KR20010063153A - Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety - Google Patents

Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety Download PDF

Info

Publication number
KR20010063153A
KR20010063153A KR1019990060032A KR19990060032A KR20010063153A KR 20010063153 A KR20010063153 A KR 20010063153A KR 1019990060032 A KR1019990060032 A KR 1019990060032A KR 19990060032 A KR19990060032 A KR 19990060032A KR 20010063153 A KR20010063153 A KR 20010063153A
Authority
KR
South Korea
Prior art keywords
odn
sequence
cpg
cells
oligonucleotide
Prior art date
Application number
KR1019990060032A
Other languages
Korean (ko)
Other versions
KR100359753B1 (en
Inventor
성영철
이승우
송만기
백관혁
Original Assignee
서유석
주식회사 제넥신
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서유석, 주식회사 제넥신 filed Critical 서유석
Priority to KR1019990060032A priority Critical patent/KR100359753B1/en
Publication of KR20010063153A publication Critical patent/KR20010063153A/en
Application granted granted Critical
Publication of KR100359753B1 publication Critical patent/KR100359753B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

PURPOSE: Provided is a CpG oligodeoxynucleotide variant which binds to dG repetitive sequence and has improved immune regulating activity and stability. This oligodeoxynucleotide variants does not express toxicity in a living body, and is thus useful to vaccine adjuvant for the prevention and treatment of infectious disease such as AIDS, hepatitis C type and chronic hepatitis. CONSTITUTION: CpG oligodeoxynucleotide variant having improved immune regulating activity is prepared by binding deoxyriboguanosine(dG) repeat sequence to 3'end of CpG oligodeoxynucleotide. The CpG ODN variant improves bindability to an immunocyte having scavenger receptor to maximize the immunity of helper T-cell type 1 and is thus useful as a vaccine adjuvant.

Description

면역조절능력 및 안전성이 증가되고 dG 연속서열이 결합된 포스포다이에스터 CpG 올리고데옥시뉴클레오티드 변형체{Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety}Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety}

본 발명은 면역조절능력이 증가된 CpG 올리고데옥시뉴클레오티드 변형체에 관한 것으로, 보다 상세하게는 면역조절능력을 갖는 CpG 올리고데옥시뉴클레오티드의 3' 말단에 데옥시리보구아노신(dG) 연속서열을 결합시킴으로써 제거세포 수용체(scavenger receptor, 이하 SR이라 함)를 갖는 면역세포에 대한 특이적인 결합능을 향상시켜 보조 T 세포타입-1(Th-1) 면역활성을 최대화하면서 인체에 대한 독성은 유발하지 않는, 백신 보조제 및 면역치료제로 유용한 CpG ODN 변형체에 관한 것이다.The present invention relates to a CpG oligodeoxynucleotide variant with increased immunomodulatory capacity, and more specifically, to a deoxyriboguanosine (dG) sequence sequence at the 3 'end of the CpG oligodeoxynucleotide having immunomodulatory capacity. Thereby improving specific binding ability to immune cells having a scavenger receptor (hereinafter referred to as SR), maximizing secondary T cell type-1 (Th-1) immune activity while not inducing toxicity to the human body. CpG ODN variants useful as vaccine adjuvants and immunotherapeutic agents.

CpG 올리고뉴클레오티드(oligonucleotide, 이하 'CpG ODN'이라 한다.)는 선천성 및 후천성 면역반응을 모두 활성화시킬 수 있는 유용한 면역 조절제로 알려져 있다. 구체적으로 CpG ODN은 주로 항원 제시 세포들(antigen presenting cells, 이하 APCs라 함), 예를 들어 B 세포, 대식세포(marcrophage) 및 수상돌기세포(dentritic cell)를 활성화시켜 생체내 면역증강에 중요한 사이토카인(cytokine) 의 분비나 동시-자극분자(co-stimulatory molecule)의 발현을 촉진한다는 사실이 생체외 실험을 통해 밝혀져 있다(Klinman, D.M.et al.,PNAS USA93, 2879-2883, 1996; Krieg, A.M.et al.,Nature374, 546-549, 1995; Jakob, T.et al.,J. Immunol.161, 3042-3049, 1998; Sparwasser, T.et al.,Eur. J. Immunol.28, 2045-2054, 1998). CpG ODN은 APC의 엔도좀(endosome)으로 유입되고 그 활성에는 엔도좀의 성숙이 필수적으로 요구된다. 그러나 상기 CpG ODN이 면역증강 효과를 유도하는데 어떠한 생체내 신호전달 과정을 거치는지 또는 ODN의 CpG 서열을 인식하는 생체내 분자가 무엇인지 등 자세한 기전은 아직 알려져 있지 않다.CpG oligonucleotides (hereinafter referred to as 'CpG ODN') are known as useful immune modulators that can activate both innate and acquired immune responses. Specifically, CpG ODN mainly activates antigen presenting cells (hereinafter referred to as APCs), eg, B cells, macrophages, and dentritic cells, which are important for in vivo immunity. In vitro experiments have been shown to promote the secretion of cytokines or the expression of co-stimulatory molecules (Klinman, DM et al ., PNAS USA 93, 2879-2883, 1996; Krieg). , AM et al ., Nature 374, 546-549, 1995; Jakob, T. et al ., J. Immunol. 161, 3042-3049, 1998; Sparwasser, T. et al ., Eur. J. Immunol. 28 , 2045-2054, 1998). CpG ODN is introduced into the endosomes of APC and its activity is essential for maturation of endosomes. However, detailed mechanisms such as what in vivo signaling processes the CpG ODN undergoes inducing an immunostimulating effect or what in vivo molecules recognize the CpG sequence of the ODN are still unknown.

한편 CpG ODN은 짧은 길이의 올리고뉴클레오티드로서 생체 내에 풍부하게 존재하는 핵산 분해효소(nuclease)에 의해 쉽게 분해되어 그 활성을 잃는다. 이러한 문제점을 해결하기 위해 CpG ODN의 골격을 포스포로티오에이트 결합(phosphrothioate backbone)으로 변형하는 방법이 사용되어 왔다(Stein, C.A. & Cheng, Y.C.Science261, 1004-1012, 1993). 이는 포스포로티오에이트 결합이기존의 포스포다이에스터 결합(phosphodiester backbone)에 비해 핵산 분해효소에 대한 저항성이 높아 CpG ODN의 생체내 반감기를 증가시킬 수 있는 성질을 이용한 것이다. 그러나 최근 들어 포스포로티오에이트 골격 자체가 생체내에서 비특이적 면역활성을 강하게 유도하고, 그로 인해 생체에 독성을 유발한다는 사실이 보고됨(Monteith, D.K.et al.,Toxicol. Pathol.27, 307-317, 1999; Wagner, H.Adv. Immunol.73, 329-368, 1999)에 따라 CpG ODN의 골격을 포스포로티오에이트 결합으로 변형시키는 방법은 안전성에 있어 문제점을 드러내고 있다.On the other hand, CpG ODN is a short-length oligonucleotide is easily degraded by the nuclease (nuclease) that is abundant in vivo and loses its activity. In order to solve this problem, a method of modifying the skeleton of CpG ODN to a phosphorothioate backbone has been used (Stein, CA & Cheng, YC Science 261, 1004-1012, 1993). This is because phosphorothioate bonds have higher resistance to nucleic acid degrading enzymes than phosphodiester backbones, and thus increase the in vivo half-life of CpG ODN. Recently, however, it has been reported that the phosphorothioate backbone itself strongly induces nonspecific immunological activity in vivo, thereby causing toxicity in vivo (Monteith, DK et al ., Toxicol. Pathol. 27, 307-317 , 1999; Wagner, H. Adv. Immunol. 73, 329-368, 1999), a method of modifying the backbone of CpG ODN with phosphorothioate linkages has revealed safety problems.

이에 따라 본 발명자들은 CpG ODN의 면역활성은 극대화하면서 인체에 해로운 비특이적 면역반응을 최소화할 수 있는 새로운 CpG ODN 변형체를 찾기 위해 연구한 결과, 포스포다이에스터 CpG ODN의 3' 말단에 일정한 길이의 데옥시리보구아노신 연속서열(dG run)을 결합시키면 B 세포, 대식세포 및 수상돌기세포와 같이 제거세포 수용체(scavenger receptor, 이하 SR이라 함)를 발현하는 면역세포로의 특이적인 전달을 가능하게 할 뿐 아니라, 생체내에서 보조 T 세포-1(Th-1) 면역반응을 극대화하고, 핵산 분해효소에 의한 CpG ODN의 분해를 억제하며 포스포로티오에이트 골격과는 달리 인체 내에서 독성을 나타내는 비특이적 면역반응을 최소화할 수 있음을 알아냄으로써 본 발명을 완성하였다.Accordingly, the present inventors studied to find a new CpG ODN variant that can minimize the nonspecific immune response harmful to the human body while maximizing the immune activity of CpG ODN, so that the 3 'end of the phosphodiester CpG ODN has a constant length. Incorporation of oxyriboguanosine dG run enables specific delivery to immune cells expressing scavenger receptors (SR), such as B cells, macrophages and dendritic cells. In addition, non-specific immunity that maximizes adjuvant T cell-1 (Th-1) immune responses in vivo, inhibits the degradation of CpG ODN by nucleases and is toxic in humans unlike the phosphorothioate backbone The present invention has been completed by finding out that the reaction can be minimized.

본 발명의 목적은 Th-1 면역활성을 최대화하면서, 인체에 독성을 나타내는비특이적 면역반응은 최소화한 포스포다이에스터 CpG ODN 변형체를 제공하는 것이다.It is an object of the present invention to provide a phosphodiester CpG ODN variant that maximizes Th-1 immune activity and minimizes nonspecific immune responses that are toxic to the human body.

또한 본 발명의 목적은 SR을 갖는 면역세포에 특이적인 결합능이 증가된 CpG ODN 변형체를 제공하는 것이다.It is also an object of the present invention to provide a CpG ODN variant with increased specific binding capacity to immune cells having SR.

나아가 본 발명의 목적은 상기 CpG ODN 변형체를 백신 보조제 및 면역치료제로 사용하는 용도를 제공하는 것이다.Further object of the present invention is to provide a use of the CpG ODN variant as a vaccine adjuvant and immunotherapy.

도 1은 dG 연속서열이 결합된 CpG ODN이 대식세포(도 1a)와 B 세포(도 1b)에서 IL-12의 분비에 미치는 영향을 나타낸 그래프이고, 1 is a graph showing the effect of dG sequence-bound CpG ODN on the secretion of IL-12 in macrophages (FIG. 1A) and B cells (FIG. 1B),

도 2 는3' 말단에 결합된 dG 연속서열의 길이에 따른 사이토카인 분비 효능성을 나타낸 그래프이고, 2 is a graph showing cytokine secretion efficacy according to the length of the dG sequence bound to the 3 'end,

도 3a는 dG 연속서열이 결합된 ODN이 수상돌기세포의 표면에 결합하는 정도를 나타낸 그래프이고, Figure 3a is a graph showing the degree of binding of the dG sequential ODN bound to the surface of the dendritic cells,

도 3b는 dG 연속서열이 결합된 ODN이 수상돌기세포의 내부로 유입되는 정도는 나타낸 그래프이고, Figure 3b is a graph showing the degree of inflow of the OG bound to the dG sequence sequence into the dendritic cells,

도 3c는 SR-A 리간드인 dG20, 푸코이단, 덱스트란 설페이트와, SR-BI 리간드인 LDL, CD36의 리간드인 올레산, Mac-1 리간드인 피브리노겐과 항 CD18 단일클론항체를 사용한 경쟁적 결합 분석을 통해 dG 연속서열이 결합된 ODN이 어떠한 세포표면 수용체를 통해 세포 내로 유입되는지는 조사한 결과이고, FIG. 3C shows competitive binding assay using SR-A ligand dG 20 , fucoidan, dextran sulfate, SR-BI ligand LDL, CD36 ligand oleic acid, Mac-1 ligand fibrinogen and anti-CD18 monoclonal antibody. It is the result of the investigation that the cell surface receptors in which the dG sequence-bound ODN enters the cell.

