KR20010052390A - USE OF α1β1 INTEGRIN RECEPTOR INHIBITORS AND TGF-β1 INHIBITORS IN THE TREATMENT OF KIDNEY DISEASE - Google Patents
USE OF α1β1 INTEGRIN RECEPTOR INHIBITORS AND TGF-β1 INHIBITORS IN THE TREATMENT OF KIDNEY DISEASE Download PDFInfo
- Publication number
- KR20010052390A KR20010052390A KR1020007013144A KR20007013144A KR20010052390A KR 20010052390 A KR20010052390 A KR 20010052390A KR 1020007013144 A KR1020007013144 A KR 1020007013144A KR 20007013144 A KR20007013144 A KR 20007013144A KR 20010052390 A KR20010052390 A KR 20010052390A
- Authority
- KR
- South Korea
- Prior art keywords
- tgf
- beta
- alpha
- inhibitor
- patient
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2839—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
- C07K16/2842—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily against integrin beta1-subunit-containing molecules, e.g. CD29, CD49
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/39—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K3/00—Materials not provided for elsewhere
- C09K3/18—Materials not provided for elsewhere for application to surfaces to minimize adherence of ice, mist or water thereto; Thawing or antifreeze materials for application to surfaces
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S977/00—Nanotechnology
- Y10S977/902—Specified use of nanostructure
- Y10S977/904—Specified use of nanostructure for medical, immunological, body treatment, or diagnosis
- Y10S977/906—Drug delivery
- Y10S977/907—Liposome
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Combustion & Propulsion (AREA)
- Materials Engineering (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 신장 질환(예컨대, 신장 사구체신염 및/또는 신장 섬유증)을 치료(즉, 질환의 발병의 지연, 진행의 지연 및/또는 역전)하는 방법을 제공한다. 특정한 이들 방법은 TGF-β1 저해제와 임의적으로 병용하여 α1β1 인테그린 수용체 저해제를 투여하는 것을 포함한다. 또한, 본 발명은 마우스가 정상적인 콜라겐 타입 4 조성을 발현시키지 않고(즉, 콜라겐 α3(Ⅳ), α4(Ⅳ), 및 α5(Ⅳ) 사슬을 사구체 기저막에 혼입시키지 않는다) α1β1 인테그린 수용체를 발현시키지 않는 것을 특징으로 하는 신장 질환용 마우스 모델을 제공한다.The present invention provides a method of treating (i. E., Delaying the onset, delaying the progression and / or reversing the progression of the disease) of the kidney disease (e.g., renal glomerulonephritis and / or renal fibrosis). Certain of these methods include administering an alpha 1 integrin receptor inhibitor optionally in conjunction with a TGF-? 1 inhibitor. In addition, the present invention provides a method of inhibiting the expression of a < RTI ID = 0.0 > (I), < / RTI > A mouse model for kidney disease.
Description
SEQUENCE LISTINGSEQUENCE LISTING
〈110〉 BOYS TOWN NATIONAL RESEARCH HOSPITAL<110> BOYS TOWN NATIONAL RESEARCH HOSPITAL
〈120〉 USE OF a1B1 INTEGRIN RECEPTOR INHIBITORS AND TGF-B1<120> USE OF a1B1 INTEGRIN RECEPTOR INHIBITORS AND TGF-B1
INHIBITORS IN THE TREATMENT OF KIDNEY DISEASEINHIBITORS IN THE TREATMENT OF KIDNEY DISEASE
〈130〉 249.00010230<130> 249.00010230
〈140〉 PCT/US99/11073<140> PCT / US99 / 11073
〈141〉 1999-05-19<141> 1999-05-19
〈150〉 60/086,587<150> 60 / 086,587
〈151〉 1998-05-22<151> 1998-05-22
〈150〉 09/088,766<150> 09 / 088,766
〈151〉 1998-06-02<151> 1998-06-02
〈150〉 09/150,485<150> 09 / 150,485
〈151〉 1998-09-09<151> 1998-09-09
〈160〉 26<160> 26
〈170〉 PatentIn Ver. 2.0<170> PatentIn Ver. 2.0
〈210〉 1<210> 1
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 1<400> 1
tctgtggacc atggcttc 18tctgtggacc atggcttc 18
〈210〉 2<210> 2
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 2<400> 2
ttctcatgca cacttggc 18ttctcatgca cacttggc 18
〈210〉 3<210> 3
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 3<400> 3
ggctacctcc tggtgaag 18ggctacctcc tggtgaag 18
〈210〉 4<210> 4
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 4<400> 4
ttcatgcaca cttggcag 18ttcatgcaca cttggcag 18
〈210〉 5<210> 5
〈211〉 15<211> 15
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 5<400> 5
cgggccacat tctcc 15cgggccacat tctcc 15
〈210〉 6<210> 6
〈211〉 17<211> 17
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 6<400> 6
ggagtggccg ttgcatt 17ggagtggccg ttgcatt 17
〈210〉 7<210> 7
〈211〉 17<211> 17
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 7<400> 7
accagtacca aggcgga 17accagtacca aggcgga 17
〈210〉 8<210> 8
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 8<400> 8
tcattgagct tgttcagg 18tcattgagct tgttcagg 18
〈210〉 9<210> 9
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 9<400> 9
tagaggttat tttgcagcag a 21tagaggttat tttgcagcag a 21
〈210〉 10<210> 10
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 10<400> 10
ttggatatcc tcatcagctt g 21ttggatatcc tcatcagctt g 21
〈210〉 11<210> 11
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 11<400> 11
gtggtttact ggacagacat c 21gtggtttact ggacagacat c 21
〈210〉 12<210> 12
〈211〉 19<211> 19
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 12<400> 12
ccaatctgtc caataaagg 19ccaatctgtc caataaagg 19
〈210〉 13<210> 13
〈211〉 26<211> 26
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 13<400> 13
acacactcca agcccacaaa agcaag 26acacactcca agcccacaaa agcaag 26
〈210〉 14<210> 14
〈211〉 24<211> 24
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 14<400> 14
gagggaagac tccttgtagg tcaa 24gagggaagac tccttgtagg tcaa 24
〈210〉 15<210> 15
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 15<400> 15
gcagagcggg cacggagc 18gcagagcggg cacggagc 18
〈210〉 16<210> 16
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 16<400> 16
tgtacctgcc atcctctcct g 21tgtacctgcc atcctctcct g 21
〈210〉 17<210> 17
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 17<400> 17
cccctatcta cacctacacc a 21cccctatcta cacctacacc a 21
〈210〉 18<210> 18
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 18<400> 18
tgtcactgtc cgccaaataa a 21tgtcactgtc cgccaaataa a 21
〈210〉 19<210> 19
〈211〉 22<211> 22
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 19<400> 19
cagaagaaga gcctgaacca ca 22cagaagaaga gcctgaacca ca 22
〈210〉 20<210> 20
〈211〉 18<211> 18
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 20<400> 20
gtaccacgcg caagaacc 18gtaccacgcg caagaacc 18
〈210〉 21<210> 21
〈211〉 25<211> 25
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 21<400> 21
ggtctacact attaagcaga tgaag 25ggtctacact attaagcaga tgaag 25
〈210〉 22<210> 22
〈211〉 21<211> 21
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 22<400> 22
aaaattggag agcatgtcgg t 21aaaattggag agcatgtcgg t 21
〈210〉 23<210> 23
〈211〉 19<211> 19
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 23<400> 23
gcagaagttg gcatggtag 19gcagaagttg gcatggtag 19
〈210〉 24<210> 24
〈211〉 20<211> 20
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 24<400> 24
ggacatcaac gggttcacta 20ggacatcaac gggttcacta 20
〈210〉 25<210> 25
〈211〉 19<211> 19
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 25<400> 25
gcagaagttg gcatggtag 19gcagaagttg gcatggtag 19
〈210〉 26<210> 26
〈211〉 20<211> 20
〈212〉 DNA<212> DNA
〈213〉 Artificial Sequence<213> Artificial Sequence
〈220〉<220>
〈223〉 Description of Artificial Sequence: primer<223> Description of Artificial Sequence: primer
〈400〉 26<400> 26
ggacatcaac gggttcacta 20ggacatcaac gggttcacta 20
발명의 배경BACKGROUND OF THE INVENTION
미국에서는, 현재 약 12,000명의 사람들이 앨포트(Alport) 증후군을 가지고 살고 있다. 이러한 유전 질환은 단지 투석과 신장 이식에 의해서만 치료될 수 있는 진행성 신장 질환을 초래한다. 이식된 신장은 일반적으로 거부반응을 나타낸다. 따라서, 대안적인 치료법이 필요하다. 그러나, 상기 질환의 발병 또는 진행에 관한 메카니즘을 처리하는 치료법은 현재로서 존재하지 않는다. 따라서, 필요한 것은 질병의 발병 및/또는 진행의 메카니즘을 공격하는 치료법으로, 신장 사구체신염 및 신장 섬유증과 같은 질환 상태를 실질적으로 늦출 수 있는 치료법이다.In the United States, about 12,000 people now live with Alport syndrome. These genetic disorders result in progressive kidney disease that can only be treated by dialysis and kidney transplantation. Transplanted kidneys generally show rejection. Therefore, alternative therapies are needed. However, therapies that address the mechanism of onset or progression of the disease do not exist at present. What is needed, therefore, is a therapy that attacks the mechanism of the onset and / or progression of the disease, and is a therapy that can substantially slow the disease state, such as renal glomerulonephritis and renal fibrosis.
많은 신장 질환이 매트릭스 항상성의 변화과 관련이 있으며, 상기 변화에서 구조 분자의 합성 및 교체의 정밀한 균형이 방해된다. 일례로서, 앨포트 증후군은 진행성 신장 장해를 초래하는 질환이고, 감각신경성 청각 상실과 관련이 있다. 남성 보인자는 대부분 병에 걸리며 초미세구조 연구 결과 이환된 개개인의 사구체 기저막(GBM)에 이상이 있는 것으로 밝혀졌다. 20,000명중 약 1명이 앨포트 증후군을 가지며, 이 사실은 상기 질환을 보다 만연하는 공지된 유전 질환중의 하나로 만든다[참조: 예컨대, Atkin et al., "Alport Syndrome" In R.W. Schrier & C.W. Gottschalk(Eds.), Disease of the Kidney, 4th ed., Chap. 19, Little Brown, Boston, pp. 617-641, 1988]. X-연관된 앨포트 증후군은 콜라겐 4A5 유전자에서 임의의 일련의 돌연변이에 기인한다[참조: Barker et al., Science, 348:1224-1227, 1990]. 상기 유전자에서 60개 이상의 상이한 돌연변이가 확인되었다. 앨포트 증후군의 상염색체형은 X-연관형과 동일한 범위의 표현형으로 나타나며 기저막 콜라겐 유전자 4A3(COL4A3) 또는 4A4(COL4A4)에서의 돌연변이에 기인한다[참조: 예컨대, Lemmink et al., Hum. Mol. Gen., 3:1269-1273, 1994, and Mochizuki et al., Nature Genet., 8:77-81, 1994]. 기타 기저막의 질환은 콜라겐 4A3의 NC1 도메인상의 에피토프에 대한 급성 자가면역 반응에 기인하는 굿파스튜어(Goodpasture) 증후군[참조: Hudson et al., Kidney Int., 43: 135-139, 1993], 및 콜라겐 4A5 및 4A6 모두의 결실과 관련된 양성 평활근 종양인 범발성 평활근종상태[참조: Zhou et al., Science, 261:1167-1169, 1993]를 포함한다.Many renal diseases are associated with a change in matrix homeostasis, which precludes a precise balance of synthesis and replacement of structural molecules. As an example, Alport syndrome is a disease that causes progressive renal failure and is associated with sensory neuron loss. Most of the male carriers are sick and found to have abnormalities in the glomerular basement membrane (GBM) of individuals with hypermicroscopic findings. About one out of 20,000 people have Alport syndrome, which makes this disease one of the more prevalent known genetic disorders (see, e.g., Atkin et al., "Alport Syndrome" In R. W. et al. Schrier & Gottschalk (Eds.), Disease of the Kidney, 4th ed., Chap. 19, Little Brown, Boston, pp. 617-641, 1988). X-linked Alport syndrome is due to a series of mutations in the collagen 4A5 gene (Barker et al., Science, 348: 1224-1227, 1990). Over 60 different mutations in the gene were identified. The autosomal form of Alport syndrome appears in the same range of phenotypes as the X-linked and is due to mutations in the basement membrane collagen gene 4A3 (COL4A3) or 4A4 (COL4A4) (see, for example, Lemmink et al., Hum. Mol. Gen., 3: 1269-1273, 1994, and Mochizuki et al., Nature Genet., 8: 77-81,1994). Other basement membrane disorders include Goodpasture syndrome (Hudson et al., Kidney Int., 43: 135-139, 1993), which is caused by an acute autoimmune response to an epitope on the NC1 domain of collagen 4A3, and collagen (See Zhou et al., Science, 261: 1167-1169, 1993), which is a benign smooth muscle tumor associated with deletion of both 4A5 and 4A6.
기저막은 신체의 거의 모든 기관 및 조직과 관련된 분화된 세포외 구조이다. 기저막은 일반적으로 세포 및 결합 조직 사이의 경계에서 발견되지만, 신장 사구체(즉, 모세혈관의 다발)의 경우에서와 같이, 상피 세포와 내피 세포 사이에서도 발견될 수 있다. 기저막의 주된 구조 재료는 타입 Ⅳ 콜라겐, 라미닌, 헤파린 술페이트 프로테오글리칸, 엔탁틴, 및 종종 피브로넥틴 및 타입 Ⅴ 콜라겐을 포함한다. 모든 기저막에서 최고로 나타나는 성분은 기저막에서만 발견되는 독특한 콜라겐형인 타입 Ⅳ 콜라겐이다. 천연 형태에서, 타입 Ⅳ는 모든 콜라겐과 같이, 6개 알파 사슬(4A1 내지 4A6)의 독특한 조합으로 구성된 3중 헬릭스에 어셈블링된 3개의 콜라겐 분자로 구성된다. 4A1 및 4A2 사슬(α1(Ⅳ) 및 α2(Ⅳ) 사슬로도 지칭)이 가장 일반적이다[참조: Timpl, J. Biochem., 180:487-502, 1989]. 타입 Ⅳ 콜라겐은 간질성 콜라겐과는 많은 방식에서 차이가 있다. 알파 사슬 회합의 헬릭스 구조는 기타 콜라겐에서 관찰되는 글리신-X-Y 모티프와 완전하게 유착되어 있지 않으며; 4-히드록시프롤린 보다는 3-히드록시프롤린을 함유하고, 탄수화물이 풍부하다. 결과적인 콜라겐의 상부구조는 기저막 콜라겐의 닭장 철망형 망상구조이다. 이러한 망상구조는 그 위에 부속 분자(라미닌, 헤파린 술페이트 등)가 결합하는 기본구조이다.The basement membrane is a differentiated extracellular structure associated with almost all organs and tissues of the body. Basement membranes are generally found at the boundary between cells and connective tissue, but can also be found between epithelial and endothelial cells, as in the case of renal glomeruli (ie, capillary bundles). The major structural materials of the basement membrane include type IV collagen, laminin, heparin sulfate proteoglycans, entmotin, and often fibronectin and type V collagen. The most prominent component in all basement membranes is type Ⅳ collagen, a unique type of collagen found only in the basement membrane. In its native form, Type IV, like all collagens, is composed of three collagen molecules assembled into a triple helix composed of a unique combination of six alpha chains (4A1 to 4A6). The 4A1 and 4A2 chains (also referred to as the? 1 (IV) and? 2 (IV) chains) are the most common (Timpl, J. Biochem., 180: 487-502, 1989). Type IV collagen differs from interstitial collagen in many ways. The helix structure of the alpha chain association is not completely conjugated with the glycine-X-Y motif observed in other collagen; It contains 3-hydroxyproline rather than 4-hydroxyproline and is rich in carbohydrates. The resulting superstructure of collagen is a chicken - elbow network of basement membrane collagen. This network structure is a basic structure in which adjunct molecules (laminin, heparin sulfate, etc.) are bonded thereon.
기저막은 매우 이종의 구조이며, 이는 그의 다양한 기능적 성질의 원인이 된다. 이들 구조의 복잡성에 관한 이해는 아직 불충분하다. 몇가지 새로운 기저막 콜라겐 사슬(알파 3, 4, 5, 및 6 사슬)이 최근 발견되었을 뿐이다[참조: 예컨대, Gunwar et al., J. Biol. Chem., 266:15318-15324, 1990; Hostikka et al., Proc. Natl. Acad. Sci. USA, 87:1606-1610, 1990; Butkowski et al., J. Biol. Chem., 262:7874-7877, 1987; and Zhou et al., Science 261:1167-1169, 1993]. 흥미롭게도, 상기 새로운 사슬은 특정한 조직(예컨대, 신장의 사구체, 눈의 데시멧트 막(Decimet's membrane), 렌즈, 피부, 폐, 고환, 와우각)에서만 발견되었다[참조: 예컨대, Kleppel et al., Am. J. Pathol., 134:813-825, 1989, and Tryggvason et al., Kidney Int., 43:38-44, 1993]. 기저막 어셈블리 및 기능에서 이러한 새로운 사슬의 역할은 현재로서 알려져 있지 않다. 이러한 새로운 기저막 콜라겐은 콜라겐 타입 4A1(α1(Ⅳ)) 및 4A2(α2(Ⅳ))의 망상구조와는 구별되는 별개의 망상구조를 형성하는 것으로 생각된다.The basement membrane is a very heterogeneous structure, which causes its diverse functional properties. Understanding the complexity of these structures is still insufficient. Several new basement membrane collagen chains (alpha 3, 4, 5, and 6 chains) have only recently been discovered (see, for example, Gunwar et al., J. Biol. Chem., 266: 15318-15324, 1990; Hostikka et al., Proc. Natl. Acad. Sci. USA, 87: 1606-1610, 1990; Butkowski et al., J. Biol. Chem., 262: 7874-7877, 1987; and Zhou et al., Science 261: 1167-1169, 1993). Interestingly, the new chain has been found only in certain tissues (e.g., kidney glomeruli, eyes Decimet's membrane, lens, skin, lungs, testicles, cornice) (see, for example, Kleppel et al., Am . J. Pathol., 134: 813-825, 1989, and Tryggvason et al., Kidney Int., 43: 38-44, 1993). The role of this new chain in basement membrane assembly and function is currently unknown. This new basement membrane collagen is thought to form a distinct reticular structure distinct from collagen type 4A1 (α1 (IV)) and 4A2 (α2 (IV)) network.
신장 사구체 기저막(GBMs)은 한외여과 과정에 필수적인 것이다(즉, 상기 과정에서 혈액이 여과되어, 예컨대 뇨의 형태로 배설되는 대사물질을 제거한다). 앨포트 증후군은 세포외 매트릭스의 대량 축적 및 손상된 기저막을 초래하는 결과, 소상 및 분절성 사구체신염(즉, 신장 사구체의 모세혈관 루프의 염증)을 일으켜, 결국 치명적인 요독증(즉, 신장 장해의 결과 혈액중 과량의 우레아가 존재)이 초래된다. 또한, 다수의 동일한 세포외 매트릭스 분자(예컨대, 콜라겐 타입 Ⅰ, 피브로넥틴, 라미닌, 및 콜라겐 타입 Ⅳ)는 IDDM(인슐린 의존성 당뇨병) 신염을 가진 환자의 GBM에 진행성으로 축적된다. 그러나, 이러한 질환에서 GBM은 비후화되지만, 앨포트 증후군의 특징인 GBM의 소상 박화 및 분열(분할)은 없다.The kidney glomerular basement membranes (GBMs) are essential for the ultrafiltration process (ie, the blood is filtered during this process to remove, for example, the metabolites excreted in the form of urine). Alport syndrome causes bulky accumulation of extracellular matrix and resulting in damaged basement membrane, resulting in scarring and segmental glomerulonephritis (i. E. Inflammation of the capillary loop of the renal glomeruli) and ultimately leading to fatal uraemia (i.e., Excess urea is present). In addition, a number of identical extracellular matrix molecules (e.g., collagen type I, fibronectin, laminin, and collagen type IV) accumulate progressively in GBM of patients with IDDM (insulin dependent diabetes) nephritis. However, GBM is exaggerated in these diseases, but there is no phagocytosis and division (division) of GBM which is characteristic of Alport syndrome.
인테그린은 기저 라미나 및 세포외 매트릭스의 성분과 결합하는 이종이량체 막전달 당단백 수용체의 일종이다. 이들은 세포 집합 및 기저 라미나에 세포를 고정시키는 것과 관련된 유착 분자로서 작용한다. 이들은 신호를 핵에 변환시키고, 유전자 발현, 특히 세포 이동 및 세포 분화에 대한 유전자 발현을 조절하는 것과 관련되어 있다[참조: Hynes, Cell, 69: 11-25, 1992]. 20개가 넘는 상이한 인테그린 수용체가 공지되어 있고, 이들은 약 14개의 상이한 알파 아단위 및 약 8개의 상이한 베타 아단위를 포함한다[참조: DiSimone, Curr. Opin. Cell Biol., 6: 182-194, 1994].Integrin is a heterodimeric transmembrane glycoprotein receptor that binds to components of basal lamina and extracellular matrix. They act as adhesion molecules associated with immobilizing cells in the cell aggregate and basal lamina. They are involved in converting signals to nuclei and regulating gene expression, particularly gene expression for cell migration and cell differentiation (Hynes, Cell, 69: 11-25, 1992). Over 20 different integrin receptors are known, and they contain about 14 different alpha subunits and about 8 different beta subunits (DiSimone, Curr. Opin. Cell Biol., 6: 182-194,1994).
신장 사구체에는, 별개의 셋트의 인테그린 수용체가 존재한다. 이들은 메산쥼 매트릭스(즉, 신장 사구체에서 모세혈관 루프를 지지하는 것을 보조하는 막) 또는 내장 상피 세포와 관련이 있다[참조: Patey et al., Cell Adhesion Commun., 2:159-167, 1994]. 성인 사구체 내장 상피 세포상에서 가장 우세한 인테그린 수용체는 α3β1 이종이량체이다[참조: Adler, Am, J. Pathol., 141:571-578, 1992: and Patey et al., Cell Adhesion Commun., 2:159-167, 1994]. β5 아단위는 성인 내장 상피 세포에서 발현되는 것으로 증명되었고[참조: Yamada et al., Cell Adhesion Communic., 3:311-325, 1995], α1, α3, α5, αⅤ, β1, 및 β3 인테그린 수용체는 신장 형태발생 동안 발생적으로 발현된다[참조: Korhonen et al., Lab. Invest., 62:616-625, 1990; Wada et al., J. Cell. Biol., 132:1161-1176, 1996; and Yamada et al., Cell Adhesion Communic., 3:311-325, 1995]. α1β1 이종이량체 인테그린 수용체는 신장 사구체의 메산쥼 세포의 표면에서 확인된 유일한 인테그린 수용체이다.There are distinct sets of integrin receptors in the renal glomeruli. These are associated with mesangial matrix (ie, membranes that assist in supporting the capillary loop in the kidney glomeruli) or visceral epithelial cells (Patey et al., Cell Adhesion Commun., 2: 159-167, 1994) . The most prevalent integrin receptor on adult glomerular endothelial cells is the? 3? 1 heterodimer (Adler, Am, J. Pathol., 141: 571-578, 1992: and Patey et al., Cell Adhesion Commun., 2: 159 -167, 1994]. β5 subunit has been demonstrated to be expressed in adult visceral epithelial cells (Yamada et al., Cell Adhesion Communic., 3: 311-325, 1995), α1, α3, α5, αV, β1, and β3 integrin receptors Are genetically expressed during kidney morphogenesis (Korhonen et al., Lab. Invest., 62: 616-625, 1990; Wada et al., J. Cell. Biol., 132: 1161-1176,1996; and Yamada et al., Cell Adhesion Communic., 3: 311-325, 1995). The α1β1 heterodimeric integrin receptor is the only integrin receptor identified on the surface of mesangial cells of the renal glomeruli.
