KR20010052390A - USE OF α1β1 INTEGRIN RECEPTOR INHIBITORS AND TGF-β1 INHIBITORS IN THE TREATMENT OF KIDNEY DISEASE - Google Patents

Abstract

The present invention provides a method of treating (i. E., Delaying the onset, delaying the progression and / or reversing the progression of the disease) of the kidney disease (e.g., renal glomerulonephritis and / or renal fibrosis). Certain of these methods include administering an alpha 1 integrin receptor inhibitor optionally in conjunction with a TGF-? 1 inhibitor. In addition, the present invention provides a method of inhibiting the expression of a < RTI ID = 0.0 > (I), < / RTI > A mouse model for kidney disease.

Description

[0001] The present invention relates to an inhibitor of alpha 1 integrin receptor and a therapeutic agent for the treatment of kidney diseases of TGF-beta 1 inhibitor. [0002]

SEQUENCE LISTING

<110> BOYS TOWN NATIONAL RESEARCH HOSPITAL

<120> USE OF a1B1 INTEGRIN RECEPTOR INHIBITORS AND TGF-B1

INHIBITORS IN THE TREATMENT OF KIDNEY DISEASE

<130> 249.00010230

<140> PCT / US99 / 11073

<141> 1999-05-19

<150> 60 / 086,587

<151> 1998-05-22

<150> 09 / 088,766

<151> 1998-06-02

<150> 09 / 150,485

<151> 1998-09-09

<160> 26

<170> PatentIn Ver. 2.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 1

tctgtggacc atggcttc 18

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 2

ttctcatgca cacttggc 18

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 3

ggctacctcc tggtgaag 18

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 4

ttcatgcaca cttggcag 18

<210> 5

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 5

cgggccacat tctcc 15

<210> 6

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 6

ggagtggccg ttgcatt 17

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 7

accagtacca aggcgga 17

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 8

tcattgagct tgttcagg 18

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 9

tagaggttat tttgcagcag a 21

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 10

ttggatatcc tcatcagctt g 21

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 11

gtggtttact ggacagacat c 21

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 12

ccaatctgtc caataaagg 19

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 13

acacactcca agcccacaaa agcaag 26

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 14

gagggaagac tccttgtagg tcaa 24

<210> 15

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 15

gcagagcggg cacggagc 18

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 16

tgtacctgcc atcctctcct g 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 17

cccctatcta cacctacacc a 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 18

tgtcactgtc cgccaaataa a 21

<210> 19

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 19

cagaagaaga gcctgaacca ca 22

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 20

gtaccacgcg caagaacc 18

<210> 21

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 21

ggtctacact attaagcaga tgaag 25

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 22

aaaattggag agcatgtcgg t 21

<210> 23

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 23

gcagaagttg gcatggtag 19

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 24

ggacatcaac gggttcacta 20

<210> 25

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 25

gcagaagttg gcatggtag 19

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: primer

<400> 26

ggacatcaac gggttcacta 20

BACKGROUND OF THE INVENTION

In the United States, about 12,000 people now live with Alport syndrome. These genetic disorders result in progressive kidney disease that can only be treated by dialysis and kidney transplantation. Transplanted kidneys generally show rejection. Therefore, alternative therapies are needed. However, therapies that address the mechanism of onset or progression of the disease do not exist at present. What is needed, therefore, is a therapy that attacks the mechanism of the onset and / or progression of the disease, and is a therapy that can substantially slow the disease state, such as renal glomerulonephritis and renal fibrosis.

Many renal diseases are associated with a change in matrix homeostasis, which precludes a precise balance of synthesis and replacement of structural molecules. As an example, Alport syndrome is a disease that causes progressive renal failure and is associated with sensory neuron loss. Most of the male carriers are sick and found to have abnormalities in the glomerular basement membrane (GBM) of individuals with hypermicroscopic findings. About one out of 20,000 people have Alport syndrome, which makes this disease one of the more prevalent known genetic disorders (see, e.g., Atkin et al., "Alport Syndrome" In R. W. et al. Schrier &amp; Gottschalk (Eds.), Disease of the Kidney, 4th ed., Chap. 19, Little Brown, Boston, pp. 617-641, 1988). X-linked Alport syndrome is due to a series of mutations in the collagen 4A5 gene (Barker et al., Science, 348: 1224-1227, 1990). Over 60 different mutations in the gene were identified. The autosomal form of Alport syndrome appears in the same range of phenotypes as the X-linked and is due to mutations in the basement membrane collagen gene 4A3 (COL4A3) or 4A4 (COL4A4) (see, for example, Lemmink et al., Hum. Mol. Gen., 3: 1269-1273, 1994, and Mochizuki et al., Nature Genet., 8: 77-81,1994). Other basement membrane disorders include Goodpasture syndrome (Hudson et al., Kidney Int., 43: 135-139, 1993), which is caused by an acute autoimmune response to an epitope on the NC1 domain of collagen 4A3, and collagen (See Zhou et al., Science, 261: 1167-1169, 1993), which is a benign smooth muscle tumor associated with deletion of both 4A5 and 4A6.

The basement membrane is a differentiated extracellular structure associated with almost all organs and tissues of the body. Basement membranes are generally found at the boundary between cells and connective tissue, but can also be found between epithelial and endothelial cells, as in the case of renal glomeruli (ie, capillary bundles). The major structural materials of the basement membrane include type IV collagen, laminin, heparin sulfate proteoglycans, entmotin, and often fibronectin and type V collagen. The most prominent component in all basement membranes is type Ⅳ collagen, a unique type of collagen found only in the basement membrane. In its native form, Type IV, like all collagens, is composed of three collagen molecules assembled into a triple helix composed of a unique combination of six alpha chains (4A1 to 4A6). The 4A1 and 4A2 chains (also referred to as the? 1 (IV) and? 2 (IV) chains) are the most common (Timpl, J. Biochem., 180: 487-502, 1989). Type IV collagen differs from interstitial collagen in many ways. The helix structure of the alpha chain association is not completely conjugated with the glycine-X-Y motif observed in other collagen; It contains 3-hydroxyproline rather than 4-hydroxyproline and is rich in carbohydrates. The resulting superstructure of collagen is a chicken - elbow network of basement membrane collagen. This network structure is a basic structure in which adjunct molecules (laminin, heparin sulfate, etc.) are bonded thereon.

The basement membrane is a very heterogeneous structure, which causes its diverse functional properties. Understanding the complexity of these structures is still insufficient. Several new basement membrane collagen chains (alpha 3, 4, 5, and 6 chains) have only recently been discovered (see, for example, Gunwar et al., J. Biol. Chem., 266: 15318-15324, 1990; Hostikka et al., Proc. Natl. Acad. Sci. USA, 87: 1606-1610, 1990; Butkowski et al., J. Biol. Chem., 262: 7874-7877, 1987; and Zhou et al., Science 261: 1167-1169, 1993). Interestingly, the new chain has been found only in certain tissues (e.g., kidney glomeruli, eyes Decimet's membrane, lens, skin, lungs, testicles, cornice) (see, for example, Kleppel et al., Am . J. Pathol., 134: 813-825, 1989, and Tryggvason et al., Kidney Int., 43: 38-44, 1993). The role of this new chain in basement membrane assembly and function is currently unknown. This new basement membrane collagen is thought to form a distinct reticular structure distinct from collagen type 4A1 (α1 (IV)) and 4A2 (α2 (IV)) network.

The kidney glomerular basement membranes (GBMs) are essential for the ultrafiltration process (ie, the blood is filtered during this process to remove, for example, the metabolites excreted in the form of urine). Alport syndrome causes bulky accumulation of extracellular matrix and resulting in damaged basement membrane, resulting in scarring and segmental glomerulonephritis (i. E. Inflammation of the capillary loop of the renal glomeruli) and ultimately leading to fatal uraemia (i.e., Excess urea is present). In addition, a number of identical extracellular matrix molecules (e.g., collagen type I, fibronectin, laminin, and collagen type IV) accumulate progressively in GBM of patients with IDDM (insulin dependent diabetes) nephritis. However, GBM is exaggerated in these diseases, but there is no phagocytosis and division (division) of GBM which is characteristic of Alport syndrome.

Integrin is a heterodimeric transmembrane glycoprotein receptor that binds to components of basal lamina and extracellular matrix. They act as adhesion molecules associated with immobilizing cells in the cell aggregate and basal lamina. They are involved in converting signals to nuclei and regulating gene expression, particularly gene expression for cell migration and cell differentiation (Hynes, Cell, 69: 11-25, 1992). Over 20 different integrin receptors are known, and they contain about 14 different alpha subunits and about 8 different beta subunits (DiSimone, Curr. Opin. Cell Biol., 6: 182-194,1994).

There are distinct sets of integrin receptors in the renal glomeruli. These are associated with mesangial matrix (ie, membranes that assist in supporting the capillary loop in the kidney glomeruli) or visceral epithelial cells (Patey et al., Cell Adhesion Commun., 2: 159-167, 1994) . The most prevalent integrin receptor on adult glomerular endothelial cells is the? 3? 1 heterodimer (Adler, Am, J. Pathol., 141: 571-578, 1992: and Patey et al., Cell Adhesion Commun., 2: 159 -167, 1994]. β5 subunit has been demonstrated to be expressed in adult visceral epithelial cells (Yamada et al., Cell Adhesion Communic., 3: 311-325, 1995), α1, α3, α5, αV, β1, and β3 integrin receptors Are genetically expressed during kidney morphogenesis (Korhonen et al., Lab. Invest., 62: 616-625, 1990; Wada et al., J. Cell. Biol., 132: 1161-1176,1996; and Yamada et al., Cell Adhesion Communic., 3: 311-325, 1995). The α1β1 heterodimeric integrin receptor is the only integrin receptor identified on the surface of mesangial cells of the renal glomeruli.

A gene knockout mouse was produced in the? 3 integrin receptor subunit. The offspring die from renal insufficiency immediately after birth (Kreidberg et al., Dev., 122: 3537-3547, 1996). The ultrastructural pathology of GBM in neonates in this model is quite similar to that observed in advanced Alport syndrome. The basement membrane appears to be rarefied (ie, irregularly thickening, thinning, and cleavage), and the foot process of intestinal epithelial cells appears to be fused. One ligand for the? 3? 1 receptor is type IV collagen (Krishnamurti et al., Lab. Invest., 74: 650-665,1996; and Rupprecht et al., Kidney Int., 49: 1575-1582, 1996), since this receptor is localized along the interface between the intestinal epithelial cells and GBM (Baraldi et al., Nephron, 66: 295 -301, 1994], the observations described above for [alpha] 3 integrin knockout support a model in which such integrin / ligand interactions play an important role in basement membrane development.

In normal animals, type IV collagen in fetal glomerular basement membrane (GBM) by birth only contains only the alpha 1 (IV) and alpha 2 (IV) chains (referred to as classical collagen chains). Immediately after birth, developmental changes occur and α3 (Ⅳ), α4 (Ⅳ), and α5 (Ⅳ) chains (referred to as new collagen chains) are clearly detectable in GBM and α1 (Ⅳ) and α2 It is primarily localized in the Mesan 쥼 matrix [Minor & Sanes, J. Cell. Biol., 127: 879-891, 1994).

In adult kidneys, a thin layer of GBM containing the α1 (Ⅳ) and α2 (Ⅳ) chains is located adjacent to the endothelial cell layer, while the GBM of the majority of total thickness is α3 (Ⅳ), α4 (IV) chain (see Desjardins &amp; Bendayan, J. Cell. Biol., 113: 689-700,1991; and Kashtan et al., J. Clin. Invest., 78: 1035-1044, 1996]. There is biochemical evidence suggesting that two different sets of collagen chains form a distinct network (Kleppel et al., J. Biol. Chem., 267: 4137-4142, 1992]. In familial nephritis, an ineffective mutation (ie a mutation that disrupts gene expression) in α3 (Ⅳ), α4 (Ⅳ), or α5 (Ⅳ) results in the absence of all three chains in GBM, Lt; RTI ID = 0.0 &gt; assembly. &Lt; / RTI &gt; This leads to the presence of α1 (Ⅳ) and α2 (Ⅳ) chains through the total thickness of GBM. Thus, type IV collagen receptors on the surface of intestinal epithelial cells directly contact the GBM of the non-characteristic type IV collagen chain composition in Alport's kidney (i.e., the kidney of an individual with Alport syndrome). One or more studies have referred to the relative abilities of vaginal epithelial cells that bind to these different composition type IV collagens, and vimentin epithelial cells are composed of new chains when compared directly to the classical α1 (Ⅳ) and α2 (Ⅳ) Lt; RTI ID = 0.0 &gt; basement membrane. &Lt; / RTI &gt; Such binding may be blocked by an antibody to the [alpha] 3 integrin receptor.

A mouse model for autosomal form of Alport syndrome was created by targeted mutagenesis of the COL4A3 procollagen gene (Cosgrove et al., Genes Dev., 10: 2981-2992, 1996). In the animal model, proteinuria develops at about 4 weeks of age in the homozygous breeding 129Sv / J background, and progressive glomerulonephritis develops, and the average age of death due to renal failure is about 8.5 weeks. Ultrastructural changes in GBM are observed in one week of age before the onset of proteinuria, and are observed up to 3 weeks of age through GBM of most glomeruli. Extracellular matrix components, including laminin-1, heparin sulfate proteoglycan, fibronectin, and entatin, accumulate in the GBM. Such a mouse is referred to herein as an " allport " mouse.

The accumulation of extracellular matrix and mesangial cells by the action of progression of renal disease in GBM and mesangial is a common feature of various glomerular diseases in both patient and laboratory animal systems (see, e.g., Goyal &amp; Wiggins, Am. Soc. Nephrol., 1: 1334-1342, 1991; Wilson et al., Contrib. Nephrol. Basel, Karger, 118: 126-134, 1996: Razzaque et al., Clin. Nephrol. 46: 213-214,1996; Yoshioka et al., Kidney Int., 35: 1203-1211, 1989: and Klahr et al., N. Engl. J. Med., 318: 1657-1666, 1988]. In diabetes, the primary mediator of this effect is thought to be long-term exposure to non-enzymatically glycosylated serum proteins due to chronic high glucose levels (Doi et al., Proc. Natl. Acad. Sci. USA, 89: 2873-2877, 1992; and Roy et al., J. Clin. Invest., 93: 483-442, 1994).

In the majority of progressive somatic diseases, overgrowth of the transforming growth factor TGF- [beta] 1 appears to be closely related to the accumulation of extracellular matrix resulting in fibrosis (i.e., formation of fibrous tissue) (see, for example, Border &Amp; Ruoslahti, Nature (London), 346: 371-374, 1992: Yang et al., J. Am. Soc. Nephrol., 5: 1610-1617,1995; and Yamamoto et al., Kidney Int., 45: 916-927, 1994). In one animal model for autoimmune nephritis, the injection of an antibody against TGF-? 1, or an antisense oligonucleotide of the corresponding mRNA, inhibited the accumulation of advanced glomerulonephritis and extracellular matrix (Border et al., Nature London), 346: 371-374, 1990; and Akagi et al., Kidney Int., 50: 148-155, 1996).

The half-life of basement membrane collagen in GBM of rats was estimated to be 16 to 40 days based on a pulse-tracing study with ³ H-proline (See et al., Nephron. 22: 522-528, 1978]. This is very slow compared to the heparin sulfate proteoglycan of the replacement (t _1/2 = 20 hours), or other alcohol replacement of Polymer Chemistry sulfate (t _1/2 = 20 to 60 hours) in the GBM. The accumulation of basement membrane proteins in the GBM of the AlportMouse model (Cosgrove et al., Genes Dev., 10: 2981-2992, 1996) may be the net effect of changes in both the synthesis and degradation of these proteins. Of the proteases involved in the replacement of both GBM and mesangial matrices, the most prominent are the metalloproteinases MMP-2 (72 kD collagenase) and MMP-9 (92 kD collagenase) as well as MMP-3 -1). These enzymes will degrade not only Type IV collagen but also various other extracellular matrix components.