도 4a는 HIV 입자(particle)와 함께 dG 연속서열이 결합된 ODN을 포함하거나 포함하지 않은 상태로 면역반응을 유도하여 생체 내에서 dG 연속서열이 Th-1 면역반응을 유도하는지 여부를 면역글로블린의 양을 측정하여 조사한 결과이고, FIG. 4A shows whether the dG sequence induces a Th-1 immune response in vivo by inducing an immune response with or without an ODN bound to a dG sequence with HIV particles . FIG. Is the result of measuring the quantity

도 4b는 마우스에 1826D, 1826T 및 M21과 gDE2t 단백질을 근육주사한 후 항 E2 IgG2a 역가를 측정한 ELISA 결과를 나타낸 것이고, Figure 4b shows the ELISA results measuring the anti-E2 IgG2a titers after intramuscular injection of 1826D, 1826T and M21 and gDE2t proteins in mice,

도 4c는 ODN들과 gDE2t 단백질이 함께 면역된 생쥐의 CD4+T세포로부터 사이토카인(IL-4 및 IFN-γ)의 분비에 미치는 영향을 나타낸 그래프이다. 4C is a graph showing the effect of ODNs and gDE2t protein on the secretion of cytokines (IL-4 and IFN-γ) from CD4 + T cells of mice immunized together.

상기 목적을 달성하기 위해, 본 발명은 3' 말단에 데옥시리보구아노신 연속서열(dG run)이 결합된 것을 특징으로 하며 CpG 모티프를 갖는 포스포다이에스터 올리고데옥시뉴클레오티드(oligodeoxynucleotide, 이하 'ODN'이라 함) 변형체를 제공한다.In order to achieve the above object, the present invention is characterized in that the deoxyriboguanosine sequence (dG run) is coupled to the 3 'end and has a CpG motif phosphodiester oligodeoxynucleotide (oligodeoxynucleotide, hereinafter' ODN ' ') Provides a variant.

또한 본 발명은 상기 dG 연속서열이 결합된 CpG ODN 중 Th-1 면역활성을 특이적으로 유도하는 서열번호 2, 9, 14, 16 또는 18로 기재되는 염기서열을 갖는 CpG ODN 변형체를 제공한다.The present invention also provides a CpG ODN variant having the nucleotide sequence set forth in SEQ ID NO: 2, 9, 14, 16 or 18 specifically inducing Th-1 immune activity in the dG sequencing CpG ODN.

또한 본 발명은 상기 dG 연속서열이 결합된 CpG ODN을 백신보조제 및 면역치료제로 사용하는 용도를 제공한다.In another aspect, the present invention provides a use of the CpG ODN conjugated with the dG sequence sequence as a vaccine adjuvant and immunotherapy.

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 명세서에서 'ODN'이라 함은 면역반응을 활성화할 수 있는 11∼26 nt 길이의 올리고데옥시뉴클레오티드를 의미하며, 특히 'CpG ODN'은 면역조절능력을 나타내는 CpG 모티프(5' Purine Purine CpG Pyrimidine Pyrimidine 3')를 갖는 올리고데옥시뉴클레오티드를 말한다.In the present specification, 'ODN' refers to an oligodeoxynucleotide having a length of 11 to 26 nt capable of activating an immune response. In particular, 'CpG ODN' refers to a CpG motif (5 'Purine Purine CpG Pyrimidine) indicating immunomodulatory ability. Oligodeoxynucleotides with Pyrimidine 3 ').

'dG 연속서열'이란 데옥시리보구아노신이 최소한 4개 이상 연속적으로 포스포다이에스터 결합으로 CpG ODN에 연결된 형태를 지칭한다.'dG sequence' refers to a form in which deoxyriboguanosine is linked to CpG ODN by at least four consecutive phosphodiester bonds.

본 발명에서 p19 ODN 서열은 이미 공지된 pUC19 플라스미드의 ampr유전자에서 유래된 것으로(염기순서 2293에서 2312), 본 발명의 실시예에서는 GenoTech(대전시, 대한민국)사에 합성을 의뢰하여 제조하였다. 다른 ODN들은 p19 및 이미 활성이 알려진 ODN 서열에 dG 연속서열을 3' 말단에 결합시킨 채로 합성해서 쉽게 얻을 수 있다.In the present invention, the p19 ODN sequence is derived from the amp r gene of the already known pUC19 plasmid (base sequence 2293 to 2312). In the embodiment of the present invention, the synthesis was made by GenoTech (Daejeon, Korea). Other ODNs can be easily obtained by synthesizing p19 and known ODN sequences with dG sequences linked to the 3 ′ end.

포스포로티오에이트 결합을 갖도록 제조된 ODN은 세포내에 존재하는 핵산분해효소의 공격으로부터 보호되어 생체내에서 ODN의 반감기를 연장시키는 역할을 한다. 그러나 포스포로티오에이트 결합 자체에 의한 비특이적 면역반응의 유발로 인해 안전성에 많은 문제점을 갖고 있다. 실제로 본 발명자들이 포스포로티오에이트 결합을 갖는 ODN(50㎍)을 알루미늄 하이드록사이드로 처리하여 CHO에서 유래한 gDE2t 5㎍와 함께 쥐에 주사해본 결과, 주사부위에서 육종(granuloma)이 발생하는 것을 확인하였다. 반면, 포스포다이에스터 결합을 갖는 CpG ODN들은 시험관 내(in vitro) 실험은 물론 생체내(in vivo) 실험에서도 인체에 해로운 비특이적 면역반응은 나타내지 않았다. 이는 핵산분해효소에 대한 공격가능성 및 효율 면에서 상당히 낮은 정도로 비특이적 엔도사이토시스(endocytosis)를 통해 면역세포에 작용하기 때문인 것으로 여겨진다. 이와 같이 포스포로티오에이트 결합이 갖는 안전성의 문제와 공지의 포스포다이에스터 결합이 갖는 낮은 면역원성의 문제를 해결하기 위하여 본 발명에서는 dG 연속서열을 포스포다이에스터 결합을 갖는 CpG ODN의 3' 말단에 결합하여 면역원성과 안전성의 문제를 동시에 해결하였다.ODN prepared to have phosphorothioate bonds are protected from the attack of nucleases present in the cell and serve to extend the half-life of the ODN in vivo. However, there are many problems in safety due to the induction of nonspecific immune response by phosphorothioate binding itself. In fact, the present inventors treated ODN (50 μg) having phosphorothioate bonds with aluminum hydroxide and injected it into mice with 5 μg of gDE2t derived from CHO, indicating that granuloma occurred at the injection site. Confirmed. On the other hand, CpG ODNs with phosphodiester bonds did not show a nonspecific immune response that is harmful to humans in vitro as well as in vivo experiments. This is believed to be due to action on immune cells through nonspecific endocytosis to a considerably lower level in terms of attackability and efficiency against nucleases. Thus, in order to solve the problem of safety of phosphorothioate bonds and the problem of low immunogenicity of known phosphodiester bonds, in the present invention, the dG sequence is 3 'of CpG ODN having a phosphodiester bond. Binding to the terminal solves the problem of immunogenicity and safety at the same time.

본 발명에서 3' 말단에 dG 연속서열을 결합시켜 그 면역반응 유도활성을 증가시킬 수 있는 CpG ODN들은 서열번호 2의 p19, 서열번호 9의 M16, 서열번호 14의 M21 및 서열번호 16의 M22인 것이 바람직하다. 5' 말단에 dG 연속서열이 결합된 경우에는 dG 연속서열이 결합되지 않은 경우보다 더 낮은 정도로 수상돌기세포에서 인터루킨-12(interleukin-12, 이하 IL-12라 함)가 분비되어, 오히려 5' dG 연속서열은 CpG 모티프에 의해 유도되는 IL-12의 분비능력을 억제한다. 또한 5' dG 연속서열은 3' dG 연속서열과 마찬가지로 연속서열이 없는 경우에 비해서는 세포 결합 및 세포내로의 유입 면에서 더욱 효과적이지만, 3' 말단의 경우가 5' 말단에 dG 연속서열이 결합한 경우보다 세포 결합 및 세포내 유입면에서 더욱 효과적이다. 이러한 세포 결합 및 세포내 유입효과는 dG 연속서열을 다른 염기, 예를 들어 dC 연속서열로 치환한 경우에는 사라지는 것으로 보아 dG 연속서열의 특이적인 효과임을 알 수 있다.In the present invention, CpG ODNs that can increase the immune response-inducing activity by binding the dG sequence to the 3 'end are p19 of SEQ ID NO: 2, M16 of SEQ ID NO: 9, M21 of SEQ ID NO: 14, and M22 of SEQ ID NO: 16. It is preferable. When the dG sequence is bound to the 5 'end, interleukin-12 (interleukin-12, hereinafter referred to as IL-12) is secreted from the dendritic cells to a lower degree than when the dG sequence is not bound. dG sequencing inhibits the secretion capacity of IL-12 induced by the CpG motif. The 5 'dG sequence is more effective in cell binding and inflow into cells than in the case of 3' dG sequence, but the 3 'end is bound to the 5' end. It is more effective in cell binding and intracellular inflow than in the case. Such cell binding and intracellular influx effect disappears when the dG sequence is replaced with another base, for example, the dC sequence, indicating that it is a specific effect of the dG sequence.

특히 IL-12의 생산면에서 수상돌기세포는 본 발명의 dG 연속서열이 결합된 CpG ODN의 가장 바람직한 목표가 되는데, 이는 수상돌기세포가 생체내에서 면역반응 유도에 핵심적이며 IL-12는 Th-1 면역반응의 유도에 중요한 역할을 하기 때문이다. 수상돌기세포는 대식세포에 비해 ODN에 대한 결합력이 4배 이상 낮지만, 본 발명의 dG 연속서열이 결합된 CpG ODN은 대식세포보다 약 50배 이상 IL-12를 많이 생산한다.In particular, dendritic cells in the production of IL-12 is the most desirable target of the CpG ODN coupled to the dG sequence of the present invention, which is essential for induction of immune response in vivo and IL-12 is Th-1 This is because it plays an important role in inducing an immune response. Although dendritic cells are four times lower in binding capacity to ODN than macrophages, CpG ODN to which dG sequencing of the present invention is bound produces about 50 times more IL-12 than macrophages.

본 발명의 실시예에서 생쥐의 지라로부터 분리한 수상돌기세포에 처리한 생체외 실험(in vitro)결과 CpG ODN들은 수상돌기세포를 자극하여 종양괴사인자-α(tumor necrosis factor-α, 이하 TNF-α라 함) 및 IL-12를 높은 수준으로 분비하도록 하였다. 또한 복강 내 대식세포나 B 세포에서도 IL-12를 분비하도록 유도하였다. 이러한 효과는 오직 CpG ODN들의 3' 말단에 dG 연속서열이 결합된 경우에만 나타나는 것으로 5' 말단에 결합한 경우에는 이를 관찰할 수 없었다.In vitro results of treatment with dendritic cells isolated from spleens of mice in the embodiment of the present invention (CpG ODNs) stimulate the dendritic cells tumor necrosis factor-α (hereinafter referred to as TNF- and a high level of IL-12. In addition, the intraperitoneal macrophages and B cells were also induced to secrete IL-12. This effect appears only when the dG sequence was bound to the 3 'end of the CpG ODNs, but could not be observed when bound to the 5' end.

한편, 면역세포의 표면에 존재하는 수용체 중 어떠한 수용체에 의해 dG 연속서열이 결합된 ODN의 세포 결합이 이루어지는지 실험하기 위해 다양한 리간드를 사용하여 경쟁적 결합양상을 조사한 결과, 본 발명의 dG 연속서열이 결합된 ODN의 세포 결합은 SR-A에 특이적인 리간드에 의해서만 저해되었으며, 이로부터 dG 연속서열이 결합된 ODN이 SR-A 리간드 특이성을 갖는 수용체를 경유하여 세포내로 유입됨을 알 수 있다.Meanwhile, as a result of examining competitive binding patterns using various ligands in order to test whether the OGs in which dG sequences are bound are bound by any of the receptors present on the surface of immune cells, the dG sequences of the present invention are Cell binding of bound ODN was inhibited only by ligands specific for SR-A, from which it can be seen that ODN bound with dG sequence was introduced into cells via a receptor having SR-A ligand specificity.

