KR20010063153A - Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety - Google Patents

Abstract

PURPOSE: Provided is a CpG oligodeoxynucleotide variant which binds to dG repetitive sequence and has improved immune regulating activity and stability. This oligodeoxynucleotide variants does not express toxicity in a living body, and is thus useful to vaccine adjuvant for the prevention and treatment of infectious disease such as AIDS, hepatitis C type and chronic hepatitis. CONSTITUTION: CpG oligodeoxynucleotide variant having improved immune regulating activity is prepared by binding deoxyriboguanosine(dG) repeat sequence to 3'end of CpG oligodeoxynucleotide. The CpG ODN variant improves bindability to an immunocyte having scavenger receptor to maximize the immunity of helper T-cell type 1 and is thus useful as a vaccine adjuvant.

Description

Modified phosphodiester CpG oligdeoxynucleotides conjugated with a dG run which have improved immunomodulatory activity and safety}

The present invention relates to a CpG oligodeoxynucleotide variant with increased immunomodulatory capacity, and more specifically, to a deoxyriboguanosine (dG) sequence sequence at the 3 'end of the CpG oligodeoxynucleotide having immunomodulatory capacity. Thereby improving specific binding ability to immune cells having a scavenger receptor (hereinafter referred to as SR), maximizing secondary T cell type-1 (Th-1) immune activity while not inducing toxicity to the human body. CpG ODN variants useful as vaccine adjuvants and immunotherapeutic agents.

CpG oligonucleotides (hereinafter referred to as 'CpG ODN') are known as useful immune modulators that can activate both innate and acquired immune responses. Specifically, CpG ODN mainly activates antigen presenting cells (hereinafter referred to as APCs), eg, B cells, macrophages, and dentritic cells, which are important for in vivo immunity. In vitro experiments have been shown to promote the secretion of cytokines or the expression of co-stimulatory molecules (Klinman, DM et al ., PNAS USA 93, 2879-2883, 1996; Krieg). , AM et al ., Nature 374, 546-549, 1995; Jakob, T. et al ., J. Immunol. 161, 3042-3049, 1998; Sparwasser, T. et al ., Eur. J. Immunol. 28 , 2045-2054, 1998). CpG ODN is introduced into the endosomes of APC and its activity is essential for maturation of endosomes. However, detailed mechanisms such as what in vivo signaling processes the CpG ODN undergoes inducing an immunostimulating effect or what in vivo molecules recognize the CpG sequence of the ODN are still unknown.

On the other hand, CpG ODN is a short-length oligonucleotide is easily degraded by the nuclease (nuclease) that is abundant in vivo and loses its activity. In order to solve this problem, a method of modifying the skeleton of CpG ODN to a phosphorothioate backbone has been used (Stein, CA & Cheng, YC Science 261, 1004-1012, 1993). This is because phosphorothioate bonds have higher resistance to nucleic acid degrading enzymes than phosphodiester backbones, and thus increase the in vivo half-life of CpG ODN. Recently, however, it has been reported that the phosphorothioate backbone itself strongly induces nonspecific immunological activity in vivo, thereby causing toxicity in vivo (Monteith, DK et al ., Toxicol. Pathol. 27, 307-317 , 1999; Wagner, H. Adv. Immunol. 73, 329-368, 1999), a method of modifying the backbone of CpG ODN with phosphorothioate linkages has revealed safety problems.

Accordingly, the present inventors studied to find a new CpG ODN variant that can minimize the nonspecific immune response harmful to the human body while maximizing the immune activity of CpG ODN, so that the 3 'end of the phosphodiester CpG ODN has a constant length. Incorporation of oxyriboguanosine dG run enables specific delivery to immune cells expressing scavenger receptors (SR), such as B cells, macrophages and dendritic cells. In addition, non-specific immunity that maximizes adjuvant T cell-1 (Th-1) immune responses in vivo, inhibits the degradation of CpG ODN by nucleases and is toxic in humans unlike the phosphorothioate backbone The present invention has been completed by finding out that the reaction can be minimized.

It is an object of the present invention to provide a phosphodiester CpG ODN variant that maximizes Th-1 immune activity and minimizes nonspecific immune responses that are toxic to the human body.

It is also an object of the present invention to provide a CpG ODN variant with increased specific binding capacity to immune cells having SR.

Further object of the present invention is to provide a use of the CpG ODN variant as a vaccine adjuvant and immunotherapy.

1 is a graph showing the effect of dG sequence-bound CpG ODN on the secretion of IL-12 in macrophages (FIG. 1A) and B cells (FIG. 1B),

2 is a graph showing cytokine secretion efficacy according to the length of the dG sequence bound to the 3 'end,

Figure 3a is a graph showing the degree of binding of the dG sequential ODN bound to the surface of the dendritic cells,

Figure 3b is a graph showing the degree of inflow of the OG bound to the dG sequence sequence into the dendritic cells,

FIG. 3C shows competitive binding assay using SR-A ligand dG ₂₀ , fucoidan, dextran sulfate, SR-BI ligand LDL, CD36 ligand oleic acid, Mac-1 ligand fibrinogen and anti-CD18 monoclonal antibody. It is the result of the investigation that the cell surface receptors in which the dG sequence-bound ODN enters the cell.