α3 인테그린 수용체 아단위에서 유전자 녹아웃 마우스가 생산되었다. 그 자손은 출생 직후 신장 기능 부전으로 사망한다[참조: Kreidberg et al., Dev., 122:3537-3547, 1996]. 이 모델의 신생아에서 GBM의 초미세구조 병리학은 진전된 앨포트 증후군에서 관찰된 것과 상당히 유사하다. 기저막은 희박화된(rarefied) 것으로 나타나며(즉, 불규칙적으로 비후, 박화, 및 분열) 내장 상피 세포의 푸트 프로세스(foot process)가 융합된 것으로 나타난다. α3β1 수용체에 대한 한 리간드가 타입 Ⅳ 콜라겐이고[참조: Krishnamurti et al., Lab. Invest., 74:650-665, 1996; and Rupprecht et al., Kidney Int., 49:1575-1582, 1996], 이 수용체가 내장 상피 세포 및 GBM 사이의 접촉면을 따라 국재화되어 있기 때문에[참조: Baraldi et al., Nephron, 66:295-301, 1994], α3 인테그린 녹아웃에 대하여 상기 기재된 관찰은 이러한 인테그린/리간드 상호작용이 기저막 발생에서 중요한 역할을 하는 모델을 지지한다.A gene knockout mouse was produced in the? 3 integrin receptor subunit. The offspring die from renal insufficiency immediately after birth (Kreidberg et al., Dev., 122: 3537-3547, 1996). The ultrastructural pathology of GBM in neonates in this model is quite similar to that observed in advanced Alport syndrome. The basement membrane appears to be rarefied (ie, irregularly thickening, thinning, and cleavage), and the foot process of intestinal epithelial cells appears to be fused. One ligand for the? 3? 1 receptor is type IV collagen (Krishnamurti et al., Lab. Invest., 74: 650-665,1996; and Rupprecht et al., Kidney Int., 49: 1575-1582, 1996), since this receptor is localized along the interface between the intestinal epithelial cells and GBM (Baraldi et al., Nephron, 66: 295 -301, 1994], the observations described above for [alpha] 3 integrin knockout support a model in which such integrin / ligand interactions play an important role in basement membrane development.
정상적인 동물에서, 출생시까지 태아 사구체 기저막(GBM)의 타입 Ⅳ 콜라겐은 오직 α1(Ⅳ) 및 α2(Ⅳ) 사슬(고전적인 콜라겐 사슬로 지칭)만을 포함한다. 출생 직후에, 발생적 전환이 일어나 α3(Ⅳ), α4(Ⅳ), 및 α5(Ⅳ) 사슬(새로운 콜라겐 사슬로 지칭)이 GBM에서 명백하게 검출가능하며, α1(Ⅳ) 및 α2(Ⅳ) 사슬은 메산쥼 매트릭스에 주로 국재화된다[참조: Minor & Sanes, J. Cell. Biol., 127:879-891, 1994].In normal animals, type IV collagen in fetal glomerular basement membrane (GBM) by birth only contains only the alpha 1 (IV) and alpha 2 (IV) chains (referred to as classical collagen chains). Immediately after birth, developmental changes occur and α3 (Ⅳ), α4 (Ⅳ), and α5 (Ⅳ) chains (referred to as new collagen chains) are clearly detectable in GBM and α1 (Ⅳ) and α2 It is primarily localized in the Mesan 쥼 matrix [Minor & Sanes, J. Cell. Biol., 127: 879-891, 1994).
성인의 신장에서, α1(Ⅳ) 및 α2(Ⅳ) 사슬을 포함하는 GBM의 박층이 내피 세포층에 인접하여 위치하는 반면, 대다수의 전체 두께의 GBM은 α3(Ⅳ), α4(Ⅳ), 및 α5(Ⅳ) 사슬을 포함한다[참조: Desjardins & Bendayan, J. Cell. Biol., 113:689-700, 1991; and Kashtan et al., J. Clin. Invest.,78:1035-1044,1996]. 2개의 상이한 셋트의 콜라겐 사슬이 별개의 망상구조를 형성함을 시사하는 생화학적 증거가 있다[참조: Kleppel et al., J. Biol. Chem., 267:4137-4142,1992]. 가족성 신염에서, α3(Ⅳ), α4(Ⅳ), 또는 α5(Ⅳ)에서 무효 돌연변이(즉, 유전자 발현을 소실시키는 돌연변이)는 GBM에서 모든 3개 사슬의 부재를 초래하며, 이는 GBM 상부구조의 고분자 어셈블리에서 필수적인 회합에 기인하는 것으로 추정된다. 이는 GBM의 전체 두께를 통하여 α1(Ⅳ) 및 α2(Ⅳ) 사슬의 존재를 초래한다. 따라서, 앨포트 신장(즉, 앨포트 증후군을 가진 개인의 신장)에서 내장 상피 세포의 표면상의 타입 Ⅳ 콜라겐 수용체는 비특징적인 타입 Ⅳ 콜라겐 사슬 조성의 GBM과 직접 접촉한다. 1개 이상의 연구에서 이러한 상이한 조성을 가진 타입 Ⅳ 콜라겐과 결합하는 내장 상피 세포의 상대적 능력에 관하여 언급하였으며, 내장 상피 세포는 고전적인 α1(Ⅳ) 및 α2(Ⅳ) 사슬과 직접 비교할 때 새로운 사슬로 구성된 기저막과 보다 현저히 우수하게 결합하는 것으로 밝혀졌다. 이러한 결합은 α3 인테그린 수용체에 대한 항체로 차단될 수 있다.In adult kidneys, a thin layer of GBM containing the α1 (Ⅳ) and α2 (Ⅳ) chains is located adjacent to the endothelial cell layer, while the GBM of the majority of total thickness is α3 (Ⅳ), α4 (IV) chain (see Desjardins & Bendayan, J. Cell. Biol., 113: 689-700,1991; and Kashtan et al., J. Clin. Invest., 78: 1035-1044, 1996]. There is biochemical evidence suggesting that two different sets of collagen chains form a distinct network (Kleppel et al., J. Biol. Chem., 267: 4137-4142, 1992]. In familial nephritis, an ineffective mutation (ie a mutation that disrupts gene expression) in α3 (Ⅳ), α4 (Ⅳ), or α5 (Ⅳ) results in the absence of all three chains in GBM, Lt; RTI ID = 0.0 > assembly. ≪ / RTI > This leads to the presence of α1 (Ⅳ) and α2 (Ⅳ) chains through the total thickness of GBM. Thus, type IV collagen receptors on the surface of intestinal epithelial cells directly contact the GBM of the non-characteristic type IV collagen chain composition in Alport's kidney (i.e., the kidney of an individual with Alport syndrome). One or more studies have referred to the relative abilities of vaginal epithelial cells that bind to these different composition type IV collagens, and vimentin epithelial cells are composed of new chains when compared directly to the classical α1 (Ⅳ) and α2 (Ⅳ) Lt; RTI ID = 0.0 > basement membrane. ≪ / RTI > Such binding may be blocked by an antibody to the [alpha] 3 integrin receptor.
앨포트 증후군의 상염색체형에 대한 마우스 모델이 COL4A3 프로콜라겐 유전자의 표적화된 돌연변이발생에 의해 창제되었다[참조: Cosgrove et al., Genes Dev., 10:2981-2992, 1996]. 상기 동물 모델은 동종번식 129Sv/J 배경에서 약 4주의 주령에서 단백뇨가 발증하고, 진행성 사구체신염이 발병하여, 신부전으로 인한 사망의 평균 주령은 약 8.5주이다. GBM에서 초미세구조의 변화는 단백뇨가 발증되기 훨씬 전인 1주의 주령에서 관찰되며, 대부분의 사구체의 GBM을 통하여 3주 주령까지 관찰된다. 라미닌-1, 헤파린 술페이트 프로테오글리칸, 피브로넥틴, 및 엔탁틴을 포함한 세포외 매트릭스 성분이 GBM에 축적된다. 이러한 마우스는 본원에서 "앨포트" 마우스로서 지칭된다.A mouse model for autosomal form of Alport syndrome was created by targeted mutagenesis of the COL4A3 procollagen gene (Cosgrove et al., Genes Dev., 10: 2981-2992, 1996). In the animal model, proteinuria develops at about 4 weeks of age in the homozygous breeding 129Sv / J background, and progressive glomerulonephritis develops, and the average age of death due to renal failure is about 8.5 weeks. Ultrastructural changes in GBM are observed in one week of age before the onset of proteinuria, and are observed up to 3 weeks of age through GBM of most glomeruli. Extracellular matrix components, including laminin-1, heparin sulfate proteoglycan, fibronectin, and entatin, accumulate in the GBM. Such a mouse is referred to herein as an " allport " mouse.
GBM 및 메산쥼에서 신장 질환의 진행의 작용으로 세포외 매트릭스 및 메산쥼의 축적은 환자 및 실험 동물 시스템 모두에서 다양한 사구체 질환에 공통되는 특징이다[참조: 예컨대, Goyal & Wiggins, Am. Soc. Nephrol., 1:1334-1342, 1991; Wilson et al., Contrib. Nephrol. Basel, Karger, 118:126-134, 1996: Razzaque et al., Clin. Nephrol. 46:213-214, 1996; Yoshioka et al., Kidney Int., 35:1203-1211, 1989: and Klahr et al., N. Engl. J. Med., 318:1657-1666, 1988]. 당뇨병에서, 이러한 효과의 1차적인 매개자는 만성적인 높은 글루코오스 수치로 인해 비효소적으로 글리코실화된 혈청 단백질에 대한 장기간의 노출인 것으로 생각된다[참조: Doi et al., Proc. Natl. Acad. Sci. USA, 89:2873-2877, 1992; and Roy et al., J. Clin. Invest., 93:483-442, 1994].The accumulation of extracellular matrix and mesangial cells by the action of progression of renal disease in GBM and mesangial is a common feature of various glomerular diseases in both patient and laboratory animal systems (see, e.g., Goyal & Wiggins, Am. Soc. Nephrol., 1: 1334-1342, 1991; Wilson et al., Contrib. Nephrol. Basel, Karger, 118: 126-134, 1996: Razzaque et al., Clin. Nephrol. 46: 213-214,1996; Yoshioka et al., Kidney Int., 35: 1203-1211, 1989: and Klahr et al., N. Engl. J. Med., 318: 1657-1666, 1988]. In diabetes, the primary mediator of this effect is thought to be long-term exposure to non-enzymatically glycosylated serum proteins due to chronic high glucose levels (Doi et al., Proc. Natl. Acad. Sci. USA, 89: 2873-2877, 1992; and Roy et al., J. Clin. Invest., 93: 483-442, 1994).
진행성 사구체성 질환의 대다수에 있어서, 변형 성장 인자 TGF-β1의 과생성은 섬유증(즉, 섬유 조직의 형성)을 가져오는 세포외 매트릭스의 축적과 밀접하게 관련이 있는 것 같다[참조: 예컨대, Border & Ruoslahti, Nature(London), 346:371-374, 1992: Yang et al., J. Am. Soc. Nephrol., 5:1610-1617, 1995; and Yamamoto et al., Kidney Int., 45:916-927, 1994]. 자가면역성 신염에 대한 한 동물 모델에서, TGF-β1에 대한 항체, 또는 대응 mRNA의 안티센스 올리고누클레오티드를 주사한 결과 진행성 사구체신염 및 세포외 매트릭스의 축적이 억제되었다[참조: Border et al., Nature(London), 346:371-374, 1990; and Akagi et al., Kidney Int., 50:148-155, 1996].In the majority of progressive somatic diseases, overgrowth of the transforming growth factor TGF- [beta] 1 appears to be closely related to the accumulation of extracellular matrix resulting in fibrosis (i.e., formation of fibrous tissue) (see, for example, Border &Amp; Ruoslahti, Nature (London), 346: 371-374, 1992: Yang et al., J. Am. Soc. Nephrol., 5: 1610-1617,1995; and Yamamoto et al., Kidney Int., 45: 916-927, 1994). In one animal model for autoimmune nephritis, the injection of an antibody against TGF-? 1, or an antisense oligonucleotide of the corresponding mRNA, inhibited the accumulation of advanced glomerulonephritis and extracellular matrix (Border et al., Nature London), 346: 371-374, 1990; and Akagi et al., Kidney Int., 50: 148-155, 1996).
랫트의 GBM의 기저막 콜라겐의 반감기는3H-프롤린을 사용한 펄스-추적 연구에 기초하여 16 내지 40일인 것으로 추정되었다[참조: Daha et al., Nephron. 22:522-528, 1978]. 이는 헤파린 술페이트 프로테오글리칸의 교체(t1/2=20시간), 또는 GBM에서 기타 술페이트화된 고분자의 교체(t1/2=20 내지 60시간)과 비교하여 매우 느리다. 앨포트 마우스 모델의 GBM에서 기저막 단백질의 축적[참조: Cosgrove et al., Genes Dev., 10:2981-2992, 1996]은 이러한 단백질의 합성 및 분해 양자 모두에서의 변화의 순 효과일 것이다. GBM 및 메산쥼 매트릭스 모두의 교체와 관련된 프로테아제중에서, 가장 특징적인 것은 메탈로프로테이나제 MMP-2(72kD 콜라게나제) 및 MMP-9(92kD 콜라게나제) 뿐만 아니라 MMP-3(스트로모라이신-1)이다. 이러한 효소들은 타입 Ⅳ 콜라겐 뿐만 아니라 다양한 기타 세포외 매트릭스 성분을 분해할 것이다.The half-life of basement membrane collagen in GBM of rats was estimated to be 16 to 40 days based on a pulse-tracing study with 3 H-proline (See et al., Nephron. 22: 522-528, 1978]. This is very slow compared to the heparin sulfate proteoglycan of the replacement (t 1/2 = 20 hours), or other alcohol replacement of Polymer Chemistry sulfate (t 1/2 = 20 to 60 hours) in the GBM. The accumulation of basement membrane proteins in the GBM of the AlportMouse model (Cosgrove et al., Genes Dev., 10: 2981-2992, 1996) may be the net effect of changes in both the synthesis and degradation of these proteins. Of the proteases involved in the replacement of both GBM and mesangial matrices, the most prominent are the metalloproteinases MMP-2 (72 kD collagenase) and MMP-9 (92 kD collagenase) as well as MMP-3 -1). These enzymes will degrade not only Type IV collagen but also various other extracellular matrix components.
메산쥼 세포(및 아마 기타 사구체 세포 유형)도 메탈로프로테이나제에 대한 천연의 저해제를 생성한다. 이들은 TIMP's(메탈로프로테이나제의 조직 저해제)로 지칭된다. 이들은 비교적 저분자량의 당단백이다. 이들중에서, TIMP-1은 스트로몰라이신-1 및 MMP-9에 특이적인 반면, TIMP-2 및 TIMP-3은 MMP-2를 저해할 것이다[참조: Goldberg et al., Proc. Natl. Acad. Sci. USA, 86:8207-8211, 1989; Staskus et al., J. Biol. Chem., 266:449-454, 1991; and Stetler-Stevenson et al., J. Biol. Chem., 264:17374-17378, 1989].Mesenchymal cells (and possibly other glomerular cell types) also produce natural inhibitors of metalloproteinases. These are referred to as TIMP's (tissue inhibitors of metalloproteinases). These are relatively low molecular weight glycoproteins. Of these, TIMP-1 is specific for stromolysin-1 and MMP-9, while TIMP-2 and TIMP-3 will inhibit MMP-2 (Goldberg et al., Proc. Natl. Acad. Sci. USA, 86: 8207-8211, 1989; Staskus et al., J. Biol. Chem., 266: 449-454, 1991; and Stetler-Stevenson et al., J. Biol. Chem., 264: 17374-17378, 1989).
메탈로프로테이나제 및 이들의 대응 저해제의 조절은 유사하게 GBM 교체의 적당한 수준을 유지하는 역할을 한다. 사구체에서 이러한 단백질을 엔코딩하는 유전자의 조절에 관하여 거의 알려진 바 없으나, 인테그린 수용체/ECM(세포외 매트릭스) 상호작용을 통한 신호 변환은 이러한 과정에서 중요한 일면일 수 있다.The modulation of metalloproteinases and their corresponding inhibitors similarly plays a role in maintaining a reasonable level of GBM replacement. Little is known about the regulation of genes encoding these proteins in the glomeruli, but signal transduction through integrin receptor / ECM (extracellular matrix) interactions may be an important aspect of this process.
앨포트 증후군에 대한 동물 모델, 특히 질병 진행이 현저하게 느린 모델에 대한 필요성이 남아있다. 또한, 예컨대 앨포트 증후군 및 인슐린 의존성 당뇨병을 포함하여, 메산쥼 매트릭스 확장, 및 사구체 기저막 및 관상간극에 진행성 매트릭스 축적과 관련된 신장 질환을 치료하기 위한 새로운 치료법에 대한 필요성이 남아있다.There remains a need for animal models of Alport syndrome, particularly those with significantly slower disease progression. There remains a need also for new therapies for the treatment of kidney diseases associated with esophageal matrix enlargement and progressive matrix accumulation in the glomerular basement membrane and coronary gaps, including, for example, Alport syndrome and insulin-dependent diabetes mellitus.
요약summary
본 발명은 환자(바람직하게는 포유동물, 및 보다 바람직하게는 사람)에서 신장 질환을 치료 및 제한하는(즉, 질환의 발병 지연, 진행 지연 및/또는 역전) 다양한 치료법을 제공한다. 상기 신장 질환은, 바람직하게는 신장 사구체신염, 신장 섬유증, 또는 양자 모두를 포함한다. 이러한 질환은, 예컨대 앨포트 증후군, IDDM 신염, 메산쥼 증식성 사구체신염, 막 증식성 사구체신염, 반월형 사구체신염, 당뇨병성 망막증, 및 신장 간질성 섬유증과 관련될 수 있다.The present invention provides a variety of therapies for treating and restricting kidney disease (i. E. Delaying the onset, delaying progression and / or reversing the disease) in a patient (preferably a mammal, and more preferably a human). The renal disease preferably includes renal glomerulonephritis, renal fibrosis, or both. Such diseases may be associated with, for example, Alport syndrome, IDDM nephritis, mesangial proliferative glomerulonephritis, proliferative glomerulonephritis, meniscus glomerulonephritis, diabetic retinopathy, and renal interstitial fibrosis.
한 구현예에서, 상기 방법은 환자에게 유효량의 α1β1 인테그린 수용체 저해제를 투여하는 것을 포함한다. 이 α1β1 인테그린 수용체 저해제는 신장 세포의 표면상의 α1β1 인테그린 수용체 결합 부위와 결합하는 차단제일 수 있다. 상기 차단제는 라미닌, 피브로넥틴, 엔탁틴, 및 콜라겐 타입 4로 구성된 군으로부터 선택된 단백질의 9량체 이상의 펩티드 단편일 수 있다. 대안적으로, 상기 차단제는 항체일 수 있다. 기타 메카니즘에 의해 α1β1 인테그린 수용체를 저해시키는(즉, 불활성화시키는) 기타 약물이 사용될 수도 있다.In one embodiment, the method comprises administering to the patient an effective amount of an alpha 1 integrin receptor inhibitor. This? 1? 1 integrin receptor inhibitor may be a blocking agent that binds to the? 1? 1 integrin receptor binding site on the surface of the kidney cells. The blocking agent may be a peptide fragment of nine or more fragments of a protein selected from the group consisting of laminin, fibronectin, entatin, and collagen type 4. [ Alternatively, the blocking agent may be an antibody. Other drugs that inhibit (i.e., inactivate) the? 1? 1 integrin receptor by other mechanisms may also be used.
다른 구현예에서, 상기 방법은 환자에게 α1β1 인테그린 수용체 저해제에 추가하여 유효량의 TGF-β1 저해제를 투여하는 것을 포함한다. 이들 저해제는 동시에(즉, 혼합물로서) 또는 순차적으로 투여될 수 있다. TGF-β1 저해제는 TGF-β1과 비가역적으로 결합하여 TGF-β1이 수용체와 결합하는 능력을 저해시키는 약물일 수 있다. 대안적으로, TGF-β1 저해제는 신장 세포의 핵에 신호를 변환하는 TGF-β1의 능력을 저해시키는 약물일 수 있다. 후자 유형의 저해제는 바람직하게는 타크롤리무스(tacrolimus)(FK506으로 시판)와 같은 칼시누린(calineurin) 저해제이다. 기타 메카니즘에 의해 TGF-β1을 저해시키는(즉, 불활성화시키는) 기타 약물도 사용될 수 있다.In another embodiment, the method comprises administering to the patient an effective amount of a TGF-? 1 inhibitor in addition to an? 1? 1 integrin receptor inhibitor. These inhibitors may be administered simultaneously (i.e., as a mixture) or sequentially. The TGF-? 1 inhibitor may be a drug that inhibits the ability of TGF-? 1 to bind to the receptor by irreversibly binding to TGF-? 1. Alternatively, the TGF- [beta] l inhibitor may be a drug that inhibits the ability of TGF- [beta] l to convert signals to the nucleus of kidney cells. The latter type of inhibitor is preferably a calineurin inhibitor such as tacrolimus (commercially available as FK506). Other drugs that inhibit (i.e., inactivate) TGF-? 1 by other mechanisms may also be used.
바람직하게는, 본 발명은 환자에서 앨포트 증후군의 발병을 지연 및/또는 진행을 지연시키는 방법을 제공한다. 한 구현예에서, 본 방법은 신장 세포의 α1β1 인테그린 수용체를 통한 신호 변환을 저해시키는 약물의 유효량을 투여하는 것을 포함한다. 다른 구현예에서, 본 방법은 환자의 신장 세포 표면상의 α1β1 인테그린 수용체 결합 부위를 차단시키는 것을 포함한다. 이러한 방법은 환자에게 유효량의 TGF-β1 저해제를 투여함으로써 보다 강화될 수 있다.Preferably, the invention provides a method of delaying the onset and / or delaying the onset of Alport syndrome in a patient. In one embodiment, the method comprises administering an effective amount of a drug that inhibits signal transduction through the alpha 1 beta 1 integrin receptor of the kidney cells. In another embodiment, the method comprises blocking the alpha 1 beta 1 integrin receptor binding site on the kidney cell surface of the patient. Such a method may be further enhanced by administering to the patient an effective amount of a TGF-? 1 inhibitor.
바람직하게는, 본 발명은 환자에서 인슐린 의존성 당뇨병에서 신장 질환의 발병을 지연 및/또는 진행을 지연시키는 방법도 제공한다. 한 구현예에서, 본 방법은 신장 세포의 α1β1 인테그린 수용체를 통한 신호 변환을 저해시키는 약물의 유효량을 투여하는 것을 포함한다. 다른 구현예에서, 본 방법은 신장 세포 표면상의 α1β1 인테그린 수용체 결합 부위를 차단시키는 것을 포함한다. 이러한 방법은 환자에게 TGF-β1 저해제를 투여함으로써 보다 강화될 수 있다.Preferably, the invention also provides a method of delaying the onset and / or delaying the onset of a renal disease in insulin dependent diabetes mellitus in a patient. In one embodiment, the method comprises administering an effective amount of a drug that inhibits signal transduction through the alpha 1 beta 1 integrin receptor of the kidney cells. In another embodiment, the method comprises blocking the alpha 1 beta 1 integrin receptor binding site on the kidney cell surface. Such a method may be further enhanced by administering a TGF- [beta] l inhibitor to the patient.
또한, 환자에서 신장 섬유증을 제한하는 방법이 제공된다. 한 구현예에서, 상기 방법은 환자에서 TGF-β1 활성을 감소시키면서 환자의 신장 세포의 α1β1 인테그린 수용체를 저해시키는 것을 포함한다. 이러한 활성은 환자에게 TGF-β1과 비가역적으로 결합하여 TGF-β1이 그의 수용체와 결합하는 능력을 저해시키는 약물을 투여함으로써 감소될 수 있다. 대안적으로, 이러한 활성은 신장 세포의 핵에 신호를 변환시키는 TGF-β1의 능력을 저해시킬 수 있는 약물을 투여함으로써 감소될 수 있다.Also provided is a method of limiting renal fibrosis in a patient. In one embodiment, the method comprises inhibiting the alpha 1 beta 1 integrin receptor of a patient's kidney cells while reducing TGF- beta 1 activity in the patient. Such activity can be reduced by administering a drug that inhibits the ability of TGF-beta1 to bind to its receptor by irreversibly binding to the patient. Alternatively, such activity can be reduced by administering a drug that can inhibit the ability of TGF-? 1 to convert signals to the nucleus of kidney cells.
또다른 구현예에서, 앨포트 증후군을 가진 환자의 GBM에서 매트릭스 축적을 제한시키는 방법이 제공된다. 한 구현예에서, 상기 방법은 환자에서 TGF-β1 활성을 감소시키는 것을 포함한다. 이는 본원에 기술된 TGF-β1 저해제를 투여함으로써 달성될 수 있다.In another embodiment, a method is provided for limiting matrix accumulation in a GBM of a patient with Alport syndrome. In one embodiment, the method comprises reducing TGF-? 1 activity in a patient. This can be accomplished by administering the TGF- [beta] l inhibitors described herein.