본 발명에 의해 제조된 dG 연속서열을 갖는 CpG ODN들은 4개의 가닥으로 이루어진 나선구조(four-stranded helix)인 테트라플렉스(tetraplex) 구조를 만들어서 항원제시세포의 SR에 선택적으로 결합하고 그 결과 세포내의 CpG ODN들의 농도를 증가시킬 것으로 예상된다. 이러한 테트라플렉스 구조는 dG 연속서열에 의해 만들어지는 G-사중체(G-quartet)에 의해 안정화된다고 알려져 있으며, dG 연속서열과 결합한 CpG ODN이 APCs와 결합하고 유입되는 효율에 영향을 미친다. SR과의 결합에 의한 수용체 신호는 사이토카인의 생산에 영향을 미치는 것으로 알려져 있다. 예를 들어 말레일-BSA(maleyl-bovine serum albumin)가 SR에 결합하면 생쥐의 대식세포에서 TNF-α 유전자의 전사가 촉진됨이 보고되어 있다. 그러나 이와는 반대로 골수세포에서 유래한 대식세포에서 LPS에 의해 유도되는 IL-12의 생산은 저해된다는 보고도 있다. 한편, 본 발명에서 단순히 G-사중체 자체만이 SR과 결합해서는 TNF-α 및 IL-12와 같은 사이토카인의 생산이 증가되지 않는 것으로 보인다. 이러한 사실은 dG6연속서열은 갖고 있지만 CpG 모티프가 존재하지 않는 M1 또는 M16GC에 의해서는 전혀 사이토카인의 생산이 유도되지 않는 것으로부터 알 수 있다. 따라서 증가된 면역활성을 나타내도록 하기 위해서는 dG 연속서열이 ODN의 3' 말단에 결합하는 것은 물론 ODN 자체가 CpG 모티프를 갖는 것이 중요하다.CpG ODNs having dG sequences prepared by the present invention selectively form tetraplex structures, which are four-stranded helix, to selectively bind to SR of antigen presenting cells and consequently intracellularly. It is expected to increase the concentration of CpG ODNs. These tetraplex structures are known to be stabilized by G-quartets produced by dG sequences, and CpG ODN combined with dG sequences sequence affects the efficiency of binding and influx of APCs. Receptor signals by binding to SR are known to affect cytokine production. For example, it has been reported that maleyl-BSA (maleyl-bovine serum albumin) binds to SR and promotes transcription of TNF-α gene in mouse macrophages. In contrast, it has been reported that LPS-induced production of IL-12 is inhibited in macrophages derived from myeloid cells. On the other hand, in the present invention, only the G-quartet itself does not seem to increase the production of cytokines such as TNF-α and IL-12 by binding to SR. This can be seen from the fact that cytokine production is not induced at all by M1 or M16GC, which has a dG 6 sequence but does not have a CpG motif. Therefore, in order to exhibit increased immune activity, it is important that the dG sequence not only binds to the 3 'end of the ODN, but also the ODN itself has a CpG motif.

dG 연속서열의 길이는 최소한 테트라플렉스 구조를 이룰 수 있도록 적어도 4개의 연속적인 dG가 결합된 dG 연속서열이 필요하며, dG가 6개 결합한 경우가 IL-12의 분비에 가장 효과적이다. dG 연속서열의 길이가 계속 증가하는 경우 IL-12의 분비정도는 큰 차이가 없으나, TNF-α의 경우에는 dG 가 15개 결합한 경우에 가장 높은 분비정도를 나타낸다. 따라서 생체내에서 과량의 TNF-α 분비가 독성을 나타낼 수 있으므로 dG 연속서열의 길이는 최소한 4개 내지 15개 이하로 이루어지는것이 바람직하다.The length of the dG sequence requires at least four consecutive dG sequences combined with at least four consecutive dGs to achieve a tetraplex structure, and the combination of six dGs is most effective for secreting IL-12. IL-12 secretion is not significantly different when the length of dG sequence is continuously increased, but TNF-α shows the highest secretion level when 15 dG is bound. Therefore, since the excess TNF-α secretion in vivo may be toxic, it is preferable that the length of the dG sequence is at least 4 to 15 or less.

한편, 본 발명의 dG 연속서열이 결합된 CpG ODN은 5' 또는 3' 말단의 염기 결합을 포스포로티오에이트 결합으로 변형함으로써 보다 증진된 사이토카인 분비활성을 나타낼 수 있다. 상기에서 포스포로티오에이트 결합으로 변형되는 것은 5' 또는 3' 말단에서 1∼3 개의 염기결합을 변형시키는 것이 바람직하다.On the other hand, CpG ODN to which the dG sequencing of the present invention is bound may exhibit more enhanced cytokine secretion activity by modifying 5 'or 3' terminal base bonds to phosphorothioate bonds. In the above modification of the phosphorothioate bond, it is preferable to modify 1 to 3 base bonds at the 5 'or 3' end.

보다 바람직하게는 양쪽 말단에서 2개의 염기결합을 변형시킨 서열번호 18의 M21E를 이용할 수 있다.More preferably, M21E of SEQ ID NO: 18 in which two base bonds are modified at both ends may be used.

본 발명의 실험예 8에 따르면, 3' 말단에 dG 연속서열이 도입된 포스포다이에스터 CpG ODN의 생체내 핵산 분해효소에 대한 저항성을 더욱 증가시키기 위해 본 발명의 dG 연속서열이 결합된 CpG ODN의 양쪽 말단에서 두 개의 염기결합을 포스포로티오에이트 결합으로 변형하여 수상돌기세포에서의 사이토카인 생산에 미치는 영향을 조사하였다. 구체적으로 수상돌기세포에서의 IL-12 분비 유도 능력이 가장 뛰어난 M21의 양쪽 말단의 두 개의 염기를 각각 포스포로티오에이트 결합으로 치환한 뒤 생체외 실험을 통해 사이토카인 분비능력을 1826T 및 M21과 비교하였다. 그 결과 양쪽 말단 두 개의 염기에 포스포로티오에이트 결합이 도입된 CpG ODN은 포스포다이에스터 결합만으로 이루어진 M21보다 높은 IL-12 분비능력을 보임은 물론 모든 결합이 포스포로티오에이트 결합으로 이루어진 1826T 보다도 높은 수준으로 IL-12 분비 자극활성을 나타냄을 확인할 수 있었다. 이러한 사실은 양쪽 말단에만 포스포로티오에이트 결합을 도입함으로써 사이토카인 분비 자극활성을 더욱 높이고 핵산 분해효소에 대한 저항성을 더욱 증가시킬 수 있음을 나타낸다.According to Experimental Example 8 of the present invention, in order to further increase the resistance of the phosphodiester CpG ODN in which the dG sequence was introduced at the 3 'end to the nucleic acid degrading enzyme in vivo, the CpG ODN in which the dG sequence of the present invention was bound The effects of cytokine production on dendritic cells were investigated by transforming two base bonds into phosphorothioate bonds at both ends of. Specifically, two bases at both ends of M21, the most capable of inducing IL-12 secretion in dendritic cells, were replaced with phosphorothioate bonds, and the cytokine secretion was compared with 1826T and M21 through in vitro experiments. It was. As a result, CpG ODN with phosphorothioate bonds in both bases showed higher IL-12 secretion capacity than M21 consisting only of phosphodiester bonds, and all bonds were less than 1826T, with phosphorothioate bonds. It was confirmed that the IL-12 secretory stimulating activity at a high level. This fact suggests that by introducing phosphorothioate bonds only at both ends, cytokine secretion stimulating activity can be further increased and resistance to nucleases can be further increased.

본 발명에 의해 제조된 CpG ODN들은 백신 보조제(vaccine adjuvant) 및 면역치료제로 유용하게 사용될 수 있으며, 특히 알레르기(allergy), 천식, 자가면역질환 등의 면역치료제 또는 AIDS, C형 만성 간염 등의 감염성 질병들에 대한 예방 및 치료 백신의 보조제로 이용될 수 있다. 이때 면역반응을 유도하고자 하는 항원과 상기 ODN들은 0.1 ~ 2.5 mg/kg의 양으로 2 ~ 4주 간격으로 2 ~3 번 투입되는 것이 바람직하다. 또한 항원에 대한 ODN의 비율은 0.2 ∼ 10 인 것이 바람직하다. 항원들은 인체에 사용될 수 있는 백신 보조제인 알루미늄 하이드록사이드(aluminum hydroxide)와 함께 혹은 단독으로 면역할 수 있고 근육주사 (intramuscular) 또는 피하주사 (subcutaneous)의 방법으로 투여될 수 있다. dG 연속서열의 3' 결합에 의해 효능성이 증가된 ODN M16, M21은 각각 생쥐에서 Th-1 면역반응인 IgG2a 생성 및 CD4+T 보조세포로부터 높은 인터페론-γ/인터루킨-4(IFN-γ/IL-4) 분비 비율을 나타낸다.CpG ODNs prepared by the present invention can be usefully used as a vaccine adjuvant and immunotherapeutic agent, and especially infectious agents such as allergy, asthma, autoimmune diseases such as AIDS, hepatitis C or chronic hepatitis It can be used as an adjuvant of preventive and therapeutic vaccines against diseases. At this time, the antigen and the ODN to induce an immune response is preferably added 2 to 3 times at intervals of 2 to 4 weeks in the amount of 0.1 ~ 2.5 mg / kg. Moreover, it is preferable that the ratio of ODN with respect to an antigen is 0.2-10. Antigens can be immunized with or alone with aluminum hydroxide, a vaccine adjuvant that can be used in the human body and can be administered by intramuscular or subcutaneous methods. dG continuous sequence of the 3 'ODN M16, M21 are the last name efficacy by combined increase respectively of Th-1 immune response in mice produced IgG2a and CD4 + T cells from the secondary high interferon -γ / IL -4 (IFN-γ / IL-4) secretion ratio.

이하 실시예에 의해 본 발명을 상세히 설명한다.The present invention will be described in detail by the following examples.

단, 하기 실시예는 본 발명을 예시하는 것으로, 본 발명의 범위가 이에 한정되는 것은 아니다.However, the following examples are illustrative of the present invention, and the scope of the present invention is not limited thereto.

<실시예> dG 연속서열이 3' 말단에 결합된 CpG ODN들의 제조EXAMPLES Preparation of CpG ODNs with dG Sequences Bound to the 3 ′ End

dG 연속서열의 효과를 포스포다이에스터 골격(phosphodiester backbone)을 갖는 CpG ODN에서 규명하기 위하여 데옥시리보구아노신(deoxyriboguanosine) 연속서열로 추정되는 염기서열(putative dG run, GGGGCG)과 CpG 모티브인 AACGTT를 갖고 있는 적절한 염기서열을 탐색하였다. 그 결과 pUC19 내에 존재하는 암피실린 저항성 유전자인 ampr의 2293-2312번째 20개 염기로 이루어진 서열을 선택하였고, 이를 p19로 명명하였다. 또한 대조군으로 이미 면역활성 능력이 있다고 알려진 CpG ODN인 1826(Jakob, T.et al.,J. Immunol.161, 3042-3049, 1998)을 각각 포스포로티오에이트 골격(phosphorothioate backbone, 이하 1826T라 함) 또는 포스포다이에스터 골격(phosphodiester backbone, 이하 1826D라 함)으로 GenoTech사에 합성을 의뢰하여 제조, 사용하였다. 상기 ODN들을 주형으로 하여 일부 염기가 치환되거나 dG 연속서열(dG run)을 3' 또는 5' 말단에 결합시킨 ODN들을 제조하였다.To determine the effect of dG sequences on CpG ODNs with phosphodiester backbone, putative dG run (GGGGCG) and CpG motifs, presumably deoxyriboguanosine sequences The appropriate base sequence with As a result, a sequence consisting of the 2293-2312 th 20 bases of amp r , the ampicillin resistance gene present in pUC19, was selected and named p19. In addition, 1826 (Jakob, T. et al ., J. Immunol. 161, 3042-3049, 1998), a CpG ODN already known as an immunosuppressive agent, was referred to as a phosphorothioate backbone (hereinafter referred to as 1826T). ) Or a phosphodiester backbone (hereinafter referred to as 1826D), which was manufactured and used by requesting synthesis from GenoTech. Using the ODNs as templates, ODNs were prepared by substituting some bases or binding dG run to 3 'or 5' ends.