FIG. 4A shows whether the dG sequence induces a Th-1 immune response in vivo by inducing an immune response with or without an ODN bound to a dG sequence with HIV particles . FIG. Is the result of measuring the quantity

Figure 4b shows the ELISA results measuring the anti-E2 IgG2a titers after intramuscular injection of 1826D, 1826T and M21 and gDE2t proteins in mice,

4C is a graph showing the effect of ODNs and gDE2t protein on the secretion of cytokines (IL-4 and IFN-γ) from CD4 ⁺ T cells of mice immunized together.

In order to achieve the above object, the present invention is characterized in that the deoxyriboguanosine sequence (dG run) is coupled to the 3 'end and has a CpG motif phosphodiester oligodeoxynucleotide (oligodeoxynucleotide, hereinafter' ODN ' ') Provides a variant.

The present invention also provides a CpG ODN variant having the nucleotide sequence set forth in SEQ ID NO: 2, 9, 14, 16 or 18 specifically inducing Th-1 immune activity in the dG sequencing CpG ODN.

In another aspect, the present invention provides a use of the CpG ODN conjugated with the dG sequence sequence as a vaccine adjuvant and immunotherapy.

Hereinafter, the present invention will be described in detail.

In the present specification, 'ODN' refers to an oligodeoxynucleotide having a length of 11 to 26 nt capable of activating an immune response. In particular, 'CpG ODN' refers to a CpG motif (5 'Purine Purine CpG Pyrimidine) indicating immunomodulatory ability. Oligodeoxynucleotides with Pyrimidine 3 ').

'dG sequence' refers to a form in which deoxyriboguanosine is linked to CpG ODN by at least four consecutive phosphodiester bonds.

In the present invention, the p19 ODN sequence is derived from the amp ^r gene of the already known pUC19 plasmid (base sequence 2293 to 2312). In the embodiment of the present invention, the synthesis was made by GenoTech (Daejeon, Korea). Other ODNs can be easily obtained by synthesizing p19 and known ODN sequences with dG sequences linked to the 3 ′ end.

ODN prepared to have phosphorothioate bonds are protected from the attack of nucleases present in the cell and serve to extend the half-life of the ODN in vivo. However, there are many problems in safety due to the induction of nonspecific immune response by phosphorothioate binding itself. In fact, the present inventors treated ODN (50 μg) having phosphorothioate bonds with aluminum hydroxide and injected it into mice with 5 μg of gDE2t derived from CHO, indicating that granuloma occurred at the injection site. Confirmed. On the other hand, CpG ODNs with phosphodiester bonds did not show a nonspecific immune response that is harmful to humans in vitro as well as in vivo experiments. This is believed to be due to action on immune cells through nonspecific endocytosis to a considerably lower level in terms of attackability and efficiency against nucleases. Thus, in order to solve the problem of safety of phosphorothioate bonds and the problem of low immunogenicity of known phosphodiester bonds, in the present invention, the dG sequence is 3 'of CpG ODN having a phosphodiester bond. Binding to the terminal solves the problem of immunogenicity and safety at the same time.

In the present invention, CpG ODNs that can increase the immune response-inducing activity by binding the dG sequence to the 3 'end are p19 of SEQ ID NO: 2, M16 of SEQ ID NO: 9, M21 of SEQ ID NO: 14, and M22 of SEQ ID NO: 16. It is preferable. When the dG sequence is bound to the 5 'end, interleukin-12 (interleukin-12, hereinafter referred to as IL-12) is secreted from the dendritic cells to a lower degree than when the dG sequence is not bound. dG sequencing inhibits the secretion capacity of IL-12 induced by the CpG motif. The 5 'dG sequence is more effective in cell binding and inflow into cells than in the case of 3' dG sequence, but the 3 'end is bound to the 5' end. It is more effective in cell binding and intracellular inflow than in the case. Such cell binding and intracellular influx effect disappears when the dG sequence is replaced with another base, for example, the dC sequence, indicating that it is a specific effect of the dG sequence.

In particular, dendritic cells in the production of IL-12 is the most desirable target of the CpG ODN coupled to the dG sequence of the present invention, which is essential for induction of immune response in vivo and IL-12 is Th-1 This is because it plays an important role in inducing an immune response. Although dendritic cells are four times lower in binding capacity to ODN than macrophages, CpG ODN to which dG sequencing of the present invention is bound produces about 50 times more IL-12 than macrophages.

In vitro results of treatment with dendritic cells isolated from spleens of mice in the embodiment of the present invention (CpG ODNs) stimulate the dendritic cells tumor necrosis factor-α (hereinafter referred to as TNF- and a high level of IL-12. In addition, the intraperitoneal macrophages and B cells were also induced to secrete IL-12. This effect appears only when the dG sequence was bound to the 3 'end of the CpG ODNs, but could not be observed when bound to the 5' end.