특히 바람직한 구현예에서, 환자에게 칼시누린 저해제, 바람직하게는 타크롤리무스를 투여함으로써 신장 섬유증을 제한하는 방법이 제공된다.In a particularly preferred embodiment, a method is provided for limiting renal fibrosis by administering a calcineurin inhibitor, preferably tacrolimus, to the patient.
또한, 본 발명은 신장 질환에 대한 마우스 모델을 제공하며, 상기 마우스는 콜라겐 α3(Ⅳ) 유전자를 녹아웃시키는 결과 GBM에서 정상적인 콜라겐 타입 4 조성을 발현시키지 못한다. 즉, 상기 마우스는 콜라겐 α3(Ⅳ), α4(Ⅳ), 또는 α5(Ⅳ) 사슬을 사구체 기저막으로 혼입시키지 못한다(따라서, GBM은 그의 타입 Ⅳ 콜라겐 사슬 조성에 관하여 오직 콜라겐 α1(Ⅳ) 및 α2(Ⅳ) 사슬만을 포함한다). 또한, α1 아단위 유전자를 녹아웃시키는 결과 α1β1 인테그린 수용체를 발현시키지 못한다.In addition, the present invention provides a mouse model for renal disease, wherein the knockout of the collagen alpha 3 (IV) gene does not result in the expression of normal collagen type 4 composition in GBM. That is, the mouse fails to incorporate the collagen α3 (IV), α4 (Ⅳ), or α5 (Ⅳ) chains into the glomerular basement membrane (thus GBM has only collagen α1 (Ⅳ) and α2 (IV) chains. In addition, knockout of the alpha 1 subunit gene does not result in the expression of the alpha 1 beta 1 integrin receptor.
이중 녹아웃 마우스에서, 종래 기술의 마우스 모델과 비교하여 단백뇨의 발증이 지연된다. 또한, 동물은 앨포트 동복자의 거의 두배 오래 생존한다. 앨포트 마우스의 사망 평균 주령인 약 8주의 주령에서, 이중 녹아웃은 현저하게 감소된 사구체 질병경과를 나타낸다. 즉, 동일한 주령의 앨포트 마우스에 비하여, 이중 녹아웃 마우스는 보다 적은 GBM 희박화(raefication)와 함께 초미세구조 손상이 현저히 감소되며 족세포 푸트 프로세스가 거의 소멸하지 않는다. 또한, 앨포트 마우스에 비하여 GBM에서 피브로넥틴, 라미닌-1, 및 헤파린 술페이트 프로테오글리칸 축적의 약화가 일어나는 반면, 엔탁틴 및 타입 Ⅳ 콜라겐의 축적은 변화가 없다. 이러한 결과는 앨포트 신장 질환 발병에서 α1β1 인테그린 수용체에 대한 특이적 역할이 존재함을 시사한다. 이는 단일 α1 인테그린 녹아웃이 신장 생리 또는 기능에 뚜렷한 효과를 가지지 않는다는 것을 고려하면 주목할 만하다.In double knockout mice, the onset of proteinuria is delayed compared to the mouse model of the prior art. Also, animals survive almost twice as long as Alport's apprentice. At approximately 8 weeks of age, the average weekly mortality of Alport mice, double knockout represents a significantly reduced glomerular disease course. That is, double knockout mice show significantly less hypermicroscopic damage with less GBM raffication and almost no extinction of the podocyte foot process, compared to the same week old Alport mice. In addition, the accumulation of enstatin and type IV collagen remains unchanged, while the degradation of fibronectin, laminin-1, and heparin sulfate proteoglycan accumulation occurs in GBM relative to altox mice. These results suggest that there is a specific role for α1β1 integrin receptors in Alport renal disease outbreaks. This is noteworthy considering that a single alpha 1 integrin knockout has no significant effect on renal physiology or function.
이 마우스는 사구체신염 및/또는 섬유증을 특징으로 하는 앨포트 증후군, 인슐린 의존성 당뇨병, 및 기타 질환을 연구하는데 사용될 수 있다. 이 마우스는 또한 세포외 매트릭스 축적 및/또는 섬유증을 특징으로 하는 앨포트 증후군 및 인슐린 의존성 당뇨병 및 기타 질환을 치료하는 데 사용될 수 있는 약물을 스크리닝하는데 사용될 수 있다.This mouse can be used to study Alport syndrome, insulin dependent diabetes mellitus, and other diseases characterized by glomerulonephritis and / or fibrosis. This mouse can also be used to screen for Alport syndrome, which is characterized by extracellular matrix accumulation and / or fibrosis, and drugs that can be used to treat insulin-dependent diabetes and other diseases.
도면의 간단한 설명Brief Description of Drawings
도 1은 1주일 간격으로 마우스로부터 뇨를 수집하여 연구한 앨포트 대 이중 돌연변이 마우스에서 단백뇨의 발증을 예시한다. 수자는 뇨 수집시의 마우스의 주령(주)을 표시하였다. A=앨포트 마우스; B=이중 돌연변이 마우스; Mr=분자량 표준.Figure 1 illustrates the proliferation of proteinuria in Alport vs. double mutant mice studied by collecting urine from mice at intervals of one week. The mice showed the week of the mouse (note) at the time of urine collection. A = Alport mouse; B = double mutant mice; Mr = molecular weight standard.
도 2는 대조 및 이중 돌연변이 마우스에서 사구체 모세혈관 루프에 대한 초미세구조적 손상을 예시한다. 정상 마우스(A), 앨포트 마우스(B), 및 이중 돌연변이 마우스(C)의 신피질을 7주째에 에폭시 수지에 포매시켜 수집하였다. 초박형 절편을 염색하여 투과 전자 현미경으로 분석하였다. 화살표는 푸트 프로세스를 나타낸다. C=모세혈관 내강; U= 비뇨 공간. 배율 바아는 0.5㎛를 나타낸다.Figure 2 illustrates ultrastructural damage to the glomerular capillary loop in control and dual mutant mice. The cortex of normal mice (A), albintox (B), and double mutant mice (C) were collected by embedding in epoxy resin at 7 weeks. Ultrathin sections were stained and analyzed by transmission electron microscope. The arrows represent the foot process. C = capillary lumen; U = urinary space. The magnification bar indicates 0.5 mu m.
도 3은 정상, 앨포트, 및 이중 돌연변이 마우스에서 세포외 매트릭스 단백질의 면역형광 분석의 결과를 제공한다. 신피질의 동결된 한랭절편을 Y-축 표지상에 표시된 세포외 매트릭스 단백질에 특이적인 항체와 반응시켰다. 적당한 형광-콘쥬게이션된 2차 항체를 사용하여 신호가 생성되었고, 영상을 디지털로 수집하고 사이토비젼 울트라 소프트웨어(Cytovision Ultra software)(Applied Imaging, Inc)를 사용하여 처리하였다. 화살표는 사구체 모세혈관 루프를 나타낸다. 4A1,2=콜라겐 α1(Ⅳ) 및 α2(Ⅳ) 사슬; Lam-1=라미닌-1; Fib=피브로넥틴; HSP=헤파린 술페이트 프로테오글리칸; ent=엔탁틴. α1+/+=α1 인테그린 유전자에서 동형접합성 정상; α1-/-=α1 인테그린 유전자에서 동형접합성 돌연변이체; α3(Ⅳ)+/+=α3(Ⅳ) 콜라겐 유전자에서 동형접합성 정상; α3(Ⅳ)-/-=α3(Ⅳ) 콜라겐 유전자에서 동형접합성 돌연변이체.Figure 3 provides results of immunofluorescence analysis of extracellular matrix proteins in normal, albort, and double mutant mice. The frozen cold sections of the renal cortex were reacted with antibodies specific for the extracellular matrix proteins displayed on the Y-axis label. Signals were generated using appropriate fluorescent-conjugated secondary antibodies and images were digitally collected and processed using Cytovision Ultra software (Applied Imaging, Inc.). The arrow represents the glomerular capillary loop. 4A1, 2 = collagen alpha 1 (IV) and alpha 2 (IV) chain; Lam-1 = laminin-1; Fib = fibronectin; HSP = heparin sulfate proteoglycans; ent = Enchanted. α1 + / + = homozygosity in α1 integrin gene normal; homozygous mutants in the alpha 1 - / - = alpha 1 integrin gene; α3 (Ⅳ) + / + = α3 (Ⅳ) homozygosity in the collagen gene normal; α3 (Ⅳ) - / - = α3 (Ⅳ) homozygous mutant in the collagen gene.
도 4는 앨포트 신장 질환 진행의 시간경과 동안 총 신장으로부터 mRNA의 노턴 분석의 결과를 도시한다. 지정된 시점(주)에서 수집된 신장으로부터 분리된 총 RNA를 변성 아가로즈 겔상에서 분별시키고, 나일론 위에 블롯팅시켜, TGF-β1, 또는 사구체 기저막 및/또는 세포외 매트릭스의 다양한 성분을 엔코딩하는 쥐과동물 cDNA로 프로빙하였다. 패널에 예시된 데이터를 생성하기 위해 사용된 프로브는 하기와 같다: A, TGF-β1; B, 콜라겐 α1(Ⅳ); C, 콜라겐 α2(Ⅳ); D, 피브로넥틴; E, 엔탁틴; F, 라미닌 β1 사슬; G, 라미닌 β2 사슬.Figure 4 shows the results of Norton analysis of mRNA from total kidney over time of Alport renal disease progression. Total RNA isolated from the kidneys collected at a given time point (week) was fractionated on denaturing agarose gels and blotted onto nylon to detect TGF- [beta] l, or murine animals encoding the various components of the glomerular basement membrane and / and probed with cDNA. The probes used to generate the data exemplified in the panel are: A, TGF-β1; B, collagen alpha 1 (IV); C, collagen alpha 2 (IV); D, fibronectin; E, enstatin; F, laminin beta 1 chain; G, laminin β2 chain.
도 5는 앨포트 신장 질환 진행 동안 mRNA 유도의 정량적 분석을 도시한다. X-선 필름에 노출시킨 후, 도 4를 생성하는데 사용된 막을 바이오래드(BioRad) GS-525 인영상기(phosphorimager)를 사용하여 분석하였다. 플롯팅된 수치는 정상 동복자에서 관찰된 것에 대한 앨포트 샘플에서 특이적 mRNA의 폴드 유도를 나타낸다. 모든 밴드를 배경에 대하여 공제하였다. 분석된 특이적 mRNA 종은 삽입하여 표시되어 있다.Figure 5 shows a quantitative analysis of mRNA induction during Alport renal disease progression. After exposure to the X-ray film, the membrane used to produce Figure 4 was analyzed using a BioRad GS-525 phosphorimager. The plotted figure shows the fold induction of specific mRNA in the alphabet sample relative to that observed in normal subjects. All bands were subtracted against the background. The specific mRNA species analyzed are indicated by insertion.
도 6은 단백뇨 후의 앨포트 마우스에서 특이적 전사체의 원위치 하이브리드화 분석을 예시한다. 정상 동복자의 신장(A, D, G, 및 J)을 앨포트 마우스의 신장(B, E, H, 및 K)을 따라 분석하였다. 안티센스 프로브는 콜라겐 α1(Ⅳ)(A 및 B), TGF-β1(D 및 E), 엔탁틴(J 및 K), 피브로넥틴(G 및 H)또는 라미닌 β1 사슬(M 및 N)의 NC1 도메인에 대하여 특이적이었다. 세균 β-갈락토시다제에 특이적인 프로브는 비특이적 결합에 대한 대조로서 사용하였다(C, F, I, L, 및 O).Figure 6 illustrates in situ hybridization analysis of specific transcripts in albumin after proteinuria. The elongations (A, D, G, and J) of normal subjects were analyzed along the elongation (B, E, H, and K) The antisense probes can bind to the NC1 domain of collagen alpha 1 (IV) (A and B), TGF- beta 1 (D and E), enstatin (J and K), fibronectin (G and H) or laminin beta 1 chains (M and N) . Probes specific for bacterial [beta] -galactosidase were used as controls for non-specific binding (C, F, I, L, and O).
도 7은 정상 및 앨포트 마우스의 조직 절편에서 TGF-β1에 대한 이뮤노퍼옥시다제를 예시한다. 파라핀 포매된 절편을 이뮤노퍼옥시다제 검출을 사용하여 TGF-β1의 활성형에 대하여 염색하였다. P=족세포; M=메산쥼 세포.Figure 7 illustrates the immune oxidase for TGF-? 1 in tissue sections of normal and Alport mice. Paraffin-embedded sections were stained for the active form of TGF-β1 using Immunoperoxidase detection. P = group cell; M = mesangial cells.
도 8은 정상 및 앨포트 사람 신피질에서 TGF-β1 mRNA에 대한 RN아제 검출 분석을 예시한다. 총 RNA를 정상 및 앨포트 사람 신피질로부터 분리시키고, 각 10㎍을 사람 TGF-β1 안티센스 메시지의 방사성 표지된 부분을 프로브로서 사용하여 RN아제 보호 분석하였다. 상기 검정 결과 264bp 보호된 단편이 얻어진다. 분자 크기 마커는 MSP1 컷 PBR322로 방사성표지되고, 적당한 단편이 비교용으로 표시된다. N=정상; A=앨포트.Figure 8 illustrates RNase detection assay for TGF- [beta] l mRNA in normal and albumin cortex. Total RNA was isolated from normal and allantoic renal cortices and each 10 μg of RNase protection analyzed using the radioactive labeled portion of the human TGF-? 1 antisense message as a probe. The assay results in a 264 bp protected fragment. Molecular size markers are radiolabeled with MSP1 cut PBR322, and appropriate fragments are labeled for comparison. N = normal; A = Alport.
도 9는 정상 마우스, 앨포트 마우스, α1 인테그린 결핍 마우스, 및 α1 인테그린 및 콜라겐 α3(Ⅳ)이 둘다 결핍된 마우스의 신피질로부터 얻은 RNA의 노턴 블롯을 예시한다. 총 RNA를 지정된 제노타입을 가진 7주 된 마우스(동복자)의 신피질로부터 분리하였다: +/+=대립유전자 모두에서 정상; -/-=대립유전자 모두에서 돌연변이.Figure 9 illustrates the Norton blot of RNA from the cortex of normal mice, allt mice, alpha 1 integrin deficient mice, and mice deficient in both alpha 1 integrin and collagen alpha 3 (IV). Total RNA was isolated from the renal cortex of a 7-week-old mouse (confluent) with the designated genotype: + / + = normal at all alleles; - / - = mutation in alleles.
도 10은 α1 인테그린에 특이적인 중화 항체를 주사한 7주 된 앨포트 동물의 GBM의 투과 전자 현미경사진이다. GBM의 규칙적인 3층 형태 및 소상 비후화된 영역의 부재에 유의한다. 배율은 10,500배이다.FIG. 10 is a transmission electron micrograph of GBM of a 7 week old Alport animal injected with a neutralizing antibody specific for? 1 integrin. Notice the absence of a regular three - layer form of the GBM and a degenerated area of the small phase. The magnification is 10,500 times.
도 11은 129Sv/J 앨포트 마우스에서 GBM 초미세구조에 대한 TGF-β1 저해제의 효과를 예시한다. 동물을 FK506 또는 TGF-β1 가용성 수용체로 처리하였다. 신피질을 에폭시에 포매시키고, 절단하여 아세트산 우라닐 및 시트르산 납으로 염색시키고, 투과 전자 현미경에 의해 분석하였다. A=대조; B=미처리 앨포트; C=FK506으로 처리한 앨포트; D=가용성 TGF-β1 수용체로 처리한 앨포트. 배율은 11,000배이다.Figure 11 illustrates the effect of TGF- [beta] l inhibitors on GBM superfine structure in 129Sv / J altrip mice. Animals were treated with FK506 or TGF- [beta] l soluble receptors. The renal cortex was embedded in epoxy, sectioned, stained with uranyl acetic acid and lead citrate, and analyzed by transmission electron microscopy. A = contrast; B = unprocessed alport; C = alpha pot treated with FK506; D = albut treated with soluble TGF-? 1 receptor. The magnification is 11,000 times.
도 12는 처리 대 미처리 129Sv/J 앨포트 마우스 사구체의 주사 전자 현미경사진이다. 도 11에서 사용한 마우스의 신피질을 동결 건조하여, 파괴시키고, 아세트산 우라닐 및 시트르산 납으로 염색하고, 확인된 사구체를 노출시켜 주사 전자 현미경을 사용하여 사진촬영하였다. A=대조; B=주사하지 않은 앨포트; C=TGF-β1 가용성 수용체로 처리한 앨포트 마우스. 배율은 2500배이다.Figure 12 is a scanning electron micrograph of the treated vs. untreated 129Sv / J altxt mouse glomeruli. The cortex of the mouse used in Fig. 11 was lyophilized, destroyed, stained with uranyl acetic acid and lead citrate, exposed to visible glomeruli and photographed using scanning electron microscope. A = contrast; B = uninjected alport; C = Alport mice treated with TGF-? 1 soluble receptor. The magnification is 2500 times.
도 13은 129Sv/J 앨포트 마우스에서 뇨 알부민에 대한 약물 처리의 효과를 설명한다. 약물 처리의 기간 동안, 뇨를 수집하여, 동결건조시키고, 0.5㎕ 등량을 폴리아크릴아미드 겔상에서 분별시켰다. 겔을 쿠마시 블루로 염색시켜 가시화하였다. 최초 2개의 레인은 주사하지 않은 대조였고, 다음 2개(Ⅰ군)는 FK506으로 주사하였으며, 세 번째 군(Ⅱ 군)은 가용성 TGF-β1 수용체로 주사하였다. 하부의 수자는 뇨 수집시에 마우스의 주령(주)을 나타낸다. C=대조; A= 앨포트.Figure 13 illustrates the effect of drug treatment on urinary albumin in 129Sv / J altxt mice. During the period of drug treatment, urine was collected, lyophilized, and fractionated on a polyacrylamide gel with 0.5 쨉 l equivalents. The gel was visualized by staining with Coomassie blue. The first two lanes were uninjected controls, the next two (Group I) were injected with FK506, and the third group (Group II) was injected with soluble TGF-β1 receptor. The lower digit represents the week of the mouse when collecting urine. C = contrast; A = Alport.
도 14는 이중 녹아웃 마우스에서 GBM 초미세구조에 대한 TGF-β1 저해제의 효과를 예시한다. 동물들을 처리하지 않거나, FK506 또는 TGF-β1 가용성 수용체로 처리하였다. 신피질을 에폭시에 포매시켜, 절단하고, 아세트산 우라닐 및 시트르산 납으로 염색하여, 투과 전자 현미경에 의해 분석하였다. A=주사하지 않은 대조; B=주사하지 않은 이중 녹아웃; C=FK506으로 처리한 이중 녹아웃; D=TGF-β1에 대한 가용성 수용체로 처리한 이중 녹아웃. 배율은 8000배이다.Figure 14 illustrates the effect of TGF-? 1 inhibitors on GBM microstructure in double knockout mice. Animals were either untreated or treated with FK506 or TGF- [beta] l soluble receptors. The renal cortex was embedded in epoxy, cut, stained with uranyl acetic acid and lead citrate, and analyzed by transmission electron microscopy. A = control without injection; B = double knockout without injection; Double knockout treated with C = FK506; D = double knockout treated with soluble receptor for TGF-? 1. The magnification is 8000 times.
도 15는 TGF-β1 저해제로 처리한 10주 된 이중 녹아웃 마우스에서 정상적인 사구체 구조의 예를 예시한다. TGF-β1 저해제로 처리한 마우스에서 약 25%의 사구체는 대조 동물에서의 사구체와 형태학적으로 구별되지 않았다. 동물들을 처리하지 않거나, FK506으로 처리하였다. 신피질을 에폭시에 포매시켜, 절단하고, 아세트산 우라닐 및 시트르산 납으로 염색하여, 투과 전자 현미경에 의해 분석하였다. A=주사하지 않은 대조; B=FK506으로 처리한 이중 녹아웃.Figure 15 illustrates an example of normal glomerular structure in a 10 week old double knockout mouse treated with a TGF-? 1 inhibitor. About 25% of the glomeruli in the mice treated with the TGF-? 1 inhibitor were not morphologically distinguishable from the glomeruli in the control animals. Animals were either not treated or treated with FK506. The renal cortex was embedded in epoxy, cut, stained with uranyl acetic acid and lead citrate, and analyzed by transmission electron microscopy. A = control without injection; B = double knockout treated with FK506.
도 16은 이중 녹아웃 마우스에서 뇨 알부민에 대한 약물 처리의 효과를 설명한다. 약물 치료의 기간 동안, 뇨를 수집하여, 동결건조시키고, 0.5㎕ 등량을 폴리아크릴아미드 겔상에서 분별시켰다. 겔을 쿠마시 블루로 염색시켜 가시화하였다. 뇨 수집시에 마우스의 주령(주)을 도면 하부에 표시한다. A=주사하지 않은 이중 녹아웃; B=가용성 수용체로 주사한 이중 녹아웃; C=FK506로 주사한 대조 마우스; D=FK506으로 주사한 이중 녹아웃.Figure 16 illustrates the effect of drug treatment on urinary albumin in a double knockout mouse. During the course of drug treatment, urine was collected, lyophilized, and fractionated on a polyacrylamide gel with 0.5 쨉 l equivalents. The gel was visualized by staining with Coomassie blue. At the time of collection of urine, the mouse's state (note) is displayed on the lower part of the drawing. A = double knockout without injection; B = double knockout injected with soluble receptor; Control mice injected with C = FK506; D = double knockout injected with FK506.
도 17은 앨포트 대 이중 녹아웃 마우스의 사구체의 주사 전자 현미경사진이다. 7주 된 마우스의 신피질을 동결 건조하여, 파쇄시키고, 아세트산 우라닐 및 시트르산 납으로 염색하고, 확인된 사구체를 노출시켜 주사 전자 현미경을 사용하여 사진촬영하였다. A=대조; B=앨포트; C=이중 녹아웃.17 is a scanning electron micrograph of the glomeruli of the Alport vs. double knockout mouse. Seven week old mice were lyophilized, lysed, stained with uranyl acetic acid and lead citrate, exposed glomeruli and photographed using scanning electron microscopy. A = contrast; B = Alport; C = double knockout.
도 18은 정상 및 돌연변이 마우스에서 라미닌 α2 사슬에 대한 이중 면역형광 염색을 도시한다. 사구체 기저막을 엔탁틴 특이적 1차 항체 및 FITC 콘쥬게이션된 2차 항체를 사용하여 녹색으로 염색하였다. 라미닌 α2 사슬을 텍사스 레드 (Texas red)콘쥬게이션된 2차 항체를 사용하여 적색으로 염색하였다. 모세혈관 루프에서 공동국재화는 황색 염색을 초래한다. Ⅰ군은 7주 된 마우스의 사구체이다; A=주사하지 않은 대조; B=가용성 수용체로 주사한 앨포트; D=부사하지 않은 이중 녹아웃. Ⅱ군은 2주 된 마우스의 사구체이다; A=대조; B=앨포트. 화살표는 사구체의 모세혈관 루프에서 면역염색을 나타낸다.Figure 18 shows dual immunofluorescence staining for laminin [alpha] 2 chains in normal and mutant mice. Glomerular basement membrane was stained with green using an enstatine-specific primary antibody and a FITC-conjugated secondary antibody. The laminin alpha 2 chain was stained red using a Texas red conjugated secondary antibody. In the capillary loop, co-localization results in yellow staining. Group I is the glomeruli of 7-week-old mice; A = control without injection; B = ALPOT injected with soluble receptor; D = double knockout without adverb. Group II is the glomeruli of 2-week-old mice; A = contrast; B = ALPTOT. The arrow shows immunostaining in the capillary loop of the glomeruli.
도 19는 2주 된 정상 대 앨포트 마우스의 GBM의 투과 전자 현미경사진이다. 신피질을 에폭시에 포매시켜 절단시키고, 아세트산 우라닐 및 시트르산 납으로 염색하여 투과 전자 현미경으로 분석하였다. A=대조; B=앨포트.19 is a transmission electron micrograph of GBM of a 2 week old normal versus altem mouse. The renal cortex was embedded in epoxy and cut, stained with uranyl acetic acid and lead citrate and analyzed by transmission electron microscopy. A = contrast; B = ALPTOT.