상기와 같은 방법으로 하기 표 1에 나타난 서열을 갖는 올리고뉴클레오티드를 합성하였다. 하기 표 1에서 밑줄은 각각의 ODN에 존재하는 CpG 모티프 부위를 나타내고, 대문자는 포스포다이에스터 결합을 소문자는 포스포로티오에이트 결합을 나타낸다.In the same manner as described above to synthesize an oligonucleotide having the sequence shown in Table 1. In Table 1 below, underlining indicates the CpG motif sites present in each ODN, uppercase letters indicate phosphodiester bonds and lowercase letters indicate phosphorothioate bonds.

본 발명에서 제조된 CpG ODN 들의 염기서열Base Sequences of CpG ODNs Prepared in the Present Invention 명칭designation 서열번호SEQ ID NO: 염기서열Sequence 1826T1826T 1One 5' tccatgacgttcctgacgtt3'5 'tccat gacgtt cct gacgtt 3' 1826D1826D 5' TCCATGACGTTCCTGACGTT3'5 'TCCAT GACGTT CCT GACGTT 3' p19p19 22 5' GGAAAACGTTCTTCGGGGCG 3'5 'GGAA AACGTT CTTCGGGGCG 3' p19dp19d 33 5' GGAAAACGTTCTTC 3'5 'GGAA AACGTT CTTC 3' M1M1 44 5' GGAAAAGCTTCTTCGGGGCG 3'5 'GGAAAAGCTTCTTCGGGGCG 3' M7M7 55 5' GGAAAACGTTCTTCGCCCCG 3'5 'GGAA AACGTT CTTCGCCCCG 3' M13M13 66 5' GGAAAACGTTCTTCGGGCCG 3'5 'GGAA AACGTT CTTCGGGCCG 3' M14M14 77 5' GGAAAACGTTCTTCGGCCCG 3'5 'GGAA AACGTT CTTCGGCCCG 3' M15M15 88 5' GGAAAACGTTCTTCGGCGCG 3'5 'GGAA AACGTT CTTCGGCGCG 3' M16M16 99 5' GGAAAACGTTCTTCGGGGGG 3'5 'GGAA AACGTT CTTCGGGGGG 3' M19M19 1010 5' GGGGAAAACGTTCTTCGCCC 3'5 'GGGGAA AACGTT CTTCGCCC 3' M26M26 1111 5' GGGGGGAAAACGTTCTTCGC 3'5 'GGGGGGAA AACGTT CTTCGC 3' M27M27 1212 5' GGGGGGGGGAAAACGTTCTT 3'5 'GGGGGGGGGAA AACGTT CTT 3' M20M20 1313 5' GGGGGGTCCATGACGTTCCTGACGTT3'5 'GGGGGGTCCAT GACGTT CCT GACGTT 3' M21M21 1414 5' TCCATGACGTTCCTGACGTTGGGGGG 3'5 'TCCAT GACGTT CCT GACGTT GGGGGG 3' M12M12 1515 5' CTTAACGTTCT 3'5 'CTT AACGTT CT 3' M22M22 1616 5' CTTAACGTTCTGGGGGG 3'5 'CTT AACGTT CTGGGGGG 3' M23M23 1717 5' GGGGGGCTTAACGTTCT 3'5 'GGGGGGCTT AACGTT CT 3'

<실험예 1> dG 연속서열이 생쥐의 지라(spleen)에서 분리한 수상돌기세포(dendritic cell)로부터 사이토카인의 분비에 미치는 영향Experimental Example 1 Effect of dG Sequence on Cytokine Secretion from Dendritic Cells Isolated from Spleen of Mice

상기 실시예에서 제조된 CpG ODN들의 면역활성 정도를 비교분석하기 위하여 생후 약 6~8주정도의 C57BL/6 암컷 생쥐(대한실험동물센터)의 지라(spleen)로부터 수상돌기세포를 분리하여 CpG ODN들을 처리한 뒤 각각 종양괴사인자-α(TNF-α)와 인터루킨-12(IL-12)의 분비정도를 조사하였다.In order to analyze the degree of immunological activity of CpG ODN prepared in the above example, CpG ODN was isolated by separating dendritic cells from spleen of C57BL / 6 female mice (Korea Experimental Animal Center) about 6-8 weeks old. After treatment, the levels of tumor necrosis factor-α (TNF-α) and interleukin-12 (IL-12) were examined.

수상돌기세포의 분리는 기존의 보고(Singh, Net al.,J. Immunol. 160, 4849-4880, 1998; Ridge, J.P.et al.,Science271, 1723-1726, 1996)에 약간의 변형을 통해 이루어졌다. 즉, 마우스의 비장세포(splenocytes)를 조직 배양 플레이트에 90분간 부착시킨 후, 비부착성 세포 (non-adherent cells)를 제거한 다음, 부착성 세포(adherent cells)에 10 ng/ml의 재조합 생쥐 GM-CSF(granulocyte macrophage-colony stimulating factor, R&D System) 존재하에 하룻동안 배양하였다. 배양후 비부착성 세포 및 약한 부착성 세포들을 퍼콜 농도 구배(percoll density gradient)로 분리한 다음, 경계면으로부터 수상돌기세포들이 많은 저밀도 세포층을 수집하여 사용하였다. 1×105개의 수상돌기세포에 각각의 CpG ODN들을 1.5 μM의 농도로 처리하고 10시간과 30시간 뒤에 각각 배양액을 수거하여 분비된 TNF-α 및 IL-12 양을 상용 ELISA 키트들 (Mouse TNF-α DuoSeT ELISA Development System, TOTAL MOUSE IL-12 DuoSeT ELISA Development System; Genzyme)을 이용하여 측정하였다. 그 결과를 하기 표 2 에 나타내었다.Isolation of dendritic cells has made some modifications to previous reports (Singh, N et al ., J. Immunol . 160, 4849-4880, 1998; Ridge, JP et al ., Science 271, 1723-1726, 1996). Was done through. That is, after splenocytes of the mouse were attached to the tissue culture plate for 90 minutes, the non-adherent cells were removed, and then 10 ng / ml of recombinant mouse GM was added to the adherent cells. -CSF (granulocyte macrophage-colony stimulating factor, R & D System) was incubated for one day. After incubation, the non-adherent cells and the weak adherent cells were separated by a percoll density gradient, and then a low density cell layer containing many dendritic cells was collected from the interface. Each CpG ODN was treated with 1.5 μM concentration in 1 × 10 5 dendritic cells, and the culture medium was collected after 10 and 30 hours, respectively. The amount of secreted TNF-α and IL-12 was determined using commercial ELISA kits (Mouse TNF). -α DuoSeT ELISA Development System, TOTAL MOUSE IL-12 DuoSeT ELISA Development System; Genzyme). The results are shown in Table 2 below.

양성 대조군으로는 리포폴리사카라이드(lipopolysaccharide, 이하 LPS라 함)을 사용하였고, 음성 대조군으로는 배지만을 사용하여 IL-12 및 TNF-α의 양을 정량하였다.Lipopolysaccharide (lipopolysaccharide, referred to as LPS) was used as a positive control, and the amount of IL-12 and TNF-α was quantified using only medium as a negative control.

수상돌기세포에서의 사이토카인(IL-12, TNF-α) 생산에 미치는 영향Effect on cytokine (IL-12, TNF-α) production in dendritic cells 명칭designation 서열번호SEQ ID NO: IL-12(ng/ml)IL-12 (ng / ml) TNF-α(pg/ml)TNF-α (pg / ml) 1826T1826T 1One 5.41 ± 1.285.41 ± 1.28 2768 ± 6282768 ± 628 1826D1826D 0.37 ± 0.070.37 ± 0.07 134 ± 58134 ± 58 p19p19 22 1.32 ± 0.311.32 ± 0.31 640 ± 96640 ± 96 p19dp19d 33 0.07 ± 0.010.07 ± 0.01 25 ± 325 ± 3 M1M1 44 0.05 ± 0.010.05 ± 0.01 27 ± 327 ± 3 M7M7 55 0.09 ± 0.020.09 ± 0.02 30 ± 330 ± 3 M13M13 66 0.07 ± 0.010.07 ± 0.01 20 ± 120 ± 1 M14M14 77 0.05 ± 0.010.05 ± 0.01 22 ± 222 ± 2 M15M15 88 0.08 ± 0.020.08 ± 0.02 36 ± 536 ± 5 M16M16 99 2.40 ± 0.772.40 ± 0.77 960 ± 166960 ± 166 M19M19 1010 0.13 ± 0.050.13 ± 0.05 39 ± 639 ± 6 M26M26 1111 0.13 ± 0.070.13 ± 0.07 96 ± 2696 ± 26 M27M27 1212 0.07 ± 0.030.07 ± 0.03 64 ± 1964 ± 19 M20M20 1313 0.42 ± 0.110.42 ± 0.11 115 ± 29115 ± 29 M21M21 1414 3.04 ± 0.573.04 ± 0.57 1103 ± 1761103 ± 176 M12M12 1515 0.05 ± 0.010.05 ± 0.01 18 ± 318 ± 3 M22M22 1616 0.88 ± 0.170.88 ± 0.17 408 ± 55408 ± 55 M23M23 1717 0.05 ± 0.010.05 ± 0.01 40 ± 540 ± 5 LPSLPS 1.59 ± 0.251.59 ± 0.25 844 ± 154844 ± 154 배지badge 0.07 ± 0.010.07 ± 0.01 27 ± 427 ± 4

상기 표 2에 나타나 있듯이 포스포로티오에이트 변형 (1826T)이 포스포다이에스터(1826D)에 비해 월등히 뛰어난 사이토카인 분비를 나타냈다. 그러나 p19는 1826D에 비해 약 네 배 정도 높은 IL-12 분비를 보였다. 또한 이러한 높은 수준의 사이토카인 분비는 dG로 구성된 연속서열 (GGGGCG)에서 일부 dG를 dC로 치환하거나 (M7, M13, M14, M15), 제거했을 때(p19d) 현저하게 감소함을 알 수 있다. 또한 p19의 dG로 구성된 연속서열의 dC를 dG로 치환하였을 때 (M16) 그 활성이 더욱 증가하였다. 이러한 dG로 구성된 연속서열의 효과는 서로 다른 염기서열 혹은 다른 길이를 갖고 있는 CpG ODN에서도 마찬가지로 나타났다. 즉, M21과 M22가 1826, M12에 비해 현저히 높은 TNF-α 및 IL-12 분비를 나타내었다. 특히 dG 연속서열을 5' 말단에 결합시킨 경우 (M19, M26, M27)에는 사이토카인 분비에 효과가 없는 것으로 나타나 결론적으로 dG 연속서열의 효과는 CpG ODN의 3' 말단에 있을 때에만선택적으로 나타나는 것임을 알 수 있다.As shown in Table 2 above, the phosphorothioate modification (1826T) showed significantly better cytokine secretion than the phosphodiester (1826D). However, p19 showed about four times higher IL-12 secretion than 1826D. In addition, this high level of cytokine secretion was found to be significantly reduced when the dG is replaced by some dG (M7, M13, M14, M15), or removed (p19d) in the sequence consisting of dG (GGGGCG). In addition, when dC of the sequential sequence consisting of dG of p19 was substituted with dG (M16), the activity was further increased. The effect of the sequence consisting of dG was also shown in CpG ODNs with different sequences or different lengths. That is, M21 and M22 showed significantly higher TNF-α and IL-12 secretion than 1826 and M12. In particular, when the dG sequence was bound to the 5 'end (M19, M26, M27), there was no effect on cytokine secretion. Consequently, the effect of the dG sequence was selectively shown only at the 3' end of CpG ODN. It can be seen that.