Meanwhile, as a result of examining competitive binding patterns using various ligands in order to test whether the OGs in which dG sequences are bound are bound by any of the receptors present on the surface of immune cells, the dG sequences of the present invention are Cell binding of bound ODN was inhibited only by ligands specific for SR-A, from which it can be seen that ODN bound with dG sequence was introduced into cells via a receptor having SR-A ligand specificity.

CpG ODNs having dG sequences prepared by the present invention selectively form tetraplex structures, which are four-stranded helix, to selectively bind to SR of antigen presenting cells and consequently intracellularly. It is expected to increase the concentration of CpG ODNs. These tetraplex structures are known to be stabilized by G-quartets produced by dG sequences, and CpG ODN combined with dG sequences sequence affects the efficiency of binding and influx of APCs. Receptor signals by binding to SR are known to affect cytokine production. For example, it has been reported that maleyl-BSA (maleyl-bovine serum albumin) binds to SR and promotes transcription of TNF-α gene in mouse macrophages. In contrast, it has been reported that LPS-induced production of IL-12 is inhibited in macrophages derived from myeloid cells. On the other hand, in the present invention, only the G-quartet itself does not seem to increase the production of cytokines such as TNF-α and IL-12 by binding to SR. This can be seen from the fact that cytokine production is not induced at all by M1 or M16GC, which has a dG ₆ sequence but does not have a CpG motif. Therefore, in order to exhibit increased immune activity, it is important that the dG sequence not only binds to the 3 'end of the ODN, but also the ODN itself has a CpG motif.

The length of the dG sequence requires at least four consecutive dG sequences combined with at least four consecutive dGs to achieve a tetraplex structure, and the combination of six dGs is most effective for secreting IL-12. IL-12 secretion is not significantly different when the length of dG sequence is continuously increased, but TNF-α shows the highest secretion level when 15 dG is bound. Therefore, since the excess TNF-α secretion in vivo may be toxic, it is preferable that the length of the dG sequence is at least 4 to 15 or less.

On the other hand, CpG ODN to which the dG sequencing of the present invention is bound may exhibit more enhanced cytokine secretion activity by modifying 5 'or 3' terminal base bonds to phosphorothioate bonds. In the above modification of the phosphorothioate bond, it is preferable to modify 1 to 3 base bonds at the 5 'or 3' end.

More preferably, M21E of SEQ ID NO: 18 in which two base bonds are modified at both ends may be used.

According to Experimental Example 8 of the present invention, in order to further increase the resistance of the phosphodiester CpG ODN in which the dG sequence was introduced at the 3 'end to the nucleic acid degrading enzyme in vivo, the CpG ODN in which the dG sequence of the present invention was bound The effects of cytokine production on dendritic cells were investigated by transforming two base bonds into phosphorothioate bonds at both ends of. Specifically, two bases at both ends of M21, the most capable of inducing IL-12 secretion in dendritic cells, were replaced with phosphorothioate bonds, and the cytokine secretion was compared with 1826T and M21 through in vitro experiments. It was. As a result, CpG ODN with phosphorothioate bonds in both bases showed higher IL-12 secretion capacity than M21 consisting only of phosphodiester bonds, and all bonds were less than 1826T, with phosphorothioate bonds. It was confirmed that the IL-12 secretory stimulating activity at a high level. This fact suggests that by introducing phosphorothioate bonds only at both ends, cytokine secretion stimulating activity can be further increased and resistance to nucleases can be further increased.

CpG ODNs prepared by the present invention can be usefully used as a vaccine adjuvant and immunotherapeutic agent, and especially infectious agents such as allergy, asthma, autoimmune diseases such as AIDS, hepatitis C or chronic hepatitis It can be used as an adjuvant of preventive and therapeutic vaccines against diseases. At this time, the antigen and the ODN to induce an immune response is preferably added 2 to 3 times at intervals of 2 to 4 weeks in the amount of 0.1 ~ 2.5 mg / kg. Moreover, it is preferable that the ratio of ODN with respect to an antigen is 0.2-10. Antigens can be immunized with or alone with aluminum hydroxide, a vaccine adjuvant that can be used in the human body and can be administered by intramuscular or subcutaneous methods. dG continuous sequence of the 3 'ODN M16, M21 are the last name efficacy by combined increase respectively of Th-1 immune response in mice produced IgG2a and CD4 ⁺ T cells from the secondary high interferon -γ / IL -4 (IFN-γ / IL-4) secretion ratio.

The present invention will be described in detail by the following examples.

However, the following examples are illustrative of the present invention, and the scope of the present invention is not limited thereto.