Mesenchymal cells (and possibly other glomerular cell types) also produce natural inhibitors of metalloproteinases. These are referred to as TIMP's (tissue inhibitors of metalloproteinases). These are relatively low molecular weight glycoproteins. Of these, TIMP-1 is specific for stromolysin-1 and MMP-9, while TIMP-2 and TIMP-3 will inhibit MMP-2 (Goldberg et al., Proc. Natl. Acad. Sci. USA, 86: 8207-8211, 1989; Staskus et al., J. Biol. Chem., 266: 449-454, 1991; and Stetler-Stevenson et al., J. Biol. Chem., 264: 17374-17378, 1989).

The modulation of metalloproteinases and their corresponding inhibitors similarly plays a role in maintaining a reasonable level of GBM replacement. Little is known about the regulation of genes encoding these proteins in the glomeruli, but signal transduction through integrin receptor / ECM (extracellular matrix) interactions may be an important aspect of this process.

There remains a need for animal models of Alport syndrome, particularly those with significantly slower disease progression. There remains a need also for new therapies for the treatment of kidney diseases associated with esophageal matrix enlargement and progressive matrix accumulation in the glomerular basement membrane and coronary gaps, including, for example, Alport syndrome and insulin-dependent diabetes mellitus.

summary

The present invention provides a variety of therapies for treating and restricting kidney disease (i. E. Delaying the onset, delaying progression and / or reversing the disease) in a patient (preferably a mammal, and more preferably a human). The renal disease preferably includes renal glomerulonephritis, renal fibrosis, or both. Such diseases may be associated with, for example, Alport syndrome, IDDM nephritis, mesangial proliferative glomerulonephritis, proliferative glomerulonephritis, meniscus glomerulonephritis, diabetic retinopathy, and renal interstitial fibrosis.

In one embodiment, the method comprises administering to the patient an effective amount of an alpha 1 integrin receptor inhibitor. This? 1? 1 integrin receptor inhibitor may be a blocking agent that binds to the? 1? 1 integrin receptor binding site on the surface of the kidney cells. The blocking agent may be a peptide fragment of nine or more fragments of a protein selected from the group consisting of laminin, fibronectin, entatin, and collagen type 4. [ Alternatively, the blocking agent may be an antibody. Other drugs that inhibit (i.e., inactivate) the? 1? 1 integrin receptor by other mechanisms may also be used.

In another embodiment, the method comprises administering to the patient an effective amount of a TGF-? 1 inhibitor in addition to an? 1? 1 integrin receptor inhibitor. These inhibitors may be administered simultaneously (i.e., as a mixture) or sequentially. The TGF-? 1 inhibitor may be a drug that inhibits the ability of TGF-? 1 to bind to the receptor by irreversibly binding to TGF-? 1. Alternatively, the TGF- [beta] l inhibitor may be a drug that inhibits the ability of TGF- [beta] l to convert signals to the nucleus of kidney cells. The latter type of inhibitor is preferably a calineurin inhibitor such as tacrolimus (commercially available as FK506). Other drugs that inhibit (i.e., inactivate) TGF-? 1 by other mechanisms may also be used.

Preferably, the invention provides a method of delaying the onset and / or delaying the onset of Alport syndrome in a patient. In one embodiment, the method comprises administering an effective amount of a drug that inhibits signal transduction through the alpha 1 beta 1 integrin receptor of the kidney cells. In another embodiment, the method comprises blocking the alpha 1 beta 1 integrin receptor binding site on the kidney cell surface of the patient. Such a method may be further enhanced by administering to the patient an effective amount of a TGF-? 1 inhibitor.

Preferably, the invention also provides a method of delaying the onset and / or delaying the onset of a renal disease in insulin dependent diabetes mellitus in a patient. In one embodiment, the method comprises administering an effective amount of a drug that inhibits signal transduction through the alpha 1 beta 1 integrin receptor of the kidney cells. In another embodiment, the method comprises blocking the alpha 1 beta 1 integrin receptor binding site on the kidney cell surface. Such a method may be further enhanced by administering a TGF- [beta] l inhibitor to the patient.

Also provided is a method of limiting renal fibrosis in a patient. In one embodiment, the method comprises inhibiting the alpha 1 beta 1 integrin receptor of a patient's kidney cells while reducing TGF- beta 1 activity in the patient. Such activity can be reduced by administering a drug that inhibits the ability of TGF-beta1 to bind to its receptor by irreversibly binding to the patient. Alternatively, such activity can be reduced by administering a drug that can inhibit the ability of TGF-? 1 to convert signals to the nucleus of kidney cells.

In another embodiment, a method is provided for limiting matrix accumulation in a GBM of a patient with Alport syndrome. In one embodiment, the method comprises reducing TGF-? 1 activity in a patient. This can be accomplished by administering the TGF- [beta] l inhibitors described herein.

In a particularly preferred embodiment, a method is provided for limiting renal fibrosis by administering a calcineurin inhibitor, preferably tacrolimus, to the patient.

In addition, the present invention provides a mouse model for renal disease, wherein the knockout of the collagen alpha 3 (IV) gene does not result in the expression of normal collagen type 4 composition in GBM. That is, the mouse fails to incorporate the collagen α3 (IV), α4 (Ⅳ), or α5 (Ⅳ) chains into the glomerular basement membrane (thus GBM has only collagen α1 (Ⅳ) and α2 (IV) chains. In addition, knockout of the alpha 1 subunit gene does not result in the expression of the alpha 1 beta 1 integrin receptor.

In double knockout mice, the onset of proteinuria is delayed compared to the mouse model of the prior art. Also, animals survive almost twice as long as Alport's apprentice. At approximately 8 weeks of age, the average weekly mortality of Alport mice, double knockout represents a significantly reduced glomerular disease course. That is, double knockout mice show significantly less hypermicroscopic damage with less GBM raffication and almost no extinction of the podocyte foot process, compared to the same week old Alport mice. In addition, the accumulation of enstatin and type IV collagen remains unchanged, while the degradation of fibronectin, laminin-1, and heparin sulfate proteoglycan accumulation occurs in GBM relative to altox mice. These results suggest that there is a specific role for α1β1 integrin receptors in Alport renal disease outbreaks. This is noteworthy considering that a single alpha 1 integrin knockout has no significant effect on renal physiology or function.

This mouse can be used to study Alport syndrome, insulin dependent diabetes mellitus, and other diseases characterized by glomerulonephritis and / or fibrosis. This mouse can also be used to screen for Alport syndrome, which is characterized by extracellular matrix accumulation and / or fibrosis, and drugs that can be used to treat insulin-dependent diabetes and other diseases.

Brief Description of Drawings

Figure 1 illustrates the proliferation of proteinuria in Alport vs. double mutant mice studied by collecting urine from mice at intervals of one week. The mice showed the week of the mouse (note) at the time of urine collection. A = Alport mouse; B = double mutant mice; Mr = molecular weight standard.

Figure 2 illustrates ultrastructural damage to the glomerular capillary loop in control and dual mutant mice. The cortex of normal mice (A), albintox (B), and double mutant mice (C) were collected by embedding in epoxy resin at 7 weeks. Ultrathin sections were stained and analyzed by transmission electron microscope. The arrows represent the foot process. C = capillary lumen; U = urinary space. The magnification bar indicates 0.5 mu m.

Figure 3 provides results of immunofluorescence analysis of extracellular matrix proteins in normal, albort, and double mutant mice. The frozen cold sections of the renal cortex were reacted with antibodies specific for the extracellular matrix proteins displayed on the Y-axis label. Signals were generated using appropriate fluorescent-conjugated secondary antibodies and images were digitally collected and processed using Cytovision Ultra software (Applied Imaging, Inc.). The arrow represents the glomerular capillary loop. 4A1, 2 = collagen alpha 1 (IV) and alpha 2 (IV) chain; Lam-1 = laminin-1; Fib = fibronectin; HSP = heparin sulfate proteoglycans; ent = Enchanted. α1 + / + = homozygosity in α1 integrin gene normal; homozygous mutants in the alpha 1 - / - = alpha 1 integrin gene; α3 (Ⅳ) + / + = α3 (Ⅳ) homozygosity in the collagen gene normal; α3 (Ⅳ) - / - = α3 (Ⅳ) homozygous mutant in the collagen gene.

Figure 4 shows the results of Norton analysis of mRNA from total kidney over time of Alport renal disease progression. Total RNA isolated from the kidneys collected at a given time point (week) was fractionated on denaturing agarose gels and blotted onto nylon to detect TGF- [beta] l, or murine animals encoding the various components of the glomerular basement membrane and / and probed with cDNA. The probes used to generate the data exemplified in the panel are: A, TGF-β1; B, collagen alpha 1 (IV); C, collagen alpha 2 (IV); D, fibronectin; E, enstatin; F, laminin beta 1 chain; G, laminin β2 chain.

Figure 5 shows a quantitative analysis of mRNA induction during Alport renal disease progression. After exposure to the X-ray film, the membrane used to produce Figure 4 was analyzed using a BioRad GS-525 phosphorimager. The plotted figure shows the fold induction of specific mRNA in the alphabet sample relative to that observed in normal subjects. All bands were subtracted against the background. The specific mRNA species analyzed are indicated by insertion.

Figure 6 illustrates in situ hybridization analysis of specific transcripts in albumin after proteinuria. The elongations (A, D, G, and J) of normal subjects were analyzed along the elongation (B, E, H, and K) The antisense probes can bind to the NC1 domain of collagen alpha 1 (IV) (A and B), TGF- beta 1 (D and E), enstatin (J and K), fibronectin (G and H) or laminin beta 1 chains (M and N) . Probes specific for bacterial [beta] -galactosidase were used as controls for non-specific binding (C, F, I, L, and O).

Figure 7 illustrates the immune oxidase for TGF-? 1 in tissue sections of normal and Alport mice. Paraffin-embedded sections were stained for the active form of TGF-β1 using Immunoperoxidase detection. P = group cell; M = mesangial cells.

Figure 8 illustrates RNase detection assay for TGF- [beta] l mRNA in normal and albumin cortex. Total RNA was isolated from normal and allantoic renal cortices and each 10 μg of RNase protection analyzed using the radioactive labeled portion of the human TGF-? 1 antisense message as a probe. The assay results in a 264 bp protected fragment. Molecular size markers are radiolabeled with MSP1 cut PBR322, and appropriate fragments are labeled for comparison. N = normal; A = Alport.

Figure 9 illustrates the Norton blot of RNA from the cortex of normal mice, allt mice, alpha 1 integrin deficient mice, and mice deficient in both alpha 1 integrin and collagen alpha 3 (IV). Total RNA was isolated from the renal cortex of a 7-week-old mouse (confluent) with the designated genotype: + / + = normal at all alleles; - / - = mutation in alleles.

FIG. 10 is a transmission electron micrograph of GBM of a 7 week old Alport animal injected with a neutralizing antibody specific for? 1 integrin. Notice the absence of a regular three - layer form of the GBM and a degenerated area of the small phase. The magnification is 10,500 times.

Figure 11 illustrates the effect of TGF- [beta] l inhibitors on GBM superfine structure in 129Sv / J altrip mice. Animals were treated with FK506 or TGF- [beta] l soluble receptors. The renal cortex was embedded in epoxy, sectioned, stained with uranyl acetic acid and lead citrate, and analyzed by transmission electron microscopy. A = contrast; B = unprocessed alport; C = alpha pot treated with FK506; D = albut treated with soluble TGF-? 1 receptor. The magnification is 11,000 times.

Figure 12 is a scanning electron micrograph of the treated vs. untreated 129Sv / J altxt mouse glomeruli. The cortex of the mouse used in Fig. 11 was lyophilized, destroyed, stained with uranyl acetic acid and lead citrate, exposed to visible glomeruli and photographed using scanning electron microscope. A = contrast; B = uninjected alport; C = Alport mice treated with TGF-? 1 soluble receptor. The magnification is 2500 times.

Figure 13 illustrates the effect of drug treatment on urinary albumin in 129Sv / J altxt mice. During the period of drug treatment, urine was collected, lyophilized, and fractionated on a polyacrylamide gel with 0.5 쨉 l equivalents. The gel was visualized by staining with Coomassie blue. The first two lanes were uninjected controls, the next two (Group I) were injected with FK506, and the third group (Group II) was injected with soluble TGF-β1 receptor. The lower digit represents the week of the mouse when collecting urine. C = contrast; A = Alport.

Figure 14 illustrates the effect of TGF-? 1 inhibitors on GBM microstructure in double knockout mice. Animals were either untreated or treated with FK506 or TGF- [beta] l soluble receptors. The renal cortex was embedded in epoxy, cut, stained with uranyl acetic acid and lead citrate, and analyzed by transmission electron microscopy. A = control without injection; B = double knockout without injection; Double knockout treated with C = FK506; D = double knockout treated with soluble receptor for TGF-? 1. The magnification is 8000 times.

Figure 15 illustrates an example of normal glomerular structure in a 10 week old double knockout mouse treated with a TGF-? 1 inhibitor. About 25% of the glomeruli in the mice treated with the TGF-? 1 inhibitor were not morphologically distinguishable from the glomeruli in the control animals. Animals were either not treated or treated with FK506. The renal cortex was embedded in epoxy, cut, stained with uranyl acetic acid and lead citrate, and analyzed by transmission electron microscopy. A = control without injection; B = double knockout treated with FK506.

Figure 16 illustrates the effect of drug treatment on urinary albumin in a double knockout mouse. During the course of drug treatment, urine was collected, lyophilized, and fractionated on a polyacrylamide gel with 0.5 쨉 l equivalents. The gel was visualized by staining with Coomassie blue. At the time of collection of urine, the mouse's state (note) is displayed on the lower part of the drawing. A = double knockout without injection; B = double knockout injected with soluble receptor; Control mice injected with C = FK506; D = double knockout injected with FK506.

17 is a scanning electron micrograph of the glomeruli of the Alport vs. double knockout mouse. Seven week old mice were lyophilized, lysed, stained with uranyl acetic acid and lead citrate, exposed glomeruli and photographed using scanning electron microscopy. A = contrast; B = Alport; C = double knockout.

Figure 18 shows dual immunofluorescence staining for laminin [alpha] 2 chains in normal and mutant mice. Glomerular basement membrane was stained with green using an enstatine-specific primary antibody and a FITC-conjugated secondary antibody. The laminin alpha 2 chain was stained red using a Texas red conjugated secondary antibody. In the capillary loop, co-localization results in yellow staining. Group I is the glomeruli of 7-week-old mice; A = control without injection; B = ALPOT injected with soluble receptor; D = double knockout without adverb. Group II is the glomeruli of 2-week-old mice; A = contrast; B = ALPTOT. The arrow shows immunostaining in the capillary loop of the glomeruli.

19 is a transmission electron micrograph of GBM of a 2 week old normal versus altem mouse. The renal cortex was embedded in epoxy and cut, stained with uranyl acetic acid and lead citrate and analyzed by transmission electron microscopy. A = contrast; B = ALPTOT.

Figure 20 illustrates the effect of TGF- [beta] l inhibitors on the expression in the kidney of RNA encoding cell matrix molecules or metalloproteinase inhibitors in normal versus altitudinal mice. Total RNA was isolated from the kidneys of 7 week old normal (C) or Alport (A) mice treated or not treated with FK506 (I) (NI). RNA was fractionated on a denaturing agarose gel and analyzed by hybridization with a radiolabeled probe encoding an extracellular matrix molecule or a metalloproteinase inhibitor. After hybridization, the membrane was washed and exposed to X-ray film. The probe used was specified on the left side of the panel. ? 1 (IV) = collagen? 1 (IV); fn = fibronectin; ent = enstatin; Timp2 = metalloproteinase inhibitor Timp-2; Timp3 = metalloproteinase inhibitor Timp-3.