<실험예 2> 복강 대식세포와 B 세포에서 dG 연속서열의 효과Experimental Example 2 Effect of dG Sequences on Peritoneal Macrophages and B Cells

수상돌기세포와 마찬가지로 대식세포 또는 B 세포에서도 dG ODN이 사이토카인의 분비를 촉진하는지 알아보기 위하여 생쥐의 복강 대식세포 및 지라에서 얻은 B 세포에 대해 실험예 1과 같은 방법으로 실험하였다.In order to determine whether dG ODN promotes the secretion of cytokines in macrophages or B cells, as in dendritic cells, B cells obtained from peritoneal macrophages and spleen of mice were tested in the same manner as in Experimental Example 1.

복강 대식세포는 생후 약 6~8주정도의 C57BL/6 암컷 생쥐(대한실험동물센터)의 복강을 배지로 세척하고 이를 조직 배양 플레이트에 접종하여 9시간 동안 배양한 뒤에 배지로 3회 세척하여 부착성 세포들만 분리, 사용하였다. 또한 B 세포는 생쥐의 지라에서 비부착성 세포들을 분리한 뒤 B 세포에 특징적인 세포 표면 표지(surface marker)인 CD19(complement differentiation 19)을 인식하는 마이크로비드(microbead, Miltenyl Biotech)를 결합시키고 이를 미니(mini)MACS 칼럼(Miltenyl Biotech)을 사용하여 분리하였다. 1 x 105수의 대식세포와 2 x 105의 B 세포에 각각 3 μM의 CpG ODN을 처리한 후 30시간 뒤에 그 배양액을 얻어 IL-12 ELISA를 수행하였다.Peritoneal macrophages were washed in the abdominal cavity of C57BL / 6 female mice (Korea Experimental Animal Center) about 6 to 8 weeks old with medium, inoculated into tissue culture plates for 9 hours, and then washed with medium 3 times. Only sex cells were isolated and used. B cells also isolate nonadherent cells from the spleen of mice and bind microbeads (miltenyl biotech) that recognize CD19 (complement differentiation 19), a characteristic surface marker for B cells. Separation was done using a miniMACS column (Miltenyl Biotech). After treating 3 × M CpG ODN with 1 × 10 5 macrophages and 2 × 10 5 B cells, respectively, the culture solution was obtained 30 hours later, and IL-12 ELISA was performed.

그 결과 수상돌기 세포에서와 마찬가지로 생쥐의 복강 대식세포(microphage)와 지라로부터 분리한 B 세포에 CpG ODN들을 처리하였을 때에도 3' 말단에 dG 연속서열이 결합된 ODN만 높은 정도로 IL-12를 분비하는 것으로 나타났다. 특히 M16과 M21은 다른 ODN에 비해 현저히 높은 IL-12 분비유도활성을 나타내었다(도 1a1b참조).As a result, when CpG ODNs were treated to B cells isolated from mouse peritoneal macrophage and spleen as in dendritic cells, only ODN with dG sequencing at the 3 'end was highly secreted. Appeared. In particular, M16 and M21 showed significantly higher IL-12 secretion inducing activity than other ODN (see FIGS. 1A and 1B ).

<실험예 3> 3' 말단에 결합된 dG로 구성된 연속서열의 길이에 따른 효능성 변화Experimental Example 3 Change in efficacy according to the length of the continuous sequence consisting of dG bound to the 3 'end

p19의 dG로 구성된 연속서열(GGGGCG)을 제거한 p19d를 대조군으로 하여 그 3' 말단에 다양한 길이의 dG 연속서열을 결합시킨 다음, 수상돌기세포에서 사이토카인의 분비정도를 측정하였다. 구체적인 실험과정은 상기 실험예 1의 방법을 따랐다. 그 결과를도 2에 나타내었다.p19d from which the sequential sequence consisting of dG of p19 (GGGGCG) was removed was combined with dG sequential sequences of various lengths at its 3 'ends, and cytokine secretion was measured in dendritic cells. The specific experimental procedure followed the method of Experimental Example 1. The result is shown in Fig.

도 2의 결과로부터 알 수 있듯이, 사이토카인의 분비에는 적어도 4개의 연속적인 dG로 이루어진 dG 연속서열이 필요하고, 특히 데옥시리보구아노신이 6개 결합한 dG6일 때 IL-12의 분비가 가장 효과적인 것으로 나타났다. dG 연속서열의 길이가 계속 증가하는 경우 IL-12의 분비정도는 큰 차이가 없었으나, TNF-α의 경우 dG15일 때 가장 높은 분비정도를 나타내어 dG6가 결합된 ODN에 비해 약 5배 정도 더 높은 값을 나타내었다.As can be seen from the results of FIG. 2 , cytokine secretion requires dG sequence consisting of at least 4 consecutive dGs, and IL-12 secretion is most effective when dG 6 is bound to 6 deoxyriboguanosine. Appeared. IL-12 secretion was not significantly different when the length of dG sequence increased continuously, but TNF-α showed the highest level of secretion at dG 15 , which was about 5 times higher than that of dG 6 -bound ODN. Higher values.

이러한 결과로부터 3' 말단에 결합된 dG 연속서열의 길이에 따라 TNF-α와 IL-12의 분비정도를 변화시킬 수 있음을 알 수 있다.From these results, it can be seen that the degree of secretion of TNF-α and IL-12 can be changed depending on the length of the dG sequence coupled to the 3 'end.

<실험예 4> dG 연속서열의 결합에 따른 ODN들의 세포 결합 및 세포내 유입정도 변화Experimental Example 4 Changes in Cell Binding and Inflow of ODNs by Binding of dG Sequences

(4-1) dG 연속서열이 ODN의 세포결합에 미치는 영향(4-1) Effect of dG Sequence on ODN Cell Binding

CpG ODN의 효과적인 활성을 위해선 세포 내로 많은 양의 ODN이 유입되어야 한다. 따라서 수상돌기세포에 결합하는 정도나 세포 내로 유입되는 정도가 dG 연속서열의 결합에 의해 어떻게 변화하는지 조사하였다.For the effective activity of CpG ODN, a large amount of ODN must be introduced into the cell. Therefore, we investigated how the degree of binding to dendritic cells or the degree of inflow into cells changed by the binding of dG sequences.

용이한 관찰을 위해 CpG ODN의 3' 혹은 5' 말단에 형광물질인 플루오레신(fluorescien)을 결합시킨 fODN들을 이용하였다. 세포에 결합하는 fODN의 양은 1× 105의 수상돌기세포에 5 μM의 fODN들을 4。C에서 한시간 동안 처리한 뒤 PBS(phosphate buffered saline)로 2회 세척하여 결합하지 않은 fODN들을 제거하고 FACS(Becton Dickinson, USA)를 이용하여 형광광도를 측정하였다. 세포 내로 유입된 fODN의 양은 1× 105의 수상돌기세포에 1μM의 fODN들을 4。C에서 30분 처리하고 37。C에서 각각 1.5 또는 6시간 동안 배양한 후 세포막에 부착된 fODN을 제거하고 측정하였다. 각각의 ODN이 수상돌기세포에 결합하는 정도 및 세포내로 유입되는 정도를 평균형광강도(mean fluorescent intensity, 이하 MFI라 함)로 측정하되, 배지만 존재할 때의 MFI를 기준으로 하여 fM21이 존재할 때의 MFI의 증가정도를 상대적인 지수로 나타낸 결합지수(binding index)와 유입지수(internalization index)로 나타내었다.For easy observation, fODNs in which fluorescent fluorescien is bound to the 3 'or 5' end of CpG ODN were used. The amount of fODN bound to the cells was treated with 5 μM of fODNs at 1 ° 10 5 dendritic cells at 4 ° C for 1 hour and washed twice with PBS (phosphate buffered saline) to remove unbound fODNs and FACS ( Fluorescence was measured using Becton Dickinson, USA). The amount of fODN introduced into the cells was measured in 1 × 10 5 dendritic cells treated with 1μM fODNs at 4 ° C for 30 minutes and incubated at 37 ° C for 1.5 or 6 hours, respectively, to remove fODN attached to the cell membrane. It was. The extent to which each ODN binds to and enters the dendritic cells is measured by mean fluorescent intensity (hereinafter referred to as MFI), and MFI in the presence of fM21 based on the MFI in the presence of embryos. The index of increase is expressed by the binding index and the internalization index.

그 결과는도 3과 같다. 즉, 3' 혹은 5'에 dG 연속서열이 결합된 경우 ODN의 세포 결합 (도 3a) 및 세포 내 유입 (도 3b)은 dG 연속서열이 없는 ODN들의 경우에 비해 현저하게 증가하였다. 한편 dG 연속서열이 3' 말단 위치에 있는 경우가 5' 말단위치에 결합한 경우보다 세포 결합 및 세포내 유입 면에서 더욱 효과적인것으로 나타났다. 또한 이러한 효과는 dG 연속서열이 dC 연속서열로 바뀌면 사라지는 것으로 보아 dG 연속서열의 특이적인 효과임을 알 수 있다.The result is shown in FIG. 3 . That is, when the dG sequence was bound to 3 'or 5', the cell binding of ODN ( FIG. 3A ) and the influx of cells ( FIG. 3B ) were significantly increased compared to the case of ODN without dG sequence. On the other hand, when the dG sequence was located at the 3 'end position, it was found to be more effective in terms of cell binding and influx into the cell than when bound to the 5' end position. In addition, this effect disappears when the dG sequence is changed to the dC sequence, it can be seen that the specific effect of the dG sequence.

(4-2) dG ODN과 결합하는 수용체의 탐색(4-2) Search for Receptors Binding to dG ODN

dG 연속서열을 포함한 ODN들의 세포표면에 결합하는 능력이 어떠한 수용체에 의해 이루어지는가를 조사하기 위하여 기존에 여러 수용체에 결합한다고 알려진 리간드들을 함께 처리하는 경쟁적 결합 분석(competitive binding assay)을 수행하였다. 즉, SR-A의 리간드로 dG20, 푸코이단(fucoidan, Sigma), 덱스트란 설페이트(dextran sulfate, Sigma)를, SR-BI의 리간드로 LDL(low density lipoprotein, Sigma)을, CD36의 리간드로 올레산(oleic acid, Sigma)을, Mac-1(CD11b/CD18, αMβ2)의 리간드로 피브리노겐(fibrinogen, Sigma)과 항 CD18 단일클론항체(Pharmigen) 등을 사용하였다. 우선 0.25mg/ml 농도의 리간드 각각과 10 μM 농도의 dG20을 1μM 농도의 fM21과 공동배양한 후, 결합된 fM21로부터의 MFI를 측정하여 각각의 리간드가 ODN의 세포결합에 미치는 영향을 조사하였다. 그 결과 SR-A에 특이적인 리간드들만 dG 연속서열이 3' 말단에 결합된 fM21 ODN의 수상돌기세포에의 결합을 저해할 수 있었다(도 3c참조). 이러한 결과는 dG 연속서열이 SR-A 리간드 특이성을 갖는 수용체를 경유하여 세포 내로 유입됨을 나타낸다.In order to investigate what receptors are capable of binding to the cell surface of ODNs, including dG sequences, a competitive binding assay was performed to treat ligands known to bind multiple receptors. In other words, dG 20 , fucoidan (Sigma), dextran sulfate (Sigma) as SR-A ligand, low density lipoprotein (Sigma) as ligand of SR-BI, and oleic acid as ligand of CD36 (oleic acid, Sigma), fibrinogen (Sigma) and anti-CD18 monoclonal antibody (Pharmigen) and the like were used as ligands of Mac-1 (CD11b / CD18, αMβ2). First, each ligand of 0.25 mg / ml concentration and dG 20 of 10 μM concentration were co-cultured with 1 μM concentration of fM21, and MFI from bound fM21 was measured to investigate the effect of each ligand on ODN cell binding. . As a result, only ligands specific for SR-A were able to inhibit the binding of fM21 ODN bound to dendritic cells bound to the 3 'end of the dG sequence (see FIG. 3C ). This result indicates that dG sequence is introduced into the cell via a receptor having SR-A ligand specificity.