EXAMPLES Preparation of CpG ODNs with dG Sequences Bound to the 3 ′ End

To determine the effect of dG sequences on CpG ODNs with phosphodiester backbone, putative dG run (GGGGCG) and CpG motifs, presumably deoxyriboguanosine sequences The appropriate base sequence with As a result, a sequence consisting of the 2293-2312 th 20 bases of amp ^r , the ampicillin resistance gene present in pUC19, was selected and named p19. In addition, 1826 (Jakob, T. et al ., J. Immunol. 161, 3042-3049, 1998), a CpG ODN already known as an immunosuppressive agent, was referred to as a phosphorothioate backbone (hereinafter referred to as 1826T). ) Or a phosphodiester backbone (hereinafter referred to as 1826D), which was manufactured and used by requesting synthesis from GenoTech. Using the ODNs as templates, ODNs were prepared by substituting some bases or binding dG run to 3 'or 5' ends.

In the same manner as described above to synthesize an oligonucleotide having the sequence shown in Table 1. In Table 1 below, underlining indicates the CpG motif sites present in each ODN, uppercase letters indicate phosphodiester bonds and lowercase letters indicate phosphorothioate bonds.

Base Sequences of CpG ODNs Prepared in the Present Invention designation SEQ ID NO: Sequence 1826T One 5 'tccat gacgtt cct gacgtt 3' 1826D 5 'TCCAT GACGTT CCT GACGTT 3' p19 2 5 'GGAA AACGTT CTTCGGGGCG 3' p19d 3 5 'GGAA AACGTT CTTC 3' M1 4 5 'GGAAAAGCTTCTTCGGGGCG 3' M7 5 5 'GGAA AACGTT CTTCGCCCCG 3' M13 6 5 'GGAA AACGTT CTTCGGGCCG 3' M14 7 5 'GGAA AACGTT CTTCGGCCCG 3' M15 8 5 'GGAA AACGTT CTTCGGCGCG 3' M16 9 5 'GGAA AACGTT CTTCGGGGGG 3' M19 10 5 'GGGGAA AACGTT CTTCGCCC 3' M26 11 5 'GGGGGGAA AACGTT CTTCGC 3' M27 12 5 'GGGGGGGGGAA AACGTT CTT 3' M20 13 5 'GGGGGGTCCAT GACGTT CCT GACGTT 3' M21 14 5 'TCCAT GACGTT CCT GACGTT GGGGGG 3' M12 15 5 'CTT AACGTT CT 3' M22 16 5 'CTT AACGTT CTGGGGGG 3' M23 17 5 'GGGGGGCTT AACGTT CT 3'

Experimental Example 1 Effect of dG Sequence on Cytokine Secretion from Dendritic Cells Isolated from Spleen of Mice

In order to analyze the degree of immunological activity of CpG ODN prepared in the above example, CpG ODN was isolated by separating dendritic cells from spleen of C57BL / 6 female mice (Korea Experimental Animal Center) about 6-8 weeks old. After treatment, the levels of tumor necrosis factor-α (TNF-α) and interleukin-12 (IL-12) were examined.

Isolation of dendritic cells has made some modifications to previous reports (Singh, N et al ., J. Immunol . 160, 4849-4880, 1998; Ridge, JP et al ., Science 271, 1723-1726, 1996). Was done through. That is, after splenocytes of the mouse were attached to the tissue culture plate for 90 minutes, the non-adherent cells were removed, and then 10 ng / ml of recombinant mouse GM was added to the adherent cells. -CSF (granulocyte macrophage-colony stimulating factor, R & D System) was incubated for one day. After incubation, the non-adherent cells and the weak adherent cells were separated by a percoll density gradient, and then a low density cell layer containing many dendritic cells was collected from the interface. Each CpG ODN was treated with 1.5 μM concentration in 1 × 10 ⁵ dendritic cells, and the culture medium was collected after 10 and 30 hours, respectively. The amount of secreted TNF-α and IL-12 was determined using commercial ELISA kits (Mouse TNF). -α DuoSeT ELISA Development System, TOTAL MOUSE IL-12 DuoSeT ELISA Development System; Genzyme). The results are shown in Table 2 below.

Lipopolysaccharide (lipopolysaccharide, referred to as LPS) was used as a positive control, and the amount of IL-12 and TNF-α was quantified using only medium as a negative control.

Effect on cytokine (IL-12, TNF-α) production in dendritic cells designation SEQ ID NO: IL-12 (ng / ml) TNF-α (pg / ml) 1826T One 5.41 ± 1.28 2768 ± 628 1826D 0.37 ± 0.07 134 ± 58 p19 2 1.32 ± 0.31 640 ± 96 p19d 3 0.07 ± 0.01 25 ± 3 M1 4 0.05 ± 0.01 27 ± 3 M7 5 0.09 ± 0.02 30 ± 3 M13 6 0.07 ± 0.01 20 ± 1 M14 7 0.05 ± 0.01 22 ± 2 M15 8 0.08 ± 0.02 36 ± 5 M16 9 2.40 ± 0.77 960 ± 166 M19 10 0.13 ± 0.05 39 ± 6 M26 11 0.13 ± 0.07 96 ± 26 M27 12 0.07 ± 0.03 64 ± 19 M20 13 0.42 ± 0.11 115 ± 29 M21 14 3.04 ± 0.57 1103 ± 176 M12 15 0.05 ± 0.01 18 ± 3 M22 16 0.88 ± 0.17 408 ± 55 M23 17 0.05 ± 0.01 40 ± 5 LPS 1.59 ± 0.25 844 ± 154 badge 0.07 ± 0.01 27 ± 4