Figure 21 illustrates the effect of TGF- [beta] 1 inhibitors on the expression of RNA in the kidney of a cell that encodes a cell matrix molecule or metalloproteinase inhibitor in normal versus double knockout mice. Total RNA was isolated from kidneys treated with FK506 (I), treated with TGF-? 1 soluble receptor (II) or from untreated (NI) 10 week normal (C) or double knockout (Dko) mice. RNA was fractionated on a denaturing agarose gel and analyzed by hybridization with a radiolabeled probe encoding an extracellular matrix molecule or a metalloproteinase inhibitor. After hybridization, the membrane was washed and exposed to X-ray film. The probe used was specified on the left side of the panel. ? 1 (IV) = collagen? 1 (IV); fn = fibronectin; ent = enstatin; Timp2 = metalloproteinase inhibitor Timp-2; Timp3 = metalloproteinase inhibitor Timp-3.

Figure 22 illustrates inhibition of matrix accumulation in the tubular gap of a double knockout mouse using a TGF-? 1 inhibitor. The kidneys of 10-week-old normal or double knockout mice were embedded in plastic and 1 μM sections were stained using the Jones silver methaneamine method. A = normal height; B = double knockout kidney, not injected; Double knockout kidney treated with C = FK506; D = Double knockout kidney treated with TGF-? 1 soluble receptor.

Figure 23 illustrates the inhibition of collagen type IV accumulation in the tubular gap of a double knockout mouse using a TGF-? 1 inhibitor. The kidneys of 10-week-old normal or double knockout mice were embedded in plastic and 1 μM sections were immunostained using antibodies specific for collagen type I. Dyeing was performed using strep avidin AEC staining kit purchased from Vector laboratories. A = normal height; B = double knockout kidney, not injected; Double knockout kidney treated with C = FK506; D = Double knockout kidney treated with TGF-? 1 soluble receptor.

Figure 24 illustrates inhibition of fibronectin accumulation in the tubular gap of a double knockout mouse using a TGF-? 1 inhibitor. The kidneys of 10-week old normal or double knockout mice were embedded in plastic and 1 μM sections were immunostained using antibodies specific for fibronectin. Dyeing was performed using strep avidin AEC staining kit purchased from Vector laboratories. A = normal height; B = double knockout kidney, not injected; Double knockout kidney treated with C = FK506; D = Double knockout kidney treated with TGF-? 1 soluble receptor.

Field of invention

The present invention relates to the field of renal diseases characterized by glomerulonephritis and / or fibrosis. In particular, the present invention relates to the use of an alpha 1 beta 1 integrin receptor inhibitor in renal disease. The present invention also relates to a method of using an? 1? 1 integrin receptor inhibitor in combination with a TGF-? 1 inhibitor in renal disease.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention provides a therapeutic method for attacking the mechanism of renal disease, which is a method that can substantially delay the onset and / or progression of a disease state such as glomerulonephritis and renal fibrosis. It is believed that the methods of the present invention are capable of reversing even such disease states. In particular, the present invention provides an increased risk of developing glomerular nephritis and renal fibrosis in renal glomeruli, such as the development of mesangial proliferative glomerulonephritis, proliferative glomerulonephritis, meniscus glomerulonephritis, diabetic renal disease, and interstitial fibrosis Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; Glomerulonephritis involves irregularities in the GBM such as hypertrophy, thinning, and / or fissuring, and typically associated glomerular damage. This can be a common pathway for tubular fibrillation. These conditions are typical of the appearance of myoblast cells in the tubulointerstitium and accumulation of the matrix (including collagen type I, fibronectin, laminin, and collagen type IV). The effectiveness of the therapeutic agents used in the methods of the present invention can be determined by evaluating one or more of these characteristics.

The present invention also relates to a method of screening for a medicament for treating a patient with renal kidney disease, particularly associated with the presence of an accumulation of extracellular matrices within the renal glomeruli and the tubular gaps, or the presence of an increased risk of developing To provide a mouse model. Thus, in one embodiment, the invention provides a mouse model for Alport syndrome. This mouse model contains an inactivated α1β1 integrin receptor in combination with an inactivated collagen (type IV) molecule. In one preferred embodiment, the collagen (type IV) molecule is inactivated by destroying the expression of the a3 subunit of collagen (type IV). As a result, mice do not incorporate α3 (Ⅳ), α4 (Ⅳ), or α5 (Ⅳ) chains in GBM.

This mouse model is characterized by an expansion of the mesangial matrix and mesangial cell proliferation associated with glomerular basement membrane damage, characterized by early disease, basement membrane thickening, thinning, cleavage, and disappearance of the podocyte foot process, or a combination thereof Alport syndrome, insulin-dependent diabetes mellitus, and other renal diseases.

In one preferred embodiment, the present invention provides a method of treating glomerulonephritis in a patient suffering from glomerulonephritis and / or fibrosis (accumulation of extracellular matrices including laminin, fibronectin, collagen type I, and collagen type IV in the tubular space, (As measured by the appearance of urinary albumin) or by progression (as measured by the rate at which the level of serum albumin in the urine increases) or even by reversal (measured at the rate of increase in urine serum albumin level) An inhibitor that blocks or inactivates the action of the integrin receptor. A variety of synthetic or natural drugs, which are described in more detail below, may be used.

In another embodiment, the invention relates to the role of TGF-? 1 in the onset of Alport's kidney disease and other such kidney diseases. Significant increases in mRNA levels for TGF- [beta] l after the onset of proteinuria are observed in the mouse models used herein. In situ hybridization indicates that podocytes that produce little or no mRNA for TGF-β1 before proteinuria manifest large amounts of mRNA for TGF-β1 from the onset of proteinuria to end-stage renal disease. Activation of mRNA encoding fibronectin, COL4A1 and COL4A2, and enstatin is observed almost simultaneously. Thus, a method of reducing the level of TGF-? 1 is another mechanism for treating renal diseases such as glomerulonephritis and / or fibrosis. The effect of inhibiting TGF-? 1 activity can be assessed by measuring the time of onset (onset) of urinary albumin and the rate of increase of urinary albumin and / or the appearance of myoblasts (in the tubular gap) and / or the accumulation of extracellular matrix molecules in the GBM and tubular gaps Can be measured.

In another embodiment, through the use of a TGF-? 1 inhibitor in? 1 integrin-deficient allotropic mice, the invention provides a combination of an? 1? 1 integrin inhibitor and a TGF-? 1 inhibitor in preventing the onset and progression of glomerulonephritis and / It is about synergy of treatment.

Mouse model

Common pathways of tubular fibrosis characterized by the appearance of matrix accumulation (including collagen type I, fibronectin, laminin, and collagen type IV) in tubular gaps and fibroblast cells associated with thickening, thinning, or cleavage irregularities in GBM An important aspect of managing patients with Alport syndrome and other diseases associated with progressive glomerular injury is to determine the cause and / or mechanism of disease progression. For example, the mutation of the collagen α3 (Ⅳ) or α4 (Ⅳ) gene results in Alport syndrome, which is a chromosomal thermoform, and mutation of the α5 (Ⅳ) gene results in X-linked disease, Do not " cause " kidney disease. Instead, the absence of collagen α3 (Ⅳ), α4 (Ⅳ) or α5 (Ⅳ) appears to be the result of sustained embryonic GBM containing α1 (Ⅳ) and α2 (Ⅳ) collagen chains. These fetal GBMs are suitable glomerular filters for the first 10 years of a person's life (or about the first three weeks in a mouse model). However, after this period, the fetal GBM appears to not function effectively. For example, in one patient with Alport syndrome, GBM ultrastructure studies of nine-year-old patients with Alport syndrome were found to be relatively normal hyperfine structures (Cangiotti et al., Nephrol. Dial. Transplant., 11: 1829-1834, 1996]. However, at age 18, the GBM hyperfine structure of the same patient developed advanced Alf glomerulonephritis.

In Alport syndrome, a human basement membrane is relatively normal up to 5 to 10 years of age when the integrity of the basement membrane can be monitored by a gradual increase in urinary albumin. Biopsy studies showed that the basal membrane microstructure was normal in pre-proteinuria patients. Ultrastructurally, GBM disease is evidenced by irregular thickening and thinning of GBM. Membrane cleavage is thought to be the cause of brown rice hematuria (that is, a small number of red blood cells can be detected in urine) observed with proteinuria.

There is little known about the mechanism of Alport renal disease onset and progression; However, it has been speculated that the accumulation of GBM components and the dilution of GBM may be due to increased susceptibility of the membrane to proteolysis, and / or increased synthesis of matrix molecules due to changes in normal regulatory pathways.

Therefore, there was a need for a model for Alport syndrome due to inherent limitations in the study of human specimens. People show a range of severity in the progression of the disease, probably due to differences in genetic background. Significant studies addressing the molecular character of disease outbreaks and progression are logically impossible in humans, limiting the progress of Alport's kidney disease research.

A mouse model for autosomal allele syndrome was produced by the desired mutagenesis of the gene encoding the type IV collagen alpha 3 (IV) chain (see Cosgrove et al., Genes Devel., 10: 2981-2992, 1996]. The animal model developed progressive glomerulonephritis. Ultrastructural changes in GBM were observed at 1 week old. Such mice are referred to herein as " allport " mice.

In addition, mice were produced by the desired mutagenesis of genes encoding alpha integrin receptor subunits (Gardner et al., Dev. Biol., 175: 301-313, 1996). This integrin unit forms a heterodimer with the integrin β1 subunit to form a biologically active α1β1 integrin heterodimer, which is found on the surface of mesangial cells in the kidney glomeruli. Integrin α1β1 receptors are the only integrin receptors found in the mesangial matrix and are exclusively localized in the mesangial matrix. In addition to the altered adhesion with the collagen matrix of fibroblasts, knockout mice do not have a distinct phenotype. Mice normally develop, reproduce, and live at normal life. It was surprising that the absence of this receptor did not affect normal kidney development and / or function, since the α1β1 heterodimeric integrin receptor is the only integrin receptor identified on the surface of mesangial cells of the kidney glomeruli. This suggests that it is not needed or that many paths can compensate for its absence.

The present invention provides a novel dual knockout (i.e., dual mutant) mouse model. This was developed by crossing α1 knockout mouse species with collagen α3 (Ⅳ) knockout species (Alport mice) to produce mutants lacking both the integrin α1 receptor subunit gene and the collagen α3 (Ⅳ) gene. Although the absence of the? 1? 1 integrin receptor does not play a clear role in normal renal development and function, the mesaclin matrix is a synthetic site for metalloproteinases and cytokines such as TGF-beta 1, It is thought that the α1β1 integrin receptor plays a specific role in the development of the kidney because it is involved in cell proliferation and expansion of the mesangial matrix. In fact, the study of integrin α1 collagen α3 (IV) double knockout is quite unique and important. The following discussion describes many of the characteristics of the double knockout mice of the present invention.

A preferred overall assessment of the integrity of the kidney filter is proteinuria (i.e., the presence of excess serum protein in the urine). As illustrated in Fig. 1, in the double knockout, proteinuria was delayed by more than one week, and in the copland, which was alpha (i.e., collagen alpha 3 (IV) gene deficiency but including alpha 1 integrin unit gene) Lt; / RTI &gt; weeks to about 9.5 weeks for the week to about 6.5 weeks. The onset and rate of proteinuria (i.e., the presence of serum albumin in urine) is a good measure of the effectiveness of the methods of the present invention. Serum albumin levels can be measured by gel electrophoresis and Coomassie blue staining (running an equal volume of urine) or by commercial stick testing. The average death toll due to renal disease is about 8 to 9 weeks in Alport mice, regardless of whether the mouse is 129Sv / J or 129Sv background (to confirm this point, 10 or more mice were used for each genetic background ). Double knockouts survive to an average of about 15 weeks to about 16.5 weeks of age.

Thus, the elimination of the? 1? 1 integrin receptor had a significant effect on the onset and progression of Alport's kidney disease. In addition, mice lacking the? 1? 1 receptor exhibited improved glomerular function compared to other mice tested. In animals that did not express the α3 (Ⅳ) gene and heterozygous for the α1 knockout mutation, there was moderate improvement in glomerular function and disease progression, suggesting that α1 integrin had a dose-dependent effect on ALP progression (I. E., Reducing alpha 1 integrin expression by half, provided a protective effect intermediate between altox mice and double knockout). This intermediate protective effect in Alport animals heterozygous for the alpha 1 integrin mutation demonstrates that partial inhibition of the alpha 1 beta 1 integrin receptor provides a useful advantage. This is an important finding because it applies to treatments involving inhibition of the? 1? 1 integrin receptor when used in humans.

Transmission electron microscopic analysis revealed that both in collagen α3 (Ⅳ) and α1 integrin allele, normal in both collagen α3 (Ⅳ) and normal (α1 integrin in integrin), or both collagen α3 (Ⅳ) and α1 integrin (Double knockout) of 7-week-old mice. This viewpoint was chosen because this week's altrip mouse was nearing its end. The panel selected in Figure 2 represents at least five different glomerular regions. As illustrated in Figure 2, the glomerular capillary loop of normal mice (Figure 2A) had a three-layer basement membrane with a uniform thickness and a regular foot process (the foot process in all three panels is indicated by arrows). The capillary loop of AlportMouse (FIG. 2B) showed a dilated basement membrane (characteristic of advanced disease) with phacoemulsification and thinning. The foot process, which is thought to have an effect on the kidney filtration efficiency, has been increased and fused. In the double knockout (Figure 2c), the basement membrane was much less affected than the Alport mouse (Figure 2b). While the basement membrane was thinner than the control, it was much less sparse and the foot process of the podocytes was usually normal. In Alport mice, about 40% of the glomeruli were fibrous, whereas only 5% of the double mutants were fibrous.

Immunofluorescence analysis was performed using frozen neocortex obtained from the same animal used in Fig. The tissue was reacted with an antibody specific for a protein known to accumulate in GBM due to the action of Alport renal disease progression. The results in FIG. 3 illustrate that the distribution of the collagen COL4A1 (alpha 1 (IV)) and 4A2 (alpha 2 (IV)) chains was the same for both albop and glomerulonephritis glomeruli. In both cases, the capillary loop (indicated by arrows in all panels in FIG. 3) and the mesaclin matrix were positive (FIG. 3B, C). Laminin-1 showed a significant accumulation in the GBM of the altimouse compared to the control (Fig. 3D compared with Fig. 3E), whereas in the double mutant (Fig. 3F), accumulation of laminin- 3E). &Lt; / RTI &gt; Fibronectin was normally localized only in the mesangial matrix, but it was found in Albermouth that it was localized to the GBM as well as the mesangial matrix (Fig. 3H). Surprisingly, accumulation of fibronectin in the capillary loop was not observed in the double mutants (Fig. 3I). These results were very reproducible. In contrast, staining for heparin sulfate proteoglycans showed weakened staining in the mesaclin matrix of the duplex mutant (Fig. 3L) compared to the control (Fig. 3J) or altrip mouse (Fig. 3K). The accumulation of enstatin in GBM was observed in both the alport and the double mutant samples, with no discernible difference between them (Fig. 3N and Fig. 3O).

Together, these data illustrate that the α1 null mutation in a double mutant results in a delay in Alport's renal disease progression. This is evident in both the physiological level (delayed onset of proteinuria as shown in Fig. 1) and super-microstructural level (reduced GBM damage and foot process disappearance as shown in Fig. 2). The immunofluorescence studies provided in Figure 3 illustrate that the elimination of the [alpha] 1 [beta] 1 integrin receptor results in a specific change in the accumulation of extracellular matrix components in both the GBM and the mesogenic matrix. Accordingly, the present invention includes a therapeutic method characterized in that the? 1? 1 integrin receptor binding site is blocked on the kidney cell surface. These methods of treatment are described in more detail below.

Figure 9 also shows that cytokine TGF- [beta] l is induced in Alport mouse, whereas alpha 1 integrin mutation is not induced in further latent albmouth mice. Thus, in the absence of? 1? 1 integrin, the rate of progression of renal disease is significantly reduced since no TGF-β1 induction, which is responsible for the diminished accumulation of the matrix in the glomerular basement membrane, is observed. This role of TGF-? 1 in renal disease is discussed in more detail in the following section.