<실험예 5> 5' 말단에 결합된 dG 연속서열에 의한 사이토카인 분비 능력 저해Experimental Example 5 Inhibition of Cytokine Secretion Ability by dG sequencing bound to the 5 'end

실험예 1의 결과에서 나타나듯이 5' 말단에 dG 연속서열을 결합한 경우는 수상돌기세포로부터 사이토카인 분비를 전혀 증가시키지 못했다 (표 2; M19, M26, M27). 그러나 5' dG 연속서열도 테트라플렉스 (tetraplex) 구조 형성이나 수상돌기세포 결합정도는 dG 연속서열이 없는 ODN의 경우에 비해 현저히 높음을 알 수 있었다 (실험예 4). 이러한 결과는 dG 연속서열의 작용이 CpG ODN의 어느 위치에 있느냐에 따라 변화될 수 있음을 나타낸다. 본 실험예에서는 dG 연속서열이 CpG ODN과 결합한 위치에 따른 영향을 조사하기 위하여 양이온성 리포좀(cationic liposome)인 리포젠TM(lipogeneTM, BodiTech, Korea)을 CpG ODN과 함께 수상돌기세포에 처리하여 세포 내로 유입되는 CpG ODN의 양을 dG 연속서열의 유무에 상관없이 동일화시킨 뒤 실험하였다. 또한, dG 연속서열의 위치에 따른 영향을 조사하기 위하여 2개의 CpG 모티프만을 갖는 서열번호 2의 1826D와 1개의 CpG 모티프만을 갖는 서열번호 16의 M12를 대조군으로 하여, 각각 3' 말단에 dG 연속서열이 결합한 CpG ODN (M21, M22)과 5' 말단에 dG 연속서열이 결합한 CpG ODN (M20, M23)이 수상돌기세포에서의 사이토카인의 분비에 미치는 영향을 조사하였다.As shown in the results of Experiment 1, when the dG sequence was coupled to the 5 'end, cytokine secretion was not increased from the dendritic cells at all (Table 2; M19, M26, M27). However, the 5 'dG sequence was also found to be significantly higher in tetraplex structure formation or dendritic cell binding than in the case of ODN without dG sequence (Experimental Example 4). These results indicate that the action of the dG sequence may vary depending on where in the CpG ODN. In this experiment with the dG continuous sequence CpG ODN cationic liposomes lipoic Zen TM (lipogene TM, BodiTech, Korea ) of (cationic liposome) to investigate the effect of the position in combination with CpG ODN by treating the dendritic cells The amount of CpG ODN flowing into the cells was tested after equalizing with or without dG sequence. In addition, in order to investigate the influence of the position of the dG sequence, 1826D of SEQ ID NO: 2 having only two CpG motifs and M12 of SEQ ID NO: 16 having only one CpG motif were used as controls, respectively, and the dG sequence was inserted at the 3 'end. The effects of the bound CpG ODN (M21, M22) and the CpG ODN (M20, M23) with dG sequencing on the 5 'end were investigated on cytokine secretion in dendritic cells.

먼저 수상돌기세포에 0.3μM의 CpG ODN들을 3 μg의 리포젠과 함께 상온에서 30분 배양한 혼합액을 처리하고 4시간 동안 배양하였다. 그 뒤 배양액에 남아있는 리포젠-ODN 혼합체를 제거하고, 다시 24시간 동안 더 배양한 뒤 배양액으로부터 IL-12의 양을 측정하였다. 그 결과를 하기 표 3 에 나타내었다.First, the dendritic cells were treated with a mixture solution of 0.3 μM CpG ODNs incubated for 30 minutes at room temperature with 3 μg of lipogen and incubated for 4 hours. The lipogen-ODN mixture remaining in the culture was then removed, incubated for another 24 hours, and then the amount of IL-12 was measured from the culture. The results are shown in Table 3 below.

dG 연속서열의 결합위치에 따른 사이토카인 분비 영향Effects of Cytokine Secretion on the Binding Position of dG Sequences 명칭designation dG run위치dG run position IL-12(ng/ml)- 리포좀IL-12 (ng / ml)-liposomes TNF-α(pg/ml)- 리포좀TNF-α (pg / ml)-liposomes IL-12(ng/ml)+ 리포좀IL-12 (ng / ml) + liposomes 1826D1826D -- 0.37 ± 0.070.37 ± 0.07 134 ± 58134 ± 58 4.15 ± 1.174.15 ± 1.17 M21M21 3'3 ' 3.04 ± 0.573.04 ± 0.57 1103 ± 1761103 ± 176 8.11 ± 2.198.11 ± 2.19 M20M20 5'5 ' 0.42 ± 0.110.42 ± 0.11 115 ± 29115 ± 29 1.74 ± 0.571.74 ± 0.57 M12M12 -- 0.05 ± 0.010.05 ± 0.01 18 ± 318 ± 3 1.68 ± 0.331.68 ± 0.33 M22M22 3'3 ' 0.88 ± 0.170.88 ± 0.17 408 ± 55408 ± 55 7.89 ± 3.217.89 ± 3.21 M23M23 5'5 ' 0.05 ± 0.010.05 ± 0.01 40 ± 540 ± 5 0.86 ± 0.250.86 ± 0.25 * - : dG 연속서열이 결합되지 않음*-: dG sequence is not combined

그 결과, 3' 말단에 dG 연속서열이 없는 경우도 리포좀과 함께 처리할 때 수상돌기세포로부터 높은 정도로 IL-12를 분비하게 한다는 것을 알 수 있었다. 하지만 5' 말단에 dG 연속서열이 있는 경우(M20, M23)에는 오히려 dG 연속서열이 없는 경우(1826D, M12)에 비해 더 낮은 정도로 IL-12를 분비함을 알 수 있었다. 이 결과는 5' dG 연속서열은 오히려 수상돌기세포로부터 CpG 모티프에 의해 유도되는 IL-12 분비 능력을 억제할 수 있음을 알 수 있다.As a result, it was found that even when there was no dG sequence at the 3 'end, IL-12 was secreted from dendritic cells to a high degree when treated with liposomes. However, the presence of dG sequence at the 5 'end (M20, M23), rather than the absence of dG sequence (1826D, M12) was found to secrete IL-12 to a lower degree. This result shows that the 5 'dG sequence can rather inhibit IL-12 secretion ability induced by CpG motif from dendritic cells.

<실험예 6> 3' 말단에 결합된 연속서열의 염기종류에 따른 영향<Experiment 6> Effect of the base type of the continuous sequence bound to the 3 'end

M16의 dG 연속서열 대신 데옥시리보아데닌(dA), 데옥시리보사이토신(dC) 및 데옥시리보티민(dT)으로 구성된 연속서열을 CpG ODN의 3' 말단에 결합시킨 후 (M16-A, M16-C, M16-T), 각각의 CpG ODN이 단독으로 혹은 리포좀과 함께 전달될 때 수상돌기세포로부터 IL-12 및 TNF-α의 분비에 미치는 영향을 조사하였다. 그 결과를 하기 표 5 에 나타내었다.A sequence consisting of deoxyriboadenine (dA), deoxyribocytosine (dC), and deoxyribothymine (dT) instead of the dG sequence of M16 was bound to the 3 'end of CpG ODN (M16-A, M16-C, M16-T), and the effect of each CpG ODN alone or together with liposomes on secretion of IL-12 and TNF-α from dendritic cells were investigated. The results are shown in Table 5 below.

연속서열의 염기 종류에 따른 영향Effect of Base Type on Sequence 명칭designation 서열order IL-12(ng/ml)- 리포좀IL-12 (ng / ml)-liposomes TNF-α(pg/ml)- 리포좀TNF-α (pg / ml)-liposomes IL-12(ng/ml)+ 리포좀IL-12 (ng / ml) + liposomes M16M16 5' GGAAAACGTTCTTCGGGGGG3'5 'GGAA AACGTT CTTC GGGGGG 3' 2.40±0.772.40 ± 0.77 960±166960 ± 166 4.76±1.654.76 ± 1.65 M16-AM16-A 5' GGAAAACGTTCTTCAAAAAA3'5 'GGAA AACGTT CTTC AAAAAA 3' 0.05±0.010.05 ± 0.01 25±225 ± 2 5.56±1.105.56 ± 1.10 M16-TM16-T 5' GGAAAACGTTCTTCTTTTTT3'5 'GGAA AACGTT CTTC TTTTTT 3' 0.06±0.010.06 ± 0.01 29±329 ± 3 5.11±0.885.11 ± 0.88 M16-CM16-C 5' GGAAAACGTTCTTCCCCCCC3'5 'GGAA AACGTT CTTC CCCCCC 3' 0.06±0.010.06 ± 0.01 45±845 ± 8 4.35±0.524.35 ± 0.52 M16-GCM16-GC 5' GGCCCCGCTTCTTCGGGGGG3'5 'GGCCCCGCTTCTTC GGGGGG 3' 0.08±0.020.08 ± 0.02 31±231 ± 2 0.15±0.030.15 ± 0.03

그 결과, 리포좀 없이 단독으로 수상돌기세포에 처리된 경우 CpG 모티프를 갖는 동시에 dG 연속서열이 3' 위치에 결합한 M16만 dG 연속서열 대신 dA, dC 또는 dT 연속서열이 결합한 CpG ODN들 (M16-A, M16-T, M16-C)에 비해 현저하게 높은 사이토카인 분비자극활성을 나타내었다. 한편 3μg의 리포좀과 함께 투여된 경우에는 비슷한 IL-12 분비양상을 나타내었으나, 이 경우에도 CpG 모티프의 존재가 면역활성 증가에 필수적인 것으로 나타났다. 이 결과는 3' 말단에 결합된 dG 연속서열은 CpG ODN들의 세포내로의 유입에만 관여하고, 세포내에서 사이토카인 분비에 관계된 신호전달에 있어서는 큰 작용을 하지 않는 것을 나타낸다.As a result, when treated with dendritic cells alone without liposomes, CpG ODNs having a CpG motif and dA, dC or dT sequences combined with dA, dC or dT sequences instead of dG sequences with dG sequences bound to the 3 'position (M16-A , M16-T, M16-C) showed significantly higher cytokine secretion stimulation activity. On the other hand, when administered with 3μg liposomes showed similar IL-12 secretion pattern, in this case, the presence of the CpG motif appeared to be essential for increasing the immune activity. This result indicates that the dG sequence bound to the 3 'end is involved only in the influx of CpG ODNs into the cell and does not play a significant role in signaling related to cytokine secretion in the cell.

<실험예 7> 생체내에서 dG 연속서열 결합에 의한 CpG ODN의 면역활성 변화Experimental Example 7 Changes in CpG ODN Immune Activity by dG Sequential Binding in Vivo

(7-1) dG 연속서열이 결합된 CpG ODN의 면역반응 유발효과 (항원: HIV)(7-1) Induced Immune Response of CpG ODN Conjugated with dG Sequence (Antigen: HIV)

dG 연속서열에 의한 CpG ODN의 면역활성 능력이 생체내에서도 적용될 수 있는지를 조사하기 위하여 Balb/c 생쥐에서 dG 연속서열이 결합된 포스포다이에스터CpG ODN에 의해 유발되는 면역활성을 조사하였다. 일반적으로 포스포로티오에이트 골격을 갖는 CpG ODN만이 항원과 함께 주입되었을 때 면역반응을 주로 Th-1 면역반응 쪽으로 유도한다고 알려져 있다. 따라서 본 실험예에서는 dG 연속서열을 3' 말단에 결합한 포스포다이에스터 골격을 갖는 CpG ODN이 이와 유사하게 면역조절을 할 수 있는지를 조사함으로써 dG 연속서열의 효과를 생체내에서 조사하였다.In order to investigate whether the immunogenic ability of CpG ODN by dG sequence can be applied in vivo, the immunological activity induced by phosphodiester CpG ODN with dG sequence in Balb / c mice was investigated. In general, only CpG ODN having a phosphorothioate backbone is known to induce an immune response mainly to a Th-1 immune response when injected with antigen. Therefore, in this experimental example, the effect of the dG sequence was examined in vivo by examining whether CpG ODN having a phosphodiester backbone bound to the 3 'end was capable of immunomodulation.