As shown in Table 2 above, the phosphorothioate modification (1826T) showed significantly better cytokine secretion than the phosphodiester (1826D). However, p19 showed about four times higher IL-12 secretion than 1826D. In addition, this high level of cytokine secretion was found to be significantly reduced when the dG is replaced by some dG (M7, M13, M14, M15), or removed (p19d) in the sequence consisting of dG (GGGGCG). In addition, when dC of the sequential sequence consisting of dG of p19 was substituted with dG (M16), the activity was further increased. The effect of the sequence consisting of dG was also shown in CpG ODNs with different sequences or different lengths. That is, M21 and M22 showed significantly higher TNF-α and IL-12 secretion than 1826 and M12. In particular, when the dG sequence was bound to the 5 'end (M19, M26, M27), there was no effect on cytokine secretion. Consequently, the effect of the dG sequence was selectively shown only at the 3' end of CpG ODN. It can be seen that.

Experimental Example 2 Effect of dG Sequences on Peritoneal Macrophages and B Cells

In order to determine whether dG ODN promotes the secretion of cytokines in macrophages or B cells, as in dendritic cells, B cells obtained from peritoneal macrophages and spleen of mice were tested in the same manner as in Experimental Example 1.

Peritoneal macrophages were washed in the abdominal cavity of C57BL / 6 female mice (Korea Experimental Animal Center) about 6 to 8 weeks old with medium, inoculated into tissue culture plates for 9 hours, and then washed with medium 3 times. Only sex cells were isolated and used. B cells also isolate nonadherent cells from the spleen of mice and bind microbeads (miltenyl biotech) that recognize CD19 (complement differentiation 19), a characteristic surface marker for B cells. Separation was done using a miniMACS column (Miltenyl Biotech). After treating 3 × M CpG ODN with 1 × 10 ⁵ macrophages and 2 × 10 ⁵ B cells, respectively, the culture solution was obtained 30 hours later, and IL-12 ELISA was performed.

As a result, when CpG ODNs were treated to B cells isolated from mouse peritoneal macrophage and spleen as in dendritic cells, only ODN with dG sequencing at the 3 'end was highly secreted. Appeared. In particular, M16 and M21 showed significantly higher IL-12 secretion inducing activity than other ODN (see FIGS. 1A and 1B ).

Experimental Example 3 Change in efficacy according to the length of the continuous sequence consisting of dG bound to the 3 'end

p19d from which the sequential sequence consisting of dG of p19 (GGGGCG) was removed was combined with dG sequential sequences of various lengths at its 3 'ends, and cytokine secretion was measured in dendritic cells. The specific experimental procedure followed the method of Experimental Example 1. The result is shown in Fig.

As can be seen from the results of FIG. 2 , cytokine secretion requires dG sequence consisting of at least 4 consecutive dGs, and IL-12 secretion is most effective when dG _{6 is} bound to 6 deoxyriboguanosine. Appeared. IL-12 secretion was not significantly different when the length of dG sequence increased continuously, but TNF-α showed the highest level of secretion at dG ₁₅ , which was about 5 times higher than that of dG ₆ -bound ODN. Higher values.

From these results, it can be seen that the degree of secretion of TNF-α and IL-12 can be changed depending on the length of the dG sequence coupled to the 3 'end.

Experimental Example 4 Changes in Cell Binding and Inflow of ODNs by Binding of dG Sequences

(4-1) Effect of dG Sequence on ODN Cell Binding

For the effective activity of CpG ODN, a large amount of ODN must be introduced into the cell. Therefore, we investigated how the degree of binding to dendritic cells or the degree of inflow into cells changed by the binding of dG sequences.

For easy observation, fODNs in which fluorescent fluorescien is bound to the 3 'or 5' end of CpG ODN were used. The amount of fODN bound to the cells was treated with 5 μM of fODNs at 1 ° 10 ⁵ dendritic cells at 4 ° C for 1 hour and washed twice with PBS (phosphate buffered saline) to remove unbound fODNs and FACS ( Fluorescence was measured using Becton Dickinson, USA). The amount of fODN introduced into the cells was measured in 1 × 10 ⁵ dendritic cells treated with 1μM fODNs at 4 ° C for 30 minutes and incubated at 37 ° C for 1.5 or 6 hours, respectively, to remove fODN attached to the cell membrane. It was. The extent to which each ODN binds to and enters the dendritic cells is measured by mean fluorescent intensity (hereinafter referred to as MFI), and MFI in the presence of fM21 based on the MFI in the presence of embryos. The index of increase is expressed by the binding index and the internalization index.