도 20은 정상 대 앨포트 마우스에서 세포 매트릭스 분자 또는 메탈로프로테이나제 저해제를 엔코딩하는 RNA의 신장에서의 발현에 대한 TGF-β1 저해제의 효과를 설명한다. FK506(Ⅰ)으로 처리 또는 미처리한(NI) 7주 된 정상(C) 또는 앨포트(A) 마우스의 신장으로부터 총 RNA를 분리하였다. RNA를 변성 아가로즈 겔상에서 분별시키고, 세포외 매트릭스 분자 또는 메탈로프로테이나제 저해제를 엔코딩하는 방사성표지된 프로브와 하이브리드화시킴으로써 분석하였다. 하이브리드화 후에, 막을 세척하고 X-선 필름에 노출시켰다. 사용된 프로브를 패널의 왼쪽에 지정하였다. α1(Ⅳ)=콜라겐 α1(Ⅳ); fn=피브로넥틴; ent=엔탁틴; Timp2=메탈로프로테이나제 저해제 Timp-2; Timp3=메탈로프로테이나제 저해제 Timp-3.Figure 20 illustrates the effect of TGF- [beta] l inhibitors on the expression in the kidney of RNA encoding cell matrix molecules or metalloproteinase inhibitors in normal versus altitudinal mice. Total RNA was isolated from the kidneys of 7 week old normal (C) or Alport (A) mice treated or not treated with FK506 (I) (NI). RNA was fractionated on a denaturing agarose gel and analyzed by hybridization with a radiolabeled probe encoding an extracellular matrix molecule or a metalloproteinase inhibitor. After hybridization, the membrane was washed and exposed to X-ray film. The probe used was specified on the left side of the panel. ? 1 (IV) = collagen? 1 (IV); fn = fibronectin; ent = enstatin; Timp2 = metalloproteinase inhibitor Timp-2; Timp3 = metalloproteinase inhibitor Timp-3.
도 21은 정상 대 이중 녹아웃 마우스에서 세포 매트릭스 분자 또는 메탈로프로테이나제 저해제를 엔코딩하는 RNA의 신장에서의 발현에 대한 TGF-β1 저해제의 효과를 설명한다. FK506(Ⅰ)으로 처리, TGF-β1 가용성 수용체(Ⅱ)로 처리, 또는 미처리한(NI) 10주된 정상(C) 또는 이중 녹아웃(Dko) 마우스의 신장으로부터 총 RNA를 분리하였다. RNA를 변성 아가로즈 겔상에서 분별시키고, 세포외 매트릭스 분자 또는 메탈로프로테이나제 저해제를 엔코딩하는 방사성표지된 프로브와 하이브리드화시킴으로써 분석하였다. 하이브리드화 후에, 막을 세척하고 X-선 필름에 노출시켰다. 사용된 프로브를 패널의 왼쪽에 지정하였다. α1(Ⅳ)=콜라겐 α1(Ⅳ); fn=피브로넥틴; ent=엔탁틴; Timp2=메탈로프로테이나제 저해제 Timp-2; Timp3=메탈로프로테이나제 저해제 Timp-3.Figure 21 illustrates the effect of TGF- [beta] 1 inhibitors on the expression of RNA in the kidney of a cell that encodes a cell matrix molecule or metalloproteinase inhibitor in normal versus double knockout mice. Total RNA was isolated from kidneys treated with FK506 (I), treated with TGF-? 1 soluble receptor (II) or from untreated (NI) 10 week normal (C) or double knockout (Dko) mice. RNA was fractionated on a denaturing agarose gel and analyzed by hybridization with a radiolabeled probe encoding an extracellular matrix molecule or a metalloproteinase inhibitor. After hybridization, the membrane was washed and exposed to X-ray film. The probe used was specified on the left side of the panel. ? 1 (IV) = collagen? 1 (IV); fn = fibronectin; ent = enstatin; Timp2 = metalloproteinase inhibitor Timp-2; Timp3 = metalloproteinase inhibitor Timp-3.
도 22는 TGF-β1 저해제를 사용한 이중 녹아웃 마우스의 관상간극에서 매트릭스 축적의 저해를 예시한다. 10주 된 정상 또는 이중 녹아웃 마우스의 신장을 플라스틱에 포매시키고, 1μM 절편을 존스 실버 메탄아민(Jones silver methenamine) 방법을 사용하여 염색하였다. A=정상 신장; B=이중 녹아웃 신장, 주사하지 않음; C=FK506으로 처리한 이중 녹아웃 신장; D=TGF-β1 가용성 수용체로 처리한 이중 녹아웃 신장.Figure 22 illustrates inhibition of matrix accumulation in the tubular gap of a double knockout mouse using a TGF-? 1 inhibitor. The kidneys of 10-week-old normal or double knockout mice were embedded in plastic and 1 μM sections were stained using the Jones silver methaneamine method. A = normal height; B = double knockout kidney, not injected; Double knockout kidney treated with C = FK506; D = Double knockout kidney treated with TGF-? 1 soluble receptor.
도 23은 TGF-β1 저해제를 사용한 이중 녹아웃 마우스의 관상간극에서 콜라겐 타입 Ⅳ 축적의 저해를 예시한다. 10주 된 정상 또는 이중 녹아웃 마우스의 신장을 플라스틱에 포매시키고, 1μM 절편을 콜라겐 타입 Ⅰ에 특이적인 항체를 사용하여 면역염색시켰다. 염색은 벡터 라보라토리즈(Vector laboratories)로부터 구입한 스트렙트아비딘 AEC 염색 키트를 사용하여 현색시켰다. A=정상 신장; B=이중 녹아웃 신장, 주사하지 않음; C=FK506으로 처리한 이중 녹아웃 신장; D=TGF-β1 가용성 수용체로 처리한 이중 녹아웃 신장.Figure 23 illustrates the inhibition of collagen type IV accumulation in the tubular gap of a double knockout mouse using a TGF-? 1 inhibitor. The kidneys of 10-week-old normal or double knockout mice were embedded in plastic and 1 μM sections were immunostained using antibodies specific for collagen type I. Dyeing was performed using strep avidin AEC staining kit purchased from Vector laboratories. A = normal height; B = double knockout kidney, not injected; Double knockout kidney treated with C = FK506; D = Double knockout kidney treated with TGF-? 1 soluble receptor.
도 24는 TGF-β1 저해제를 사용한 이중 녹아웃 마우스의 관상간극에서 피브로넥틴 축적의 저해를 예시한다. 10주 된 정상 또는 이중 녹아웃 마우스의 신장을 플라스틱에 포매시키고, 1μM 절편을 피브로넥틴에 특이적인 항체를 사용하여 면역염색시켰다. 염색은 벡터 라보라토리즈(Vector laboratories)로부터 구입한 스트렙트아비딘 AEC 염색 키트를 사용하여 현색시켰다. A=정상 신장; B=이중 녹아웃 신장, 주사하지 않음; C=FK506으로 처리한 이중 녹아웃 신장; D=TGF-β1 가용성 수용체로 처리한 이중 녹아웃 신장.Figure 24 illustrates inhibition of fibronectin accumulation in the tubular gap of a double knockout mouse using a TGF-? 1 inhibitor. The kidneys of 10-week old normal or double knockout mice were embedded in plastic and 1 μM sections were immunostained using antibodies specific for fibronectin. Dyeing was performed using strep avidin AEC staining kit purchased from Vector laboratories. A = normal height; B = double knockout kidney, not injected; Double knockout kidney treated with C = FK506; D = Double knockout kidney treated with TGF-? 1 soluble receptor.
발명의 분야Field of invention
본 발명은 사구체신염 및/또는 섬유증을 특징으로 하는 신장 질환의 분야에 관한 것이다. 특히, 본 발명은 신장 질환에서 α1β1 인테그린 수용체 저해제의 용도에 관한 것이다. 또한, 본 발명은 신장 질환에서 TGF-β1 저해제와 병용하여 α1β1 인테그린 수용체 저해제를 사용하는 방법에 관한 것이다.The present invention relates to the field of renal diseases characterized by glomerulonephritis and / or fibrosis. In particular, the present invention relates to the use of an alpha 1 beta 1 integrin receptor inhibitor in renal disease. The present invention also relates to a method of using an? 1? 1 integrin receptor inhibitor in combination with a TGF-? 1 inhibitor in renal disease.
바람직한 구현예의 상세한 설명DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
본 발명은 사구체신염 및 신장 섬유증과 같은 질병 상태의 발병 및/또는 진행을 실질적으로 지연시킬 수 있는 방법인, 신장 질환의 메카니즘을 공격하는 치료 방법을 제공한다. 본 발명의 방법은 심지어 이러한 질병상태를 역전시킬 수 있는 것으로 생각된다. 특히, 본 발명은 메산쥼 증식성 사구체신염, 막 증식성 사구체신염, 반월형 사구체신염, 당뇨병성 신질환, 및 신장 간질성 섬유증의 발생과 같이, 신장 사구체에서 사구체신염 및 신장 섬유증이 발병할 증가된 위험성의 존재와 관련된 신장 질환의 치료 방법을 제공한다. 사구체신염은 GBM에서 비후화, 박화, 및/또는 분열하는 비규칙성과 전형적으로 관련된 사구체 손상을 포함한다. 이는 관상간극 섬유증의 공통적인 경로가 될 수 있다. 이들 상태는 관상간극(tubulointerstitium)에 근섬유아세포의 출현 및 매트릭스의 축적(콜라겐 타입 I, 피브로넥틴, 라미닌, 및 콜라겐 타입 Ⅳ를 포함)을 전형적인 특징으로 한다. 본 발명의 방법에서 사용된 치료제의 유효성은 이들 특징중 하나 이상을 평가함으로써 결정될 수 있다.The present invention provides a therapeutic method for attacking the mechanism of renal disease, which is a method that can substantially delay the onset and / or progression of a disease state such as glomerulonephritis and renal fibrosis. It is believed that the methods of the present invention are capable of reversing even such disease states. In particular, the present invention provides an increased risk of developing glomerular nephritis and renal fibrosis in renal glomeruli, such as the development of mesangial proliferative glomerulonephritis, proliferative glomerulonephritis, meniscus glomerulonephritis, diabetic renal disease, and interstitial fibrosis Lt; RTI ID = 0.0 > a < / RTI > Glomerulonephritis involves irregularities in the GBM such as hypertrophy, thinning, and / or fissuring, and typically associated glomerular damage. This can be a common pathway for tubular fibrillation. These conditions are typical of the appearance of myoblast cells in the tubulointerstitium and accumulation of the matrix (including collagen type I, fibronectin, laminin, and collagen type IV). The effectiveness of the therapeutic agents used in the methods of the present invention can be determined by evaluating one or more of these characteristics.
또한, 본 발명은 특히 신장 사구체 및 관상 간극내에 일반적으로 세포외 매트릭스의 축적의 존재, 또는 발병할 증가된 위험성의 존재와 관련된 신장 신장 질환을 가진 환자를 치료하기 위한 약물을 스크리닝하는 방법을 연구하기 위한 마우스 모델을 제공한다. 따라서, 한 구현예에서, 본 발명은 앨포트 증후군에 대한 마우스 모델을 제공한다. 이 마우스 모델은 불활성화된 콜라겐(타입 Ⅳ) 분자와 조합된 불활성화된 α1β1 인테그린 수용체를 포함한다. 한 바람직한 구현예에서, 콜라겐(타입 Ⅳ) 분자는 콜라겐(타입 Ⅳ)의 α3 아단위의 발현을 파괴함으로써 불활성화된다. 결과적으로 마우스는 GBM에 α3(Ⅳ), α4(Ⅳ), 또는 α5(Ⅳ) 사슬을 혼입시키지 않는다.The present invention also relates to a method of screening for a medicament for treating a patient with renal kidney disease, particularly associated with the presence of an accumulation of extracellular matrices within the renal glomeruli and the tubular gaps, or the presence of an increased risk of developing To provide a mouse model. Thus, in one embodiment, the invention provides a mouse model for Alport syndrome. This mouse model contains an inactivated α1β1 integrin receptor in combination with an inactivated collagen (type IV) molecule. In one preferred embodiment, the collagen (type IV) molecule is inactivated by destroying the expression of the a3 subunit of collagen (type IV). As a result, mice do not incorporate α3 (Ⅳ), α4 (Ⅳ), or α5 (Ⅳ) chains in GBM.
이 마우스 모델은 초기 질환이, 기저막 비후, 박화, 분열, 및 족세포 푸트 프로세스의 소멸, 또는 이들의 조합을 특징으로 하는 사구체 기저막 손상과 관련된 메산쥼 매트릭스의 확장 및 메산쥼 세포 증식을 특징으로 하는 앨포트 증후군, 인슐린 의존성 당뇨병, 및 기타 신장 질환에서 발생되는 신장 기능부전의 치료제를 시험하는 방법에서 사용될 수 있다.This mouse model is characterized by an expansion of the mesangial matrix and mesangial cell proliferation associated with glomerular basement membrane damage, characterized by early disease, basement membrane thickening, thinning, cleavage, and disappearance of the podocyte foot process, or a combination thereof Alport syndrome, insulin-dependent diabetes mellitus, and other renal diseases.
한 바람직한 구현예에서, 본 발명은 사구체 질환의 진행에서 사구체신염 및/또는 섬유증(관상간극에서 라미닌, 피브로넥틴, 콜라겐 타입 Ⅰ, 및 콜라겐 타입 Ⅳ를 포함한 세포외 매트릭스의 축적 및 근섬유아세포의 출현에 의해 증명)의 발병(뇨중 알부민의 출현으로 측정) 또는 진행(뇨중 혈청 알부민의 수준이 증가하는 속도로 측정)을 지연시키거나 심지어 역전(뇨중 혈청 알부민의 수준이 증가하는 속도로 측정)시키는 방법으로서 α1β1 인테그린 수용체의 작용을 차단 또는 불활성화시키는 저해제를 제공한다. 하기에서 보다 상세히 설명되는 합성 또는 천연의 다양한 약물이 사용될 수 있다.In one preferred embodiment, the present invention provides a method of treating glomerulonephritis in a patient suffering from glomerulonephritis and / or fibrosis (accumulation of extracellular matrices including laminin, fibronectin, collagen type I, and collagen type IV in the tubular space, (As measured by the appearance of urinary albumin) or by progression (as measured by the rate at which the level of serum albumin in the urine increases) or even by reversal (measured at the rate of increase in urine serum albumin level) An inhibitor that blocks or inactivates the action of the integrin receptor. A variety of synthetic or natural drugs, which are described in more detail below, may be used.
또다른 구현예에서, 본 발명은 앨포트 신장 질환 발병 및 기타 이러한 신장 질환에서 TGF-β1의 역할에 관한 것이다. 단백뇨의 발증 후에 TGF-β1에 대한 mRNA 수준의 현저한 증가가 본원에서 사용된 마우스 모델에서 관찰된다. 원위치 하이브리드화는 단백뇨의 발증 이전에 TGF-β1에 대한 mRNA를 거의 또는 전혀 생성하지 않는 족세포가 단백뇨의 발증 이후 말기 신장 질환까지 TGF-β1에 대한 mRNA를 대량 발현시킴을 나타낸다. 피브로넥틴, COL4A1 및 COL4A2, 및 엔탁틴을 엔코딩하는 mRNA의 활성화가 거의 동시에 관찰된다. 따라서, TGF-β1의 수준을 감소시키는 방법은 사구체신염 및/또는 섬유증과 같은 신장 질환을 치료하기 위한 다른 메카니즘이 된다. TGF-β1 활성을 저해시키는 효과는 뇨중 알부민의 출현 시점(발병) 및 뇨중 알부민의 증가 속도 및/또는 근섬유아세포의 출현(관상간극에서) 및/또는 GBM 및 관상간극에 세포외 매트릭스 분자의 축적을 결정함으로써 측정될 수 있다.In another embodiment, the invention relates to the role of TGF-? 1 in the onset of Alport's kidney disease and other such kidney diseases. Significant increases in mRNA levels for TGF- [beta] l after the onset of proteinuria are observed in the mouse models used herein. In situ hybridization indicates that podocytes that produce little or no mRNA for TGF-β1 before proteinuria manifest large amounts of mRNA for TGF-β1 from the onset of proteinuria to end-stage renal disease. Activation of mRNA encoding fibronectin, COL4A1 and COL4A2, and enstatin is observed almost simultaneously. Thus, a method of reducing the level of TGF-? 1 is another mechanism for treating renal diseases such as glomerulonephritis and / or fibrosis. The effect of inhibiting TGF-? 1 activity can be assessed by measuring the time of onset (onset) of urinary albumin and the rate of increase of urinary albumin and / or the appearance of myoblasts (in the tubular gap) and / or the accumulation of extracellular matrix molecules in the GBM and tubular gaps Can be measured.
다른 구현예에서, α1 인테그린 결핍 앨포트 마우스에서 TGF-β1 저해제의 사용을 통하여, 본 발명은 사구체신염의 발병 및 진행의 지연 및/또는 섬유증의 방지하는데 있어서 α1β1 인테그린 저해제 및 TGF-β1 저해제의 병용 치료의 상승작용에 관한 것이다.In another embodiment, through the use of a TGF-? 1 inhibitor in? 1 integrin-deficient allotropic mice, the invention provides a combination of an? 1? 1 integrin inhibitor and a TGF-? 1 inhibitor in preventing the onset and progression of glomerulonephritis and / It is about synergy of treatment.
마우스 모델Mouse model
GBM에서 비후, 박화, 또는 분열 불규칙성과 관련되며 관상간극에서 매트릭스의 축적(콜라겐 타입 Ⅰ, 피브로넥틴, 라미닌, 및 콜라겐 타입 Ⅳ를 포함) 및 근섬유아세포의 출현을 특징으로 하는 관상간극 섬유증의 공통적인 경로인 진행성 사구체 손상과 관련된 앨포트 증후군 및 기타 질환을 가진 환자를 관리하는 중요한 측면은 질병 진행의 원인 및/또는 메카니즘을 결정하는 것이다. 예컨대, 콜라겐 α3(Ⅳ) 또는 α4(Ⅳ) 유전자의 돌연변이 결과 상염색체 열성형인 앨포트 증후군이 초래되고, α5(Ⅳ) 유전자의 돌연변이 결과 X-연관형인 질환이 초래되지만, 이러한 돌연변이 자체는 진행성 신장 질환을 "초래"하지 않는다. 대신, 콜라겐 α3(Ⅳ), α4(Ⅳ) 또는 α5(Ⅳ)의 부재는 α1(Ⅳ) 및 α2(Ⅳ) 콜라겐 사슬을 포함하는 태아형 GBM이 지속되는 결과가 되는 것으로 나타난다. 이러한 태아형 GBM은 사람의 생애의 첫 10년 정도 동안(또는 마우스 모델에서는 약 첫 3주)은 적당한 사구체 필터이다. 그러나, 이 시기 이후에, 태아형 GBM은 유효하게 기능하지 않는 것으로 나타난다. 예컨대, 앨포트 증후군을 가진 한 환자에서, 앨포트 증후군을 가진 9세 환자의 GBM 초미세구조 연구 결과 비교적 정상적인 초미세구조인 것으로 나타났다[참조: Cangiotti et al., Nephrol. Dial. Transplant., 11:1829-1834, 1996]. 그러나, 18세에서는 동일한 환자의 GBM 초미세구조는 진전된 앨포트 사구체신염을 나냈다.Common pathways of tubular fibrosis characterized by the appearance of matrix accumulation (including collagen type I, fibronectin, laminin, and collagen type IV) in tubular gaps and fibroblast cells associated with thickening, thinning, or cleavage irregularities in GBM An important aspect of managing patients with Alport syndrome and other diseases associated with progressive glomerular injury is to determine the cause and / or mechanism of disease progression. For example, the mutation of the collagen α3 (Ⅳ) or α4 (Ⅳ) gene results in Alport syndrome, which is a chromosomal thermoform, and mutation of the α5 (Ⅳ) gene results in X-linked disease, Do not " cause " kidney disease. Instead, the absence of collagen α3 (Ⅳ), α4 (Ⅳ) or α5 (Ⅳ) appears to be the result of sustained embryonic GBM containing α1 (Ⅳ) and α2 (Ⅳ) collagen chains. These fetal GBMs are suitable glomerular filters for the first 10 years of a person's life (or about the first three weeks in a mouse model). However, after this period, the fetal GBM appears to not function effectively. For example, in one patient with Alport syndrome, GBM ultrastructure studies of nine-year-old patients with Alport syndrome were found to be relatively normal hyperfine structures (Cangiotti et al., Nephrol. Dial. Transplant., 11: 1829-1834, 1996]. However, at age 18, the GBM hyperfine structure of the same patient developed advanced Alf glomerulonephritis.
앨포트 증후군에서, 사람의 기저막은 기저막의 통합성(integrity)이 뇨중 알부민의 점진적인 증가로 모니터링될 수 있는 경우, 5 내지 10세까지는 비교적 정상이다. 생검 연구 결과 기저막 초미세구조가 단백뇨 이전 앨포트 환자에서 정상임이 확인되었다. 초미세구조적으로, GBM 질환은 GBM의 불규칙적인 비후 및 박화에 의해 증명된다. 막의 분열은 단백뇨와 함께 관찰되는 현미혈뇨(즉, 소수의 적혈구가 뇨중에서 검출가능)의 원인인 것으로 생각된다.In Alport syndrome, a human basement membrane is relatively normal up to 5 to 10 years of age when the integrity of the basement membrane can be monitored by a gradual increase in urinary albumin. Biopsy studies showed that the basal membrane microstructure was normal in pre-proteinuria patients. Ultrastructurally, GBM disease is evidenced by irregular thickening and thinning of GBM. Membrane cleavage is thought to be the cause of brown rice hematuria (that is, a small number of red blood cells can be detected in urine) observed with proteinuria.
앨포트 신장 질환 발병 및 진행의 메카니즘에 관하여는 알려진 바가 거의 없다; 그러나, GBM 성분의 축적 및 GBM의 희박화는 단백분해에 대하여 막의 증가된 감수성, 및/또는 정상적인 조절 경로의 변화에 기인한 매트릭스 분자의 증가된 합성때문일 수 있는 것으로 추측되어 왔다.There is little known about the mechanism of Alport renal disease onset and progression; However, it has been speculated that the accumulation of GBM components and the dilution of GBM may be due to increased susceptibility of the membrane to proteolysis, and / or increased synthesis of matrix molecules due to changes in normal regulatory pathways.
따라서, 사람 표본의 연구에 내재하는 한계 때문에 앨포트 증후군에 대한 모델의 필요성이 있었다. 사람은 상기 질환의 진행에서 중증도의 범위를 나타내는데, 이는 아마 유전적인 배경의 차이 때문일 것이다. 질병 발병 및 진행의 분자적 특성을 언급하는 의미있는 연구들은 사람에서는 논리적으로 불가능하여, 앨포트 신장 질환 연구의 진전이 제한된다.Therefore, there was a need for a model for Alport syndrome due to inherent limitations in the study of human specimens. People show a range of severity in the progression of the disease, probably due to differences in genetic background. Significant studies addressing the molecular character of disease outbreaks and progression are logically impossible in humans, limiting the progress of Alport's kidney disease research.
상염색체성 앨포트 증후군에 대한 마우스 모델은 타입 Ⅳ 콜라겐 α3(Ⅳ) 사슬을 엔코딩하는 유전자의 목적하는 돌연변이유발에 의해 생산되었다[참조: Cosgrove et al., Genes Devel., 10:2981-2992, 1996]. 상기 동물 모델은 진행성 사구체신염을 발병하였다. GBM에서 초미세구조적 변화는 1주 주령에서 관찰되었다. 이러한 마우스는 본원에서 "앨포트" 마우스로 언급된다.A mouse model for autosomal allele syndrome was produced by the desired mutagenesis of the gene encoding the type IV collagen alpha 3 (IV) chain (see Cosgrove et al., Genes Devel., 10: 2981-2992, 1996]. The animal model developed progressive glomerulonephritis. Ultrastructural changes in GBM were observed at 1 week old. Such mice are referred to herein as " allport " mice.
