i). Therefore, signaling receptive complexes for GDNF are present in spermatogonial cells of both wild-type and transgenic mice. In wild-type mice, GDNF apparently acts as a spermatogenic paracrine cell lytic-cell-mediated regulator, but in regulated mice this regulation is inhibited by sustained autocrine expression of GDNF by germ cells.

Spermatocytes are the only germ cells that proliferate in testes and mitosis occurs in the normal tubules (Fig. 4A). In genetically modified rats, BrdU-labeled spermatids showed an abnormal distribution in the cleansing tube reflecting the spermatogonial mass in the tubules of the tubules (Fig. 4B). Because of the highly fragmented nature of cell proliferation in wild-type testes, it is difficult to compare net breeding rates of wild-type and transgenic testes. However, the cell proliferation index peaks of spermatogenesis (BrdU-labeled nuclei / 100 spermatids) are clearly lower in transgenic mice than in wild-type mice: 0.26 +/- 0.11 (n = 714) and 0.72 +/- 0.14 = 436, cells calculated from proliferation of tubules) (Fig. 4c)

As shown in the TUNEL-label, apoptosis is prominent in other germ cells that are only differentiated from spermatogonial cells at 2 weeks of age (Figs. 4d and 4e). Numerous apoptotic cells similar to type A spermatogonial cells are submerged by Sertoli cells, (Fig. 4f, 4g). Thus, increased risk of overproduction of cell proliferation can explain the gradual loss of testes in GDNF-overexpressed rats. On the other hand, the accumulation of spermatozoa produced in young rats resulted from their inhibition of differentiation and did not appear to promote cell proliferation.

Three male males overexpressing GDNF were observed for 5 months and observed during the period when both testicular tumors and invasive cancer cells were not visually observed. Furthermore, in any autopsy of young male rats (n = 103), testicular malignant tumors, which demonstrate that deficiency of spermatogonial differentiation in GDNF and expression mice ultimately causes malignant tumors of the reproductive system, Was not found. However, to rule out the increased risk of colon cancer, more mice should be observed over a longer period.

Male rats or rats are infertile due to a deficiency of vitamin A metabolite, retinic acid (RA), which results from feeding with a vitamin A deficiency (VAD) diet. Differentiation of type A spermatogonial cells is completely inhibited by the VAD diet and restored by the reintroduction of vitamin A or its active metabolites. (Kim, KH, et al., Molec. Endocrinology 4: 1679-1688, 1990). The amount of retinoic acid receptor α (RARα) mRNA and protein is reduced to the VAD diet. (Akmal, K., et al., Endocrinology 139 , 1239-1248, 1998). Thus, RARα deficient transgenic mice become infertile and cause testis degeneration. (Lufkin, T., et al., Devel, Biiol 90 , 7225-7229, 1993). Therefore, RAR protein expression was analyzed in wild-type and GDNF-overexpressing transgenic mice. RAR expression partially disappeared from the germinal cell mass of the transgenic mouse, as evidenced by the indirect immunoperoxidase that would contaminate the antibody of the RAR protein. The data show that one of the mechanisms by which GDNF acts as an inhibitory regulator of spermatids is the downregulation of RAR expression in Ret expressing sperm cells.

To investigate whether other elements of GDNF would act as inhibitory regulators of sperm production, the researchers set up transgenic mice that overexpress neutrin in testes. In fact, transgenic mice overexpressing neutrins under a radioligand 1 alpha coenzyme intended for species-specific gene expression only in testes, as described in the same cross-breeding experiment involving GDNF-overexpressing rats, Indicates infertility.