The result is shown in FIG. 3 . That is, when the dG sequence was bound to 3 'or 5', the cell binding of ODN ( FIG. 3A ) and the influx of cells ( FIG. 3B ) were significantly increased compared to the case of ODN without dG sequence. On the other hand, when the dG sequence was located at the 3 'end position, it was found to be more effective in terms of cell binding and influx into the cell than when bound to the 5' end position. In addition, this effect disappears when the dG sequence is changed to the dC sequence, it can be seen that the specific effect of the dG sequence.

(4-2) Search for Receptors Binding to dG ODN

In order to investigate what receptors are capable of binding to the cell surface of ODNs, including dG sequences, a competitive binding assay was performed to treat ligands known to bind multiple receptors. In other words, dG ₂₀ , fucoidan (Sigma), dextran sulfate (Sigma) as SR-A ligand, low density lipoprotein (Sigma) as ligand of SR-BI, and oleic acid as ligand of CD36 (oleic acid, Sigma), fibrinogen (Sigma) and anti-CD18 monoclonal antibody (Pharmigen) and the like were used as ligands of Mac-1 (CD11b / CD18, αMβ2). First, each ligand of 0.25 mg / ml concentration and dG ₂₀ of 10 μM concentration were co-cultured with 1 μM concentration of fM21, and MFI from bound fM21 was measured to investigate the effect of each ligand on ODN cell binding. . As a result, only ligands specific for SR-A were able to inhibit the binding of fM21 ODN bound to dendritic cells bound to the 3 'end of the dG sequence (see FIG. 3C ). This result indicates that dG sequence is introduced into the cell via a receptor having SR-A ligand specificity.

Experimental Example 5 Inhibition of Cytokine Secretion Ability by dG sequencing bound to the 5 'end

As shown in the results of Experiment 1, when the dG sequence was coupled to the 5 'end, cytokine secretion was not increased from the dendritic cells at all (Table 2; M19, M26, M27). However, the 5 'dG sequence was also found to be significantly higher in tetraplex structure formation or dendritic cell binding than in the case of ODN without dG sequence (Experimental Example 4). These results indicate that the action of the dG sequence may vary depending on where in the CpG ODN. In this experiment with the dG continuous sequence CpG ODN cationic liposomes lipoic Zen ^{TM (lipogene TM, BodiTech, Korea} ) of (cationic liposome) to investigate the effect of the position in combination with CpG ODN by treating the dendritic cells The amount of CpG ODN flowing into the cells was tested after equalizing with or without dG sequence. In addition, in order to investigate the influence of the position of the dG sequence, 1826D of SEQ ID NO: 2 having only two CpG motifs and M12 of SEQ ID NO: 16 having only one CpG motif were used as controls, respectively, and the dG sequence was inserted at the 3 'end. The effects of the bound CpG ODN (M21, M22) and the CpG ODN (M20, M23) with dG sequencing on the 5 'end were investigated on cytokine secretion in dendritic cells.

First, the dendritic cells were treated with a mixture solution of 0.3 μM CpG ODNs incubated for 30 minutes at room temperature with 3 μg of lipogen and incubated for 4 hours. The lipogen-ODN mixture remaining in the culture was then removed, incubated for another 24 hours, and then the amount of IL-12 was measured from the culture. The results are shown in Table 3 below.

Effects of Cytokine Secretion on the Binding Position of dG Sequences designation dG run position IL-12 (ng / ml)-liposomes TNF-α (pg / ml)-liposomes IL-12 (ng / ml) + liposomes 1826D - 0.37 ± 0.07 134 ± 58 4.15 ± 1.17 M21 3 ' 3.04 ± 0.57 1103 ± 176 8.11 ± 2.19 M20 5 ' 0.42 ± 0.11 115 ± 29 1.74 ± 0.57 M12 - 0.05 ± 0.01 18 ± 3 1.68 ± 0.33 M22 3 ' 0.88 ± 0.17 408 ± 55 7.89 ± 3.21 M23 5 ' 0.05 ± 0.01 40 ± 5 0.86 ± 0.25 *-: dG sequence is not combined

As a result, it was found that even when there was no dG sequence at the 3 'end, IL-12 was secreted from dendritic cells to a high degree when treated with liposomes. However, the presence of dG sequence at the 5 'end (M20, M23), rather than the absence of dG sequence (1826D, M12) was found to secrete IL-12 to a lower degree. This result shows that the 5 'dG sequence can rather inhibit IL-12 secretion ability induced by CpG motif from dendritic cells.

<Experiment 6> Effect of the base type of the continuous sequence bound to the 3 'end

A sequence consisting of deoxyriboadenine (dA), deoxyribocytosine (dC), and deoxyribothymine (dT) instead of the dG sequence of M16 was bound to the 3 'end of CpG ODN (M16-A, M16-C, M16-T), and the effect of each CpG ODN alone or together with liposomes on secretion of IL-12 and TNF-α from dendritic cells were investigated. The results are shown in Table 5 below.