Role of TGF-β1

The data herein clearly demonstrate that TGF-? 1 is derived from a particular glomerular cell type (podocyte) of the mouse model used herein. The induction of TGF-? 1 mRNA is reflected by the induction of genes encoding known matrix molecules (e.g., laminin, fibronectin, entanthin, and type IV collagen) that accumulate in the glomerular basement membrane by the action of progressive glomerulonephritis in the model do. In addition, the data herein indicate that TGF-β1 is induced in human alkaline cortex. This supports the validity of animal models in the ability to mimic what happens in a person's albatross kidney.

To demonstrate the role of TGF-? 1, total RNA was isolated from the renal of Alport's animal, and specific for α1 (Ⅳ) and α2 (Ⅳ) collagen chains, entatin, laminin β1 or β2 chain, fibronectin, or TGF- Lt; RTI ID = 0.0 &gt; radiolabeled &lt; / RTI &gt; probe. The results in Figure 4 illustrate that mRNA for all these proteins, except for laminin beta 1, is induced after the onset of proteinuria in the AlportMouse model. The Norton blot for this same time lapse was performed on laminin alpha 1, laminin beta 2, laminin gamma 1, heparin sulfate proteoglycan core protein, and collagen alpha 4 (IV), and alpha 5 (IV) chains. There was no significant difference in mRNA levels for these other basement membrane proteins when the control was compared to the mutants.

The results of the Norton assay were analyzed to directly quantify relative changes in specific mRNA expression over time. Figure 5 illustrates that the induction of specific mRNA levels first appears at 6 weeks of age. By 8 weeks, mRNA levels peaked and mRNAs encoding TGF-β1 and fibronectin were induced 6.6-fold and 9.4-fold, respectively, as compared to control mice. MRNA levels for collagen α1 (Ⅳ), α2 (Ⅳ), and enstatin were all induced to about three fold up to eight weeks. In contrast, when measured by these same total RNA Norton blots, no significant change in mRNA encoding the laminin β1 and β2 chains was observed at any time during renal disease progression.

Glomeruli contain only a small proportion of the total mass of the kidneys. Individual cell types within the glomeruli include lower rates. Thus, the Norton blot of total kidney RNA is unlikely to detect the induction of a message that may be specific to the glomerulus, or to a particular glomerular cell type. In-situ hybridization was performed using digoxigenin-labeled antisense probes specific for mRNA to examine whether mRNA encoding TGF-? 1, or different basement membrane components, was induced in a particular glomerular cell type. The result is shown in Fig. In normal mice, transcripts for TGF-beta 1 (FIG. 6D), fibronectin (FIG. 6G) and laminin β 1 (FIG. 6M) were localized exclusively to mesangial cells whereas in Alport mouse these same transcripts , H, and N) are clearly localized to podocytes (rings of cells on the lateral side of the glomeruli) that demonstrate gene activation in this glomerular cell type. Cell-cell activation of collagen alpha 1 (IV) is also evident (compare Fig. 6B with 6A). Activation of a gene encoding a matrix protein in glomerular cells may result in a change in GBM composition.

Detection-based TGF-β1 protein data in immune oxidase using antibodies specific for the active isoform of cytokines confirms data obtained by in situ hybridization analysis of TGF-β1 mRNA. The data shown in FIG. 7 illustrate increased translation to protein by increased expression of TGF-? 1 mRNA in podocytes.

Since data for TGF- [beta] were obtained using a mouse model, RNase protection analysis was performed to determine if the level of mRNA for cytokines was elevated in human cortex obtained from Alport vs. control patients. The data in FIG. 8 illustrate a 3- to 4-fold increase in TGF-? 1 mRNA in human Altaic cortex compared to control. This demonstrates that cytokines are also overexpressed in human Alport kidney. Thus, inhibiting the activity of TGF- [beta] l provides a valid therapeutic protocol for limiting, and preferably preventing, matrix accumulation in Alport syndrome, particularly GBM.

As discussed above, Figure 9 shows that TGF- [beta] l is induced in Alport mice, whereas it is not induced in double knockout mice that further incubate the [alpha] 1 integrin mutation. Thus, in the absence of? 1? 1 integrin, the induction of TGF-? 1, which causes a decrease in accumulation of the matrix in the glomerular basement membrane, is not observed, so the rate at which the kidney disease progresses is markedly reduced.

Blocking (or inactivating) integrin alpha 1 beta 1 receptors and inhibiting TGF- beta 1 is markedly synergistic in the onset, attenuation of progression, and / or reversal of renal disease (particularly Alport's kidney disease). This synergistic effect is demonstrated using, as an example, two different drugs that block TGF-? 1 activity in three different ways. Both have been studied to confirm that the result is due to inhibition of TGF-β1 activity rather than a side effect of drug therapy.

The first example is a drug called Tkrolimus or FK506 manufactured by Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan. This drug is generally used as an immunosuppressant to prevent rejection after organ transplantation. The drug acts by inhibiting an important sub-unit of the T-cell receptor, called serine threonine phosphatase, called calcinurin, and a critical portion of T-cell receptor signaling. As reviewed recently (Crabtree, Cell, 96: 611-614, 1999), calcinurin is a subunit of various receptors. One of these receptors has recently been reported for TGF-? 1 (Wang et al., Cell, 86: 435-444, 1996). Drug FK506 was tested as a TGF-? 1 inhibitor. Thus, treating mice with an appropriate dose of FK506 would inhibit TGF-beta type I / type II receptor signal transduction.

Because FK506 has other biological activities besides inhibiting TGF-? 1 (efficacious immunosuppression by T-cell inhibition is most notable), a second TGF-? 1 inhibitor was evaluated. This second inhibitor is an experimental phase of the drug being developed by Biogen Inc. (Cambridge, Mass.). This drug is a competitive inhibitor of cytokines and absorbs active cytokines as an inactive soluble receptor complex. It is a fusion protein of soluble chimeric TGF-beta RII / IgG1 murine animal (International Publication WO 98/48024). In the described experiment, 25 [mu] g of the inhibitor was injected through the tail vein of the mouse twice a week.

Observations made using an animal model system consistent with both drugs are concluded to be due to inhibition of TGF-? 1 activity, as the mode of action and potential side effects of FK506 and the soluble TGF-? 1 inhibitor of Biogen are different.

Two types of experiments were performed. Both drugs were tested using a 129 Sv / J mouse model (Alport mouse) to examine the biological effects of TGF-beta1 inhibition itself. Second, both drugs were tested in a double knockout mouse model to examine the biological effects of inhibition of integrin 1 integrase in combination with TGF-beta1 inhibition. In all cases, the data provided herein were repeated three or more times with a high degree of consensus.

When TGF-β1 is inhibited in the Alport mouse model, there are several beneficial effects. Basal membrane morphology is overall improved, but significant foot process loss is still observed. Thus, TGF-? 1 can improve the GBM morphology by reducing the matrix accumulation rate, but it does not have a significant effect on the foot process based mechanism. This means that even though the single administered TGF-? 1 inhibitor provides an improvement, there is no likelihood of succeeding in improving Alport syndrome or any other characteristic of such a disorder. In double knockout mice, most print processes up to 10 weeks of age appear normal, but there is a significant matrix accumulation in GBM. Approximately 30% of the glomeruli are not super-microstructurally distinct from normal mouse glomeruli when these same animals are treated starting at 4 weeks of age using any TGF-? 1 inhibitor and tissues collected at 10 weeks of age . Thus, a significant improvement in the treatment protocol described herein can be obtained using a TGF-? 1 inhibitor in combination with an? 1? 1 integrin receptor inhibitor.

Norton blot data on all mRNAs of kidneys obtained from Alportomone or double knockout treated with either of the TGF-? 1 inhibitors indicate that expression of these messages encoding matrix molecules in which the TGF-? 1 or? 1? 1 integrin knockout mutations accumulate in the GBM And there is a clear difference between the ways in which they affect. The mRNA encoding metalloproteinases (including the matrix metalloproteinase 2 (MMP-2)) and their corresponding inhibitors (including TIMP-2 and TIMP-3) Lt; / RTI &gt; and are also affected differently in Alportomo versus knockout mice treated with either of the TGF-beta 1 inhibitors. Specifically, Timp-3, which is expressed at a very high level in normal mice, is inhibited in Alport mice and double knockout. Treatment of double knockout mice with TGF- beta 1 inhibitor prevents the inhibition of TIMP-3 and restores mRNA to levels comparable to those observed in control mice (Figure 21).

Following this same trend, laminin alpha 2 expression is normally confined to mesangial matrices. The deposition of laminin α2 is the earliest molecular alteration identified in association with the onset of ALPT GBM disease and coincides with the first detection of basement membrane hyperplasia. The deposition of laminin alpha 2 in GBM of double knockout mice is not observed even at 7 weeks of age (Fig. 18, 1D group). Administration of the TGF-? 1 inhibitor to SV / J altxt mice does not inhibit the deposition of laminin? 2 (Fig. 18, 1C group). This emphasizes different differences in the way α1β1 versus TGF-β1 work in delaying disease progression and demonstrates why concomitant administration offers synergistic benefits with clear evidence.

The failure of TGF-β1 to inhibit the loss of the podocyte foot process seems to be directly related to the observation of laminin α2. Laminin forms a heterotrimer composed of alpha, beta, and gamma chains. In the basement membrane, they are crosslinked with each other to form a sheet-like superstructure that is an essential part of the basement membrane. Laminin is known to interact with integrin receptors and plays an important role in the differentiation and maintenance of tissue function. In normal mice, GBM contains a heterozygous trimer chain laminin-11, mainly of the? 5,? 2, and? 1 chains. This laminin is known to bind with high affinity to the integrin [alpha] 3 [beta] 1 receptor on the cell surface. These interactions are thought to play an important role in maintaining the complex cytoskeletal structure that forms the foot process. The laminin heterodimer (laminin-2 and laminin-4) containing the? 2 chain does not bind to the? 3? 1 integrin. Thus, the presence of the laminin-2 chain in GBM results in the suppression of foot process extinction by inhibiting the binding of the α3β1 integrin to the normal substrate (laminin-11). As mentioned, in double knockout, the deposition of laminin [alpha] 2 is inhibited, which correlates well with the maintenance of the foot process in this mouse species.

A further observation relates to the problem of interstitial fibrosis. Interstitial fibrosis occurs late in Alport syndrome progression. In the 129Sv / J altimouse model, fibrosis was not observed before 7 weeks, and the mean death age was 8 weeks. However, in a double knockout, the onset of fibrosis lasts from 8 to 9 weeks, to 15 weeks, the average death week. Therefore, double knockout is an excellent model for the study of fibrosis. There is a significant progression of fibrosis in double knockout mice, which can be largely prevented by using TGF-? 1 inhibitors.

Processing method

In one aspect, the invention provides a method of treating glomerular disease, particularly the onset of advanced glomerulonephritis and / or fibrosis (measured by the presence of detectable levels of urine serum albumin, using commercially available stick testing or gel electrophoresis and gel staining methods) (E. G., A blocking agent) for blocking or inactivating the function of the? 1? 1 integrin receptor as a way of delaying or even reversing the delay and progression (determined by measuring the rate at which the measured albumin level increases as a function of time) . These include, but are not limited to, nine or more peptides from proteins that bind to the alpha 1 beta 1 integrin receptor, such as laminin, type IV collagen, fibronectin, and entampin. Small molecules that bind within the ligand site of the receptor / [alpha] 1 [beta] l receptor can be created based on protein / alpha 1 integrin receptor studies. Antibodies and antibody fragments that specifically bind to the binding site of the? 1? 1 integrin receptor can be used in the present invention. Such antibodies or antibody fragments include polyclonal antibodies, monoclonal antibodies, anti-idiotypic antibodies, animal-derived antibodies, humanized antibodies and chimeric antibodies.

Drugs (artificial ligands) that block binding sites for the? 1? 1 integrin receptor can be used in the methods of the invention. Examples of such drugs include, but are not limited to, neutralizing antibodies, peptides, proteolytic fragments, and the like. These drugs are thought to block signal transduction through the receptor. The efficacy of such therapeutic agents can be determined, for example, by measuring the downstream effect on gene expression, such as TGF-? 1, fibronectin, laminin chain, etc., by morphological changes in the glomerular basement membrane, and / Can be determined by evaluation by improvement.

Antibodies that neutralize? 1? 1 integrin function are provided in the Examples and FIG. As an example to illustrate that a soluble drug capable of blocking the interaction of a ligand with an? 1 integrin exhibits the same effect as the? 1 gene knockout mutation on the onset of a kidney disease, Fabbri et al., Tissue Antigens, 48: 47-51 ] Was obtained. This antibody has been shown to inhibit glomerular basement membrane damage in the Alport mouse model in the same manner as observed with dual mutants (400 ng / injection, three times per week, intraperitoneal injection).

In another aspect, the invention relates to the use of a medicament for reducing the level of TGF-? 1 as a method of delaying the accumulation of a matrix in the course of glomerular disease, particularly progressive glomerulonephritis. Thus, such drugs may be useful in the treatment of patients with Alport syndrome and insulin-dependent diabetes mellitus as well as in particular progressive glomerulonephritis, or enlargement of the mesangial matrix, proliferation of mesangial cells, enlargement of the matrix deposition in the glomerular basement membrane, Irregularities, loss of podocyte foot process, or some combination of the indications described above, all of which can be used to treat a disease characterized by being a common pathway for renal fibrosis (to prevent this, the alpha 1 beta 1 integrin inhibitor And TGF-? 1 inhibitors are particularly effective). For this purpose, antisense therapy as described in the art can be used to block the expression of TGF-beta 1 or alpha 1 beta 1 integrin receptor protein. A variety of synthetic or natural drugs may be used.

Drugs that neutralize the ability of the TGF-? 1 cytokine to interact with the receptor may be used in the methods of the invention. Examples of such drugs include neutralizing antibodies, calcineurin inhibitors (i. E., Macrolides) such as those disclosed in U.S. Patent No. 5,260,301 (Nakanishi et al.) (Such as FK506 or tacrolimus and structurally related compounds) Soluble receptor such as a soluble recombinant TGF-? 1 receptor (e.g., soluble chimeric TGF-? RII / IgG1 fusion protein) disclosed in WO 9848024 (Biogen Inc.), a peptide fragment of said receptor, or a peptide that is irreversibly (or stably) But are not limited to, any such fragment that has the ability to bind and inhibit the ability to bind to the receptor. In addition, drugs that inhibit the ability of TGF-? 1 to convert signals into nuclei may be used. The efficacy of such therapeutic agents can be determined, for example, by measuring the downstream effect on gene expression, such as TGF-? 1, fibronectin, laminin chain, etc., by morphological changes in the glomerular basement membrane, and / Can be determined by evaluation by improvement.

In one embodiment, FK506 or cyclosporin A has been used to inhibit the calcineurin portion of the TGF-? 1 receptor and has been shown to inhibit the TGF-? 1 receptor as described for several other renal diseases (Wang et al., Cell 86: 435-444, 1996 and Muller et al., Endocrinol, 3: 1926-1934, 1989], inhibit signal transduction through the receptor complex and thereby inhibit the signal transduction pathway as previously described for the same renal disease (Callis et al., Pediatr. Nephrol., 6: 140-144, 1992), can inhibit the onset of proteinuria (through an unknown mechanism). Prior to the present invention, this was not recommended for diseases associated with increased extracellular matrix in Alport syndrome, diabetes, or renal glomeruli.

In particular, the invention exemplifies the effect of a combination therapy having a synergistic effect on inhibiting the alpha 1 beta 1 integrin receptor and TGF- beta 1 and preventing both fibrosis and glomerular disease associated with Alport syndrome. Other disorders, including progressive basement membrane damage, enlargement of the mesangial matrix, proliferation of mesangial cells, manifested by one or more of GBM hyperplasia, thinning, cleavage, extinction of the podocyte foot process, or any combination of the above, You will benefit from this treatment. In addition, the present inventors illustrate the effectiveness of combination therapy in preventing fibrosis of the coronary gaps in Alport syndrome. Fibrosis is a common pathway and the mechanism for this is thought to be the same for all kidney diseases involving fibrosis. Thus, the efficacy of this combination therapy in the treatment of fibrosis should be applicable to all forms of renal fibrosis, regardless of the underlying cause of the pathway leading to fibrosis.