Sperm differentiation of mammals can be separated into three different stages that are regulated by local cellular interactions and hormonal regulation. (Russell, L. D., et al., Histological and histopathological evaluation of the testes, Clearwater, F. L., Cache River, pp. 1-40 (1990)). The first step in sperm production is a mitotic phase in which spermatogonial cells produce chimeric cells. After sperm cell steps, sperm production proceeds without cleavage of mitotic cells. The spermatogonial cell is again classified as a subtype, where type A spermatogonial cell subtype includes spermatogenic hepatocytes. The second stage is the mitotic phase of the spermatogonial cells that produce half of the sperm cells. The third step is the spermatogenesis stage, where the sperm cells are transformed into spermatozoa and spermatocytes, which are structurally suitable for accessing and modifying the oocyte. During mitosis, type A spermatogonial cells proliferate and induce differentiation. However, some of them remain undifferentiated and are regarded as the reservoir of hepatocytes. (Russell, L. D., et al., Histological and histopathological evaluation of the testes, Clearwater, F. L., Cache River, pp. 1-40 (1990)). The precise mechanism by which hepatocytes are maintained or transformed into differentiated spermatogonial cells has not been elucidated yet. Northern blotting indicates that the downregulation of GDNF is consistent with the initial amount of sperm differentiation in normal rats and that GDNF overexpression inhibits spermatogonial differentiation. Therefore, local GDNF signaling may be required for spermatids to maintain their undifferentiated stage.

There is evidence that each step in the spermatozoa requires paracrine interactions between the cytolytic cells of the body wall and the hepatocytes, and these interactions may be thought of as developmental factors and their receptors. (Bellve AR & Zhang, WJ, Reprod Fertil 85, 771-793 (1989);.. Skinner, MK, Endocr Rev. 12, 45-72 (1991);... Pescovitz, OH, et al, Trends Endocrinol Metab . 5, 126-131 (1994). Parvinen, M., et al., Cell. Biol. 117, 629-41 (1992), Djakiew, D., et al., Biol. Reprod. 5 1, 214- 21 (1994), Cancilla, B. & Risbriger, GP, Biol Reprod 58, 1138-45 (1998);.. Bitgood, MJ, et al, Curr Biol 6, 298-304 (1996);... Zhao, GQ et al., Genes Dev 10 , 1657-1669 (1996); Zhao, GQ, et al., Development 125 , 1103-1112 (1998)). However, direct data on intracellular interactions between testicular wall cells and germ cells are still lacking. The interactions between the cytolytic cells and the reproductive cells are mediated by a number of factors, including hepatocellular factor (c-kit ligand), insulin such as I -generating factor, three TGF-βs (Mullerian inhibitors, activators, inhibitors) , et al., Trends Endocrinol. Metab. 5 , 126-131 (1994)). Sertoli cells secrete all these substances, and germ cells contain their receptors. Conversely, Sertoli cells express p75 neurogenic factor receptors and fibroblastogenic factor receptors, for example, where homologous ligands are secreted from testicular germ cells. (Pescovitz, OH, et al., Trends Endocrinol. Metab. 5 , 126-131 (1994); Parvinen, M., et al., J. Cell Biol., 117 , 629-41 (1992); , et al., Biol. Reprod., 51 , 214-21 (1994)). Furthermore, the cytolytic cells also interact with radic cells. The Deshit Hedgehog (Dhh) gene is expressed by Sertoli cells and its as yet unknown receptor, and is significantly patched by radic cells. (Bitgood, MJ, et al., Curr. Biol. 6 , 298-304 (1996)). In fact, mice without Dhh represent defects in severe differentiation of sperm production. (Bitgood, MJ, et al., Curr. Biol. 6 , 298-304 (1996)). Recently, bone connective tissue proteins 8a and 8b, along with their yet unknown receptors, have been found in germ cells and the activity of these ligands has resulted in abnormal sperm production and male sterility. (Zhao, GQ, et al, Genes Dev 10, 1657-1669 (1996);... Zhao, GQ, et al, Development 125, 1103-1112 (1998)). The interaction of these receptors with these factors in the germ cells implies autocrine regulation of germ cells.

The data demonstrates the new functionality of GDNF. Inhibition of testis production in transgenic testis for overexpression of GDNF suggests that GDNF acts as a local inhibitory signal in spermatogenic differentiation. The abnormal proliferation of the athrophy and radic cells of the progressive testis in transgenic mice is clearly responsible for sperm production defects. Therefore, GDNF for testicle purposes provides a new animal model for male infertility. Activation of the GDNF signaling cascade by GDNF, RET agonists or downstream agents provides us with a way to inhibit male sperm production and to develop male contraception. When GDNF-like molecules are used in clinical trials of neurodegenerative diseases such as Parkinson's disease, the effect of GDNF on sperm production should be considered.