Effect of Base Type on Sequence designation order IL-12 (ng / ml)-liposomes TNF-α (pg / ml)-liposomes IL-12 (ng / ml) + liposomes M16 5 'GGAA AACGTT CTTC GGGGGG 3' 2.40 ± 0.77 960 ± 166 4.76 ± 1.65 M16-A 5 'GGAA AACGTT CTTC AAAAAA 3' 0.05 ± 0.01 25 ± 2 5.56 ± 1.10 M16-T 5 'GGAA AACGTT CTTC TTTTTT 3' 0.06 ± 0.01 29 ± 3 5.11 ± 0.88 M16-C 5 'GGAA AACGTT CTTC CCCCCC 3' 0.06 ± 0.01 45 ± 8 4.35 ± 0.52 M16-GC 5 'GGCCCCGCTTCTTC GGGGGG 3' 0.08 ± 0.02 31 ± 2 0.15 ± 0.03

As a result, when treated with dendritic cells alone without liposomes, CpG ODNs having a CpG motif and dA, dC or dT sequences combined with dA, dC or dT sequences instead of dG sequences with dG sequences bound to the 3 'position (M16-A , M16-T, M16-C) showed significantly higher cytokine secretion stimulation activity. On the other hand, when administered with 3μg liposomes showed similar IL-12 secretion pattern, in this case, the presence of the CpG motif appeared to be essential for increasing the immune activity. This result indicates that the dG sequence bound to the 3 'end is involved only in the influx of CpG ODNs into the cell and does not play a significant role in signaling related to cytokine secretion in the cell.

Experimental Example 7 Changes in CpG ODN Immune Activity by dG Sequential Binding in Vivo

(7-1) Induced Immune Response of CpG ODN Conjugated with dG Sequence (Antigen: HIV)

In order to investigate whether the immunogenic ability of CpG ODN by dG sequence can be applied in vivo, the immunological activity induced by phosphodiester CpG ODN with dG sequence in Balb / c mice was investigated. In general, only CpG ODN having a phosphorothioate backbone is known to induce an immune response mainly to a Th-1 immune response when injected with antigen. Therefore, in this experimental example, the effect of the dG sequence was examined in vivo by examining whether CpG ODN having a phosphodiester backbone bound to the 3 'end was capable of immunomodulation.

Human immunodeficiency virus (HIV) particles pretreated with aluminum hydroxide (Sigma) were mixed together with 5 μg / mouse and 50 μg / mouse M16 CpG ODN at 6-8 weeks of age. Balb / c female mice (Korean Experimental Animal Center) were injected subcutaneously. All mice were boosted four weeks after the first immunization and two weeks later the humoral immune response was examined by ELISA analysis. ELISA assays used HIV particles as antigen to specifically observe anti-HIV IgG responses, and anti-mouse IgG, IgG1 and IgG2a (horseradish peroxidase (HRP)) bound to horseshoe peroxidase (HRP) (Southern Biotechnology, USA) were each used as secondary antibodies. Color reaction was carried out using tetramethyl-benzidine (TMB) solution as the substrate (Sigma).

The result is shown in FIG . 4A . Treatment of M16 with dG sequence sequence at the 3 'end with HIV particles showed a significant increase in both total immunoglobulin G (IgG) and IgG2a, a typical Th-1 immune response. However, the effects were minimal when the d 'sequence was present at the 3' end or when ODNs with GpC (M16C, M16GC) were injected together instead of CpG (see FIG. 4A ). This result suggests that M16 ODN effectively increased Th-1 immune response and that the effect is dependent on the CpG motif of M16 and dG sequence of 3 'end.

(7-2) Induced Humoral Immune Response of CpG ODN Conjugated with dG Sequence (Antigen: gDE2t)

In general, only CpG ODN having a phosphorothioate backbone is known to induce an immune response mainly to a Th-1 immune response when injected with antigen. Therefore, in order to investigate the immunomodulatory effect by dG sequential binding in detail, next, 1826T, an ODN of a phosphorothioate backbone, which is well known in the past, was used as a comparison group. The effect of M21 binding sequence was analyzed. As an antigen, gDE2t was used in which the glycoprotein gD of the herpes simplex virus (HSV) was fused to the E2 protein of the hepatitis C virus (HCV). In addition, a relatively small amount of CpG ODN was injected without using aluminum hydroxide (2 μg / mouse) to more accurately observe the immunomodulatory effects of ODN. The immunization method was injected into Balb / c mice via intramuscular injection of 5 μg of gDE2t protein isolated from Chinese hamster ovary cells (CHO) with 2 μg of ODN (1826D, 1826T, M21) and also boosted after 4 weeks. 2 weeks later, the humoral immune response was examined. In the ELISA assay, the Hgh-E2t protein derived from CHO was used as an antigen to specifically observe the anti-E2t IgG2a response, and the anti-mouse IgG2a to which HRP was bound was used as a secondary antibody. The results are shown in Figure 4b .