또한, 마우스는 α1 인테그린 수용체 아단위를 엔코딩하는 유전자의 목적하는 돌연변이유발에 의해 생산되었다[참조: Gardner et al., Dev. Biol., 175:301-313, 1996]. 이 인테그린 아단위는 인테그린 β1 아단위와 이종이량체를 형성하여 생물학적 활성인 α1β1 인테그린 이종이량체를 형성하며, 이는 신장 사구체에서 메산쥼 세포의 표면에서 발견된다. 인테그린 α1β1 수용체는 메산쥼 매트릭스에서 발견되는 유일한 인테그린 수용체이며, 메산쥼 매트릭스에 배타적으로 국재화되어 있다. 섬유세포의 콜라겐 매트릭스와의 변화된 유착성 이외에, 녹아웃 마우스는 뚜렷한 표현형을 가지지 않는다. 마우스는 정상적으로 발육, 번식하며, 정상적인 수명으로 살아간다. α1β1 이종이량체 인테그린 수용체가 신장 사구체의 메산쥼 세포의 표면에서 확인된 유일한 인테그린 수용체이기 때문에, 이 수용체의 부재가 정상적인 신장 발육 및/또는 기능에 영향을 미치지 않는다는 것은 놀라운 것이었다. 이는 그것이 필요하지 않거나 많은 경로들이 그의 부재를 보상할 수 있음을 시사한다.In addition, mice were produced by the desired mutagenesis of genes encoding alpha integrin receptor subunits (Gardner et al., Dev. Biol., 175: 301-313, 1996). This integrin unit forms a heterodimer with the integrin β1 subunit to form a biologically active α1β1 integrin heterodimer, which is found on the surface of mesangial cells in the kidney glomeruli. Integrin α1β1 receptors are the only integrin receptors found in the mesangial matrix and are exclusively localized in the mesangial matrix. In addition to the altered adhesion with the collagen matrix of fibroblasts, knockout mice do not have a distinct phenotype. Mice normally develop, reproduce, and live at normal life. It was surprising that the absence of this receptor did not affect normal kidney development and / or function, since the α1β1 heterodimeric integrin receptor is the only integrin receptor identified on the surface of mesangial cells of the kidney glomeruli. This suggests that it is not needed or that many paths can compensate for its absence.
본 발명은 새로운 이중 녹아웃(즉, 이중 돌연변이) 마우스 모델을 제공한다. 이것은 인테그린 α1 수용체 아단위 유전자 및 콜라겐 α3(Ⅳ) 유전자 모두가 결핍된 돌연변이체를 생성하기 위하여 α1 녹아웃 마우스종을 콜라겐 α3(Ⅳ) 녹아웃 종(앨포트 마우스)과 이종교배함시킴으로써 개발되었다. α1β1 인테그린 수용체의 부재가 정상적인 신장 발육 및 기능에서 명백하게 역할을 하지 않을지라도, 메산쥼 매트릭스는 메탈로프로테이나제 및 예컨대 TGF-β1과 같은 사이토카인에 대한 합성 부위이고 앨포트 사구체신염의 초기는 메산쥼 세포 증식 및 메산쥼 매트릭스의 확장과 관련되므로, α1β1 인테그린 수용체가 신장 발병에서 특이적인 역할을 하는 것으로 생각된다. 사실, 인테그린 α1 콜라겐 α3(Ⅳ) 이중 녹아웃의 연구는 상당히 특이하고 중요하다. 하기 논의는 본 발명의 이중 녹아웃 마우스의 많은 특성을 기술한다.The present invention provides a novel dual knockout (i.e., dual mutant) mouse model. This was developed by crossing α1 knockout mouse species with collagen α3 (Ⅳ) knockout species (Alport mice) to produce mutants lacking both the integrin α1 receptor subunit gene and the collagen α3 (Ⅳ) gene. Although the absence of the? 1? 1 integrin receptor does not play a clear role in normal renal development and function, the mesaclin matrix is a synthetic site for metalloproteinases and cytokines such as TGF-beta 1, It is thought that the α1β1 integrin receptor plays a specific role in the development of the kidney because it is involved in cell proliferation and expansion of the mesangial matrix. In fact, the study of integrin α1 collagen α3 (IV) double knockout is quite unique and important. The following discussion describes many of the characteristics of the double knockout mice of the present invention.
신장 필터의 통합성의 바람직한 총괄 평가는 단백뇨(즉, 뇨중의 과량의 혈청 단백의 존재)이다. 도 1에 예시된 바와 같이, 이중 녹아웃에서는 단백뇨의 발증은 1주 이상까지 지연되었고, 앨포트(즉, 콜라겐 α3(Ⅳ) 유전자 결핍이지만, α1 인테그린 아단위 유전자를 포함)이었던 동복자에서 약 6주 내지 약 6.5주인 것에 대하여 약 9주 내지 약 9.5주에서 피크를 나타냈다. 단백뇨(즉, 뇨중 혈청 알부민의 존재)의 발증 및 속도는 본 발명의 방법의 유효성을 평가하는 우수한 척도이다. 혈청 알부민 수준은 겔 전기영동 및 쿠마시 블루 염색(뇨 1㎕의 등량을 주행시킴) 또는 시판용 스틱 시험에 의해 측정될 수 있다. 신장 질환에 의한 평균 사망 주령은 마우스가 129Sv/J 또는 129Sv 배경지 여부와 상관없이 앨포트 마우스에서 약 8 내지 9주이다(이러한 점을 확인하기 위하여 10마리 이상의 마우스를 각 유전적 배경에 대하여 말기까지 진행시켰다). 이중 녹아웃은 평균 약 15주 내지 약 16.5주의 주령까지 생존한다.A preferred overall assessment of the integrity of the kidney filter is proteinuria (i.e., the presence of excess serum protein in the urine). As illustrated in Fig. 1, in the double knockout, proteinuria was delayed by more than one week, and in the copland, which was alpha (i.e., collagen alpha 3 (IV) gene deficiency but including alpha 1 integrin unit gene) Lt; / RTI > weeks to about 9.5 weeks for the week to about 6.5 weeks. The onset and rate of proteinuria (i.e., the presence of serum albumin in urine) is a good measure of the effectiveness of the methods of the present invention. Serum albumin levels can be measured by gel electrophoresis and Coomassie blue staining (running an equal volume of urine) or by commercial stick testing. The average death toll due to renal disease is about 8 to 9 weeks in Alport mice, regardless of whether the mouse is 129Sv / J or 129Sv background (to confirm this point, 10 or more mice were used for each genetic background ). Double knockouts survive to an average of about 15 weeks to about 16.5 weeks of age.
따라서, α1β1 인테그린 수용체를 제거한 것은 앨포트 신장 질환 발병 및 진행에 현저한 영향을 미쳤다. 또한, α1β1 수용체가 없는 마우스는 시험된 기타 마우스에 비하여 개선된 사구체 기능을 나타냈다. α3(Ⅳ) 유전자를 발현하지 않고 α1 녹아웃 돌연변이에 대하여 이형접합성인 동물에서, 사구체 기능 및 질환 진행에서 중간정도의 개선이 있었고, 이는 α1 인테그린이 앨포트 신장 질환 진행에 용량 의존적인 효과를 가졌음을 예시한다(즉, α1 인테그린 발현을 절반으로 감소시킨 것은 앨포트 마우스 및 이중 녹아웃의 중간인 보호 효과를 제공하였다). α1 인테그린 돌연변이에 대하여 이형접합성인 앨포트 동물에서 이러한 중간 보호 효과는 α1β1 인테그린 수용체의 부분적 저해가 유용한 잇점을 제공한다는 것을 예시한다. 이것은 사람에서 사용될 경우 α1β1 인테그린 수용체의 저해를 포함하는 요법에 적용되므로 중요한 발견이다.Thus, the elimination of the? 1? 1 integrin receptor had a significant effect on the onset and progression of Alport's kidney disease. In addition, mice lacking the? 1? 1 receptor exhibited improved glomerular function compared to other mice tested. In animals that did not express the α3 (Ⅳ) gene and heterozygous for the α1 knockout mutation, there was moderate improvement in glomerular function and disease progression, suggesting that α1 integrin had a dose-dependent effect on ALP progression (I. E., Reducing alpha 1 integrin expression by half, provided a protective effect intermediate between altox mice and double knockout). This intermediate protective effect in Alport animals heterozygous for the alpha 1 integrin mutation demonstrates that partial inhibition of the alpha 1 beta 1 integrin receptor provides a useful advantage. This is an important finding because it applies to treatments involving inhibition of the? 1? 1 integrin receptor when used in humans.
투과 전자 현미경적 분석은 콜라겐 α3(Ⅳ) 및 α1 인테그린 대립유전자 양자 모두에서 정상, 콜라겐 α3(Ⅳ)에서 무효 및 α1 인테그린에서 정상(앨포트), 또는 콜라겐 α3(Ⅳ) 및 α1 인테그린 양자 모두에서 무효(이중 녹아웃)인 7주 된 마우스의 신장에 관하여 수행하였다. 이러한 시점은 이 주령의 앨포트 마우스가 말기에 근접하기 때문에 선택하였다. 도 2에 선택된 패널은 5개 이상의 상이한 사구체 영역을 나타낸다. 도 2에 예시된 바와 같이, 정상 마우스의 사구체 모세혈관 루프(도 2A)는 균일한 두께 및 규칙적인 푸트 프로세스(모든 3개의 패널에서 푸트 프로세스는 화살표로 표시된다)를 갖는 3층 기저막을 가졌다. 앨포트 마우스의 모세혈관 루프(도 2B)는 소상 비후화 및 박화를 갖는 희박화된 기저막(진전된 질환의 특징)을 나타내었다. 신장 여과 효율에 영향을 주는 것으로 생각되는 성질인 푸트 프로세스는 증대되고, 융합된 것으로 나타났다. 이중 녹아웃에서(도 2c), 기저막은 앨포트 마우스(도 2b)에서 보다 훨씬 덜 영향을 받았다. 기저막이 대조의 경우 보다 얇아진 반면, 휠씬 덜 희박화되었고, 족세포의 푸트 프로세스는 대개 정상인 것으로 나타났다. 앨포트 마우스에서, 약 40%의 사구체가 섬유성인 반면, 이중 돌연변이에서는 단지 5% 만이 섬유성이었다.Transmission electron microscopic analysis revealed that both in collagen α3 (Ⅳ) and α1 integrin allele, normal in both collagen α3 (Ⅳ) and normal (α1 integrin in integrin), or both collagen α3 (Ⅳ) and α1 integrin (Double knockout) of 7-week-old mice. This viewpoint was chosen because this week's altrip mouse was nearing its end. The panel selected in Figure 2 represents at least five different glomerular regions. As illustrated in Figure 2, the glomerular capillary loop of normal mice (Figure 2A) had a three-layer basement membrane with a uniform thickness and a regular foot process (the foot process in all three panels is indicated by arrows). The capillary loop of AlportMouse (FIG. 2B) showed a dilated basement membrane (characteristic of advanced disease) with phacoemulsification and thinning. The foot process, which is thought to have an effect on the kidney filtration efficiency, has been increased and fused. In the double knockout (Figure 2c), the basement membrane was much less affected than the Alport mouse (Figure 2b). While the basement membrane was thinner than the control, it was much less sparse and the foot process of the podocytes was usually normal. In Alport mice, about 40% of the glomeruli were fibrous, whereas only 5% of the double mutants were fibrous.
면역형광 분석은 도 2에서 사용한 동일한 동물로부터 얻은 동결된 신피질을 사용하여 수행하였다. 상기 조직을, 앨포트 신장 질환 진행의 작용으로 GBM에 축적되는 것으로 공지된 단백질에 특이적인 항체와 반응시켰다. 도 3의 결과는 콜라겐 COL4A1(α1(Ⅳ)) 및 4A2(α2(Ⅳ)) 사슬의 분포가 앨포트 사구체 및 이중 돌연변이체의 사구체 양자 모두에 대하여 동일하였음을 예시한다. 두 경우 모두에서, 모세혈관 루프(도 3의 모든 패널에서 화살표로 표시) 및 메산쥼 매트릭스는 양성이었다(도 3B, C). 라미닌-1은 대조에 비하여 앨포트 마우스의 GBM에 현저한 축적을 나타내었으나(도 3D를 도 3E와 비교), 이중 돌연변이체에서는(도 3F), 라미닌-1의 축적은 앨포트 사구체의 경우(도 3E)와 비교하여 현저하게 약화되었다. 피브로넥틴은 정상적으로 오직 메산쥼 매트릭스에만 국재화되어 있으나, 앨포트 마우스에서는 메산쥼 매트릭스 뿐만 아니라 GBM에 국재화되어 있는 것으로 발견되었다(도 3H). 놀랍게도, 이중 돌연변이체에서는 모세혈관 루프에 피브로넥틴의 축적은 관찰되지 않는다(도 3I). 이러한 결과는 매우 재현성이 있었다. 대조적으로, 헤파린 술페이트 프로테오글리칸에 대한 염색은 대조(도 3J) 또는 앨포트 마우스(도 3K)에 비하여 이중 돌연변이체(도 3L)의 메산쥼 매트릭스에서 약화된 염색을 나타냈다. GBM에 엔탁틴의 축적은 앨포트 및 이중 돌연변이체 샘플 모두에서 관찰되었고, 양자 사이에 식별가능한 차이는 없었다(도 3N 및 도 3O).Immunofluorescence analysis was performed using frozen neocortex obtained from the same animal used in Fig. The tissue was reacted with an antibody specific for a protein known to accumulate in GBM due to the action of Alport renal disease progression. The results in FIG. 3 illustrate that the distribution of the collagen COL4A1 (alpha 1 (IV)) and 4A2 (alpha 2 (IV)) chains was the same for both albop and glomerulonephritis glomeruli. In both cases, the capillary loop (indicated by arrows in all panels in FIG. 3) and the mesaclin matrix were positive (FIG. 3B, C). Laminin-1 showed a significant accumulation in the GBM of the altimouse compared to the control (Fig. 3D compared with Fig. 3E), whereas in the double mutant (Fig. 3F), accumulation of laminin- 3E). ≪ / RTI > Fibronectin was normally localized only in the mesangial matrix, but it was found in Albermouth that it was localized to the GBM as well as the mesangial matrix (Fig. 3H). Surprisingly, accumulation of fibronectin in the capillary loop was not observed in the double mutants (Fig. 3I). These results were very reproducible. In contrast, staining for heparin sulfate proteoglycans showed weakened staining in the mesaclin matrix of the duplex mutant (Fig. 3L) compared to the control (Fig. 3J) or altrip mouse (Fig. 3K). The accumulation of enstatin in GBM was observed in both the alport and the double mutant samples, with no discernible difference between them (Fig. 3N and Fig. 3O).
겸하여, 이들 데이터는 이중 돌연변이체에서 α1 무효 돌연변이는 앨포트 신장 질환 진행의 지연을 초래함을 예시한다. 이것은 생리학적 수준(도 1에 도시된 바와 같이 단백뇨의 지연된 발증) 및 초미세구조적 수준(도 2에 도시된 바와 같이 감소된 GBM 손상 및 푸트 프로세스 소멸) 모두에서 명백하다. 도 3에 제공된 면역형광 연구는 α1β1 인테그린 수용체의 제거가 GBM 및 메산쥼 매트릭스 양자 모두에서 세포외 매트릭스 성분의 축적에 특이적인 변화를 초래함을 예시한다. 따라서, 본 발명은 신장 세포 표면상에 α1β1 인테그린 수용체 결합 부위가 차단되는 것을 특징으로 하는 치료 방법을 포함한다. 이러한 치료 방법은 하기에서 보다 상세히 기술된다.Together, these data illustrate that the α1 null mutation in a double mutant results in a delay in Alport's renal disease progression. This is evident in both the physiological level (delayed onset of proteinuria as shown in Fig. 1) and super-microstructural level (reduced GBM damage and foot process disappearance as shown in Fig. 2). The immunofluorescence studies provided in Figure 3 illustrate that the elimination of the [alpha] 1 [beta] 1 integrin receptor results in a specific change in the accumulation of extracellular matrix components in both the GBM and the mesogenic matrix. Accordingly, the present invention includes a therapeutic method characterized in that the? 1? 1 integrin receptor binding site is blocked on the kidney cell surface. These methods of treatment are described in more detail below.
또한, 도 9는 사이토카인 TGF-β1이 앨포트 마우스에서 유도되는 반면, α1인테그린 돌연변이를 추가로 잠복하는 앨포트 마우스에서는 유도되지 않음을 나타낸다. 따라서, α1β1 인테그린의 부재하에서, 사구체 기저막에서 매트릭스의 축적의 감소에 대한 원인이 되는 TGF-β1 유도는 관찰되지 않으므로, 신장 질환이 진행하는 속도가 현저히 감소한다. 신장 질환에서 TGF-β1의 이러한 역할은 하기 섹션에서 보다 상세히 논의된다.Figure 9 also shows that cytokine TGF- [beta] l is induced in Alport mouse, whereas alpha 1 integrin mutation is not induced in further latent albmouth mice. Thus, in the absence of? 1? 1 integrin, the rate of progression of renal disease is significantly reduced since no TGF-β1 induction, which is responsible for the diminished accumulation of the matrix in the glomerular basement membrane, is observed. This role of TGF-? 1 in renal disease is discussed in more detail in the following section.
TGF-β1의 역할Role of TGF-β1
본원의 데이터는 TGF-β1이 본원에서 사용된 마우스 모델의 특정 사구체 세포 유형(족세포)에서 유도됨을 명백히 증명한다. TGF-β1 mRNA의 유도는 상기 모델에서 진행성 사구체신염의 작용으로 사구체 기저막에 축적되는 것으로 공지된 매트릭스 분자(예컨대, 라미닌, 피브로넥틴, 엔탁틴, 및 타입 Ⅳ 콜라겐)를 엔코딩하는 유전자의 유도에 의해 반영된다. 또한, 본원의 데이터는 TGF-β1이 사람의 앨포트 신피질에서 유도됨을 나타낸다. 이것은 사람의 앨포트 신장에서 일어나는 것을 모방하는 능력에서 동물 모델의 타당성을 지지한다.The data herein clearly demonstrate that TGF-? 1 is derived from a particular glomerular cell type (podocyte) of the mouse model used herein. The induction of TGF-? 1 mRNA is reflected by the induction of genes encoding known matrix molecules (e.g., laminin, fibronectin, entanthin, and type IV collagen) that accumulate in the glomerular basement membrane by the action of progressive glomerulonephritis in the model do. In addition, the data herein indicate that TGF-β1 is induced in human alkaline cortex. This supports the validity of animal models in the ability to mimic what happens in a person's albatross kidney.
TGF-β1의 역할을 증명하기 위하여, 총 RNA를 앨포트 동물의 신장으로부터 분리시켰고 α1(Ⅳ) 및 α2(Ⅳ) 콜라겐 사슬, 엔탁틴, 라미닌 β1 또는 β2 사슬, 피브로넥틴, 또는 TGF-β1에 특이적인 방사성표지된 프로브로 프로빙시켰다. 도 4의 결과는 라미닌 β1을 제외한 이러한 모든 단백질에 대한 mRNA는 앨포트 마우스 모델에서 단백뇨의 발증 후에 유도됨을 예시한다. 이러한 동일한 시간경과에 대한 노턴 블롯을 라미닌 α1, 라미닌 β2, 라미닌 γ1, 헤파린 술페이트 프로테오글리칸 코아 단백질, 및 콜라겐 α4(Ⅳ), 및 α5(Ⅳ) 사슬에 대하여 수행하였다. 대조를 돌연변이체와 비교할 때 이러한 다른 기저막 단백질에 대한 mRNA 수준에서 유의한 차이는 나타나지 않았다.To demonstrate the role of TGF-? 1, total RNA was isolated from the renal of Alport's animal, and specific for α1 (Ⅳ) and α2 (Ⅳ) collagen chains, entatin, laminin β1 or β2 chain, fibronectin, or TGF- Lt; RTI ID = 0.0 > radiolabeled < / RTI > probe. The results in Figure 4 illustrate that mRNA for all these proteins, except for laminin beta 1, is induced after the onset of proteinuria in the AlportMouse model. The Norton blot for this same time lapse was performed on laminin alpha 1, laminin beta 2, laminin gamma 1, heparin sulfate proteoglycan core protein, and collagen alpha 4 (IV), and alpha 5 (IV) chains. There was no significant difference in mRNA levels for these other basement membrane proteins when the control was compared to the mutants.
노턴 분석의 결과는 상기 시간경과 동안 특이적 mRNA 발현에서 상대적인 변화를 직접 정량하기 위해 분석되었다. 도 5는 특이적 mRNA 수준의 유도가 6주 주령에서 최초로 나타남을 예시한다. 8주까지, mRNA 수준은 피크를 이루고, TGF-β1 및 피브로넥틴을 엔코딩하는 mRNA는, 대조 마우스에 비하여 각각 6.6배 및 9.4배가 유도되었다. 콜라겐 α1(Ⅳ), α2(Ⅳ), 및 엔탁틴에 대한 mRNA 수준은 8주까지 모두 약 3배 유도되었다. 대조적으로, 이들 동일한 총 RNA 노턴 블롯에 의해 측정될 때, 신장 질환 진행의 임의의 시점에서 라미닌 β1 및 β2 사슬을 엔코딩하는 mRNA의 어떠한 유의한 변화도 관찰되지 않았다.The results of the Norton assay were analyzed to directly quantify relative changes in specific mRNA expression over time. Figure 5 illustrates that the induction of specific mRNA levels first appears at 6 weeks of age. By 8 weeks, mRNA levels peaked and mRNAs encoding TGF-β1 and fibronectin were induced 6.6-fold and 9.4-fold, respectively, as compared to control mice. MRNA levels for collagen α1 (Ⅳ), α2 (Ⅳ), and enstatin were all induced to about three fold up to eight weeks. In contrast, when measured by these same total RNA Norton blots, no significant change in mRNA encoding the laminin β1 and β2 chains was observed at any time during renal disease progression.
사구체는 신장의 총 질량의 작은 비율만을 포함한다. 사구체내의 개개의 세포 유형은 보다 낮은 비율을 포함한다. 따라서, 총 신장 RNA의 노턴 블롯은 사구체, 또는 특정한 사구체 세포 유형에 특이적일 수 있는 메시지의 유도를 검출할 가능성이 없다. TGF-β1, 또는 상이한 기저막 성분을 엔코딩하는 mRNA가 특정한 사구체 세포 유형에서 유도되었는지 여부를 검사하기 위하여, mRNA에 특이적인 디곡시게닌 표지된 안티센스 프로브를 사용하여 원위치 하이브리드화를 수행하였다. 그 결과는 도 6에 도시된다. 정상 마우스에서, TGF-β1(도 6D), 피브로넥틴(도 6G) 및 라미닌 β1(도 6M)에 대한 전사체가 오직 메산쥼 세포에만 국재화된 반면, 앨포트 마우스에서는 이러한 동일한 전사체(각각 도 6E, H, 및 N)가 이 사구체 세포 유형에서 유전자 활성화를 예시하는 족세포(사구체의 외측상에 있는 세포의 고리)에 뚜렷이 국재화된다. 콜라겐 α1(Ⅳ)의 족세포 활성화도 분명히 나타난다(도 6B를 6A와 비교). 사구체 족세포에서 매트릭스 단백질을 엔코딩하는 유전자의 활성화는 GBM 조성의 변화를 초래할 수 있다.Glomeruli contain only a small proportion of the total mass of the kidneys. Individual cell types within the glomeruli include lower rates. Thus, the Norton blot of total kidney RNA is unlikely to detect the induction of a message that may be specific to the glomerulus, or to a particular glomerular cell type. In-situ hybridization was performed using digoxigenin-labeled antisense probes specific for mRNA to examine whether mRNA encoding TGF-? 1, or different basement membrane components, was induced in a particular glomerular cell type. The result is shown in Fig. In normal mice, transcripts for TGF-beta 1 (FIG. 6D), fibronectin (FIG. 6G) and laminin β 1 (FIG. 6M) were localized exclusively to mesangial cells whereas in Alport mouse these same transcripts , H, and N) are clearly localized to podocytes (rings of cells on the lateral side of the glomeruli) that demonstrate gene activation in this glomerular cell type. Cell-cell activation of collagen alpha 1 (IV) is also evident (compare Fig. 6B with 6A). Activation of a gene encoding a matrix protein in glomerular cells may result in a change in GBM composition.
사이토카인의 활성 이소형에 특이적인 항체를 사용한 이뮤노퍼옥시다제에 검출에 기초한 TGF-β1 단백질 데이터는 TGF-β1 mRNA에 대한 원위치 하이브리드화 분석에 의해 얻은 데이터를 확증한다. 도 7에 도시된 데이터는 족세포에서 TGF-β1 mRNA의 증가된 발현으로 단백질로의 번역이 증가함을 예시한다.Detection-based TGF-β1 protein data in immune oxidase using antibodies specific for the active isoform of cytokines confirms data obtained by in situ hybridization analysis of TGF-β1 mRNA. The data shown in FIG. 7 illustrate increased translation to protein by increased expression of TGF-? 1 mRNA in podocytes.