The present invention is further illustrated in the materials and methods used in the production of transgenic mice and in the following experimental part which demonstrates the experiments used to demonstrate the effect of GDNF in animal models. The experimental part will not limit the scope of the invention. Those skilled in the art will be able to predict many different applications based on results obtained in the following experimental part.

Way

Genetically modified GDNF construct and production of transgenic mice.

Human GDNF cDNA is cloned into the pEF-BOS carrier containing the EF1 alpha -cocatalyst by replacing the XbaI-XbaI stuffer fragment with the full coding sequence of human GDNF cDNA (GenBank accession number L15306). (Migushima, S. and Nagata, S., Nucleic Acid Res.18, 5322 (1990)) The accuracy of the expression construct is confirmed by the sequence. Modified GDNF GDNF protein is identified by Cos cell transfection, which causes immune precipitation of GDNF from the lysate and culture supernatant. A 2.7 kb PvuI-HindIII fragment of the GDNF cDNA structure is microinjected into the egg nucleus of the newly modified FVB-subfamily rat to produce transgenic mice. (1994)). Human GDNF cDNA and DNA end-PCR were followed by Southern blotting with genetically-modified progeny offspring (Hogan, B., et al., Manipulating the Mouse Embryo. Check the balloon. The primers for human GDNF are from exon 1 (5'-TGT CGT GGC TGT CTG CCT GGT GC-3 ') and exon 2 (5'-AAG GCG ATG GGT CTG CAA CAT GCC-3`).

Histology, cell proliferation and apoptosis.

In the tissues, immediately incised testes and adrenal glands are fixed in Bouins fixative or 4% PFA for 2 to 24 hours depending on size, treated with paraffin, cut into 7 탆 and stained with hematocylin / eosin . For cell proliferation validation, intraperitoneal injection of BrdU and 5-fluoro-2-deoxyuridine (FrdU) cocktail (Amersham) at a concentration of 10 mg / kg in PBS is intraperitoneally injected into the mice. After 2 hours, it is killed with a neck dislocation, dissected, removed testes, and fixed to the solution. The testis is treated with paraffin, cut to 7 μm and paraffin removed. The BrdU mixture was incubated with anti-bromodioxyuridine (Amersham) and rhodamine conjugated goat anti-mouse

(anti-mouse) IPG (Jackson) monoclonal antibody using indirect immunofluorescence. The dead cells are detected on the paraffin-removed portion of the apoptosis detection kit (Oncor) according to the production method.

Live cell. Sections were incised and squashed using a PBS buffer. Parvinen M., et al. (Histochem. &Amp; Biol. 108 , 77-81 (1997)).

Northern blotting. The total RNA of different tissues is separated into TRIZOL assay kit (biotechnology) according to the manufacturing method and 30 g of total RNA is used in each lane. Northern blotting is performed according to the Maniatis protocol. (Sambrook, J., et al., T. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989 pp. 7.43-7.50). The cDNA locus (identical to the self-hybridization described above) is labeled with [ ^32p ] dCTP. The filter is exposed to the FujiBAS Phosphor Major.

Immunoprecipitation involving anti-GDNF antibodies and Western blotting.

The immediately incised testes were homogenized and homogenized in a high salt lysis buffer (300 mg protein / ml; high salt lysis buffer: 1 M NaCl, 100 mM Tris HCl, pH 8, 2% BSA, 4 mM EDTA, 0.2% Triton X-100, 2 mM PMSF, 10 ml of complete overnight EDTA, Boehringer Mannheim) and 1 tabl. / Protease inhibition cocktail tablet. The filtrate is immunoprecipitated with a polyclonal antibody against human GDNF peptide (R & D system) and human recombinant GDNF peptide cross-reacting with protein A-sepharose. Immunoprecipitation is carried out with 20% SDS-PAGE and transferred to a Hybond ECL nitrocellulose membrane. (Amersham Life Science). Membranes are blocked with 5% bovine serum albumin and immunoprecipitated GDNF is analyzed with polyclonal anti-GDNF antibody for 2 hours at room temperature. (Santa Cruz Biotechnology). Analysis is carried out using an anti-rabbit secondary antibody and ECL chemiluminescence (Amersham) conjugated to peroxides of horseradish according to the manufacturing method.