When examining IgG2a titer, a representative Th-1 immune response, CpG ODN of the phosphodiester backbone 1826D showed very low IgG2a titer against E2. However, 1826T modified with phosphorothioate backbone showed high IgG2a titers, as previously reported. In the case of M21 in which the dG sequence was coupled to the 3 'end of 1826D, the IgG2a response was about 50 times higher than that of 1826D. This result can be said to agree with the result of (7-1). In other words, the binding of the dG sequencing increased the ability of the phosphodiester backbone to induce Th-1 immune response of CpG ODN.

(7-3) Induced Cellular Immune Response of CpG ODN Conjugated with dG Sequence (Antigen: gDE2t)

To investigate this in more detail, the cytokines secreted when CD4 ⁺ T cells were isolated and activated from the spleen of immunized mice were examined. 2 × 10 ⁵ CD4 ⁺ T cells were treated with E2t antigen isolated from Chinese hamster ovary (CHO) at a concentration of 1 or 5 μg / ml and incubated at 37 ° C. for 5 days. The type of immune response was determined by comparing IFN-γ, a representative cytokine of Th-1 immune response, and IL-4, a representative cytokine of Th-2 immune response, from the culture. As can be seen in FIG. 4c , when M21 was injected together compared to 1826D, a high IFN-γ / IL-4 ratio was observed. These results were also observed when 1826T was injected. In other words, it can be seen that the immunomodulatory ability of the CpG ODN of the phosphodiester backbone induces an immune response toward Th-1 in a similar manner to that of the phosphorothioate backbone due to the binding of the dG sequence.

Experimental Example 8 Improvement of cytokine secretion ability by introducing phosphorothioate modification at both ends of ODN

In order to further increase the in vivo nuclease resistance of the phosphodiester CpG ODN having the dG sequencing introduced at the 3 'end, in this experiment, two base bonds at both ends of the phosphodiester CpG ODN are bound to the phosphodiester. Modified to phosphorothioate bonds. After exchanging the two bases of M21 which secreted IL-12 to the highest extent in dendritic cells with phosphorothioate bonds (M21E), the secretion capacity of IL-12 was determined in vitro by 1826T and M21. Comparative analysis. The results are shown in Table 6 below. Lowercase letters indicate phosphorothioate bonds and uppercase letters indicate phosphodiester bonds.

Effect of cytokine secretion on both ends by phosphorothioate linkage designation SEQ ID NO: order IL-12 (ng / ml) 1826T One 5 'tccat gacgtt cct gacgtt 3' 5.41 ± 1.28 M21 14 5 'TCCAT GACGTT CCT GACGTT GGGGGG 3' 3.04 ± 0.57 M21E 18 5 'tcCAT GACGTT CCT GACGTT GGGGgg 3' 6.03 ± 2.19

As a result, M21E, which introduced phosphorothioate linkages at both bases of both ends of M21, was twice as high as M21 and higher than that of 1826T, which showed the highest IL-12 secretion capacity in dendritic cells. -12 secretory stimulatory activity. These results show that by introducing phosphorothioate modifications only at both ends, cytokine secretion stimulation activity can be further enhanced and nuclease resistance can be further increased.

As described above, the modified phosphodiester CpG ODN in which the dG sequential sequence of the present invention is bound to the 3 'end shows high Th-1 immune response inducing activity, and is modified with a known phosphorothioate backbone. Unlike CpG ODN, it does not show toxicity in vivo and thus has excellent safety and can be used as an effective vaccine adjuvant and immunotherapy.

Claims (13)

A phosphodiester oligodeoxynucleotide (ODN) having immunological activity, wherein the deoxyriboguanosine (dG) sequencing is bonded to a dG-modified oligodeoxynucleotide. 10. The dG modified oligodeoxynucleotide of claim 1, wherein the ODN has a CpG motif. The oligonucleotide of claim 1, wherein the dG sequencing is bound to the 3 'end of the ODN. The oligonucleotide of claim 1, wherein the dG sequence is 4 to 15 nucleotides in length and at least 4 dGs are contiguous. The dG-modified oligonucleotide according to claim 1, wherein one to three phosphodiester nucleotide bonds at the 5 'or 3' end are replaced with phosphorothioate bonds. The oligonucleotide of claim 1, wherein the ODN specifically binds to immune cells having a scavenger receptor (SR). 7. The oligonucleotide of claim 6, wherein the oligonucleotide is modified specifically for antigen presenting cells, including dendritic cells, macrophages, and B cells. 2. The dG-modified oligonucleotide according to claim 1, which promotes secretion of IL-12 and TNF-α from dendritic cells. The oligonucleotide according to claim 1 or 5, wherein the dG has a nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 16, or SEQ ID NO: 18. Vaccine adjuvant or immunotherapeutic agent comprising the oligonucleotide modified dG of claim 1 as an active ingredient. The vaccine adjuvant or immunotherapeutic agent according to claim 10, further used together with another antigen. The vaccine adjuvant according to claim 10 or 11, wherein the vaccine is for preventing or treating diseases such as AIDS and chronic hepatitis C. The immunotherapeutic agent according to claim 10 or 11, wherein the therapeutic agent is used for the treatment of allergy, asthma and autoimmune diseases.