TGF-β1에 대한 데이터는 마우스 모델을 사용하여 얻었기 때문에, 사이토카인에 대한 mRNA 수준이 앨포트 대 대조 환자로부터 얻은 사람 신피질에서 상승되었는지를 결정하기 위하여 RN아제 보호 분석이 수행되었다. 도 8의 데이터는 대조에 비하여 사람의 앨포트 신피질에서 TGF-β1 mRNA의 3 내지 4배 상승을 예시한다. 이는 사이토카인이 또한 사람의 앨포트 신장에서 과발현됨을 증명한다. 따라서, TGF-β1의 활성을 저해시키는 것은 앨포트 증후군, 특히 GBM에서 매트릭스 축적을 제한, 및 바람직하게는 예방하기 위한 타당한 치료 프로토콜을 제공한다.Since data for TGF- [beta] were obtained using a mouse model, RNase protection analysis was performed to determine if the level of mRNA for cytokines was elevated in human cortex obtained from Alport vs. control patients. The data in FIG. 8 illustrate a 3- to 4-fold increase in TGF-? 1 mRNA in human Altaic cortex compared to control. This demonstrates that cytokines are also overexpressed in human Alport kidney. Thus, inhibiting the activity of TGF- [beta] l provides a valid therapeutic protocol for limiting, and preferably preventing, matrix accumulation in Alport syndrome, particularly GBM.
상기 논의한 바와 같이, 도 9는 TGF-β1이 앨포트 마우스에서 유도되는 반면, α1 인테그린 돌연변이를 추가로 잠복하는 이중 녹아웃 마우스에서는 유도되지 않음을 나타낸다. 따라서, α1β1 인테그린의 부재하에서, 사구체 기저막에서 매트릭스의 축적의 감소의 원인이 되는 TGF-β1 유도는 관찰되지 않으므로, 신장 질환이 진행하는 속도가 현저하게 감소한다.As discussed above, Figure 9 shows that TGF- [beta] l is induced in Alport mice, whereas it is not induced in double knockout mice that further incubate the [alpha] 1 integrin mutation. Thus, in the absence of? 1? 1 integrin, the induction of TGF-? 1, which causes a decrease in accumulation of the matrix in the glomerular basement membrane, is not observed, so the rate at which the kidney disease progresses is markedly reduced.
인테그린 α1β1 수용체를 차단시키고(또는 불활성화) TGF-β1을 저해시키는 것은 신장 질환(특히, 앨포트 신장 질환) 발병, 진행의 약화, 및/또는 역전에 현저하게 상승적이다. 이러한 상승적 효과는, 3가지 상이한 방식으로 TGF-β1 활성을 차단하는 2개의 상이한 약물을 예로서 사용하여 증명된다. 양자 모두는 그 결과가 약물 치료의 부작용이라기 보다는 TGF-β1 활성을 저해시키는 것에 기인한 것임을 확인하기 위하여 연구되었다.Blocking (or inactivating) integrin alpha 1 beta 1 receptors and inhibiting TGF- beta 1 is markedly synergistic in the onset, attenuation of progression, and / or reversal of renal disease (particularly Alport's kidney disease). This synergistic effect is demonstrated using, as an example, two different drugs that block TGF-? 1 activity in three different ways. Both have been studied to confirm that the result is due to inhibition of TGF-β1 activity rather than a side effect of drug therapy.
첫번째 예는 후지사와 파마슈티칼 컴파니 리미티드(Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan)에 의해 제조된 타클롤리무스 또는 FK506으로 지칭되는 약물이다. 이 약물은 일반적으로 장기 이식 후에 거부반응을 방지하기 위한 면역저해제로서 사용된다. 상기 약물은 세린 트레오닌 포스파타제인, 칼시누린으로 불리는 T-세포 수용체의 중요한 아단위, 및 T-세포 수용체 신호 전환의 중요 부분을 저해함으로써 작용한다. 최근에 검토된 바와 같이[참조: Crabtree, Cell, 96:611-614, 1999], 칼시누린은 다양한 수용체의 아단위이다. 이러한 수용체중의 하나는 최근 TGF-β1에 대한 것으로 보고되었다[참조: Wang et al., Cell, 86:435-444, 1996]. 약물 FK506은 TGF-β1 저해제로서 시험되었다. 따라서, 적당한 투여량의 FK506으로 마우스를 치료하는 것은 TGF-β1 타입 Ⅰ/타입 Ⅱ 수용체 신호 전환을 저해할 것이다.The first example is a drug called Tkrolimus or FK506 manufactured by Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan. This drug is generally used as an immunosuppressant to prevent rejection after organ transplantation. The drug acts by inhibiting an important sub-unit of the T-cell receptor, called serine threonine phosphatase, called calcinurin, and a critical portion of T-cell receptor signaling. As reviewed recently (Crabtree, Cell, 96: 611-614, 1999), calcinurin is a subunit of various receptors. One of these receptors has recently been reported for TGF-? 1 (Wang et al., Cell, 86: 435-444, 1996). Drug FK506 was tested as a TGF-? 1 inhibitor. Thus, treating mice with an appropriate dose of FK506 would inhibit TGF-beta type I / type II receptor signal transduction.
FK506이 TGF-β1을 저해시키는 외에 다른 생물학적 활성을 가지기 때문에(T-세포 저해에 의한 효능있는 면역억제가 가장 주목할 만함), 제 2의 TGF-β1 저해제가 평가되었다. 이러한 제 2의 저해제는 바이오젠 인코포레이티드(Biogen Inc., Cambridge, MA)에 의해 개발중인 실험단계의 약물이다. 이 약물은 사이토카인의 경쟁적 저해제이고, 불활성인 가용성 수용체 복합체로서 활성 사이토카인을 흡수한다. 이는 가용성 키메라 TGF-βRⅡ/IgG1 쥐과동물의 융합 단백질이다[참조: 국제 공개 WO98/48024]. 기술된 실험에서는 저해제의 25㎍을 마우스의 꼬리 정맥을 통하여 1주에 2회 주사하였다.Because FK506 has other biological activities besides inhibiting TGF-? 1 (efficacious immunosuppression by T-cell inhibition is most notable), a second TGF-? 1 inhibitor was evaluated. This second inhibitor is an experimental phase of the drug being developed by Biogen Inc. (Cambridge, Mass.). This drug is a competitive inhibitor of cytokines and absorbs active cytokines as an inactive soluble receptor complex. It is a fusion protein of soluble chimeric TGF-beta RII / IgG1 murine animal (International Publication WO 98/48024). In the described experiment, 25 [mu] g of the inhibitor was injected through the tail vein of the mouse twice a week.
FK506 및 바이오젠사의 가용성 TGF-β1 저해제의 활성 방식 및 가능한 부작용이 상이하게 때문에, 두 약물 모두와 일치된 동물 모델 시스템을 사용하여 행한 관찰은 TGF-β1 활성의 저해에 기인한 것으로 결론지어진다.Observations made using an animal model system consistent with both drugs are concluded to be due to inhibition of TGF-? 1 activity, as the mode of action and potential side effects of FK506 and the soluble TGF-? 1 inhibitor of Biogen are different.
2가지 유형의 실험이 수행되었다. 두 약물 모두 TGF-β1 저해의 생물학적 효과 그 자체를 검토하기 위하여 129 Sv/J 마우스 모델(앨포트 마우스)을 사용하여 시험하였다. 둘째로, 두 약물 모두 TGF-β1 저해와 결합된 α1β1 인테그린 저해의 생물학적 효과를 검토하기 위하여 이중 녹아웃 마우스 모델에서 시험하였다. 모든 경우에서, 본원에 제공된 데이터는 고도의 콘시스턴시를 가지고 3회 이상 반복하였다.Two types of experiments were performed. Both drugs were tested using a 129 Sv / J mouse model (Alport mouse) to examine the biological effects of TGF-beta1 inhibition itself. Second, both drugs were tested in a double knockout mouse model to examine the biological effects of inhibition of integrin 1 integrase in combination with TGF-beta1 inhibition. In all cases, the data provided herein were repeated three or more times with a high degree of consensus.
TGF-β1이 앨포트 마우스 모델에서 저해된 경우, 유리한 몇가지 효과가 있다. 기저막 형태가 전체적으로 개선되지만, 현저한 푸트 프로세스 소실이 여전히 관찰된다. 따라서, TGF-β1은 매트릭스 축적율을 감소시킴으로써 GBM 형태를 개선할 수 있으나, 푸트 프로세스를 기초로 하는 메카니즘에 대하여는 현저한 효과를 나타내지 않는다. 이는 단독 투여된 TGF-β1 저해제가 개선을 제공할지라도, 앨포트 증후군 또는 기타 이러한 질환의 모든 특성을 개선시키는데 성공할 가능성이 없음을 의미한다. 이중 녹아웃 마우스에서, 10주 주령까지 대부분의 프트 프로세스는 정상적으로 보이지만, GBM에 현저한 매트릭스 축적이 있다. 이러한 동일한 동물을 임의의 TGF-β1 저해제를 사용하여 4주 주령에서 시작하여 치료하고, 10주 주령에서 조직을 수집할 경우, 약 30%의 사구체는 정상적인 마우스의 사구체와 초미세구조적으로 구별되지 않는다. 따라서, 본원에 기재된 치료 프로토콜에서 현저한 개선은 α1β1 인테그린 수용체 저해제와 병용하여 TGF-β1 저해제를 사용하여 얻어질 수 있다.When TGF-β1 is inhibited in the Alport mouse model, there are several beneficial effects. Basal membrane morphology is overall improved, but significant foot process loss is still observed. Thus, TGF-? 1 can improve the GBM morphology by reducing the matrix accumulation rate, but it does not have a significant effect on the foot process based mechanism. This means that even though the single administered TGF-? 1 inhibitor provides an improvement, there is no likelihood of succeeding in improving Alport syndrome or any other characteristic of such a disorder. In double knockout mice, most print processes up to 10 weeks of age appear normal, but there is a significant matrix accumulation in GBM. Approximately 30% of the glomeruli are not super-microstructurally distinct from normal mouse glomeruli when these same animals are treated starting at 4 weeks of age using any TGF-? 1 inhibitor and tissues collected at 10 weeks of age . Thus, a significant improvement in the treatment protocol described herein can be obtained using a TGF-? 1 inhibitor in combination with an? 1? 1 integrin receptor inhibitor.
TGF-β1 저해제중 어느 하나로 처리된 앨포트 마우스 또는 이중 녹아웃으로부터 얻은 신장의 특정 mRNA에 관한 노턴 블롯 데이터는 TGF-β1 또는 α1β1 인테그린 녹아웃 돌연변이가 GBM에 축적되는 매트릭스 분자를 엔코딩하는 이들 메시지의 발현에 영향을 미치는 방식간에 뚜렷한 차이가 있음을 증명한다. 메탈로프로테이나제(매트릭스 메탈로프로테이나제 2(MMP-2)를 포함) 및 이들의 대응하는 저해제(TIMP-2 및 TIMP-3을 포함)를 엔코딩하는 mRNA는 GBM을 포함하는 분자의 교체율을 조절하는 것으로 생각되며, 또한 TGF-β1 저해제중 어느 하나로 처리된 앨포트 마우스 대 아중 녹아웃 마우스에서 상이하게 영향을 받는다. 상세하게는, 정상 마우스에서 매우 높은 수준으로 발현되는 Timp-3은 앨포트 마우스 및 이중 녹아웃에서 억제된다. TGF-β1 저해제를 사용한 이중 녹아웃 마우스의 처리는 TIMP-3의 억제를 방지하고, mRNA를 대조 마우스에서 관찰되는 것과 대등한 수준으로 회복시킨다(도 21).Norton blot data on all mRNAs of kidneys obtained from Alportomone or double knockout treated with either of the TGF-? 1 inhibitors indicate that expression of these messages encoding matrix molecules in which the TGF-? 1 or? 1? 1 integrin knockout mutations accumulate in the GBM And there is a clear difference between the ways in which they affect. The mRNA encoding metalloproteinases (including the matrix metalloproteinase 2 (MMP-2)) and their corresponding inhibitors (including TIMP-2 and TIMP-3) Lt; / RTI > and are also affected differently in Alportomo versus knockout mice treated with either of the TGF-beta 1 inhibitors. Specifically, Timp-3, which is expressed at a very high level in normal mice, is inhibited in Alport mice and double knockout. Treatment of double knockout mice with TGF- beta 1 inhibitor prevents the inhibition of TIMP-3 and restores mRNA to levels comparable to those observed in control mice (Figure 21).
이와 동일한 경향에 따라, 라미닌 α2 발현은 정상적으로는 메산쥼 매트릭스에 염격하게 한정된다. 라미닌 α2의 퇴적은 앨포트 GBM 질환 발병과 관련하여 확인된 가장 초기의 분자적 변화이고, 기저막 비후화가 최초로 검출되는 때와 동시에 나타난다. 이중 녹아웃 마우스의 GBM에서 라미닌 α2의 퇴적은 7주 주령에서 조차 관찰되지 않는다(도 18, 1D군). SV/J 앨포트 마우스에 TGF-β1 저해제의 투여는 라미닌 α2의 퇴적을 저해하지 않는다(도 18, 1C군). 이것은 질환 진행의 지연에서α1β1 대 TGF-β1이 작용하는 방식에서 다른 차이를 강조하며, 왜 병용 투여가 상승적 잇점을 제공하는가를 확실한 증거와 함께 증명한다.Following this same trend, laminin alpha 2 expression is normally confined to mesangial matrices. The deposition of laminin α2 is the earliest molecular alteration identified in association with the onset of ALPT GBM disease and coincides with the first detection of basement membrane hyperplasia. The deposition of laminin alpha 2 in GBM of double knockout mice is not observed even at 7 weeks of age (Fig. 18, 1D group). Administration of the TGF-? 1 inhibitor to SV / J altxt mice does not inhibit the deposition of laminin? 2 (Fig. 18, 1C group). This emphasizes different differences in the way α1β1 versus TGF-β1 work in delaying disease progression and demonstrates why concomitant administration offers synergistic benefits with clear evidence.
TGF-β1이 족세포 푸트 프로세스의 소실을 저해하지 못한 것은 라미닌 α2에 관한 관찰과 직접적으로 관련이 있는 것으로 생각된다. 라미닌은 알파, 베타, 및 감마 사슬로 구성된 이종삼량체를 형성한다. 기저막에서, 이들은 서로 가교되어 기저막의 필수적인 부분인 시트형 상부구조를 형성한다. 라미닌은 인테그린 수용체와 상호작용하는 것으로 공지되어 있으며, 조직 기능의 분화 및 유지에 중요한 역할을 한다. 정상 마우스에서, GBM은 주로 α5, β2, 및 γ1 사슬의 이종삼량체인 라미닌-11을 함유한다. 이 라미닌은 족세포 표면상의 인테그린 α3β1 수용체와 높은 친화성으로 결합하는 것으로 공지되어 있다. 이러한 상호작용은 푸트 프로세스를 형성하는 복잡한 세포골격 구조를 유지하는데 중요한 역할을 하는 것으로 생각된다. α2 사슬을 함유한 라미닌 이종삼량체(라미닌-2 및 라미닌-4)는 α3β1 인테그린과 결합하지 않는다. 따라서, GBM에서 라미닌-2 사슬의 존재는 정상적인 기질(라미닌-11)과 α3β1 인테그린의 결합을 저해함으로써 푸트 프로세스 소멸이 관찰되는 결과를 초래한다. 언급한 바와 같이, 이중 녹아웃에서, 라미닌 α2의 퇴적이 저해되고, 이는 이 마우스종에서 푸트 프로세스의 유지와 적절한 상관관계가 있다.The failure of TGF-β1 to inhibit the loss of the podocyte foot process seems to be directly related to the observation of laminin α2. Laminin forms a heterotrimer composed of alpha, beta, and gamma chains. In the basement membrane, they are crosslinked with each other to form a sheet-like superstructure that is an essential part of the basement membrane. Laminin is known to interact with integrin receptors and plays an important role in the differentiation and maintenance of tissue function. In normal mice, GBM contains a heterozygous trimer chain laminin-11, mainly of the? 5,? 2, and? 1 chains. This laminin is known to bind with high affinity to the integrin [alpha] 3 [beta] 1 receptor on the cell surface. These interactions are thought to play an important role in maintaining the complex cytoskeletal structure that forms the foot process. The laminin heterodimer (laminin-2 and laminin-4) containing the? 2 chain does not bind to the? 3? 1 integrin. Thus, the presence of the laminin-2 chain in GBM results in the suppression of foot process extinction by inhibiting the binding of the α3β1 integrin to the normal substrate (laminin-11). As mentioned, in double knockout, the deposition of laminin [alpha] 2 is inhibited, which correlates well with the maintenance of the foot process in this mouse species.
추가의 관찰은 간질성 섬유증의 문제에 관한 것이다. 간질성 섬유증은 앨포트 증후군 진행에서 후기에 발생한다. 129Sv/J 앨포트 마우스 모델에서, 7주 이전에는 섬유증이 관찰되지 않으며, 평균 사망 주령은 8주이다. 그러나, 이중 녹아웃에서는, 섬유증의 발병은 8 내지 9주이고, 평균 사망 주령인 15주까지 진행한다. 따라서, 이중 녹아웃은 섬유증의 연구에 우수한 모델이다. 이중 녹아웃 마우스에서 섬유증의 현저한 경과가 있으며, 이는 TGF-β1 저해제를 사용함으로써 크게 방지될 수 있다.A further observation relates to the problem of interstitial fibrosis. Interstitial fibrosis occurs late in Alport syndrome progression. In the 129Sv / J altimouse model, fibrosis was not observed before 7 weeks, and the mean death age was 8 weeks. However, in a double knockout, the onset of fibrosis lasts from 8 to 9 weeks, to 15 weeks, the average death week. Therefore, double knockout is an excellent model for the study of fibrosis. There is a significant progression of fibrosis in double knockout mice, which can be largely prevented by using TGF-? 1 inhibitors.
처리 방법Processing method
한 측면에서, 본 발명은 사구체 질환, 특히 진행성 사구체신염 및/또는 섬유증의 발병(시판용 스틱 시험 또는 겔 전기영동 및 겔 염색 방법을 사용하여, 검출가능한 수준의 뇨중 혈청 알부민의 출현에 의해 측정)을 지연 및 진행(상기 측정된 알부민 수준이 시간의 함수로서 증가하는 속도를 측정함으로써 결정)을 지연시키거나, 심지어 역전시키는 방법으로서 α1β1 인테그린 수용체의 기능을 차단 또는 불활성화시키기 위한 저해제(예컨대, 차단제)의 용도에 관한 것이다. 이들은, 예컨대 라미닌, 타입 Ⅳ 콜라겐, 피브로넥틴, 및 엔탁틴과 같이 α1β1 인테그린 수용체와 결합하는 단백질로부터의 9량체 이상의 펩티드를 포함하지만, 이에 한정되지 않는다. 수용체/α1β1 수용체의 리간드 부위내에서 결합하는 작은 분자들이 단백질/α1β1 인테그린 수용체 연구에 기초하여 창조될 수 있다. α1β1 인테그린 수용체의 결합 부위에 특이적으로 결합하는 항체 및 항체 단편들이 본 발명에서 사용될 수 있다. 이러한 항체 또는 항체 단편들은 폴리클로날 항체, 모노클로날 항체, 항-이디오타입 항체, 동물 유래의 항체, 인간화된 항체 및 키메라 항체를 포함한다.In one aspect, the invention provides a method of treating glomerular disease, particularly the onset of advanced glomerulonephritis and / or fibrosis (measured by the presence of detectable levels of urine serum albumin, using commercially available stick testing or gel electrophoresis and gel staining methods) (E. G., A blocking agent) for blocking or inactivating the function of the? 1? 1 integrin receptor as a way of delaying or even reversing the delay and progression (determined by measuring the rate at which the measured albumin level increases as a function of time) . These include, but are not limited to, nine or more peptides from proteins that bind to the alpha 1 beta 1 integrin receptor, such as laminin, type IV collagen, fibronectin, and entampin. Small molecules that bind within the ligand site of the receptor / [alpha] 1 [beta] l receptor can be created based on protein / alpha 1 integrin receptor studies. Antibodies and antibody fragments that specifically bind to the binding site of the? 1? 1 integrin receptor can be used in the present invention. Such antibodies or antibody fragments include polyclonal antibodies, monoclonal antibodies, anti-idiotypic antibodies, animal-derived antibodies, humanized antibodies and chimeric antibodies.
α1β1 인테그린 수용체에 대한 결합 부위를 차단하는 약물(인위적 리간드)이 본 발명의 방법에서 사용될 수 있다. 이러한 약물의 예는 중화 항체, 펩티드, 단백분해성 단편 등을 포함하지만, 이에 한정되지 않는다. 이러한 약물은 수용체를 통한 신호 전환을 차단하는 것으로 생각된다. 이러한 치료제의 유효성은, 예컨대 TGF-β1, 피브로넥틴, 라미닌 사슬 등의 유전자 발현에 대한 다운스트림 효과를 사구체 기저막의 형태적 변화에 의해, 및/또는 단백뇨의 발증 및 진행 속도의 감소로 증명되는 사구체의 개선에 의해 평가함으로써 결정될 수 있다.Drugs (artificial ligands) that block binding sites for the? 1? 1 integrin receptor can be used in the methods of the invention. Examples of such drugs include, but are not limited to, neutralizing antibodies, peptides, proteolytic fragments, and the like. These drugs are thought to block signal transduction through the receptor. The efficacy of such therapeutic agents can be determined, for example, by measuring the downstream effect on gene expression, such as TGF-? 1, fibronectin, laminin chain, etc., by morphological changes in the glomerular basement membrane, and / Can be determined by evaluation by improvement.
α1β1 인테그린 기능을 중화시키는 항체는 실시예 및 도 10에 제공된다. 리간드와 α1β1 인테그린의 상호작용을 차단할 수 있는 가용성 약물이 신장 질환 발병에 대하여 α1 유전자 녹아웃 돌연변이와 동일한 효과를 나타냄을 예시하기 위한 예로서, Fabbri 등의 문헌[Tissue Antigens, 48:47-51, 1996]에 기재된 항체를 수득하였다. 이 항체는 주사되어(400ng/주사, 주 3회, 복강내투여), 이중 돌연변이체에서 관찰된 바와 동일한 방식으로 앨포트 마우스 모델에서 사구체 기저막 손상을 저해시키는 것으로 나타났다.Antibodies that neutralize? 1? 1 integrin function are provided in the Examples and FIG. As an example to illustrate that a soluble drug capable of blocking the interaction of a ligand with an? 1 integrin exhibits the same effect as the? 1 gene knockout mutation on the onset of a kidney disease, Fabbri et al., Tissue Antigens, 48: 47-51 ] Was obtained. This antibody has been shown to inhibit glomerular basement membrane damage in the Alport mouse model in the same manner as observed with dual mutants (400 ng / injection, three times per week, intraperitoneal injection).
다른 측면에서, 본 발명은 사구체 질환, 특히 진행성 사구체신염의 진행에서 매트릭스의 축적을 지연시키는 방법으로서 TGF-β1의 수준을 감소시키는 약제의 용도에 관한 것이다. 따라서, 이러한 약물은 앨포트 증후군 환자 및 인슐린 의존성 당뇨병 뿐만 아니라 특히 진행성 사구체신염, 또는 메산쥼 매트릭스의 확대, 메산쥼 세포의 증식, 사구체 기저막에 매트릭스의 퇴적 결과 비후화, 박화, 분열, 또는 몇가지 이러한 불규칙성, 족세포 푸트 프로세스의 소실, 또는 상기 기재한 징후의 몇가지 조합이 일어나며, 이들 모두가 신장 섬유증의 공통적인 경로가 되는 것을 특징으로 하는 질환을 치료하는데 사용될 수 있다(이를 방지하기 위하여 α1β1 인테그린 저해제 및 TGF-β1 저해제의 병용 요법이 특히 유효하다). 이러한 목적으로, 당해분야에서 기술된 바와 같은 안티센스 요법은 TGF-β1 또는 α1β1 인테그린 수용체 단백질의 발현을 차단하는데 사용될 수 있다. 다양한 합성 또는 천연 약물이 사용될 수 있다.In another aspect, the invention relates to the use of a medicament for reducing the level of TGF-? 1 as a method of delaying the accumulation of a matrix in the course of glomerular disease, particularly progressive glomerulonephritis. Thus, such drugs may be useful in the treatment of patients with Alport syndrome and insulin-dependent diabetes mellitus as well as in particular progressive glomerulonephritis, or enlargement of the mesangial matrix, proliferation of mesangial cells, enlargement of the matrix deposition in the glomerular basement membrane, Irregularities, loss of podocyte foot process, or some combination of the indications described above, all of which can be used to treat a disease characterized by being a common pathway for renal fibrosis (to prevent this, the alpha 1 beta 1 integrin inhibitor And TGF-? 1 inhibitors are particularly effective). For this purpose, antisense therapy as described in the art can be used to block the expression of TGF-beta 1 or alpha 1 beta 1 integrin receptor protein. A variety of synthetic or natural drugs may be used.