알루미늄 하이드록사이드(aluminum hydroxide, Sigma)로 미리 처리한 인간 면역결핍 바이러스 입자 [human immunodeficiency virus (HIV) particle] 5 μg/mouse과 50 μg/mouse의 M16 CpG ODN을 함께 혼합하여 6-8 주령의 Balb/c 암컷 생쥐(대한실험동물센터)에 피하주사로 주입하였다. 모든 생쥐는 첫 번째 면역 4주 뒤에 부스팅(boosting)을 하고 그 후 2주 뒤에 체액성 면역반응을 ELISA 분석을 통해 조사하였다. ELISA 분석은 항 HIV IgG 반응을 특이적으로 관찰하기 위하여 HIV 입자를 항원으로 이용하였고, 양고추냉이 퍼록시다제(horseradish peroxidase, HRP)가 결합되어 있는 항-마우스 IgG, IgG1 및 IgG2a(Southern Biotechnology, USA)를 각각 이차 항체로 사용하였다. 발색반응은 테트라메틸-벤지딘(tetramethyl-benzidine,TMB) 용액을 기질(Sigma)로 사용하여 수행하였다.Human immunodeficiency virus (HIV) particles pretreated with aluminum hydroxide (Sigma) were mixed together with 5 μg / mouse and 50 μg / mouse M16 CpG ODN at 6-8 weeks of age. Balb / c female mice (Korean Experimental Animal Center) were injected subcutaneously. All mice were boosted four weeks after the first immunization and two weeks later the humoral immune response was examined by ELISA analysis. ELISA assays used HIV particles as antigen to specifically observe anti-HIV IgG responses, and anti-mouse IgG, IgG1 and IgG2a (horseradish peroxidase (HRP)) bound to horseshoe peroxidase (HRP) (Southern Biotechnology, USA) were each used as secondary antibodies. Color reaction was carried out using tetramethyl-benzidine (TMB) solution as the substrate (Sigma).

그 결과를도 4a에 도시하였다. 3' 말단에 dG 연속서열이 결합된 M16을 HIV 입자와 함께 처리한 경우 전체 면역글로블린G (IgG)와 대표적인 Th-1 면역반응인 IgG2a 반응 모두 확률적으로 유의하게 증가함을 알 수 있었다. 그러나 3' 말단에 dC 연속서열이 있는 경우나 CpG 대신 GpC가 있는 ODN (M16C, M16GC)들을 함께주입한 경우 그 효과가 미미하였다(도 4a참조). 이 결과는 M16 ODN이 Th-1 면역반응을 효과적으로 증가시켰음을 나타내고 그 효과는 M16의 CpG 모티프와 3' 말단의 dG 연속서열에 의존적임을 시사한다.The result is shown in FIG . 4A . Treatment of M16 with dG sequence sequence at the 3 'end with HIV particles showed a significant increase in both total immunoglobulin G (IgG) and IgG2a, a typical Th-1 immune response. However, the effects were minimal when the d 'sequence was present at the 3' end or when ODNs with GpC (M16C, M16GC) were injected together instead of CpG (see FIG. 4A ). This result suggests that M16 ODN effectively increased Th-1 immune response and that the effect is dependent on the CpG motif of M16 and dG sequence of 3 'end.

(7-2) dG 연속서열이 결합된 CpG ODN의 체액성 면역반응 유발효과 (항원: gDE2t)(7-2) Induced Humoral Immune Response of CpG ODN Conjugated with dG Sequence (Antigen: gDE2t)

일반적으로 포스포로티오에이트 골격을 갖는 CpG ODN만이 항원과 함께 주입되었을 때 면역반응을 주로 Th-1 면역반응 쪽으로 유도한다고 알려져 있다. 따라서 dG 연속서열 결합에 의한 면역조절 효과를 더욱 상세히 조사하기 위하여 다음으로 이미 기존에 그 효과가 잘 알려진 포스포로티오에이트 골격의 ODN인 1826T를 비교군으로 하여 1826D와 1826D의 3' 말단에 dG 연속서열을 결합시킨 M21의 효과를 비교 분석하였다. 항원으로는 C형 간염 바이러스(hepatitis C virus, HCV)의 당단백질인 E2 단백질에 헤르페스 심플렉스(herpes simplex virus, HSV)의 당단백질 gD가 융합된 형태의 gDE2t를 사용하였다. 또한 ODN의 면역조절 효과를 보다 정확히 관찰하기 위하여 알루미늄 하이드록사이드(alum)를 사용하지 않고 비교적 작은 양 (2 μg/생쥐)의 CpG ODN을 주입하였다. 면역 방법은 중국 햄스터 난소세포(CHO)로부터 분리한 5 μg의 gDE2t 단백질을 2 μg의 ODN(1826D, 1826T, M21)과 함께 근육주사를 통해 Balb/c 생쥐에 주입하고 역시 4주 뒤에 부스팅(boosting)을 하고 그 후 2주 뒤에 체액성 면역반응을 조사하였다. ELISA 분석은 항-E2t IgG2a 반응을 특이적으로 관찰하기 위하여 CHO에서 유래된 Hgh-E2t 단백질을 항원으로 이용하였고 HRP가 결합되어 있는 항-마우스 IgG2a를 이차 항체로 이용하였다. 그 결과를도 4b에 나타내었다.In general, only CpG ODN having a phosphorothioate backbone is known to induce an immune response mainly to a Th-1 immune response when injected with antigen. Therefore, in order to investigate the immunomodulatory effect by dG sequential binding in detail, next, 1826T, an ODN of a phosphorothioate backbone, which is well known in the past, was used as a comparison group. The effect of M21 binding sequence was analyzed. As an antigen, gDE2t was used in which the glycoprotein gD of the herpes simplex virus (HSV) was fused to the E2 protein of the hepatitis C virus (HCV). In addition, a relatively small amount of CpG ODN was injected without using aluminum hydroxide (2 μg / mouse) to more accurately observe the immunomodulatory effects of ODN. The immunization method was injected into Balb / c mice via intramuscular injection of 5 μg of gDE2t protein isolated from Chinese hamster ovary cells (CHO) with 2 μg of ODN (1826D, 1826T, M21) and also boosted after 4 weeks. 2 weeks later, the humoral immune response was examined. In the ELISA assay, the Hgh-E2t protein derived from CHO was used as an antigen to specifically observe the anti-E2t IgG2a response, and the anti-mouse IgG2a to which HRP was bound was used as a secondary antibody. The results are shown in Figure 4b .

대표적인 Th-1 면역반응인 IgG2a 역가를 조사하였을 때 포스포다이에스터 골격의 CpG ODN인 1826D는 E2에 대해 매우 낮은 IgG2a 역가를 보였다. 그러나 포스포로티오에이트 골격으로 변형된 1826T는 기존의 보고와 마찬가지로 높은 IgG2a 역가를 나타냈다. 1826D의 3' 말단에 dG 연속서열을 결합시킨 M21의 경우에는 1826D에 비해 약 50배 정도 높은 IgG2a 반응을 보였다. 이 결과는 상기 (7-1)의 결과와 일치한다고 할 수 있다. 즉 dG 연속서열의 결합에 의해 포스포다이에스터 골격의 CpG ODN의 Th-1 면역반응 유도 능력이 증가되었다.When examining IgG2a titer, a representative Th-1 immune response, CpG ODN of the phosphodiester backbone 1826D showed very low IgG2a titer against E2. However, 1826T modified with phosphorothioate backbone showed high IgG2a titers, as previously reported. In the case of M21 in which the dG sequence was coupled to the 3 'end of 1826D, the IgG2a response was about 50 times higher than that of 1826D. This result can be said to agree with the result of (7-1). In other words, the binding of the dG sequencing increased the ability of the phosphodiester backbone to induce Th-1 immune response of CpG ODN.

(7-3) dG 연속서열이 결합된 CpG ODN의 세포성 면역반응 유발효과 (항원: gDE2t)(7-3) Induced Cellular Immune Response of CpG ODN Conjugated with dG Sequence (Antigen: gDE2t)

이를 더욱 자세히 조사하기 위해 면역된 생쥐의 지라로부터 CD4+T 세포를 분리하여 활성화시켰을 때 분비되는 사이토카인을 조사하였다. 2× 105의 CD4+T 세포에 중국 햄스터 난소세포(chinese hamster ovary, CHO)에서 분리된 E2t 항원을 각각 1 또는 5 μg/ml의 농도로 처리하고 37℃에서 5일 동안 배양하였다. 배양액으로부터 Th-1 면역반응의 대표적인 사이토카인인 IFN-γ와, Th-2 면역반응의 대표적인 사이토카인인 IL-4의 분비정도를 비교함으로써 면역반응의 타입을 결정하였다.도 4c에서 볼 수 있듯이 1826D에 비해 M21을 함께 주입한 경우 높은IFN-γ/IL-4 비율을 보인다는 것을 알 수 있었다. 또한 이러한 결과는 1826T를 주입한 경우도 관찰되었다. 즉, dG 연속서열의 결합으로 인해 포스포다이에스터 골격의 CpG ODN의 면역조절 능력이 포스포로티오에이트 골격으로의 변형과 유사한 방식으로 면역반응을 Th-1 쪽으로 유도함을 알 수 있다.To investigate this in more detail, the cytokines secreted when CD4 + T cells were isolated and activated from the spleen of immunized mice were examined. 2 × 10 5 CD4 + T cells were treated with E2t antigen isolated from Chinese hamster ovary (CHO) at a concentration of 1 or 5 μg / ml and incubated at 37 ° C. for 5 days. The type of immune response was determined by comparing IFN-γ, a representative cytokine of Th-1 immune response, and IL-4, a representative cytokine of Th-2 immune response, from the culture. As can be seen in FIG. 4c , when M21 was injected together compared to 1826D, a high IFN-γ / IL-4 ratio was observed. These results were also observed when 1826T was injected. In other words, it can be seen that the immunomodulatory ability of the CpG ODN of the phosphodiester backbone induces an immune response toward Th-1 in a similar manner to that of the phosphorothioate backbone due to the binding of the dG sequence.

<실험예 8> ODN 양쪽 말단에 포스포로티오에이트 변형의 도입에 의한 사이토카인 분비 능력 향상Experimental Example 8 Improvement of cytokine secretion ability by introducing phosphorothioate modification at both ends of ODN

3' 말단에 dG 연속서열이 도입된 포스포다이에스터 CpG ODN의 생체내 핵산 분해효소 저항성을 더욱 증가시키기 위해 본 실험에서는 포스포다이에스터 CpG ODN의 양쪽 말단 두 개의 염기결합을 포스포다이에스터 결합에서 포스포로티오에이트 결합으로 변형하였다. 수상돌기세포에서 가장 높은 정도로 IL-12를 분비시킨 M21의 양쪽 끝 두 개의 염기를 각각 포스포로티오에이트 결합으로 치환한 뒤 (M21E) 생체외 실험을 통해 IL-12의 분비능력을 1826T 및 M21과 비교 분석하였다. 그 결과를 하기 표 6 에 나타내었다. 하기 표에서 소문자는 포스포로티오에이트 결합을, 대문자는 포스포다이에스터 결합을 나타낸다.In order to further increase the in vivo nuclease resistance of the phosphodiester CpG ODN having the dG sequencing introduced at the 3 'end, in this experiment, two base bonds at both ends of the phosphodiester CpG ODN are bound to the phosphodiester. Modified to phosphorothioate bonds. After exchanging the two bases of M21 which secreted IL-12 to the highest extent in dendritic cells with phosphorothioate bonds (M21E), the secretion capacity of IL-12 was determined in vitro by 1826T and M21. Comparative analysis. The results are shown in Table 6 below. Lowercase letters indicate phosphorothioate bonds and uppercase letters indicate phosphodiester bonds.