Self-hybridization. Self-hybridization is performed as described above. (Wilkinsen, D. & Green, P., In situ hybrization and the three-dimensional reconstruction of serial sections, In: Postimplantation Mammalian Embryos, A practical approach (Ed A. Copp and D. Cockroft), pp. 155-171 Antisense and sense cRNA genes (328 bp in exon 3, 328 bp in human GDNF, 325 bp in exon 1 and exon 2, mouse Ret in mouse 3 and 714 bp in exon 1, 777 bp in mouse GFRα1) Synthesize using appropriate RNA polymerase and ³⁵ S-labeled UTP. The hybridization temperature is 52 ° C, and the self-emissive slides are exposed to +4 C for 2 to 4 weeks. The slides are taken with a CCR camera connected to the computer. In a Photoshop graphics program, reverse the dark field image, dye it in red, and combine it with the bright field image.

Example 1.

Production of transgenic mice

Testis Radiation Extension Factor 1 Study the function of GDNF in testis for the purpose of GDNF expression under alpha-coenzyme. The entire coding region of human GDNF (hGDNF) cDNA is Human GDNF cDNA is cloned into the pEF-BOS carrier by replacing the XbaI-XbaI stuffer fragment with the entire coding sequence of human GDNF cDNA. (Migushima, S. & Nagata, S., Nucleic Acid Res.18, 5322 (1990)) A 2.7 kb PvuI-HindIII-EcoRI fragment is isolated in a pEF-BOS carrier containing a 0.7 kb Xba-EcoRI fragment containing EF1α (Radiation Extension Factor 1α) coenzyme and a ply (A) adenylation signal . Genetically modified mice are produced by microinjection into the egg nucleus of a newly modified FVB subcultured mouse. Initially injected into the FVB / NIH-rat genetic tract, and then transgenic mice are crossed with the FVB / NIH- and NMRI-mouse strains. Genetically modified finnus mice are confirmed by subsequent blotting with hGDNF-reporters, and progeny of transgenic mice are identified by polymerase chain reaction (PCR) of the DNA ends. The primers used in PCR are derived from exon 1 (5'-TGT CGT GGC TGT CTG CCT GGT GC-3`) and exon 2 (5'-AAG GCG ATG GGT CTG CAA CAT GCC-3`) . GDNF t-rats carry the coding region of human GDNF cDNA and carry it in their offspring.

Example 2

Expression of transgenes is studied by Northern blot hybridization and RT-PCR.

The expression of transgenic mice was analyzed by Northern blot hybridization of different age (0-13 weeks) analysis of GDNF mRNA levels of different age tolerance and genetically modified 3-week-old mice that compared the endogenous GDNF mRNA with the human transgenic GDNF mRNA We study reverse transcription polymerase chain reaction (RT-PCR) from mouse testis RNA. Reverse transcription PCR 1 ug total RNA is transcribed into reverse transcripts in any initial reaction (20 ul) using AMV reverse transcriptase (Finnzymes, Helsinki) according to the preparation method. When copying my mouse GDNF cDNA or transgenic human GDNF cDNA, 2ul of the reagent is used as template.