수용체와 상호작용하는 TGF-β1 사이토카인의 능력을 중화시키는 약물이 본 발명의 방법에 사용될 수 있다. 이러한 약물의 예는 중화 항체, 미국 특허 제 5,260,301호(Nakanishi et al.)에 개시된 것(예컨대, FK506 또는 타크롤리무스 및 구조적으로 관련된 화합물)과 같은 칼시누린 저해제(즉, 마크로라이드), 국제 공개 WO9848024(Biogen Inc.)에 개시된 가용성 재조합 TGF-β1 수용체(예컨대, 가용성 키메라 TGF-βRⅡ/IgG1 융합 단백질)와 같은 가용성 수용체, 상기 수용체의 펩티드 단편, 또는 사이토카인과 비가역적으로(또는 안정하게) 결합하는 능력을 갖고 수용체와 결합하는 능력을 저해시키는 소정의 이러한 단편을 포함하지만, 이에 한정되지 않는다. 또한, 신호를 핵에 전환시키는 TGF-β1의 능력을 저해시키는 약물이 사용될 수 있다. 이러한 치료제의 유효성은, 예컨대 TGF-β1, 피브로넥틴, 라미닌 사슬 등의 유전자 발현에 대한 다운스트림 효과를 사구체 기저막의 형태적 변화에 의해, 및/또는 단백뇨의 발증 및 진행 속도의 감소로 증명되는 사구체의 개선에 의해 평가함으로써 결정될 수 있다.Drugs that neutralize the ability of the TGF-? 1 cytokine to interact with the receptor may be used in the methods of the invention. Examples of such drugs include neutralizing antibodies, calcineurin inhibitors (i. E., Macrolides) such as those disclosed in U.S. Patent No. 5,260,301 (Nakanishi et al.) (Such as FK506 or tacrolimus and structurally related compounds) Soluble receptor such as a soluble recombinant TGF-? 1 receptor (e.g., soluble chimeric TGF-? RII / IgG1 fusion protein) disclosed in WO 9848024 (Biogen Inc.), a peptide fragment of said receptor, or a peptide that is irreversibly (or stably) But are not limited to, any such fragment that has the ability to bind and inhibit the ability to bind to the receptor. In addition, drugs that inhibit the ability of TGF-? 1 to convert signals into nuclei may be used. The efficacy of such therapeutic agents can be determined, for example, by measuring the downstream effect on gene expression, such as TGF-? 1, fibronectin, laminin chain, etc., by morphological changes in the glomerular basement membrane, and / Can be determined by evaluation by improvement.
한 실시예에서, FK506 또는 사이클로스포린 A는 TGF-β1 수용체의 칼시누린 부분을 저해시키는데 사용되어, 몇가지 다른 신장 질환에 대하여 개시되었된 바와 같이[참조: Wang et al., Cell 86:435-444, 1996 and Muller et al., Endocrinol, 3:1926-1934, 1989], 수용체 복합체를 통한 신호 전환을 저해하고, 이로써 동일한 신장 질환에 대하여 기재되었던 바와 같이[참조: Callis et al., Pediatr. Nephrol., 6:140-144, 1992], 단백뇨의 발증을 저해(알려지지 않은 메카니즘을 통하여)할 수 있다. 본 발명 이전에는 앨포트 증후군, 당뇨병 또는 신장 사구체에서 세포외 매트릭스의 증가와 관련된 질환에 대한 이러한 것이 추천된 바 없었다.In one embodiment, FK506 or cyclosporin A has been used to inhibit the calcineurin portion of the TGF-? 1 receptor and has been shown to inhibit the TGF-? 1 receptor as described for several other renal diseases (Wang et al., Cell 86: 435-444, 1996 and Muller et al., Endocrinol, 3: 1926-1934, 1989], inhibit signal transduction through the receptor complex and thereby inhibit the signal transduction pathway as previously described for the same renal disease (Callis et al., Pediatr. Nephrol., 6: 140-144, 1992), can inhibit the onset of proteinuria (through an unknown mechanism). Prior to the present invention, this was not recommended for diseases associated with increased extracellular matrix in Alport syndrome, diabetes, or renal glomeruli.
특히, 본 발명은 α1β1 인테그린 수용체 및 TGF-β1을 저해하여 앨포트 증후군과 관련된 섬유증 및 사구체 질환 양자 모두를 방지하는데 상승적인 효과를 가지는 병용 요법의 효과를 예시한다. GBM 비후화, 박화, 분열, 족세포 푸트 프로세스의 소멸중 하나 이상, 또는 상기의 임의의 조합에 의해 명백히 나타나는 진행성 기저막 손상, 메산쥼 매트릭스의 확장, 메산쥼 세포의 증식을 포함하는 기타 질환이 또한 이 치료로부터 이익을 얻게 될 것이다. 또한, 본 발명자들은 앨포트 증후군에서 관상간극의 섬유증을 방지하는데 병용 치료의 유효성을 예시한다. 섬유증은 공통된 경로이며, 이에 대한 메카니즘은 섬유증이 관련되는 모든 신장 질환에 대해 동일한 것으로 생각된다. 따라서, 섬유증의 치료에 있어서 이러한 병용 요법의 유효성은 섬유증을 초래하는 경로를 시작한 기초가 되는 원인에 상관없이 모든 형태의 신장 섬유증에 적용가능한 것이어야 한다.In particular, the invention exemplifies the effect of a combination therapy having a synergistic effect on inhibiting the alpha 1 beta 1 integrin receptor and TGF- beta 1 and preventing both fibrosis and glomerular disease associated with Alport syndrome. Other disorders, including progressive basement membrane damage, enlargement of the mesangial matrix, proliferation of mesangial cells, manifested by one or more of GBM hyperplasia, thinning, cleavage, extinction of the podocyte foot process, or any combination of the above, You will benefit from this treatment. In addition, the present inventors illustrate the effectiveness of combination therapy in preventing fibrosis of the coronary gaps in Alport syndrome. Fibrosis is a common pathway and the mechanism for this is thought to be the same for all kidney diseases involving fibrosis. Thus, the efficacy of this combination therapy in the treatment of fibrosis should be applicable to all forms of renal fibrosis, regardless of the underlying cause of the pathway leading to fibrosis.
본 발명의 방법에 사용되는 약물은 약물학적으로 허용되는 담체와 배합되어투여될 수 있다. 본 발명의 약물은 약물학적 조성물(즉, 제형)로 제형화된 다음, 본 발명의 방법에 따라, 사람인 환자와 같은 포유동물에게 선택된 투여 경로에 적합한 다양한 형태로 투여된다. 제형은 전형적으로 비경구 투여(피하, 근육내, 복강내, 및 정맥내 투여를 포함) 또는 약물의 안정성을 허용하는 기타 방법에 적합한 것을 포함한다.The drug used in the method of the present invention may be administered in combination with a pharmacologically acceptable carrier. The medicament of the present invention is formulated into a pharmacological composition (i.e., a formulation) and then administered in various forms suitable for the route of administration selected for mammals such as human patients, according to the methods of the present invention. Formulations typically include those suitable for parenteral administration (including subcutaneous, intramuscular, intraperitoneal, and intravenous) or other methods that allow for the stability of the drug.
약물학적으로 허용되는 적당한 담체는 액체, 반고체, 미분된 고체, 또는 이들의 조합의 형태일 수 있다. 비경구 투여에 적합한 제형은 편의상 약물의 멸균 수성 제제, 또는 약물을 포함하는 멸균 분말의 분산제제로서, 바람직하게는 투여받는 자의 혈액과 등장인 것들을 포함한다. 액상 제제에 포함될 수 있는 등장화제는 당, 완충제, 및 염화나트륨이다. 약물의 액제는 물에서, 임의적으로 비독성 계면활성제와 혼합되어 제조될 수 있다. 약물의 분산제제는 물, 에탄올, 폴리올(예컨대, 글리세롤, 프로필렌 글리콜, 액체 폴리에틸렌글리콜 등), 식물유, 글리세롤 에스테르, 및 이들의 혼합물에서 제조될 수 있다. 최종적인 제형은 멸균되고, 제조 및 저장 조건하에서 안정하다. 필요한 유동성은, 예컨대 리포좀의 사용에 의해, 분산제제인 경우 적당한 입자 크기를 사용함으로써, 또는 계면활성제를 사용함으로써 달성될 수 있다. 액상 제제의 멸균은 약물의 생물활성을 유지시키는 임의의 편리한 방법, 바람직하게는 멸균 여과에 의해 달성될 수 있다. 산제를 제조하는 바람직한 방법은 멸균 주사 용액을 진공 건조 및 동결 건조시키는 것을 포함한다. 추후의 미생물 오염은 다양한 항미생물 약물, 예컨대 파라벤, 클로로부탄올, 페놀, 소르브산, 치메로살 등을 포함한 항균제, 항바이러스제 및 항진균제를 사용하여 방지될 수 있다. 장기간에 걸친 약물의 흡수는 지연화제, 예컨대 알루미늄 모노스테아레이트 및 젤라틴을 포함시킴으로써 달성될 수 있다.Suitable pharmacologically acceptable carriers may be in the form of liquid, semi-solid, finely divided solid, or a combination thereof. Formulations suitable for parenteral administration conveniently include sterile aqueous preparations of the drug, or dispersing preparations of sterile powders comprising the drug, preferably those which appear to the blood of the recipient. Isotonic agents that may be included in the liquid formulation are sugars, buffers, and sodium chloride. The drug solution can be prepared in water, optionally mixed with a non-toxic surfactant. Dispersions of drugs may be prepared from water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, glycerol esters, and mixtures thereof. The final formulation is sterile and stable under the conditions of manufacture and storage. The required fluidity can be achieved, for example, by the use of a liposome, by using a suitable particle size when a dispersant is used, or by using a surfactant. Sterilization of the liquid formulation can be accomplished by any convenient method of maintaining the biological activity of the drug, preferably by sterile filtration. Preferred methods of preparing powders include vacuum drying and lyophilization of sterile injectable solutions. Subsequent microbial contamination can be prevented by using various antimicrobial agents such as antimicrobial agents, antiviral agents and antifungal agents including parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. Absorption of the drug over a long period of time can be achieved by including retarding agents such as aluminum monostearate and gelatin.
상기 성분에 부가하여, 본 발명의 제형은 희석제, 완충제, 결합제, 붕해제, 계면활성제, 농조화제, 윤활제, 보존제(항산화제 포함) 등을 포함한 하나 이상의 부속 성분을 추가로 포함할 수 있다. 제형은 편의상 1회 투여 형태로 제공될 수 있고 약학 분야에서 잘 알려진 임의의 방법에 의해 제조될 수 있다.In addition to the above ingredients, the formulations of the present invention may further comprise one or more accessory ingredients including diluents, buffers, binders, disintegrants, surfactants, thickeners, lubricants, preservatives (including antioxidants) The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.
본원에 기재된 약물의 유용한 투여량(즉, 목적하는 효과를 제공하는 유효량)은 시험관내 활성 및 동물 모델에서 생체내 활성을 비교함으로써 결정될 수 있다. 마우스, 및 기타 동물에서의 유효 투여량을 사람에 대해 외삽시키는 방법은 당해 분야에 공지되어 있다. 예컨대, 정맥 주사용 약물의 1일 2회 약 150mg/kg 내지 약 300mg/kg 투여량. 투여되는 적당한 투여량은 일반적으로, 예컨대 Ⅱ상 효소 발현의 논증가능한 증가, 또는 본원에 기재된 기타 특징을 유도함으로써, 목적하는 효과를 나타내기에 충분한 양이다.A useful dose of the drugs described herein (i.e., an effective amount that provides the desired effect) can be determined by comparing the in vitro activity and the in vivo activity in an animal model. Methods of extrapolating an effective dose in humans, and other animals, to humans are known in the art. For example, about 150 mg / kg to about 300 mg / kg of the intravenous drug twice a day. A suitable dosage to be administered is generally an amount sufficient to exhibit the desired effect, for example, by inducing a demonstrable increase in expression of the enzyme on phase II, or other features described herein.
실시예Example
본 실시예에서, 두 가지의 상이한 동물 모델에 관하여 설명한다. 첫번째는 콜라겐 α3(IV)를 발현시키지 않고 α1 인테그린이 정상이며 문헌[Cosgrove et al., Genes Dev., 10:2981-2992, 1996]에 기재된 "앨포트(Alport)" 마우스 모델이며, 두번째는 "이중 녹아웃(double knockout)" 마우스라고 일컬어지며 앨포트 마우스를 α1 인테그린 유전자가 없는 마우스와 교배시킴으로써 유도되는 마우스 모델이다. 앨포트 마우스와 이중 녹아웃 마우스 사이에는 사구체 질환을 지연시키는 α1β1 인테그린 작용을 차단하는 효능을 설명하는 역할을 하는 차이점들이 있다. 이러한 효과를 이하 상세히 설명한다.In this embodiment, two different animal models are described. The first is the "Alport" mouse model which does not express collagen α3 (IV) and α1 integrin is normal and is described in Cosgrove et al., Genes Dev., 10: 2981-2992, Referred to as a " double knockout " mouse, is a mouse model induced by crossing an allt mouse with a mouse without the alpha 1 integrin gene. There are differences between Alpha and Double knockout mice that serve to explain the efficacy of blocking alpha 1 beta 1 integrin action that delays glomerular disease. These effects will be described in detail below.
앨포트 마우스는 129 Sv/J의 순종의 유전적 배경상태에 있으며, 이중 녹아웃 마우스는 97.5% 순종의 129 Sv 배경상태에 있다. 이에 대한 예외는 도 4, 5, 및 6를 도출하는데 사용한 동물이다. 이들 실험을 앨포트 마우스 모델의 연혁의 초기에 수행하였으며, 예를 들면 키메라성 숫컷을 C57B1/6 암컷과 교배시킨 후, 생성되는 이형접합체와 교배시켜 F2 세대인 동형접합성 앨포트 마우스를 생성시켰다. 이러한 세대는 앨포트 동물 모델의 최초의 설명에서 사용된 동물과 동일한 세대이다[문헌: Cosgrove et al., Genes Devel., 10:2981-2992, 1996]. 이는 녹아웃 표현형의 동정을 신속하게 하기 때문에 초기 유전자 녹아웃 연구에 있어서 통상적인 것이다. 특이적 mRNA 유도와 관련하여, 이들 F2의 마우스로부터 얻은 결과는 순종의 129 Sv/J 녹아웃에 대해 얻은 결과와 일치한다. 앨포트 마우스 대 이중 녹아웃 마우스의 비교 분석을 제공하는 모든 실험은 동종번식 계통에 대해서 수행되었음에 유의해야 한다.Alport mice are in a pure, genetically back-ground state of 129 Sv / J and double knockout mice are in a 97.5% pure, 129 Sv background state. Exceptions to this are the animals used to derive Figures 4, 5, and 6. These experiments were performed early in the history of the Alport mouse model, for example, chimeric males were crossed with C57B1 / 6 females and then crossed with the resulting heterozygotes to generate F2 generation homozygous allt mice. These generations are the same generations of animals used in the first description of the Alport animal model [Cosgrove et al., Genes Devel., 10: 2981-2992, 1996]. This is common in early gene knockout studies because it quickly identifies the knockout phenotype. Regarding the specific mRNA induction, the results from the mice of these F2 are consistent with the results obtained for the pure 129 Sv / J knockout. It should be noted that all experiments providing comparative analysis of AlportMouth vs. double knockout mice were performed on the same breeding line.
두 동물 모델에서 섬유증의 발병 뿐만 아니라, 신장 질환의 진행에 대한 TGF-β1의 역할을 시험하였다. 이는 매우 다양한 방식으로 작용하는 TGF-β1의 두 가지의 상이한 저해제를 시험함으로써 수행하였다. 두 가지의 상이한 저해제(FK506 및 이중 TGFβ1 수용체)의 사용은 그 효과가 사용된 약물의 부작용이 아니라 TGF-β1 저해에 기인하는 것이라는 증거를 제공한다. FK506은 TGF-β1의 과발현과 관련된 진행성 섬유증을 치료하는 치료제일 수 있다.In both animal models, the role of TGF-β1 in the development of fibrosis as well as in the progression of renal disease was examined. This was done by testing two different inhibitors of TGF-? 1 acting in a wide variety of ways. The use of two different inhibitors (FK506 and dual TGF [beta] 1 receptor) provides evidence that the effect is not a side effect of the drug used but is due to TGF-beta1 inhibition. FK506 may be a therapeutic agent for the treatment of advanced fibrosis associated with the overexpression of TGF-? 1.
상이한 동물 모델 및 기재된 약물 치료를 분석하는 과정에서, 시종일관 일정하게 유지된 특이적 평가 과정이 있다. 세 가지의 상이한 부위를 평가하였다. 첫 번째는 신장 기능을 검사하여, 사구체 필터의 전체 통합성을 평가를 제공하였다. 이는 혈청 알부민의 뇨중 배설량을 시험함으로써 수행하였다. 두번째는 광학 및 전자 현미경 수준 모두에서 조직의 구조적 통합성을 시험하였다. 투과 및 주사 전자 현미경 방법 양자 모두를 사용하였다. 이러한 방법들은 이러한 상이한 조건 하에 신장의 조직병리학적 정도를 측정하도록 고안되었다. 마지막으로, 분자적 분석 시험을 수행하여, 특이적 유전자에서 어떠한 변화가 일어나는지 및 이러한 상이한 조건의 결과로서 대응하는 단백질이 존재하는지를 시험하였다. 이들은 노턴 블롯, 원위치 하이브리드화, 및 RN아제 보호를 사용하여 특이적 RNA에 주목하고, 특이적 단백질에 대한 면역조직화학 검출법을 사용하여 시험하였다. 상이한 동물 모델과 상이한 동물 모델에 사용된 약물 치료의 분석에 대하여 상기 특이적 방법이 반복되기 때문에, 불필요한 언급을 피하기 위해서, 상기 방법들을 모든 경우에 동일하게 수행하였으므로(일상적인 습관에서 기대될 수 있는 한), 한 번 기재한 다음, 이후의 특정 실시예에서 인용함을 여기서 밝혀둔다.In the process of analyzing different animal models and described drug therapies, there is a specific assessment process that is consistently and consistently maintained. Three different sites were evaluated. First, the kidney function was examined to provide an assessment of the overall integrity of the glomerular filter. This was done by testing urinary excretion of serum albumin. Second, structural integrity of tissue was tested at both optical and electron microscopic levels. Both transmission and scanning electron microscopy methods were used. These methods are designed to measure the histopathologic extent of the kidney under these different conditions. Finally, molecular analysis assays were performed to test what changes were occurring in the specific genes and whether the corresponding proteins were present as a result of these different conditions. They noted specific RNA using Norton blot, in situ hybridization, and RNase protection and tested using immunohistochemistry for specific proteins. Since the above-described specific methods are repeated for the analysis of drug therapy used in different animal models and different animal models, the methods have been carried out in all cases in the same way (in order to avoid unnecessary mention It should be noted here that the description is given only once and then referred to in the specific examples which follow.
당업자들이 이용가능하며, 본 발명을 유사하게 성공적으로 수행하도록 하는 다수의 대안적인 기술 및 방법들이 존재한다. 모든 시약은, 달리 명시하지 않는 한, 미국 미주리 세인트 루이스 소재의 시그마 케미칼 캄파니(Sigma Chemical Co.)로부터 얻었다. 본원에 기재된 모든 연구에 사용된 PBS는 미국 미주리 세인트 루이스 소재의 시그마 케미칼 캄파니로부터 제품 번호 P-4417의 정제의 형태로 구입하여, 이들 각각의 정제를 200ml의 물에 재구성하여 pH 7.4 PBS를 제조하였다.There are a number of alternative techniques and methods available to those of skill in the art to enable the invention to similarly and successfully perform. All reagents were obtained from Sigma Chemical Co., St. Louis, MO, unless otherwise specified. PBS used in all of the studies described herein was purchased from Sigma Chemical Company, St. Louis, Missouri, in the form of a product number P-4417, and each of these tablets was reconstituted in 200 ml of water to produce pH 7.4 PBS Respectively.
방법Way
I. 신장 기능I. Kidney function
A. 단백질 분석: 뇨중 단백질의 초기 측정은 알부스틱스(Albustix)(Miles Laboratories, Elkhart, IN)를 사용하고, 키트가 장착된 칼라 챠트로부터 상대적인 양을 해독함으로써 수행하였다.A. Protein analysis: Initial measurements of urine protein were performed by using Albustix (Miles Laboratories, Elkhart, IN) and deciphering the relative amounts from the color charts fitted with the kit.
뇨 샘플을 일주일 간격으로 수집하였으며, 0.5㎕를 10% 변성 아크릴아미드 겔을 통해서 전기영동법에 의해 분별시켰다. 겔 중의 단백질을 쿠마시 블루(coomassie blue)로 염색하여 사진촬영하였다. 소 혈청 알부민을 분자량 표준으로 사용하였다.Urine samples were collected at weekly intervals and 0.5 μl were fractionated by electrophoresis through 10% denaturing acrylamide gel. Proteins in the gel were photographed by staining with coomassie blue. Bovine serum albumin was used as the molecular weight standard.
II. 구조 통합성(Integrity)II. Integrity
A. 투과 전자현미경: 신선한 외부 신피질을 4% 파라포름알데히드에 침지시키고, 2시간 동안 고정시키고, PBS(pH 7.4)중에 5℃로 저장하였다. 조직을 0.1M의 소렌슨 완충액(Sorenson's buffer)(소렌슨 완충액은 100ml의 200mM 일염기성 인산나트륨 및 400ml의 200mM 이염기성 인산나트륨을 500ml의 물과 혼합하고, pH를 7.4로 조정함으로써 제조하였다)으로 완전히 세척하고(4℃에서 각각 10분씩 5회), 1 시간 동안 소렌슨 완충액 중의 1% 오스뮴 테트록사이드에 후고정시켰다. 그 후, 조직을 등급화된 에탄올(각각 10분씩 차례로 70%, 80%, 90%, 100%), 및 최종적으로 프로필렌 옥사이드 중에서 탈수시키고, 제조자에 의해 기재된 방법에 따라서 폴리/베드 812 에폭시 수지(Poly/Bed 812 epoxy resin)(Polysciences, Inc., Warrington, PA)에 포매시켰다. 간단히 설명하면, 42ml의 폴리베드 812를 26ml의 도데실숙신산 무수물(DDSA, Polysciences, Inc.) 및 24ml의 나드산 메틸 무수물(nadic methyl anhydride)(Polysciences Inc.)과 혼합하였다. 1.5ml의 2,4,6 트리(디메틸 아미노메틸)페놀을 촉매로서 가하고, 표본을 포매시키는데 필요한 정도까지 활성화된 수지를 10ml 분취량으로 동결시켰다. 사구체를 톨루이딘 블루로 염색된 1㎛(미크론) 절편에서 동정하고, 얇은 절편을 레이쳐드 정 울트라컷 E 울트라마이크로톰(Reichert Jung Ultracut E Ultramicrotome)(Cambridge Instrument Co., Vienna, Austria)을 사용하여 70nm(나노메터) 두께로 절단하였다. 단편을 그리드(grid)상에 설치하고, 공지된 방법을 이용하여 아세트산 우라닐 및 시트르산 납으로 염색하였다. 그리드-설치된 절편을 시험하고 필립스 CM10 전자현미경(Phillips CM10 electron microscope)을 사용하여 사진을 촬영하였다.A. Transmission electron microscope: Fresh outer cortex was immersed in 4% paraformaldehyde, fixed for 2 hours and stored at 5 ° C in PBS (pH 7.4). The tissues were washed thoroughly with 0.1 M Sorenson's buffer (Sorensen buffer was prepared by mixing 100 ml of 200 mM monobasic basic sodium phosphate and 400 ml of 200 mM dibasic sodium phosphate with 500 ml of water and adjusting the pH to 7.4) (5 times each at 10 째 C at 4 째 C) and postfixed in 1% osmium tetroxide in Sorensen buffer for 1 hour. The tissue was then dehydrated in graded ethanol (70%, 80%, 90%, 100% each in 10 minute increments) and finally in propylene oxide and the poly / bed 812 epoxy resin Poly / Bed 812 epoxy resin) (Polysciences, Inc., Warrington, Pa.). Briefly, 42 ml of Polybod 812 were mixed with 26 ml of dodecylsuccinic anhydride (DDSA, Polysciences, Inc.) and 24 ml of nadic methyl anhydride (Polysciences Inc.). 1.5 ml of 2,4,6 tri (dimethylaminomethyl) phenol was added as a catalyst and the activated resin was frozen to an extent of 10 ml in an aliquot to the extent necessary to embed the specimen. The glomeruli were identified in a 1 mu m (micron) section stained with toluidine blue and the thin sections were analyzed using a Reichert Jung Ultracut E Ultramicrotome (Cambridge Instrument Co., Vienna, Austria) Nanometer) thick. The fragments were placed on a grid and stained with uranyl acetic acid and lead citrate using known methods. The grid-mounted sections were tested and photographed using a Philips CM10 electron microscope (Phillips CM10 electron microscope).