The drug used in the method of the present invention may be administered in combination with a pharmacologically acceptable carrier. The medicament of the present invention is formulated into a pharmacological composition (i.e., a formulation) and then administered in various forms suitable for the route of administration selected for mammals such as human patients, according to the methods of the present invention. Formulations typically include those suitable for parenteral administration (including subcutaneous, intramuscular, intraperitoneal, and intravenous) or other methods that allow for the stability of the drug.

Suitable pharmacologically acceptable carriers may be in the form of liquid, semi-solid, finely divided solid, or a combination thereof. Formulations suitable for parenteral administration conveniently include sterile aqueous preparations of the drug, or dispersing preparations of sterile powders comprising the drug, preferably those which appear to the blood of the recipient. Isotonic agents that may be included in the liquid formulation are sugars, buffers, and sodium chloride. The drug solution can be prepared in water, optionally mixed with a non-toxic surfactant. Dispersions of drugs may be prepared from water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, glycerol esters, and mixtures thereof. The final formulation is sterile and stable under the conditions of manufacture and storage. The required fluidity can be achieved, for example, by the use of a liposome, by using a suitable particle size when a dispersant is used, or by using a surfactant. Sterilization of the liquid formulation can be accomplished by any convenient method of maintaining the biological activity of the drug, preferably by sterile filtration. Preferred methods of preparing powders include vacuum drying and lyophilization of sterile injectable solutions. Subsequent microbial contamination can be prevented by using various antimicrobial agents such as antimicrobial agents, antiviral agents and antifungal agents including parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. Absorption of the drug over a long period of time can be achieved by including retarding agents such as aluminum monostearate and gelatin.

In addition to the above ingredients, the formulations of the present invention may further comprise one or more accessory ingredients including diluents, buffers, binders, disintegrants, surfactants, thickeners, lubricants, preservatives (including antioxidants) The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.

A useful dose of the drugs described herein (i.e., an effective amount that provides the desired effect) can be determined by comparing the in vitro activity and the in vivo activity in an animal model. Methods of extrapolating an effective dose in humans, and other animals, to humans are known in the art. For example, about 150 mg / kg to about 300 mg / kg of the intravenous drug twice a day. A suitable dosage to be administered is generally an amount sufficient to exhibit the desired effect, for example, by inducing a demonstrable increase in expression of the enzyme on phase II, or other features described herein.

Example

In this embodiment, two different animal models are described. The first is the "Alport" mouse model which does not express collagen α3 (IV) and α1 integrin is normal and is described in Cosgrove et al., Genes Dev., 10: 2981-2992, Referred to as a " double knockout " mouse, is a mouse model induced by crossing an allt mouse with a mouse without the alpha 1 integrin gene. There are differences between Alpha and Double knockout mice that serve to explain the efficacy of blocking alpha 1 beta 1 integrin action that delays glomerular disease. These effects will be described in detail below.

Alport mice are in a pure, genetically back-ground state of 129 Sv / J and double knockout mice are in a 97.5% pure, 129 Sv background state. Exceptions to this are the animals used to derive Figures 4, 5, and 6. These experiments were performed early in the history of the Alport mouse model, for example, chimeric males were crossed with C57B1 / 6 females and then crossed with the resulting heterozygotes to generate F2 generation homozygous allt mice. These generations are the same generations of animals used in the first description of the Alport animal model [Cosgrove et al., Genes Devel., 10: 2981-2992, 1996]. This is common in early gene knockout studies because it quickly identifies the knockout phenotype. Regarding the specific mRNA induction, the results from the mice of these F2 are consistent with the results obtained for the pure 129 Sv / J knockout. It should be noted that all experiments providing comparative analysis of AlportMouth vs. double knockout mice were performed on the same breeding line.

In both animal models, the role of TGF-β1 in the development of fibrosis as well as in the progression of renal disease was examined. This was done by testing two different inhibitors of TGF-? 1 acting in a wide variety of ways. The use of two different inhibitors (FK506 and dual TGF [beta] 1 receptor) provides evidence that the effect is not a side effect of the drug used but is due to TGF-beta1 inhibition. FK506 may be a therapeutic agent for the treatment of advanced fibrosis associated with the overexpression of TGF-? 1.

In the process of analyzing different animal models and described drug therapies, there is a specific assessment process that is consistently and consistently maintained. Three different sites were evaluated. First, the kidney function was examined to provide an assessment of the overall integrity of the glomerular filter. This was done by testing urinary excretion of serum albumin. Second, structural integrity of tissue was tested at both optical and electron microscopic levels. Both transmission and scanning electron microscopy methods were used. These methods are designed to measure the histopathologic extent of the kidney under these different conditions. Finally, molecular analysis assays were performed to test what changes were occurring in the specific genes and whether the corresponding proteins were present as a result of these different conditions. They noted specific RNA using Norton blot, in situ hybridization, and RNase protection and tested using immunohistochemistry for specific proteins. Since the above-described specific methods are repeated for the analysis of drug therapy used in different animal models and different animal models, the methods have been carried out in all cases in the same way (in order to avoid unnecessary mention It should be noted here that the description is given only once and then referred to in the specific examples which follow.

There are a number of alternative techniques and methods available to those of skill in the art to enable the invention to similarly and successfully perform. All reagents were obtained from Sigma Chemical Co., St. Louis, MO, unless otherwise specified. PBS used in all of the studies described herein was purchased from Sigma Chemical Company, St. Louis, Missouri, in the form of a product number P-4417, and each of these tablets was reconstituted in 200 ml of water to produce pH 7.4 PBS Respectively.

Way

I. Kidney function

A. Protein analysis: Initial measurements of urine protein were performed by using Albustix (Miles Laboratories, Elkhart, IN) and deciphering the relative amounts from the color charts fitted with the kit.

Urine samples were collected at weekly intervals and 0.5 μl were fractionated by electrophoresis through 10% denaturing acrylamide gel. Proteins in the gel were photographed by staining with coomassie blue. Bovine serum albumin was used as the molecular weight standard.

II. Integrity

A. Transmission electron microscope: Fresh outer cortex was immersed in 4% paraformaldehyde, fixed for 2 hours and stored at 5 ° C in PBS (pH 7.4). The tissues were washed thoroughly with 0.1 M Sorenson's buffer (Sorensen buffer was prepared by mixing 100 ml of 200 mM monobasic basic sodium phosphate and 400 ml of 200 mM dibasic sodium phosphate with 500 ml of water and adjusting the pH to 7.4) (5 times each at 10 째 C at 4 째 C) and postfixed in 1% osmium tetroxide in Sorensen buffer for 1 hour. The tissue was then dehydrated in graded ethanol (70%, 80%, 90%, 100% each in 10 minute increments) and finally in propylene oxide and the poly / bed 812 epoxy resin Poly / Bed 812 epoxy resin) (Polysciences, Inc., Warrington, Pa.). Briefly, 42 ml of Polybod 812 were mixed with 26 ml of dodecylsuccinic anhydride (DDSA, Polysciences, Inc.) and 24 ml of nadic methyl anhydride (Polysciences Inc.). 1.5 ml of 2,4,6 tri (dimethylaminomethyl) phenol was added as a catalyst and the activated resin was frozen to an extent of 10 ml in an aliquot to the extent necessary to embed the specimen. The glomeruli were identified in a 1 mu m (micron) section stained with toluidine blue and the thin sections were analyzed using a Reichert Jung Ultracut E Ultramicrotome (Cambridge Instrument Co., Vienna, Austria) Nanometer) thick. The fragments were placed on a grid and stained with uranyl acetic acid and lead citrate using known methods. The grid-mounted sections were tested and photographed using a Philips CM10 electron microscope (Phillips CM10 electron microscope).

B. Scanning electron microscope: A small piece (approximately 2 mm cubic) of the kidney cortex was fixed in 3% phosphate buffered glutaraldehyde and then postfixed in 1% phosphate buffered osmium tetroxide. Samples were then dehydrated in graded alcohols and critical-point dry in carbon dioxide. The cube was then pressed into the pieces by applying pressure to the edge of the razor blade and placed on a stub with the shredded surface facing upwards. The surface was sputter coated with gold / palladium using a known method and visualized with a scanning electron microscope.

C. Jones Silver Methenamine Stain: Burns and Bretschschneider, Thin is in: Plastic Embedding of Tissue for Light Microscopy, Educational Products Division, American Society of Clinical Pathologists, Chicago, IL, pp. 24-25, 1981). &Lt; / RTI &gt;

III. Molecular analysis

A. Norton blot analysis: The kidneys were removed, snap frozen in liquid nitrogen and ground into powder in liquid nitrogen using a mortar and pestle. The powder was solubilized in TRIZOL reagent (GibCo / BRL, Grand Island, NY) using 5 ml of reagent per kidney. Whole cell RNA was extracted according to the manufacturer's instructions. 20 의 of RNA was fractionated on a 1.0% agarose / formaldehyde / MOPS (3- (N-morpholino) propanesulfonic acid) gel by electrophoresis at 80 V for 4 hours. The gel was immersed in water for 45 hours and was then washed with Hybond N (uncharged nylon, New England Nuclear, Inc., Boston) by capillary blotting overnight using 750 mM ammonium acetate (in water) , &Lt; / RTI &gt; MA). RNA was UV cross-linked to the blot using a Stratalinker (Stratagene, Inc., LaJolla, Calif.). The blots were sonicated and denatured salmon sperm DNA (Sigma Chemical Co.) in 50% formamide, 10 × Denhard's solution, 1 M NaCl, 50 mM Tris-HCl, pH 7.4, 1% SDS, and 200 μg / ml. , St. Louis, Mo.). Probes ( ³² P-labeled cDNA probe fragments) were labeled by random priming at a concentration of 10 ⁹ cpm / μg using a random priming DNA labeling kit (Boeringer Mannheim, Indianapolis, Ind.). The prehybridization and hybridization buffers consisted of 5X saline-sodium citrate buffer (SSC), 5X Denhardt's solution, 0.5% sodium dodecyl sulfate (SDS), and sonicated and denatured salmon semen DNA at 200 μg / ml . The filters were prehybridized for at least 5 hours and then hybridized overnight using a probe of 1 million DPM per ml of hybridization solution (disintegration per minute). The filters were then washed in high stringency (twice 30 min each at 65 [deg.] C in a solution consisting of 300 mM NaCl, 30 mM sodium citrate, and 0.2% sodium dodecyl sulfate in water) Film. The quality of the RNA preparation and the consistency of loading were determined by staining the gel with ethidium bromide and incubating the 18S and 28S ribosomal RNA bands with Gel Imager 2000 digital imaging system instrument and software package, (Applied Imaging, Santa Clara, Calif.). A reasonable ratio of ribosomal bands confirmed that the RNA preparation was of high and consistent quality. Quantitative density measurement scanning only confirmed a 10% change in sample loading. Because of concerns that changes in cellular physiology associated with progressive fibrosis would make such a control probe unreliable, the above tool was used instead of a control probe. Quantitative differences in expression were assessed by fluorescence analysis using BioRad GS-525 phosphorimager (BioRad GS-525 phosphorimager) (Bio Rad, Inc., Hercules, Calif.) And background hybridization was subtracted.

The probes were separated from the murine 5 ' stretch cDNA library (Clonetech) by PCR amplification using known sequences of different basement membrane collagen cDNAs and known sequences for related proteins. In the case of basement membrane collagen probes, the sequence encoding the conserved NCl domain was amplified. The primers and conditions used were the same as described in Miner and Sanes, J. Cell Biol., 127: 879-891, 1994. In the case of collagen COL4A1, a primer (Muthukumaran et al., J. Biol. Chem., 264: 6310-6317, 1989] discloses a sense, 5'TCTGTGGACCATGGCTTC3 '(SEQ ID NO: 1); Antisense, 5'TTCTCATGCACACTTGGC3 '(SEQ ID NO: 2). In the case of collagen COL4A2, a primer (Saus et al., J. Biol. Chem., 264: 6318-6324, 1989) discloses a sense, 5'GGCTACCTCCTGGTGAAG3 '(SEQ ID NO: 3); Antisense, 5'TTCATGCACACTTGGCAG3 '(SEQ ID NO: 4). Both COL4A1 and COL4A2 were amplified under the same conditions. The virion (ax 10 ⁶ ) was amplified by 35 cycles of PCR using high temperature start (95 ° C for 10 minutes), 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute. The probe was subcloned and confirmed by DNA sequencing.

Probes for basement membrane-related proteins were amplified from the same library as basement membrane collagen. Primers were taken from the 3 ' sequence. In the case of HSPG core proteins, primers [Noonan et al., J. Biol. Chem., 263: 16379-16387, 1988] discloses a sense, 5'CGGGCCACATTCTCC3 '(SEQ ID NO: 5); Antisense, 5'GGAGTGGCCGTTGCATT3 '(SEQ ID NO: 6). In the case of laminin B2 (Laminin B2), a primer (Sasaki and Yamada, J. Biol. Chem., 262: 17111-17117, 1987] discloses the sense 5'ACCAGTACCAAGGCGGA3 '(SEQ ID NO: 7); Antisense, 5'TCATTGAGCTTGTTCAGG3 '(SEQ ID NO: 8). In the case of laminin B1, primers (Sasaki et al., Proc. Natl. Acad. Sci. USA, 84: 935-939, 1987) has the sense 5'TAGAGGTTATTTTGCAGCAGA3 '(SEQ ID NO: 9); Antisense 5'TTGGATATCCTCATCAGCTTG3 '(SEQ ID NO: 10). In the case of entactin, a primer (Mann et al., EMBO Journal, 8: 65-72, 1989) has the sense 5'GTGGTTTACTGGACAGACATC3 '(SEQ ID NO: 11); Antisense, 5'CCAATCTGTCCAATAAAGG3 '(SEQ ID NO: 12). In the case of the laminin A chain, primers (Duetzmann et al., Eur. J. Biochem., 177: 35-45, 1988) has the sense 5 'ACACACTCCAAGCCCACAAAAGCAAG3' (SEQ ID NO: 13); Antisense 5'GAGGGAAGACTCCTTGTAGGTCAA3 '(SEQ ID NO: 14). In the case of S-laminin, a primer (Hunter et al., Nature, 338: 229-234, 1989) was synthesized using the sense, 5'GCAGAGCGGGCACGGAGC3 '(SEQ ID NO: 15); Antisense, 5'TGTACCTGCCATCCTCTCCTG3 '(SEQ ID NO: 16). The PCR conditions were the same as those used for the type IV collagen chain.

Probes for MMP-2, Timp2, and Timp3 were isolated using total RNA from 13-day-old mouse embryos by RT-PCR. A primer set for MMP-2 amplifies a 237 bp fragment from mRNA (Reponen et al., J. Biol. Chem., 267: 7856-7862, 1992), upstream primer 5'CCC CTA TCT ACA CCT ACA CCA3 '(SEQ ID NO: 17) and downstream primer 5'TGT CAC TGT CCG CCA AAT AAA3' (SEQ ID NO: 18) . A primer set for Timp-2 amplified a 195 bp fragment of mRNA (Shimizu et al., Gene, 114: 291-292, 1992), an upstream primer 5'CAG AAG AAG AGC CTG AAC CAC A3 ' No. 19) and downstream primer 5'GTA CCA CGC GCA AGA ACC3 '(SEQ ID NO: 20). A primer set for Timp-3 amplified a 337 bp fragment from mRNA (Apte et al., Developmental Dynamics, 200: 177-197, 1994), an upstream primer 5'GGT CTA CAC TAT TAA GCA GAT GAA G3 (SEQ ID NO: 21) and downstream primer 5'AAA ATT GGA GAG CAT GTC GGT (SEQ ID NO: 22). For all three probes, 1 μg in total RNA was reverse transcribed by using Gibco superscript plus reverse transcriptase and downstream primer according to the protocol described by the manufacturer. One-tenth of the reactions were amplified by 40 cycles of high temperature start PCR using PFU polymerase (Stratagene, Inc.).