The first primer (5'GCTGAG / CCAGTGACTCA / CAATATGCC3`) recognizes alleles of both mouse and human GDNF and envelops intervening sequences to prevent gene mixing. Other peripheral primers selectively respond to endogenous and transgenic GDNF (GDNF specific region in mouse: 5 'TGTTAGCCTTCTACTCCGAGACAG3') and transgenic primers. These primers were prepared from the reverse transcribed endogenous and transgenic GDNF cDNAs from one of the normal mouse and transgenic murine testis in the same conditions (1 uM primer, 1 mM, dNTP and dynasem Polymerize (Finnzymes, Helsinki) Lt; RTI ID = 0.0 > 373 bp < / RTI > The period is 30s 95., 30s 62. ja 45s 72. and is updated 20-36 times after "start heating" at 95. for 2 minutes. The copy is terminated after the last cycle for 5 minutes at 72.C. PCR products prepared on agarose gels containing ethidium bromide are studied by UV radiation and photographed with a Polaroid camera. Northern blot hybridization to confirm the expression of transgenic hGDNF and mouse GDNF mRNA was carried out using the TRSP-specific reagent [- ³² p] - labeled GDNF cDNA According to the manufacturing method. (Lin et al., Science 260 , 1130-1132, (1993)) and human GDNF (536 bp exon 1 ja 2, (NCB1 Gene Bank, accession number U37459) The Northern blot hybridization was carried out by Sambrook, J., et al (Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989, pp. 7.43-7.50) The Fujian phosphophore is placed on the major plate, exposed to light overnight, and the image recorded by the FugiBAS Phosphoimage. The actin-reporter is used as a regulator to regulate the transport of the RNA hybridized in each filter after hybridization of the GDNF reporter. The results show an obvious expression of GDNF mRNA in the testes of the born rats (Figure 2a), especially when the mice become estrus, the expression weakens after the first week of life and is rarely analyzed in adult rats. 3-week GDNF t- ) In the testis Northern blotting suggests that electron-modified human GDNF mRNA is 50-500 fold of endogenous GDNF mRNA (Fig. 2a)

Example 3

The location of testis GDNF by Northern blotting and self-hybridization

Testis GDNF-gene expression is not present elsewhere in males except for testes that have studied northern blot hybridization from different tissues of females and males, since they are subject to the extension factor 1 alpha coenzyme. (Furuchi, T., et al., Development122, ≪ / RTI > 1703-1709 (1996)). cRNA was obtained from Wilkinsen, D. & Green, P., in situ hybridization and the three-dimensional reconstruction of serial sections (In: Postimplantation Mammalian Embryos, A Practical Approach, ed. &Amp; D. Cockroft, pp. 155-171, Oxford University Press: London (1990). The posters are as follows: rat GDNF-reporter (328 bp), human GDNF-reporter (536 bp), GFRα1-reporter (777 bp) and GFRα2-reporter (approximately 500 bp). In self-hybridization, the temperature of all porcine is 52 ° C and the exposure time is 1.4 to 4 weeks at + 4.C. Proceed at least three different exposures from each poster.

Results from both northern blot hybridization and self-hybridization cRNA show that the human GDNF-gene self-hybridization signal hybridizes to RNA from testis located in spermatogonial cells and some early amygdaloid cells. (Fig. 3)

In both genetically modified GDNF t-rats and normal rats, rat GDNF receptor Ret is expressed in spermatogonial spermatids of adult mice and adult rat spermatogonial gonads, but during spermatogenesis in gonadal spermatozoa, the spermatozoa of GFRα1 and GFRα2 . (Fig. 3)

Example 4

Morphology of Expression Induced by Tissue

The morphological consequences of GDNF expression in the gene transfection originate from histological studies of testis. Normal and transgenic tissues are fixed with 4% paraformaldehyde, treated with paraffin, cut into 4 to 7 mu m sites, paraffin removed and stained with hematoxylinosine-dye.

In a tissue study of 1 to 4 weeks of testis, a surge in spermatocyte volume is found in the GDNF t-mouse strain male, and the rapidity is related to the fact that spermatids and spermatozoa can not be maintained differentiating. Based on their tissue structure, it can be confirmed that the cell mass formed in the cleansing tube is a type A spermatogonial cell. After 4 weeks, the number of spermatogonial cells in the cleansing tube decreases and almost no spermatogonial cells remain after 11 weeks. Adult free sperm were not formed at any stage, and sperm cells could not be found in the seminiferous tubules.