양쪽 말단을 포스포로티오에이트 결합으로 치환시 사이토카인 분비에 미치는 영향Effect of cytokine secretion on both ends by phosphorothioate linkage 명칭designation 서열번호SEQ ID NO: 서열order IL-12(ng/ml)IL-12 (ng / ml) 1826T1826T 1One 5' tccatgacgttcctgacgtt3'5 'tccat gacgtt cct gacgtt 3' 5.41 ± 1.285.41 ± 1.28 M21M21 1414 5' TCCATGACGTTCCTGACGTTGGGGGG 3'5 'TCCAT GACGTT CCT GACGTT GGGGGG 3' 3.04 ± 0.573.04 ± 0.57 M21EM21E 1818 5' tcCATGACGTTCCTGACGTTGGGGgg 3'5 'tcCAT GACGTT CCT GACGTT GGGGgg 3' 6.03 ± 2.196.03 ± 2.19

그 결과, M21의 양쪽 말단 두 개의 염기에 포스포로티오에이트 결합을 도입한 M21E는 M21에 비해 두 배 정도 높고 또한 수상돌기세포에서 가장 높은 IL-12 분비 능력을 보였던 1826T에 비해서도 더 높은 수준으로 IL-12 분비자극 활성을 나타내었다. 이 결과는 양쪽 끝 부분만 포스포로티오에이트 변형을 도입함으로써 사이토카인 분비자극활성을 더욱 높이고 핵산 분해효소 저항성을 더욱 증가시킬 수 있음을 보여준다.As a result, M21E, which introduced phosphorothioate linkages at both bases of both ends of M21, was twice as high as M21 and higher than that of 1826T, which showed the highest IL-12 secretion capacity in dendritic cells. -12 secretory stimulatory activity. These results show that by introducing phosphorothioate modifications only at both ends, cytokine secretion stimulation activity can be further enhanced and nuclease resistance can be further increased.

이상에서 살펴본 바와 같이, 본 발명의 dG 연속서열이 3' 말단에 결합된 변형된 포스포다이에스터 CpG ODN은 높은 Th-1 면역반응 유도활성을 보이며, 기존에 알려진 포스포로티오에이트 골격으로 변형된 CpG ODN과는 달리 생체내에서 독성을 나타내지 않아 안전성이 뛰어나므로 효과적인 백신 보조제 및 면역치료제로 사용될 수 있다.As described above, the modified phosphodiester CpG ODN in which the dG sequential sequence of the present invention is bound to the 3 'end shows high Th-1 immune response inducing activity, and is modified with a known phosphorothioate backbone. Unlike CpG ODN, it does not show toxicity in vivo and thus has excellent safety and can be used as an effective vaccine adjuvant and immunotherapy.

Claims (13)

면역활성을 갖는 포스포다이에스터 올리고데옥시뉴클레오티드(ODN)에 있어서, 데옥시리보구아노신(dG) 연속서열이 결합된 것을 특징으로 하는 dG가 수식된 올리고데옥시뉴클레오티드.A phosphodiester oligodeoxynucleotide (ODN) having immunological activity, wherein the deoxyriboguanosine (dG) sequencing is bonded to a dG-modified oligodeoxynucleotide. 제 1항에 있어서, ODN은 CpG 모티프를 갖는 것을 특징으로 하는 dG가 수식된 올리고데옥시뉴클레오티드.10. The dG modified oligodeoxynucleotide of claim 1, wherein the ODN has a CpG motif. 제 1항에 있어서, dG 연속서열은 ODN의 3' 말단에 결합한 것으로 특징으로 하는 dG가 수식된 올리고뉴클레오티드.The oligonucleotide of claim 1, wherein the dG sequencing is bound to the 3 'end of the ODN. 제 1항에 있어서, dG 연속서열은 4 내지 15개 이하의 뉴클레오티드 길이를 가지며, 최소한 4개 이상의 dG가 연속되어 있는 것을 특징으로 하는 dG가 수식된 올리고뉴클레오티드.The oligonucleotide of claim 1, wherein the dG sequence is 4 to 15 nucleotides in length and at least 4 dGs are contiguous. 제 1항에 있어서, 5' 또는 3' 말단의 1∼3 개의 포스포다이에스터 뉴클레오티드 결합이 포스포로티오에이트 결합으로 치환된 것을 특징으로 하는 dG가 수식된 올리고뉴클레오티드.The dG-modified oligonucleotide according to claim 1, wherein one to three phosphodiester nucleotide bonds at the 5 'or 3' end are replaced with phosphorothioate bonds. 제 1항에 있어서, ODN은 SR(scavenger receptor)을 갖는 면역세포에 특이적으로 결합하는 것을 특징으로 하는 dG가 수식된 올리고뉴클레오티드.The oligonucleotide of claim 1, wherein the ODN specifically binds to immune cells having a scavenger receptor (SR). 제 6항에 있어서, 수상돌기세포(dendritic cell), 대식세포(macrophage), B 세포를 포함하는 항원제시세포(antigen presenting cells)에 특이적으로 작용하는 것을 특징으로 하는 dG가 수식된 올리고뉴클레오티드.7. The oligonucleotide of claim 6, wherein the oligonucleotide is modified specifically for antigen presenting cells, including dendritic cells, macrophages, and B cells. 제 1항에 있어서, 수상돌기세포로부터 IL-12, TNF-α 분비를 촉진시키는 것을 특징으로 하는 dG가 수식된 올리고뉴클레오티드.2. The dG-modified oligonucleotide according to claim 1, which promotes secretion of IL-12 and TNF-α from dendritic cells. 제 1항 또는 제 5항에 있어서, 서열번호 2, 서열번호 9, 서열번호 14, 서열번호 16 또는 서열번호 18로 표시되는 염기서열을 갖는 dG가 수식된 올리고뉴클레오티드.The oligonucleotide according to claim 1 or 5, wherein the dG has a nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 16, or SEQ ID NO: 18. 제 1항의 dG가 수식된 올리고뉴클레오티드를 유효성분으로 하는 백신 보조제 또는 면역 치료제.Vaccine adjuvant or immunotherapeutic agent comprising the oligonucleotide modified dG of claim 1 as an active ingredient. 제 10항에 있어서, 다른 항원과 함께 추가적으로 사용되는 것을 특징으로 하는 백신 보조제 또는 면역 치료제.The vaccine adjuvant or immunotherapeutic agent according to claim 10, further used together with another antigen. 제 10항 또는 제 11항에 있어서, 상기 백신은 AIDS, 만성 C 형 간염 등의 질병을 예방 또는 치료를 위한 것임을 특징으로 하는 백신 보조제.The vaccine adjuvant according to claim 10 or 11, wherein the vaccine is for preventing or treating diseases such as AIDS and chronic hepatitis C. 제 10항 또는 제 11항에 있어서, 상기 치료제는 알레르기, 천식, 자가면역질환의 치료에 사용되는 것을 특징으로 하는 면역치료제.The immunotherapeutic agent according to claim 10 or 11, wherein the therapeutic agent is used for the treatment of allergy, asthma and autoimmune diseases.
KR1019990060032A 1999-12-21 1999-12-21 Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety KR100359753B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1019990060032A KR100359753B1 (en) 1999-12-21 1999-12-21 Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1019990060032A KR100359753B1 (en) 1999-12-21 1999-12-21 Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety

Publications (2)

Publication Number Publication Date
KR20010063153A true KR20010063153A (en) 2001-07-09
KR100359753B1 KR100359753B1 (en) 2002-11-09

Family

ID=19627833

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1019990060032A KR100359753B1 (en) 1999-12-21 1999-12-21 Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety

Country Status (1)

Country Link
KR (1) KR100359753B1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004039829A3 (en) * 2002-10-29 2004-09-10 Coley Pharmaceutical Group Ltd Use of cpg oligonucleotides in the treatment of hepatitis c virus infection
KR100681470B1 (en) * 2003-03-03 2007-02-12 연세대학교 산학협력단 Oligonucleotides for stimulating immune response
KR100721928B1 (en) * 2004-11-05 2007-05-28 주식회사 바이오씨에스 Pharmaceutical composition for treating or preventing dermatitis comprising CpG oligodeoxynucleotide
WO2007139190A1 (en) 2006-05-31 2007-12-06 Toray Industries, Inc. Immunostimulatory oligonucleotide and pharmaceutical application thereof
KR100906970B1 (en) * 2006-06-03 2009-07-10 주식회사 바이오씨에스 Therapeutic use of CpG oligodeoxynucleotide for skin immune disease
WO2019115386A1 (en) * 2017-12-15 2019-06-20 Bayer Animal Health Gmbh Immunostimulatory oligonucleotides

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004039829A3 (en) * 2002-10-29 2004-09-10 Coley Pharmaceutical Group Ltd Use of cpg oligonucleotides in the treatment of hepatitis c virus infection
EP2241325A1 (en) * 2002-10-29 2010-10-20 Coley Pharmaceutical Group, Ltd. Use of CPG oligonucleotides in the treatment of hepatitis C virus infection
KR100681470B1 (en) * 2003-03-03 2007-02-12 연세대학교 산학협력단 Oligonucleotides for stimulating immune response
KR100721928B1 (en) * 2004-11-05 2007-05-28 주식회사 바이오씨에스 Pharmaceutical composition for treating or preventing dermatitis comprising CpG oligodeoxynucleotide
WO2007139190A1 (en) 2006-05-31 2007-12-06 Toray Industries, Inc. Immunostimulatory oligonucleotide and pharmaceutical application thereof
US8592566B2 (en) 2006-05-31 2013-11-26 Toray Industries, Inc. Immunostimulatory oligonucleotides and use thereof in pharmaceuticals
KR100906970B1 (en) * 2006-06-03 2009-07-10 주식회사 바이오씨에스 Therapeutic use of CpG oligodeoxynucleotide for skin immune disease
WO2019115386A1 (en) * 2017-12-15 2019-06-20 Bayer Animal Health Gmbh Immunostimulatory oligonucleotides
CN111801419A (en) * 2017-12-15 2020-10-20 拜耳动物保健有限责任公司 Immunostimulatory oligonucleotides
JP2021506245A (en) * 2017-12-15 2021-02-22 バイエル・アニマル・ヘルス・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Animal Health Gmbh Immunostimulatory oligonucleotide
JP7273040B2 (en) 2017-12-15 2023-05-12 バイエル・アニマル・ヘルス・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング immunostimulatory oligonucleotide

Also Published As

Publication number Publication date
KR100359753B1 (en) 2002-11-09

Similar Documents

Publication Publication Date Title
EP2901856B1 (en) Immunostimulatory oligonucleotide multimers
JP6406793B2 (en) Immunoregulatory nucleotide (IRO) compounds that modulate immune responses based on toll-like receptors
CN102333538B (en) Immunostimulatory oligonucleotides
US20040052763A1 (en) Immunostimulatory RNA/DNA hybrid molecules
US7498426B2 (en) Immunostimulatory oligonucleotide multimers
KR101065760B1 (en) Immunostimulatory oligonucleotide and pharmaceutical application thereof
EP0855184A1 (en) Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
AU2005216075B2 (en) Potent mucosal immune response induced by modified immunomodulatory oligonucleotides
WO2006035939A1 (en) Immune stimulating oligonucleotide and use thereof in pharmaceutical
CA2289741A1 (en) Oligonucleotide adjuvant
JP2005502338A (en) Combinatorial motif immunostimulatory oligonucleotides with improved activity
WO2007118660A2 (en) Her-2/neu multi-peptide vaccine
TW200916106A (en) RNA sequence motifs in the context of defined internucleotide linkages inducing specific immune modulatory profiles
KR100359753B1 (en) Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety
TWI719351B (en) Nano-particles that contain synthetic variants of gm3 ganglioside as adjuvants in vaccines
US20040009944A1 (en) Methylated immunostimulatory oligonucleotides and methods of using the same
EP1506010B1 (en) Methylated immunostimulatory oligonucleotides and methods of using the same
RU2815763C1 (en) Composition for immunostimulation and use thereof
Takabayashi et al. Protein-Immunostimulatory DNA-Conjugate: A Novel Immunogen
MXPA06006506A (en) Modulation of immunostimulatory properties by small oligonucleotide-based compounds

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20111024

Year of fee payment: 10

LAPS Lapse due to unpaid annual fee