TGF-β1 probes are except for RNase protection, which requires human probes. L. Moses (H. L. Moses [Miller et al., Mol. Endodrinol., 3: 1926-1934, 1989]. For these probes, 24 base pair fragments of TGF-? 1 were amplified by PCR from human renal cDNA library (Clonetech, Palo Alto, Calif.). The primer set used was GCA GAA GTT GGC ATG GTA G (SEQ ID NO: 23) (lower) and GGA CAT CGG GTT CAC TA (SEQ ID NO: 24) (upper). The fragment was reamplified with PFU polymerase (Statagene) and blunt end ligated into pBluescript SK + plasmid.

B. In situ hybridization: The kidney was initially fixed with gentle light heart perfusion (using 4% paraformaldehyde in PBS). Animals were first anesthetized using Avertin (2,2,2-tribromoethanol, Aldrich Chemical Co., Milwaukee, Wis.). The thoracic cavity was opened and puncture with a tuberculin needle to form a small hole in the right ventricle to allow perfusion fluid to be drained. A second tuberculin needle connected to a 30 ml syringe containing perfusion buffer was inserted at the apex of the left ventricle. 1 ml of fixative per gram of body weight was perfused at a rate of about 3 ml per minute. The properly fixed elongation was hard and showed a marble pattern appearance. After perfusion, the kidney capsules were removed with irrigating forceps, the kidneys were cut longitudinally in half (renal, water and cortex split) and placed in fixative at 4 ° C for an additional hour. The fixed halves were embedded in paraffin, cut to 6 μm and transferred onto a SUPERFROST PLUS microscope slide (Fisher Scientific, Inc., Pittsberg, Pa.). Slides were baked on a 60 ° C slide warmer for 20 minutes and stored at 4 ° C until used (slides are available up to 6 weeks). The kidneys from the control and Alport co-workers were embedded side by side to control the microscopic differences that could result during the hybridization process.

The slides were heated in a vacuum oven at 60 DEG C for 1 hour and dewaxed by xylene for 3 consecutive 2 minute washes. The tissue was dehydrated in ethanol, protein removed by incubation in 0.2N HCl for 15 min, washed with PBS and incubated with 3 [mu] g / ml Proteinase K (Boehringer Mannheim, Indianapolis, Digested. Digestion was stopped by washing with 2 mg / ml glycine in PBS. After tissue dehydration (70%, 80%, 90%, 100% for 10 minutes each at room temperature) in graded ethanol solution, the tissue was prehybridized, hybridized, And washed according to the protocol described with the Genius in Situ Hybridization Kit (Boehringer Mannheim, Indianapolis, Ind.). Both prehybridization and hybridization solutions contained 10 mg / ml phenol / chloroform-extracted Baker's yeast tRNA. This step significantly reduced the nonspecific signal. After hybridization, the tissue was washed twice in 2X SSC at 50 DEG C and then digested with RNase A for 6 minutes at room temperature. The amount of RNase A was measured for each probe (ranging from 200 ng / ml to 5 / / ml). Negative control probes include a coding sequence for bacterial [beta] -galactosidase or neomycin phosphotransferase. All probes were about 200 bases in length and were cloned into the SacI site of BlueScript SK + (Statagene, Inc., LaJolla, Calif.) And transcribed from the T3 side (after linearization). The only exception was 974 bases and TGF-? 1 cloned into the pmT vector.

C. RNase Preservation Assay: The experiment was performed using an RPA II kit (Ambion, Inc., Austin, Tex.) According to the protocol provided with the kit. For the probe, 264 base pairs of TGF- [beta] l were amplified by PCR from human renal cDNA library (Clontech, Palo Alto, Calif.). The primer set used was GCA GAA GTT GGC ATG GTA G (SEQ ID NO: 25) (lower) and GGA CAT CGG GTT CAC TA (SEQ ID NO: 26) (upper). The fragment was reamplified with PFU polymerase (Stratagene) and blunt-ended into pBluescript SK + plasmid (Stratagene). Antisense probes were generated from the T7 promoter.

D. Immunofluorescence analysis Fresh kidneys were removed and cut into 3 mm sections and embedded in Tissue Tek OCT aqueous compound (product number 4583, Miles Laboratories, Elkhart, IN) And frozen. The sections were cut to 3 microns using a microchrome type HM505N (Zeiss, Inc., Walldorf, Germany) cryostat and defrosted on poly-L-lysine-coated slides. The slides are immersed in 95% ethanol in cold (-20 ℃) when they are used for staining with basement membrane collagen-specific antibodies, or in 15 (15 ℃) acetone in case of staining with antibodies specific for basement membrane- Min. Slides were air dried overnight and stored dry at -80 ° C until used.

Samples were allowed to reach ambient temperature and then washed three times in room temperature PBS (pH 7.4). When staining with antibodies against type IV collagen, the tissue was pretreated with 0.1 M glycine and 6 M urea (pH 3.5) to denature the protein and expose the antigenic site. A suitable dilution of the primary antibody (experimentally determined) was added to the sample and allowed to react for 3 hours at 5 캜 in a humidified box. The antibody was diluted into a solution of 5% skim milk in PBS (pH 7.4). The use of skim milk powder substantially reduced background fluorescence. Samples were washed 4 times in PBS (pH 7.4) for 10 minutes each at room temperature to remove the primary antibody and then reacted with the appropriate FITC-conjugated secondary reagent. All secondary reagents were used as 1: 100 dilutions in 7% skim milk powder in PBS as diluent. The secondary reagent was reacted at 4 ° C for 2 hours. The slides were then washed four times with cold PBS (pH 7.4) followed by anti-fade mounting media (Vector Laboratories, Inc., Burlingame, Calif.). The sample was sealed under a glass cover slip using a transparent nail polish. The slides were photographed at 1000 magnifications. Jones silver methenamine staining was performed on plastic embedding specimens.

Chlorine antisera for COL4A1 and COL4A2 were purchased from Southern Biotechnology, Inc., Birmingham, AL. These antibodies were tested for cross-reactivity by the manufacturer and produced a staining pattern in the glomeruli consistent with those observed for other antibody preparations for these chains [Miner and Sanes, J. Cell. Biol., 127: 879-891, 1994). Anti-heparin sulfate proteoglycan (HSPG) antibody is a rat monoclonal antibody raised against HSPG core protein purified from EHS mouse tumors. Antibodies were detected by Western blot and dot blot immunoassay by the manufacturer (Chemicon International, Temecula, Calif.) And by Horiguchi et al., J. Histochem. Cytochem., 37: 961-970, 1989, for cross-reactivity with laminin, collagen type IV, fibronectin, and entmotin. The anti-laminin-1 antibody is a rabbit antiserum. The immunogen was purified from the EHS basement membrane and purchased from Sigma Immunochemicals (St. Louis, Mo.). The dot blot immunoassay performed by the manufacturer (Sigma) confirmed the absence of cross reactivity for collagen IV, fibronectin, vitronectin, and controitin sulfate types A, B, and C. Anti-fibronectin is a rabbit antiserum raised against fibronectin purified from human plasma. These anti-fibronectins were tested for cross-reactivity to collagen IV, laminin, bitronectin, and chondroitin sulfate A, B, and C using a dot blot immunoassay by the manufacturer (Sigma Immunochemicals). Anti-enstatin is a rat monoclonal antibody produced using EHS-induced enstatine as an immunogen. These reagents were purchased from Upstate Biotechnology Incorporated (Lake Placid, NY) and tested for proper immune activity as well as absence of cross reactivity with other major basement membrane components by western blot analysis [ Ljubimov et al., Exp. Cell Res., 165: 530-540, 1986).

Immunofluorescence and Jones stained images were recorded and processed using an Olympus BH2 RFLA fluorescence microscope interfaced with an Applied Imaging Cytovision Ultra image analysis system (Applied Imaging Inc.). Images were captured using a high resolution black and white video camera. These images were changed using system software. In the processing of the images, care was taken to closely approximate the fluorescence directly observed on the microscope.

E. Immunoperoxidase Detection: Immunoperoxidase detection method was used for immunostaining TGF-β1 in glomeruli as well as fibronectin and collagen type I in tubulointerstitium. The collagen type I antibody is a rabbit anti-mouse, purchased from Biogenesis, Inc. (Sandown, NH). Antiserum was used as a 1: 100 dilution for immunoperoxidase staining. The used fibronectin antibody used was the same antibody for immunofluorescence staining (rabbit anti-human fibronectin antiserum from Sigma Chemical Company, St. Louis, MO) as a 1: 100 dilution. Secondary reagents were biotinylated anti-rabbit antibodies purchased from Vector laboratories (Burlingame, Calif.) And used as a 1: 100 dilution. Tissues were embedded in paraffin (using the same procedure described for in situ hybridization) and cut to 3 microns. The deparaffinized sections were pretreated with 5 μg of Proteinase K (Boehringer Mannheim, Indianapolis, IN) in 100 mM Tris-HCl (pH 7.4) to expose the epitope. Proteinase digestion was stopped by incubating for 30 seconds in 2 mg / ml glycine in PBS. The dewaxed proteinase K-treated tissue was washed three times with PBS, reacted with the primary antibody for one hour at room temperature, washed three times with PBS, and then incubated with the biotinylated secondary antibody at room temperature For 1 hour. After three washes with PBS (pH 7.4), the slides were incubated with streptavidin horse radish peroxidase (3 ug / ml, Vector Laboratories) at room temperature for 30 minutes. After washing three times with PBS, antibody binding was developed with an AEC substrate system (Vector AEC SK-4200, Vector Laboratories) according to the method described by the manufacturer.

In the case of TGF-? 1, the primary antibody was chicken α-human TGF-β1 used as a 1:15 dilution in 7% skim milk in PBS (used as diluent for all antibodies). This was reacted at room temperature for 3 hours or more. The secondary antibody was a biotinylated goat anti-chicken against TGF-β1 (Vector Laboratories Burlingame, Calif.), Applied as a 1: 100 dilution and allowed to react for at least 1 hour. After three washes, the Immunoperoxidase detection was performed using an AEC kit (Vector LAboratories, Burlingame, Calif.).

Example 1

Production of Alport / a1 integrin double mutants

A mouse model for autosomal form of Alport syndrome is shown in the targeted mutagenesis of the COL4A3 procollagen gene as described in the prior art [Cosgrove et al., Genes Dev., 10: 2981-2992, 1996] &Lt; / RTI &gt; This mouse model is referred to herein as an " Alport mouse ", available from Jackson Laboratories, Bar Harbor, Maine, under accession number 2908. These α3 (IV) knockout mice in the 129 Sv / J background state were hybridized (consecutive 129 Sv followed by consecutive five consecutive reverse hybridization with 129 Sv integrin α1 null mice), over 97.5% obese 129 Sv A &quot; double knockout &quot; mouse was created. alpha 1 knockout mice were provided by Humphrey Gardner of the Scripps Institute, LaJolla, Calif., and are described by Gardner et al., Dev. Biol., 175: 301-313, 1996.

Example 2

Test of Alport's kidney disease progression in mouse model

The mice studied in this example do not express collagen alpha 3 (IV) and are normal adult mice for alpha 1 integrin (obtained from Jackson Laboratories, Bar Harbor, Maine) and collagen alpha 3 (IV) or And a double knockout (i.e., a double mutant) that does not express integrin alpha 1. The double mutants were 97.5% 129 Sv and 2.5% Sv / J background.

Urine was collected from mice at weekly intervals and protein analysis was performed as described in the Methods section. As shown in FIG. 1, in the case of animals that do not express collagen alpha 3 (IV) and are normal for alpha 1 integrin, the average weekly (six studies on) the onset of Alport's kidney disease as measured by the onset of proteinuria, Was from 3.5 weeks to 4 weeks. Proteinuria progressed rapidly, reaching a peak level at 6 to 6.5 weeks of age. These genotypic animals (9 tested) did not survive beyond 9 weeks of age. The blood urea nitrogen level (BUN) increased from 7 to 7.5 weeks old. In a double mutant (four tested in these measurements), the onset of proteinuria was between 5 and 5.5 weeks old and progressed more slowly, reaching a peak level between 9 and 9.5 weeks. The average age of death due to renal failure was 15 to 16.5 weeks. BUN was elevated at 10 to 11 weeks of age in the affected animals.

Example 3

Characterization of a dual knockout mouse model

Three different animal sets (normal controls, animals that did not express the? 3 (IV) gene and normal to the? 1 integrin (Alport mouse), and double mutants) were analyzed at 4 to 7 weeks old using many different techniques Respectively.

Transmission electron microscopy analysis was performed to evaluate basement membrane integrity. At week 4 weeks (data not shown), the Alport adherent showed a diluted basement membrane in a 100% glomerular capillary loop. The dual mutants exhibited some glomerular basement membrane (GEM) dilatation (ie, irregular hypertrophy, thinning, and division), but this was rare and rarely extended. About 20% of the glomeruli in the double mutants did not show any apparent basement membrane dilatation. At this point, approximately 5% of glomeruli in Alport mice are fibrosis, but fibrosis glomeruli were not found in the double mutant. Figure 2 shows the extent of glomerular basement membrane damage properties of these different mice by week 7 weeks. A typical glomerular capillary loop is illustrated. The basement membrane of glomeruli in Alport mice at this time of occurrence is severely damaged in virtually all glomeruli. In FIG. 2B, the overall irregular hypertrophy and thinning, and the extensive disappearance of the podocyte foot process are evident. However, in the double knockout (Fig. 2C), GBM is super-microstructurally normal except for some small irregularities in most cases, and the foot process of the podocytes maintains the normal structure (arrows The area shown is compared to the double knockout mouse in Figure 2C). At this point, 30% to 50% of glomeruli in Alport mice were fibrosis, while in double mutant animals, less than 5% were fibrosis.

Scanning electron microscopy analysis (data not shown) of 7 weeks old mice showed that Alport mouse showed a significant expansion of the foot process of the podocyte, destroying the normally stable and complex structure of these cells. The disappearance of this foot process has been described for Alport glomerulonephritis. In double mutants, the structure was not perfect, but very similar to the structure observed in glomeruli from control mice. This enlargement of the foot process causes blocking of the glomerular filter and leads to uremic disorder. Thus, this finding is significant with respect to improved glomerular function in dual mutants as compared to Alport's copulation.

Whole-height paraffin embedded specimens from 7 week old mice were stained using the Jones's Method and the total number of fibrosed glomeruli was counted (data not shown). In effect, all glomeruli from Alport mice were affected to some extent. Most of them showed enlargement of glomerular taxa and mesangial matrix, and about one third of them were fibrosis. On the other hand, glomeruli from dual mutant mice were normal in terms of mesangial matrix and cell fidelity. Approximately 25% showed evidence of mesangial cell proliferation, and 5% had fibrosis. The assay was repeated on two different sets of mice to obtain very similar results.

Immunofluorescence analysis was performed using frozen cinnabia from the same animal. These tissues were reacted with antibodies specific for proteins known to accumulate in GBM due to the action of Alport renal disease progression. These include laminin-1 (used as a 1: 200 dilution), collagen α1 (IV) and α2 (IV) chains (COL4A1,2) (used as a 1:15 dilution), fibronectin (Used as a 1: 200 dilution), heparin sulfate proteoglycan (HSP) (used as a 1: 100 dilution), and enstatin (used as a 1: 200 dilution). All antibodies were diluted in 7% skim milk powder in PBS. The results are shown in Fig. At 7 weeks of age, all these components were significantly elevated in the GBM of Alport mice as compared to the control. In the fibrosis glomeruli, all these components were abundant. In the double mutants, immunostaining for the collagen alpha 1 (IV) and alpha 2 (IV) chains was comparable to immunostaining for allport mice in nonfibrillary glomeruli. This is predicted because the type IV collagen composition of GBM in double mutants is identical to the composition in Alport mice (ie, only the collagen α1 (IV) and α2 (IV) chains are included). The staining for laminin-1 and heparin sulfate proteoglycans was significantly reduced in the GBM of double mutants compared to ALPT mice (Fig. 3F and Fig. 3L vs. Fig. 3K, respectively) 3H) of the double mutant (Figure 3I) enriched in GBM was not clearly stained for fibronectin in GBM. Immunostaining for these proteins in the mesangial matrix was comparable between the double mutants and allport mice, but in the case of heparin sulfate proteoglycans, mesangial staining was normal (Figure 3J) ) (Fig. 3L).