Example 5

Proof of GDNF function resulting in infertility

Because the GDNF can inhibit the formation of spermatogonia, the fertility of male GDNF t-rats strains was studied by crossing with female rats aged 8 weeks or more with reproductive ability. Twenty males (between six weeks old) stay with females for two weeks. They were calculated to have mated with 200 females. In addition, the females changed from 3 to 4 days apart and the three males (eight-week old) stayed with the females for half a year. They were crossed at the same frequency as normal rats. After crossing with some female female uterus and egg leader, we searched for chiotropic cells.

The results showed that genetically modified males from the GDNF t-rat genetic tract did not conceive any females mated with modified males and that no spermatocytes were found in their uterine and ovarian leaders. All males genetically modified from the GDNF t-rat genetic were infertile and unable to reproduce.

The results are discussed in the following detailed drawings.

Fig. (Right panel: b, d, f) Rat testis form and 8 major wild type (g) and genetically modified (h) testis pouches of different ages of wild type (left panel: a, c, e) (a and b) Three weeks. (c and d) 8 weeks. (e and f) 6 months. Notice the progression (f) of the remnant (d) of the many A-type sperm cell masses in young rats and the atrophy of germ cells and abnormal proliferation of radic cells (asterisk). The testis tubes of wild type (g) and transgenic (h) rats represent the absence of sperm in transgenic mice. Scale 100 탆

Fig.Of various ages Northern blotting for GDNF (a, d), Ret (b, e) and GFRα1 (c, f) mRNA in wild type (left panel) and transgenic testes (right panel). Rat GDNF cDNA and human GDNF cDNA were used in a and d, respectively. The amount of GDNF (a), Ret (b), and GDNF (c) mRNA is significantly lowered after 1 or 2 weeks after birth. In contrast to the endogenous GDNF mRNA, which is reduced in wild-type mice, the amount of human GDNF mRNA transgenic (d) remains high up to adult. In addition, Ret (e) and GFRα1 (f) mRNA levels are high in transgenic mice at all stages analyzed. (g) Immunoprecipitation of GDNF in 3 and 5, 6-week-old wild-type (WT) and transgenic (TG) testes. GDNF protein in wild-type testis is not detected. On the right, 25 ng of recombinant human GDNF protein as a control.

Figure 3. GDNF (a, b, c), Ret (d, e, f) and GFRα1 in testis of wild-type (WT, left and middle panels) and transgenic mice (TG, right panel) (g, h, I) Distribution of transcripts. (a, b) mouse GDNF cDNA template and (c) human GDNF cDNA template. All other newsers are used for the warrior of mice. Sensory control did not show low density at the upper part of the background. (a, d, g) 1 to 2 weeks of wild-type testes. (b, e, h) 8-week wild-type testes. (c, f, I) 8 main transgenic testes. Although spermatogonial cells in transgenic mice do not consistently express high amounts of human GDNF, the number of these cells is obviously reduced at 8 weeks. (d) At 2 weeks, Ret expression is located in some spermatids in the basal layer of the tubules (arrows). (g) GFR [alpha] l is also expressed in some garden cells morphologically similar to those containing Ret. (arrow). (e) At 8 weeks, Ret is expressed in some spermatogenic spermatogonial cells and sperm. (h) GFRα1 mRNA distribution follows Ret, but is also high in chimeric cells. In transgenic mice, both Ret (f) and GFRα1 (i) are expressed in spermatogonial cells. Scale 100 ㎛