Norton blot analysis was performed using RNA isolated from whole cortex from 7 week old normal, alltx and double mutant mice. 20 μg of each RNA sample was fractionated on an agarose gel, transferred to nylon by capillary blotting, and hybridized to a radio-labeled probe corresponding to some mouse TGF-β1 cDNA. After a series of high stringency washes, the films were exposed to X-ray film. Figure 9 shows that TGF- [beta] l was induced in Alport mice (the fourth lane from the left compared to the second lane from the control), while the alpha 1 integrin mutation (double knockout) Compared to the third lane from the left) is not induced in latent albomas. This is data that suggests whether the effect of the? 1 inhibitor can be modulated by inhibition of TGF-? 1. Therefore, the TGF-beta 1 inhibitor experiment described below was carried out to clarify this problem.

Example 4

The role of TGF-β1 in the progression of Alport's kidney disease after proteinuria

Tissues were obtained from F-2 reverse mating of 129 Sv / J founder animals in the C57B1 / 6 background (see above). Experiments were performed more than once (on a sample from two different animal sets). The results for the data described herein were clear and consistent.

These experiments were performed to illustrate two points. The first is whether there is a temporal correlation between the mRNA encoding matrix proteins accumulated by the action of Alport's kidney disease progression and the induction of TGF-? 1 mRNA, and the second is whether these mRNAs are substantially induced in the glomeruli Since only 5% of the wet weight of the kidney is a glomeruli, the induction of specific mRNA in the whole cortex is more related to the problems of progressive fibrosis and glomerulonephritis.

Total RNA was isolated from adult kidneys and control kidneys starting at week 6 and week 12 until week 12. Proteinuria in F2 mice used in this study started when the mice were about 5.5 to 6 weeks old (data not shown). The RNA is fractionated on a denatured agarose gel and transferred to a nylon support and labeled with a radiolabeled probe specific for the? 1 (IV) or? 2 (IV) collagen chain, enstatin, laminin? 1 or? 2 chain, fibronectin, or TGF-? Lt; / RTI &gt; The results in FIG. 4 illustrate that mRNA for all of the above proteins, except for laminin beta 1, is induced after the onset of proteinuria in the Alportmouse model.

The Norton blot for the same time lapse as above was also performed on laminin alpha 1, laminin beta 2, laminin gamma 1, heparin sulfate proteoglycan core protein, and collagen alpha 4 (IV), and alpha 5 (IV) . Significant differences in mRNA levels for these other basement membrane proteins were not apparent when the control was compared to the mutants.

The results of the Norton analysis were analyzed by using the Infrared spectrophotometer to directly quantify relative changes in specific mRNA expression over time. Figure 5 illustrates that induction of specific mRNA levels first appears at week 6, or near time, where proteins in the urinary space reach maximum levels in F2 mice [Cosgrove et al., Genes Dev., 10: 2981-2992, 1996]. By 8 weeks, mRNA levels peaked and mRNAs encoding TGF-β1 and fibronectin were induced 6.6-fold and 9.4-fold more, respectively, than control mice. MRNA levels for collagen alpha 1 (IV), alpha 2 (IV), and enstatin were all three fold induced up to 8 weeks. On the other hand, significant changes in mRNA encoding the laminin [beta] l and [beta] 2 chains, when measured by the same total RNA Norton blot, were not observed at any time during kidney disease progression.

In-situ hybridization was performed using mRNA-specific digoxigenin-labeled antisense probes to test whether mRNA encoding TGF-? 1, or different basement membrane components were induced in a particular glomerular cell type. After cardiac perfusion with 4% paraformaldehyde in PBS, kidneys were collected from 10-week-old F2 allmouth mice and normal control subjects and processed for in situ hybridization analysis as described in the method section. The antisense probes were specific for the NC1 domain of collagen alpha 1 (IV), TGF-beta 1, fibronectin, enstatin, or laminin beta 1 chain. A probe specific for bacterial [beta] -galactosidase was used as a control (negative control) for non-specific binding because such probes were not hybridized to whole mouse kidney RNA on Norton blots (data not shown) Because. Control probes were hybridized at the same time as each specific probe and treated with the same concentration of RNase A after the hybridization procedure. RNase A treatment was performed at 0.25 / / ml for α1 (IV), TGF-β1, and fibronectin, and at 3 μg / ml for enstatin and laminin β1. The results are shown in Fig.

The results of FIG. 6 illustrate that elevated levels in intestinal epithelial cells (podocytes) of glomeruli in COL4A3 knockout mice (Alport mice) are clearly observed in the case of all the specific mRNAs tested. In the case of the collagen? 1 (IV) chain, mRNA expression in the control is observed in both mesangial and endothelial cells of the glomeruli (Fig. 6A), consistent with where these molecules are localized in mature animals have. In the mutants, although expression in the mesangial matrix may be elevated, as evidenced by darker staining compared to mesangial cell staining in control samples, the most obvious difference between the control and mutants is that in the pancreatic cells Is a loop of stained cells lined up at the outer boundary of the corresponding glomeruli (Fig. 6B). Fibronectin expression in the control glomeruli was mainly observed in mesangial cells (Fig. 6D). Staining in mesangial cells is also observed in the mutants, but the pod cells apparently express a significant level of fibronectin mRNA (Fig. 6E). Expression of TGF- [beta] 1 is very weak in the glomeruli of control animals, but some specific staining is observed in the mesangial cells of control animals (Fig. 6G). In mutants, TGF-beta 1 mRNA levels were significantly elevated in mesangial, endothelial, and also progenitor cells (Fig. 6H). In the case of enstatin, mRNA is localized to the pancreatic cells of the control, which is not unpredictable because this protein is specifically localized to GBM. Incidentally, some mesangial cell-specific staining is observed in control animals. Although staining of visceral epithelial cells in the mutants may represent elevated expression, this is not a quantitative assay, and the difference between the control and the mutant is less clear (Fig. 6J vs. Fig. 6K).

The Norton blot showed that the level of mRNA for the laminin β1 chain was not changed in the control versus mutant over time. In situ hybridization analysis of this same message demonstrated mesangial cell-specific localization predicted by glomeruli from control elongation (Figure 6M). However, in the glomeruli from mutant mice, mRNA is apparently induced in intestinal epithelial cells (Fig. 6N).

Tissue samples were collected at week 3 and week 5 and analyzed by in situ hybridization using the same probe. The staining patterns in these glomeruli were indistinguishable from normal cotyledon patterns (data not shown). These results suggest that activation of these genes in podocytes occurs after onset of proteinuria.

TGF-β1 protein data based on detection of an immune oxidase using an antibody specific for the active isoform of cytokines demonstrate data obtained by in situ hybridization analysis of TGF-β1 mRNA (see FIG. 7B for immunohistochemistry 7A). These results demonstrate that elevated expression of TGF-β1 mRNA in podocytes is translated into elevated protein.

RNase protection analysis was performed to determine whether mRNA levels for cytokines were elevated in ALP versus human cortex from control patients. The human Alportocin was removed from the 15-year-old boy during transplant surgery. The sample was scarified to a moderate level and had about 50% of glomerulonephrosis. The specimen was immediately removed and snap frozen in liquid nitrogen. Normal human kidney RNA was purchased from Clonetech (Palo Alto, Calif.) And was a population sample from the normal human source collection. RNA from the Alport sample was isolated using the same method used for mouse elongation. RNA was fractionated to 10 상에서 on agarose gel and tested for integrity by staining the gel with ethidium bromide (10 ug / ml in water). Both normal and alport samples were intact based on the relative amounts of 28S and 18S ribosomal RNA bands. The RNase inhibition test was performed according to the above method. The data in FIG. 8 illustrate a 3- to 4-fold increase in TGF-? 1 mRNA in human alphal cortex compared to the control. These results demonstrate that cytokines are also overexpressed in human albatross kidneys. These data demonstrate the potential of the technology to be applied to the human body.

Example 5

Use of neutralizing antibodies to block alpha 1 beta 1 integrin

As an example to illustrate that a soluble agent capable of blocking the interaction of a ligand with an integrin integrin can produce an effect on the onset of Albert kidney disease as in the alpha 1 gene knockout mutant, Fabbri et al., Tissue Antigen , 48: 47-51, 1996]. These antibodies were injected (400 ng / injection, three times per week, intraperitoneally) into Alport mice starting at week 2. The animals were harvested at 6 weeks of age and the basement membrane was analyzed by transmission electron microscopy. As demonstrated in Figure 10, the basement membrane of these treated animals was usually regular and had a normal three-layer appearance. Endothelial cell swelling due to an immune response to the antibody was observed. These results demonstrate that soluble agents that block the integrin [alpha] 1 [beta] l receptor will retard ALTOBM disease progression in the same manner as observed in the double knockout mouse strain.

Example 6

Effect of TGF-β1 Inhibitor alone in the Alport (129 Sv / J) mouse model

The experimental protocol was as follows: intravenous injection via FK506 (2 ug / g body weight, intraperitoneal injection, Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan) or soluble TGF- ., Cambridge, Mass.) Were injected twice a week starting at week 3. Kidneys were collected at 7 weeks of age and analyzed.

Transmission electron microscopy analysis of the microstructure of the basement membrane under various conditions is shown in Fig. Figure 11A shows a glomerular capillary loop obtained from normal, untreated animals. Regular foot processes and 3-layer basement membrane staining should be noted. Figure 11B depicts a capillary loop from a 129Sv / J altomouse of typical week 7 weeks. It should be noted that GBM's expanded foot process and overall gross focal thickening. FIG. 11C is a diagram illustrating a typical capillary loop from a 7 week old Alport mouse treated with FK506. It is evident that there is no basolateral hypertrophy, suggesting that the drug reduces the matrix accumulation rate in GBM. However, there is a significant degree of puffing in the foot process with an apparent lack of foot process structure. The same results are observed in mice injected with TGF-? 1 soluble receptors (FIG. 11D). These data illustrate that TGF- [beta] 1 inhibitors can suppress irregular GBM hypertrophy, but can not inhibit changes in the foot process structure associated with advanced ALT GBM disease.

Some kidney specimens were observed with a scanning electron microscope. The glomeruli were exposed by freezing of the renal cortex and the Bowman's capsule was removed to expose the outer layer of pods covering the capillaries of the glomeruli. The normal glomeruli are shown in Fig. 12A, and the complex structure of the pod cells in Fig. 12A is clear evidence that the divider foot process surrounds the capillary loop. In a typical 7 week old Alport mouse, the surface of the glomeruli cell line is clearly lacking due to the disappearance of fine filamentous branches by expansion (Fig. 12B). In albumin animals treated with soluble receptors for TGF- [beta] 1 or FK506, the surface of the glomeruli is very similar to the surface in untreated Alport mice (Fig. 12C). These results clearly demonstrate that blockade of TGF-? 1 alone does not prevent changes in the foot process structure associated with advanced Alport glomerular disease.

Proteinuria was measured by polyacrylamide gel electrophoresis of lyophilized urine collected weekly during drug treatment. As mentioned above, the presence of albumin in urine and a large amount of albumin provide a comprehensive overview of the integrity of the glomerular filter. Figure 13 demonstrates that administration of a TGF- [beta] 1 inhibitor delayed the onset of proteinuria but progressed rapidly to high levels of urinary albumin (one week). These results suggest that TGF-β1 inhibitors may delay the onset of proteinuria when used alone but not improve glomerular filtration. This property appears to be directly related to the fact that these inhibitors do not prevent the foot process extinction of the pedigree cells described above and illustrated in Figures 11 and 12. [

It should be noted that the administration of the drug to normal subjects did not have a discernible difference when compared to a non-injected normal mouse.

Example 7

Effect of TGF-β1 Inhibitor on Double Knockout (DKO) Mice

(DKO mice lacking both collagen alpha 3 (IV) and integrin alpha 1 genes), starting at about 4 weeks per week and infusing the TGF- beta 1 inhibitor FK506 (2 [mu] g / body weight g, twice a week, intraperitoneally) TGF-? 1 soluble receptor (25 μg per week, twice a week, intravenous injection) was injected. Kidneys were collected and analyzed at about 10 weeks of age. A 10 week old age was chosen because the disease progresses to such an extent that a significant uneven obesity of GBM is typically observed in a double knockout and the animal begins to progress to terminal renal failure. Thus, if TGF-beta 1 inhibitors provide additional protection benefits, these benefits will be apparent at the end of the GBM disease progression. Transmission electron microscopy showed a very clear and consistent difference between the mice injected with the inhibitor and the untreated double knockout mice. A typical example of such a difference is illustrated in FIG. Figure 14B illustrates typical characteristics of a glomerular capillary loop in a 10 week old double knockout mouse. It is important to note that this is a significant pocket of basement membrane hyperplasia that promotes Alport's glomerulonephritis. The foot process of podocytes has a highly regular structure with slit diaphragm well developed even in advanced disease condition. This characteristic of a dual knockout mouse is characteristic of an Alport mouse (compare the foot process with the foot process shown in FIG. 12B).

When double knockout mice were treated with the TGF- [beta] l inhibitor, there was a significant reduction in small phase GBM hypertrophy and foot process extinction (Figure 14C is mouse treated with FK506 and Figure 14D shows mice treated with soluble TGF- to be). Most GBMs of the glomeruli do not have a perfectly normal superficial structure (see the apparent intermediate GBM irregularity in Figure 14D), but the apparent GBM thickening in most glomerular capillaries of untreated double knockout animals (Figure 14B) It is completely lacking in the remarkable pockets of fire. In about 25% of the glomeruli tested in this manner, the TGF- [beta] 1 inhibitor restored the glomerular hyperfine structure to such an extent that the DKO glomeruli could not be distinguished from the glomeruli of normal mice (Figure 15A) 15B shows the GBM of a 10 week old double knockout treated with FK506). Considering that these results are two weeks after the mean week of end-stage renal failure in an untreated ALP animal model, these results are actually unique and surprising findings.

Proteinuria was collected and tested weekly during treatment in these same mice. Samples (equivalent to about 1/2 of 1 ml) were analyzed by electrophoresis on polyacrylamide gels. Albumin was visualized by staining with Coomassie blue. The results shown in FIG. 16 demonstrate that both treatments with FK506 (FIG. 16D) or soluble receptors (FIG. 16B) for TGF-β1 significantly improve the performance of glomerular filter compared to untreated double knockout mice (FIG. 16A) . Figure 16C shows urinary protein for normal mice treated with FK506. Notable are the bands of the apparent diffusion group at all time points in both the DKO mouse treated with FK506 and the normal mouse (Fig. 16D). These results are always observed in drug-treated mice, which seems to be related to the nephrotoxic effect reported in some patients treated with drugs after transplantation (Solez et al., Transplantation, 66: 1736-1740, 1998) .

Example 8

Mechanisms for synergistic effects of alpha 1 integrin blockers and TGF-beta 1 inhibitors that delay the onset and progression of Alport's glomerulonephritis

In the data exemplified in Figures 11, 12 and 14, the α1 integrin blocker synergizes with the TGF-β1 blocker, while the α1 inhibition leads to an improved podocyte foot process structure, while the TGF- Lt; RTI ID = 0.0 &gt; matrix deposition. &Lt; / RTI &gt; Figure 17 is provided to further demonstrate the role of the alpha 1 integrin blocker in improving the pancreatic foot process structure. The renal cortex was prepared in the same manner as described in Fig. Figure 17A shows the surface of the glomeruli obtained from normal mice of 7 weeks old. Figure 17B shows the glomeruli from week 7 albmouth mice. It should be noted that loss of podocyte structure due to foot process disappearance. Figure 17C shows the surface of the glomeruli from a 7 week old double knockout mouse. It should be noted that almost complete recovery of the normal foot process structure is observed. These data are consistent with the cross-sectional view provided by the transmission electron microscope shown in Fig. 14B, in which the foot process exhibits a good shape in a double knockout mouse.

Example 9

α1 integrin blocking effect

In testing the possible mechanism for this phenomenon, the laminin chain was evaluated. Since the main laminin found in the glomerular basement membrane is known to be laminin 11 [Miner et al., J. Cell Biol., 137: 65-701, 1997] Which may be responsible for the loss of podocyte binding. Indeed, when testing the laminin composition of ALPTOBM, the laminin alpha2 chain, which is normally localized exclusively in the mexanic acid matrix in normal mice, was found in GBM of ALPTMO mice. Figure 18 shows a series of glomerular panels immunostained using dual fluorescent labeling protocols.

In dual fluorescence analysis, fresh cinnabolium was embedded in a Tissue Tek aqueous foam compound and snap frozen and cut to 4 microns in a cryogenic holding device. The slides were postfixed in cold (-20 &lt; 0 &gt; C) 100% acetone for 10 minutes and then air dried overnight. Tissues were rehydrated by washing three times in PBS for 10 minutes each. The primary antibody was diluted with 7% skim milk powder (BioRad). Anti-enstatin antibody (Chemicon Inc.) was used as a known marker for glomerular basement membrane with a 1: 200 dilution. Laminin α2 chain specific antibodies were obtained from Dr. Peter Yurchenco (Robert Wood Johnson Medical School, Piscataway, NJ). The specificity of this antibody for the laminin [alpha] 2 chain is described in Cheng et al., J. Biol. Chem., 272: 31525-31532, 1997). The antibody was used at a concentration of 1:10. The primary antibody was reacted overnight at 4 ° C in a humidified dish. The slides were washed 3 times in cold PBS for 10 minutes and then reacted with the secondary antibody added together. The secondary antibodies were Texas red-conjugated anti-rabbit for laminin alpha 2 and FITC-conjugated anti-rat for enstatin, both used as 1: 100 dilutions (Vector Laboratories, Burlingame, CA) . The secondary reagent was reacted at 4 ° C for 4 hours. Slides were washed 3 times for 10 minutes each in PBS and a drop of Vectashield anti-fade mounting media (Vector Laboratories, Burlingame, Calif.) Was applied before sealing under glass cover slip. Images for each antibody were digitally superimposed using a BH-2 epifluorescence microscope interfaced with a Cytovision Ultra image analysis system (Applied Imaging, Inc.).

The glomerular basement membrane-specific antigen (entatin) is green, but the laminin α2 chain is red. On the other hand, encrustin and laminin α2 co-localization is yellow. In group I of FIG. 18, Panel A shows immunostaining obtained from normal mice of 7 weeks old. Wherein laminin &lt; RTI ID = 0.0 &gt; a2 &lt; / RTI &gt; Panel B illustrates the staining of the 7 week old Alter copter. The capillary loops indicated by arrows are stained with a distinct yellow color, demonstrating that, in Alport mice, laminin [alpha] 2 is localized to both the mesangial matrix and the glomerular basement membrane. Panel C shows immunostaining in glomeruli from 129Sv / J alt mice treated with FK506 (the cortex was used in this experiment and was obtained from the animals shown in Figures 11, 12 and 13). Here again, most of the glomerular capillary loops are yellow, indicating that inhibition of TGF-? 1 activity does not prevent the accumulation of laminin? 2 in GBM of Alport mice. However, there was no laminin alpha 2 immunostaining in the glomerular capillary loop in the case of a double knockout mouse in the 7th week (panel D, arrow). The predominant integrin receptor on the cell surface is the integrin [alpha] 3 [beta] l [Patey et al., Cell Adhesion and Communication, 2: 159-167, 1994]. Such integrins are generally thought to play an important role in podocyte binding to GBM and maintenance of the normal foot process structure (Smoyer and Mundel, J. Mol. Med., 76: 172-183, 1998]. For example, knocking out the integrin alpha 3 gene has recently been shown to result in complete erasure of the podocyte foot process structure [Kreidberg et al., Development, 122: 3537-3547, 1996]. More recently, soluble α3β1 integrin receptors have been generated which bind to laminin α5 chain-containing laminin (similar to laminin-11, a heterotrimeric chain comprising α5, β2, and γ1 chains) with high affinity, but α2 chain containing laminin (Eble et al., Biochemistry, 37: 10945-10955, 1998). Given this information, the data provided herein supports a model that results in foot process extinction as a consequence of the progressive deposition of laminin alpha 2-containing laminin in GBM results in reduced adhesion through the integrin [alpha] 3 [beta] 1 receptor in Alport mice . Blockage of the integrin alpha 1 chain reduces or eliminates the deposition of the laminin alpha 2 chain in GBM, thereby suppressing the loss of normal foot process structure.

To further demonstrate this point, we evaluated the distribution of laminin a2 chains in Sv / J altxt mice at 2 weeks old compared to normal subjects. At this very early stage of GBM disease progression, there was a notable " pocket " of GBM hyperplasia that was rarely distributed on about half of the glomeruli. One such pocket of GBM depletion is shown in Figure 19B. The GBM and podocyte foot processes are morphologically normal in the uninfected areas of the glomeruli at this developmental stage, but in the area of small-phase hypertrophy, as in the more generalized changes later in the development of GBM disease, It expands and disappears. It is summarized that when laminin [alpha] 2 deposition results in loss of small phase adhesion in contact with podocytes, a pellet deposit of laminin [alpha] 2 is observed in week 2 Alportmouse. This is actually the case as exemplified in the 18 Ⅱ group. The arrow on panel B represents the pellet deposition of laminin alpha 2 in the GBM of Alport mouse in week 2. This is the earliest molecular change detected in the Alport mouse model (in addition to the change in type IV collagen composition resulting from the congenital genetic mutation) and corresponds exactly to the detection of detectable GBM damage.

Example 10

Synergistic effect of TGF-β1 inhibitor with α1 integrin blocker

As shown in Fig. 3, the matrix accumulating in GBM and epilepsy due to the onset of Alport's kidney disease involve collagen alpha 1 (IV) and alpha 2 (IV) chains, fibronectin, and entmotin. As shown in Figure 20 (the first two lanes of each gel), the mRNA encoding each of these proteins is induced in Alport's kidney relative to the normal control. Injection of the TGF- [beta] l inhibitor substantially reduces the degree of induction (gel of the last two lanes of FIG. 20). This may cause a decrease in basement membrane hyperplasia observed in Sv / J altox mice treated with TGF-? 1 inhibitors (shown in FIG. 11).

A similar set of Norton blots was performed by using RNA obtained from kidneys not treated with TGF-? 1 inhibitors or treated from double knockout mice. The drug injection protocol is described in Example 7, since the mouse used here is the same mouse used to derive the data shown in Fig. It is evident from the data shown in Fig. 21 that administration of the TGF- [beta] 1 inhibitor does not significantly change the level of mRNA encoding the matrix protein as compared to untreated control mice versus double knockout mice. However, there is a noticeable effect on the expression of mRNA encoding the metalloproteinase inhibitor Timp-3 to be added to the probe (Figure 21, last line). As evidenced in lane 1 and lane 2, there is a significant reduction in the expression of Timp-3 in the kidney of a 10 week old untreated dual knockout mouse relative to the control mice (9-fold difference from baseline analysis). This reduction in the expression of Timp-3 is not observed in double knockout mice injected with FK506 (lane 3 and lane 4) or TGF-? 1 soluble receptors (lane 5 and lane 6). This same effect on the expression of Timp-3 was observed in Sv / J mice (Fig. 20, last row), indicating that the ability to inhibit the inhibition of Timp- Lt; RTI ID = 0.0 &gt; TGF-ss1 &lt; / RTI &gt;

The functional significance of these observations is based on the fact that Timp-3 is a modulator of matrix metalloproteinases and has been suggested to be an important factor in renal basement membrane homeostasis and loss of homeostasis in disease [Esposito et al. Kidney Int., 50: 506-514, 1996; and Elliot et al., J. Am. Soc. Nephrol., 10: 62-68, 1999). A decrease in the expression of the Timp-3 metalloproteinase inhibitor will result in a corresponding increase in metalloproteinase activity. This increase may cause basal membrane damage, which may activate TGF-β1 with ancillary accumulation of the matrix. Destroying this cycle can restore the basement membrane homeostasis caused by the recovery of the observed GBM form (Figs. 11, 14 and 15).

Example 11

Inhibition of interstitial fibrosis in double knockout mice treated with TGF-beta1 inhibitor

The upregulation of matrix proteins and the role of TGF-? 1 in renal fibrosis have been well documented [Yand et al., J. Am. Soc. Nephrol., 5: 1610-1617,1994; Border and Ruoslahti, J. Clin. Invest., 90: 1-7, 1992). In double-knockout mice, kidney interstitial fibrosis is delayed, but widespread in about 10 weeks of age and progresses to end-stage renal failure in about 15 weeks of age. Animals injected with the TGF-? 1 inhibitor were analyzed using 3 markers for interstitial fibrosis and directly compared to 10 week old double knockout animals not treated with inhibitor. Animals were injected using the same protocol as that used to generate Figure 14 in Example 7. In the case of Figures 22, 23 and 24, Panel A is the control, Panel B is the untreated double knockout, Panel C is the double knockout treated with FK506, Panel D is the double treated with TGF- It is a knockout. All these figures are low magnification 50x magnification of the neocortex. 22 is Jones silver methenamine staining, a standard histochemical stain of the matrix. This demonstrates that the matrix accumulates in the epilepsy of the cortex in untreated mice (panel B compared to panel A). However, the renal cortex from animals treated with the TGF-? 1 inhibitor was indistinguishable from the control and showed little or no fibrosis. Molecular markers commonly used for kidney fibrosis include collagen type I and fibronectin [Yamamoto et al., Kidney Int., 45: 916-927, 1994]. Fig. 23 illustrates immunostaining for collagen type I. Fig. Apparently, collagen type I accumulates in the neocortical epilepsy of untreated animals (compare panel B to control in panel A). Panels B and C in Figure 23 illustrate the relative absence of collagen type I accumulation in kidneys of dual knockout mice treated with FK506 or soluble receptors, respectively. The same scenario is valid for the cortex-enriched fibronectin of the cortex of untreated double knockout (Fig. 24B) and mice injected with TGF-? 1 inhibitor similar to control (Fig. 24 panels C and D). Collectively, these data indicate that TGF-beta 1 inhibitors in combination with integrin alpha 1 blockers are effective in preventing (or delaying) epileptic fibrosis in the Alportmouse model.

All references, patents, patent applications, and publications referenced herein are incorporated herein by reference. While the present invention has been described in connection with the specific embodiments and examples for those skilled in the art, it is not intended that the invention be limited, and that various implementations, embodiments, uses, variations and modifications other than the described implementations, It will be appreciated that the invention may be practiced without departing from the scope of the invention.

Claims (33)

Comprising administering to the patient an effective amount of an alpha 1 integrin receptor inhibitor. 2. The method of claim 1, further comprising administering to the patient an effective amount of a TGF-? 1 inhibitor. 3. The method of claim 2, wherein the alpha 1 beta 1 integrin receptor inhibitor and the TGF- beta 1 inhibitor are administered simultaneously. The method according to claim 2, wherein the TGF-? 1 inhibitor inhibits the ability of TGF-? 1 to bind to the TGF-? 1 receptor by irreversibly binding to TGF-? 1. 3. The method according to claim 2, wherein the TGF-? 1 inhibitor is a drug that inhibits the ability of TGF-? 1 to convert the signal into the nucleus of the kidney cells. 6. The method of claim 5, wherein the TGF- [beta] l inhibitor is a calcineurin inhibitor. 7. The method of claim 6, wherein the calcineurin inhibitor is tacrolimus. The method according to claim 1, wherein the? 1? 1 integrin receptor inhibitor is a blocking agent binding to the? 1? 1 integrin receptor binding site on the surface of the kidney cells. 9. The method of claim 8, wherein the alpha 1 beta 1 integrin receptor blocker comprises a peptide. 10. The method according to claim 9, wherein the peptide is a fragment of nine or more fragments of a protein selected from the group consisting of laminin, fibronectin, entatin, and collagen type 4. 9. The method of claim 8, wherein the peptide is an antibody. 2. The method of claim 1, wherein the renal disease is renal glomerulonephritis, renal fibrosis, or both. 13. The method of claim 12, wherein the renal glomerulonephritis or renal fibrosis is associated with Alport syndrome, IDDM nephritis, mesangial proliferative glomerulonephritis, proliferative glomerulonephritis, meniscal glomerulonephritis, diabetic retinopathy, and renal interstitial fibrosis Lt; / RTI &gt; A method of delaying the onset of Alport syndrome in a patient and / or delaying the progression of Alport syndrome, comprising administering to the patient an effective amount of a drug that inhibits signal transduction through the alpha 1 integrin receptor of the kidney cells. A method of delaying the onset of Alport syndrome in a patient and / or delaying the progression of Alport syndrome, comprising blocking the alpha 1 beta 1 integrin receptor binding site on the kidney cell surface of the patient. 16. The method of claim 15, wherein blocking the alpha 1 beta 1 integrin receptor binding site comprises contacting the kidney cells with an effective amount of alpha 1 beta 1 integrin receptor binding site peptide. 17. The method according to claim 16, wherein the peptide is a fragment of at least nine fragments of a protein selected from the group consisting of laminin, fibronectin, entatin, and collagen type 4. 16. The method of claim 15, further comprising administering to the patient an effective amount of a TGF-? 1 inhibitor. 19. The method of claim 18, wherein the TGF- [beta] l inhibitor inhibits the ability of TGF- [beta] l to bind irreversibly to TGF- [beta] l and bind to the TGF- [beta] l receptor. 19. The method of claim 18, wherein the TGF- [beta] l inhibitor is a drug that inhibits the ability of TGF- [beta] l to convert the signal into the nucleus of kidney cells. 21. The method of claim 20, wherein the TGF- [beta] l inhibitor is a calcineurin inhibitor. 22. The method of claim 21, wherein the calcineurin inhibitor is tacrolimus. A method of delaying the onset of a renal disease and / or delaying the progression of a renal disease in a patient's insulin dependent diabetes mellitus, comprising administering to the patient an effective amount of an agent that inhibits signal transduction through the alpha 1 beta 1 integrin receptor of the kidney cells. A method of delaying the onset of, and / or delaying the progression of, renal disease in a patient &apos; s insulin dependent diabetes mellitus, comprising blocking the alpha 1 beta 1 integrin receptor binding site on the kidney cell surface of the patient. 1. A method of limiting renal fibrosis in a patient, comprising the step of inhibiting the &lt; RTI ID = 0.0 &gt; ai1 &lt; / RTI &gt; integrin receptor of a patient &apos; 26. The method of claim 25, wherein the step of reducing TGF-? 1 activity comprises administering to the patient an agent that inhibits the ability of TGF-? 1 to bind to the TGF-? 1 receptor by irreversibly binding to TGF-? 1 Lt; / RTI &gt; 27. The method of claim 26, wherein the step of reducing TGF-? 1 activity comprises administering to the patient an agent capable of inhibiting the ability of TGF-? 1 to convert the signal to the nucleus of the kidney cells. A method of inhibiting renal fibrosis in a patient comprising administering to the patient a calcineurin inhibitor. 29. The method of claim 28, wherein the calcineurin inhibitor is tacrolimus. A mouse model for kidney disease that does not express the normal collagen type 4 composition in the glomerular basement membrane of the mouse but does not express the? 1? 1 integrin receptor. 31. The mouse model according to claim 30, wherein the mouse does not incorporate collagen alpha 3 (IV), alpha 4 (IV), and alpha 5 (IV) chains into the glomerular basement membrane. A method for screening a drug used for restricting renal disease, comprising administering an agent to a mouse model for kidney disease that does not express the normal collagen type 4 composition in the glomerular basement membrane of the mouse but does not express the alpha 1 beta 1 integrin receptor. A method of inhibiting matrix accumulation in a GBM of a patient with Alport syndrome, comprising reducing the TGF-? 1 activity of the patient.