Figure 4. The cell proliferation (a, b, c), death (d, e), and live form (f, g) Describe both wild type and transgenic tubules. (a) At the 3-week testimony, note that the BrdU label of the S-stage cells does not show the presence of markers in some intersections of the tube showing a split distribution during spermatogenesis. (b) In the 3-week transgenic testes, many labeled BrdU cells are found in bright areas of the ducts, indicating an abnormal distribution of spermatogonial cells (arrows). The partial distribution of S-phase cells does not appear in the genotypic duct. 4c. Distribution index of cell proliferation in wild type and genotypic testis. The number of BrdU-labeled cells / 100 sperm cells is calculated as 100 cross-sections of wild-type and genetically modified tubules. The normal distribution of BrdU-labeled cells is rapidly increased in transgenic testes. (d and e) TUNER-cover for 4 weeks testosterone test. Notice the increase in the label in the sperm cell mass (arrow). (d) Compared to the wild type, (e). (f) Production of live tubules from 15-week-old wild-type (WT) and transgenic (TG) mice. Note the reduced diameter of the graft tube and the increase in radial cells (arrows) around the tube. (g) High expansion of viable cells from genotypic tubules in the production of unfixed scars showing numerous dead cells (arrows) resembling type A shed cells in sitolytes (arrowheads). (A-d) 100 μm, (e) 200 μm, and (f) 10 μm.

table. One

Weights of wild-type and transgenic mice of various ages (mean ± standard deviation)

n = the positive number of each group

____________________________________________________________

Age-wild type transgenic

(Mg) n (mg) n

____________________________________________________________

1 5.5 ± 2.6 20 4.8 ± 2.5 20

2 27.8 ± 6.0 20 22.7 ± 12 20

3 50.2 ± 6.5 20 58.7 ± 8.6 20

4 68.8 8.0 10 40.3 10.0 10

5 79.9 ± 7.3 10 30.5 ± 9.3 10

8 < / RTI > 102.2 + 4.6 10 34.7 8.0 8.0

13 100.9 ± 6.0 10 38.3 ± 8.3 6

24 90.0 ± 4.6 10 43.2 ± 8.9 6

___________________________________________________________

Claims (11)

GDNF and related compounds are compounds or derivatives that act similar to GDNF in receptors that carry signals of factors similar to synovial cell derived neurotrophic factor (GDNF), GDNF, as well as derivatives, derivatives of GDNF and GDNF, (GDNF), which is characterized in that the compound or mutual receptor modulates and studies sperm production, inhibits cell differentiation, develops male contraceptive, and is used for male contraceptive pills. Use of related compounds. . The method of claim 1, wherein the GDNF and related compound or derivative thereof is selected from the group consisting of GDNF, peresin, neutrin, or a compound similar to artemin, a compound similar to GDNF, or a compound that behaves similarly to a compound associated with GDNF, Use of. The use of GDNF and related compounds according to claim 1, wherein GDNF and related compounds are characterized as GDNF and its derivatives. The use of GDNF and related compounds according to claim 1, wherein GDNF and related compounds are characterized as peresin and its derivatives. The use of GDNF and related compounds according to claim 1, wherein GDNF and related compounds are characterized as neurotrans and its derivatives. The use of GDNF and related compounds according to claim 1, wherein GDNF and related compounds are characterized as artemin and its derivatives. The use of GDNF and related compounds according to claim 1, wherein the receptor carrying a signal of GDNF and a related compound is characterized by a cRet receptor tyrosine kinase. 2. The use of GDNF and related compounds according to claim 1, wherein the mutual receptor which activates a signal-carrying receptor or carries a signal of GDNF and a related compound is characterized by GDNF and receptor α: s (GFRα). The method according to claim 1, which inhibits the differentiation of chimeric cells comprising a compound similar to GDNF, GDNF and a compound related to GDNF and a certain amount of a compound similarly acting in a receptor or mutual receptor, The use of GDNF and related compounds as man's manufacturing compositions, characterized by a composition that modulates production and causes infertility. The method according to claim 1, wherein the male contraceptive is characterized by a composition comprising GDNF, a compound similar to GDNF or a compound associated with GDNF, which inhibits the female from becoming pregnant, and a quantity of a compound that similarly acts in a receptor or a recipient receptor Use of GDNF and related compounds for the active manufacturing composition. 11. A composition according to claim 10 wherein the concentration of said compound in a male is from 50 to 5000, preferably from 50 to 500, more preferably from 50 to 100 times the concentration of endogenous GDNF in male testes, a compound analogous to GDNF or GDNF The use of GDNF and related compounds for a male contraceptive active composition characterized by a composition comprising an amount of a compound that acts similarly in a receptor or a recipient receptor.