B. 주사 전자현미경: 작은 조각(약 2mm 입방체)의 신장 피질을 3% 인산염 완충된 글루타르알데히드에 고정시킨 다음, 1% 인산염 완충된 오스뮴 테트록사이드에 후고정하였다. 샘플을 이어서 등급화된 알코올중에서 탈수시키고, 이산화탄소 중에서 임계점 건조시켰다. 입방체를 이어서 면도날의 에지로 압력을 가하여 조각들로 패쇄하고, 아교와 함께 파쇄된 표면이 상부로 향하게 하면서 스터브(stub)상에 설치하였다. 표면을 공지된 방법을 사용하여 금/팔라듐으로 스퍼터(sputter) 코팅시키고, 주사 전자 현미경으로 가시화하였다.B. Scanning electron microscope: A small piece (approximately 2 mm cubic) of the kidney cortex was fixed in 3% phosphate buffered glutaraldehyde and then postfixed in 1% phosphate buffered osmium tetroxide. Samples were then dehydrated in graded alcohols and critical-point dry in carbon dioxide. The cube was then pressed into the pieces by applying pressure to the edge of the razor blade and placed on a stub with the shredded surface facing upwards. The surface was sputter coated with gold / palladium using a known method and visualized with a scanning electron microscope.
C. 존스 실버 메텐아민 염색(Jones Silver Methenamine Stain): 문헌[Burns and Bretschschneider, Thin is in: plastic embedding of tissue for light microscopy, Educational Products Division, American Society of Clinical Pathologists, Chicago, IL, pp. 24-25, 1981]에 기재된 방법을 사용하여 파라핀 포매된 신장 상에서 존스 염색을 수행하였다.C. Jones Silver Methenamine Stain: Burns and Bretschschneider, Thin is in: Plastic Embedding of Tissue for Light Microscopy, Educational Products Division, American Society of Clinical Pathologists, Chicago, IL, pp. 24-25, 1981). ≪ / RTI >
III. 분자적 분석III. Molecular analysis
A. 노턴 블롯 분석: 신장을 제거하여 액체 질소에서 스냅 동결시키고 막자사발 및 막자를 사용하여 액체 질소중의 분말로 분쇄하였다. 분말을 신장 당 5 ml의 시약을 사용하여 트리졸(TRIZOL) 시약(GibCo/BRL, Grand Island, NY)에 가용화시켰다. 전체 세포 RNA를 제조자의 지시에 따라서 추출하였다. 20㎍의 RNA를 80V에서 4시간 동안 전기영동에 의해서 1.0% 아가로즈/포름알데히드/MOPS(3-(N-모르폴리노)프로판술폰산) 겔 상에서 분별시켰다. 겔을 물에 45시간 동안 침지시키고, 운반 완충액으로서 750 mM 암모늄 아세테이트(물 중의)를 이용하여 밤새 모세관 블롯에 의해서 하이본드 N(Hybond N)(비하전된 나일론, New England Nuclear, Inc., Boston, MA)으로 옮겼다. RNA를 스트라타링커(Stratalinker)(Stratagene, Inc., LaJolla, CA)를 사용하여 블롯에 UV 가교시켰다. 블롯을 50% 포름아미드, 10X 덴하트 용액(Denhardt's solution), 1M NaCl, 50mM Tris-HCl, pH 7.4, 1% SDS, 및 200㎍/ml의 음파처리 및 변성된 연어 정액 DNA(Sigma Chemical Co., St. Louis, MO)를 포함하는 용액에 예비하이브리드화시켰다. 프로브(32P-표지된 cDNA 프로브 단편)를 랜덤 프라미밍 DNA 표지화 키트(Boeringer Mannheim, Indianapolis, IN)를 사용하여 109cpm/㎍의 농도로 랜덤 프라이밍시킴으로써 표지화하였다. 예비하이브리드화 및 하이브리드화 완충액은 5X 식염수-시트르산 나트륨 완충액(SSC), 5X 덴하트 용액, 0.5% 나트륨 도데실 술페이트(SDS), 및 200㎍/ml의 음파처리 및 변성된 연어 정액 DNA로 구성되었다. 필터를 적어도 5시간 동안 예비하이브리드화시키고, 이어서 하이브리드화 용액 ml당 1백만 DPM(분당 붕해)의 프로브를 사용하여 밤새 하이브리드화시켰다. 필터를 이어서 높은 엄격성(stringency)(물 중의 300mM NaCl, 30mM 나트륨 시트레이트, 및 0.2% 나트륨 도데실 술페이트로 구성된 용액중의 65℃에서 각각 30분 동안 2회)에서 세척하고, X-레이 필름에 노출시켰다. RNA 제제의 품질 및 로딩의 콘시스턴시는 겔을 에티듐 브로마이드로 염색하고 18S 및 28S 리보좀성 RNA 밴드를 겔 영상기 2000 디지털 영상화 시스템 장치 및 소프트웨어 패키지(Gel Imager 2000 digital imaging system instrument and software packge)(Applied Imaging, Santa Clara, CA)를 사용하여 스캐닝함으로써 평가하였다. 적절한 비율의 리보좀성 밴드는 RNA 제제가 높고 일관된 품질이었음을 확인시켜 주었다. 정량적 밀도측정 스캐닝으로 샘플 로딩에서 단지 10% 변화만이 확인되었다. 진행성 섬유증에 수반되는 세포 생리에서의 변화가 그러한 대조 프로브를 신뢰할 수 없게 한다는 우려 때문에 대조 프로브가 아닌 상기 도구를 사용하였다. 발현에서의 정량적인 차이는 바이오래드 GS-525 인영상기(BioRad GS-525 phosphorimager)(Bio Rad, Inc., Hercules, CA)를 사용한 인영상 분석에 의해서 평가하였고, 배경 하이브리드화를 공제하였다.A. Norton blot analysis: The kidneys were removed, snap frozen in liquid nitrogen and ground into powder in liquid nitrogen using a mortar and pestle. The powder was solubilized in TRIZOL reagent (GibCo / BRL, Grand Island, NY) using 5 ml of reagent per kidney. Whole cell RNA was extracted according to the manufacturer's instructions. 20 의 of RNA was fractionated on a 1.0% agarose / formaldehyde / MOPS (3- (N-morpholino) propanesulfonic acid) gel by electrophoresis at 80 V for 4 hours. The gel was immersed in water for 45 hours and was then washed with Hybond N (uncharged nylon, New England Nuclear, Inc., Boston) by capillary blotting overnight using 750 mM ammonium acetate (in water) , ≪ / RTI > MA). RNA was UV cross-linked to the blot using a Stratalinker (Stratagene, Inc., LaJolla, Calif.). The blots were sonicated and denatured salmon sperm DNA (Sigma Chemical Co.) in 50% formamide, 10 × Denhard's solution, 1 M NaCl, 50 mM Tris-HCl, pH 7.4, 1% SDS, and 200 μg / ml. , St. Louis, Mo.). Probes ( 32 P-labeled cDNA probe fragments) were labeled by random priming at a concentration of 10 9 cpm / μg using a random priming DNA labeling kit (Boeringer Mannheim, Indianapolis, Ind.). The prehybridization and hybridization buffers consisted of 5X saline-sodium citrate buffer (SSC), 5X Denhardt's solution, 0.5% sodium dodecyl sulfate (SDS), and sonicated and denatured salmon semen DNA at 200 μg / ml . The filters were prehybridized for at least 5 hours and then hybridized overnight using a probe of 1 million DPM per ml of hybridization solution (disintegration per minute). The filters were then washed in high stringency (twice 30 min each at 65 [deg.] C in a solution consisting of 300 mM NaCl, 30 mM sodium citrate, and 0.2% sodium dodecyl sulfate in water) Film. The quality of the RNA preparation and the consistency of loading were determined by staining the gel with ethidium bromide and incubating the 18S and 28S ribosomal RNA bands with Gel Imager 2000 digital imaging system instrument and software package, (Applied Imaging, Santa Clara, Calif.). A reasonable ratio of ribosomal bands confirmed that the RNA preparation was of high and consistent quality. Quantitative density measurement scanning only confirmed a 10% change in sample loading. Because of concerns that changes in cellular physiology associated with progressive fibrosis would make such a control probe unreliable, the above tool was used instead of a control probe. Quantitative differences in expression were assessed by fluorescence analysis using BioRad GS-525 phosphorimager (BioRad GS-525 phosphorimager) (Bio Rad, Inc., Hercules, Calif.) And background hybridization was subtracted.
프로브를 상이한 기저막 콜라겐 cDNA의 공지된 서열 및 관련된 단백질에 대한 공지된 서열을 사용한 PCR 증폭에 의해서 쥐 5' 스트레치 cDNA 라이브러리(Clonetech)로부터 분리하였다. 기저막 콜라겐 프로브의 경우에, 보존된 NCl 도메인을 엔코딩하는 서열을 증폭시켰다. 사용된 프라이머 및 조건은 문헌[Miner and Sanes, J. Cell Biol., 127:879-891, 1994]에 기재된 바와 동일하였다. 콜라겐 COL4A1의 경우에, 프라이머[문헌: Muthukumaran et al., J. Biol. Chem., 264:6310-6317, 1989]는 센스, 5'TCTGTGGACCATGGCTTC3' (서열번호 1); 안티센스, 5'TTCTCATGCACACTTGGC3'(서열번호 2)이었다. 콜라겐 COL4A2의 경우에, 프라이머[문헌: Saus et al., J. Biol. Chem., 264:6318-6324, 1989]는 센스, 5'GGCTACCTCCTGGTGAAG3'(서열번호 3); 안티센스, 5'TTCATGCACACTTGGCAG3'(서열번호 4)이었다. COL4A1 및 COL4A2 모두 동일한 조건하에 증폭시켰다. 비리온(a x 106)을 고온 스타트(95℃에서 10 분), 95℃에서 30초, 55℃에서 30초, 및 72℃에서 1 분을 이용한 35 사이클의 PCR 증폭시켰다. 프로브를 서브클로닝시키고 DNA 서열 분석에 의해서 확인하였다.The probes were separated from the murine 5 ' stretch cDNA library (Clonetech) by PCR amplification using known sequences of different basement membrane collagen cDNAs and known sequences for related proteins. In the case of basement membrane collagen probes, the sequence encoding the conserved NCl domain was amplified. The primers and conditions used were the same as described in Miner and Sanes, J. Cell Biol., 127: 879-891, 1994. In the case of collagen COL4A1, a primer (Muthukumaran et al., J. Biol. Chem., 264: 6310-6317, 1989] discloses a sense, 5'TCTGTGGACCATGGCTTC3 '(SEQ ID NO: 1); Antisense, 5'TTCTCATGCACACTTGGC3 '(SEQ ID NO: 2). In the case of collagen COL4A2, a primer (Saus et al., J. Biol. Chem., 264: 6318-6324, 1989) discloses a sense, 5'GGCTACCTCCTGGTGAAG3 '(SEQ ID NO: 3); Antisense, 5'TTCATGCACACTTGGCAG3 '(SEQ ID NO: 4). Both COL4A1 and COL4A2 were amplified under the same conditions. The virion (ax 10 6 ) was amplified by 35 cycles of PCR using high temperature start (95 ° C for 10 minutes), 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute. The probe was subcloned and confirmed by DNA sequencing.
기저막 관련된 단백질에 대한 프로브를 기저막 콜라겐과 동일한 라이브러리로부터 증폭시켰다. 프라이머를 3'서열로부터 취하였다. HSPG 코아 단백질의 경우에, 프라이머[문헌: Noonan et al., J. Biol. Chem., 263:16379-16387, 1988]는 센스, 5'CGGGCCACATTCTCC3'(서열번호 5); 안티센스, 5'GGAGTGGCCGTTGCATT3'(서열번호 6)이었다. 라미닌 B2(Laminin B2)의 경우에, 프라이머[문헌: Sasaki and Yamada, J. Biol. Chem., 262:17111-17117, 1987]는 센스 5'ACCAGTACCAAGGCGGA3'(서열번호 7); 안티센스, 5'TCATTGAGCTTGTTCAGG3'(서열번호 8)이었다. 라미닌 B1의 경우에, 프라이머[문헌: Sasaki et al., Proc. Natl. Acad. Sci. USA, 84:935-939, 1987]는 센스 5'TAGAGGTTATTTTGCAGCAGA3'(서열번호 9); 안티센스 5'TTGGATATCCTCATCAGCTTG3'(서열번호 10)이었다. 엔탁틴(entactin)의 경우에, 프라이머[문헌: Mann et al., EMBO Journal, 8:65-72, 1989]는 센스 5'GTGGTTTACTGGACAGACATC3'(서열번호 11); 안티센스, 5'CCAATCTGTCCAATAAAGG3'(서열번호 12)이었다. 라미닌 A 사슬의 경우에, 프라이머[문헌: Duetzmann et al., Eur. J. Biochem., 177:35-45, 1988]는 센스 5'ACACACTCCAAGCCCACAAAAGCAAG3'(서열번호 13); 안티센스 5'GAGGGAAGACTCCTTGTAGGTCAA3'(서열번호 14)이었다. S-라미닌의 경우에, 프라이머[문헌: Hunter et al., Nature, 338:229-234, 1989]는 센스, 5'GCAGAGCGGGCACGGAGC3'(서열번호 15); 안티센스, 5'TGTACCTGCCATCCTCTCCTG3'(서열번호 16)이었다. PCR 조건은 상기 타입 IV 콜라겐 사슬에 대해서 사용된 조건과 동일하였다.Probes for basement membrane-related proteins were amplified from the same library as basement membrane collagen. Primers were taken from the 3 ' sequence. In the case of HSPG core proteins, primers [Noonan et al., J. Biol. Chem., 263: 16379-16387, 1988] discloses a sense, 5'CGGGCCACATTCTCC3 '(SEQ ID NO: 5); Antisense, 5'GGAGTGGCCGTTGCATT3 '(SEQ ID NO: 6). In the case of laminin B2 (Laminin B2), a primer (Sasaki and Yamada, J. Biol. Chem., 262: 17111-17117, 1987] discloses the sense 5'ACCAGTACCAAGGCGGA3 '(SEQ ID NO: 7); Antisense, 5'TCATTGAGCTTGTTCAGG3 '(SEQ ID NO: 8). In the case of laminin B1, primers (Sasaki et al., Proc. Natl. Acad. Sci. USA, 84: 935-939, 1987) has the sense 5'TAGAGGTTATTTTGCAGCAGA3 '(SEQ ID NO: 9); Antisense 5'TTGGATATCCTCATCAGCTTG3 '(SEQ ID NO: 10). In the case of entactin, a primer (Mann et al., EMBO Journal, 8: 65-72, 1989) has the sense 5'GTGGTTTACTGGACAGACATC3 '(SEQ ID NO: 11); Antisense, 5'CCAATCTGTCCAATAAAGG3 '(SEQ ID NO: 12). In the case of the laminin A chain, primers (Duetzmann et al., Eur. J. Biochem., 177: 35-45, 1988) has the sense 5 'ACACACTCCAAGCCCACAAAAGCAAG3' (SEQ ID NO: 13); Antisense 5'GAGGGAAGACTCCTTGTAGGTCAA3 '(SEQ ID NO: 14). In the case of S-laminin, a primer (Hunter et al., Nature, 338: 229-234, 1989) was synthesized using the sense, 5'GCAGAGCGGGCACGGAGC3 '(SEQ ID NO: 15); Antisense, 5'TGTACCTGCCATCCTCTCCTG3 '(SEQ ID NO: 16). The PCR conditions were the same as those used for the type IV collagen chain.
MMP-2, Timp2, 및 Timp3에 대한 프로브는 RT-PCR에 의해서 13일된 마우스 태아로부터 얻은 전체 RNA를 사용하여 분리하였다. MMP-2를 위한 프라이머 세트는 mRNA로부터의 237 bp 단편을 증폭시키며[문헌: Reponen et al., J. Biol. Chem., 267:7856-7862, 1992], 상류 프라이머 5'CCC CTA TCT ACA CCT ACA CCA3'(서열번호 17) 및 하류 프라이머 5'TGT CAC TGT CCG CCA AAT AAA3'(서열번호 18)을 포함하였다. Timp-2를 위한 프라이머 세트는 mRNA의 195 bp 단편을 증폭시키고[문헌: Shimizu et al., Gene, 114:291-292, 1992], 상류 프라이머 5'CAG AAG AAG AGC CTG AAC CAC A3'(서열번호 19) 및 하류 프라이머 5'GTA CCA CGC GCA AGA ACC3'(서열번호 20)을 포함하였다. Timp-3을 위한 프라이머 세트는 mRNA로부터의 337 bp 단편을 증폭시키고[문헌: Apte et al., Developmental Dynamics, 200:177-197, 1994], 상류 프라이머 5'GGT CTA CAC TAT TAA GCA GAT GAA G3'(서열번호 21) 및 하류 프라이머 5'AAA ATT GGA GAG CAT GTC GGT(서열번호 22)를 포함하였다. 세 가지 프로브 모두에 있어서, 전체 RNA중의 1㎍을 제조자에 의해서 기재된 프로토콜에 따라서 깁코 수퍼스크립트 플러스 역전사효소 및 하류 프라이머를 사용함으로써 역전사시켰다. 반응의 1/10은 PFU 중합효소(Stratagene, Inc.)를 사용하는 40사이클의 고온 스타트 PCR 증폭시켰다.Probes for MMP-2, Timp2, and Timp3 were isolated using total RNA from 13-day-old mouse embryos by RT-PCR. A primer set for MMP-2 amplifies a 237 bp fragment from mRNA (Reponen et al., J. Biol. Chem., 267: 7856-7862, 1992), upstream primer 5'CCC CTA TCT ACA CCT ACA CCA3 '(SEQ ID NO: 17) and downstream primer 5'TGT CAC TGT CCG CCA AAT AAA3' (SEQ ID NO: 18) . A primer set for Timp-2 amplified a 195 bp fragment of mRNA (Shimizu et al., Gene, 114: 291-292, 1992), an upstream primer 5'CAG AAG AAG AGC CTG AAC CAC A3 ' No. 19) and downstream primer 5'GTA CCA CGC GCA AGA ACC3 '(SEQ ID NO: 20). A primer set for Timp-3 amplified a 337 bp fragment from mRNA (Apte et al., Developmental Dynamics, 200: 177-197, 1994), an upstream primer 5'GGT CTA CAC TAT TAA GCA GAT GAA G3 (SEQ ID NO: 21) and downstream primer 5'AAA ATT GGA GAG CAT GTC GGT (SEQ ID NO: 22). For all three probes, 1 μg in total RNA was reverse transcribed by using Gibco superscript plus reverse transcriptase and downstream primer according to the protocol described by the manufacturer. One-tenth of the reactions were amplified by 40 cycles of high temperature start PCR using PFU polymerase (Stratagene, Inc.).
TGF-β1 프로브는 사람 프로브를 필요로 하는 RN아제 보호를 제외하고는 에이취. 엘. 모시스(H.L. Moses)[문헌: Miller et al., Mol. Endodrinol., 3:1926-1934, 1989]로부터 얻었다. 이러한 프로브의 경우에, TGF-β1의 24 염기쌍 단편을 사람 신장 cDNA 라이브러리(Clonetech, Palo Alto, CA)로부터 PCR에 의해서 증폭시켰다. 사용된 프라이머 세트는 GCA GAA GTT GGC ATG GTA G(서열번호 23)(하부) 및 GGA CAT CAA CGG GTT CAC TA(서열번호 24)(상부)였다. 단편을 PFU 중합효소(Statagene)로 재증폭시켰고, pBluescript SK + 플라스미드 내로 블런트 말단 연결시켰다.TGF-β1 probes are except for RNase protection, which requires human probes. L. Moses (H. L. Moses [Miller et al., Mol. Endodrinol., 3: 1926-1934, 1989]. For these probes, 24 base pair fragments of TGF-? 1 were amplified by PCR from human renal cDNA library (Clonetech, Palo Alto, Calif.). The primer set used was GCA GAA GTT GGC ATG GTA G (SEQ ID NO: 23) (lower) and GGA CAT CGG GTT CAC TA (SEQ ID NO: 24) (upper). The fragment was reamplified with PFU polymerase (Statagene) and blunt end ligated into pBluescript SK + plasmid.
B. 원위치 하이브리드화: 신장을 초기에 완만한 경심장 관류(PBS중의 4% 파라포름알데히드를 사용)에 의해서 고정시켰다. 동물을 먼저 아버틴(Avertin)(2,2,2-트리브로모에탄올, Aldrich Chemical Co., Milwalkee, WI)을 사용하여 심마취시켰다. 흉부 공동을 개방하고, 투베르쿨린 니들(tuberculin needle)로 천공함으로써 우심실에 작은 구멍을 형성시켜서 관류액이 배출되게 하였다. 관류 완충액을 함유하는 30ml 주사기에 연결된 제 2의 투베르쿨린 니들을 좌심실의 정점에 삽입하였다. 분당 약 3ml의 속도로 체중 g당 1ml의 고정제를 관류시켰다. 적합하게 고정된 신장은 단단하였고, 대리석 무늬의 외관을 나타냈다. 관류 후에, 신장 캡슐을 홍체 겸자로 제거하고, 신장을 세로로 절반으로 절단하고(신우, 수질 및 피질을 이등분함), 추가로 한 시간 동안 4℃에서 고정제내에 위치시켰다. 고정된 반쪽들을 파라핀에 포매시키고, 6㎛으로 절단하고, 수퍼프로스트 플러스 현미경 슬라이드(SUPERFROST PLUS microscope slide)(Fisher Scientific, Inc., Pittsberg, PA)상으로 옮겼다. 슬라이드를 60℃의 슬라이드 가온기 상에서 20분 동안 베이킹시키고, 사용될 때까지 4℃에서 저장하였다(슬라이드는 6 주일까지 유용하다). 대조군 및 앨포트 동복자로부터의 신장을 하이브리드화 과정 동안 초래될 수 있는 미세한 차이를 조절하기 위해서 나란히 포매시켰다.B. In situ hybridization: The kidney was initially fixed with gentle light heart perfusion (using 4% paraformaldehyde in PBS). Animals were first anesthetized using Avertin (2,2,2-tribromoethanol, Aldrich Chemical Co., Milwaukee, Wis.). The thoracic cavity was opened and puncture with a tuberculin needle to form a small hole in the right ventricle to allow perfusion fluid to be drained. A second tuberculin needle connected to a 30 ml syringe containing perfusion buffer was inserted at the apex of the left ventricle. 1 ml of fixative per gram of body weight was perfused at a rate of about 3 ml per minute. The properly fixed elongation was hard and showed a marble pattern appearance. After perfusion, the kidney capsules were removed with irrigating forceps, the kidneys were cut longitudinally in half (renal, water and cortex split) and placed in fixative at 4 ° C for an additional hour. The fixed halves were embedded in paraffin, cut to 6 μm and transferred onto a SUPERFROST PLUS microscope slide (Fisher Scientific, Inc., Pittsberg, Pa.). Slides were baked on a 60 ° C slide warmer for 20 minutes and stored at 4 ° C until used (slides are available up to 6 weeks). The kidneys from the control and Alport co-workers were embedded side by side to control the microscopic differences that could result during the hybridization process.
슬라이드를 60℃의 진공 오븐에서 1시간 동안 가온하고, 크실렌에서 3회 연속 2분 세척으로 탈왁스시켰다. 조직을 에탄올 중에서 탈수시키고, 0.2N HCl에서 15분 동안 인큐베이팅함으로써 단백질제거시키고, PBS로 세척하고, 37℃에서 10분 동안 3㎍/ml의 프로테이나제 K(Boehringer Mannheim, Indianapolis, IN)로 소화시켰다. PBS중의 2mg/ml 글리신으로 세척함으로써 소화를 중지시켰다. 등급화된 에탄올 용액중의 조직의 탈수(실온에서 각각 10분 동안 70%, 80%, 90%, 100%)후에, 조직을 예비하이브리드화시키고, 하이브리드화시키고, 이하와 같은 변화를 주면서 제니우스 원위치 하이브리드화 키트(Genius in situ Hybridization Kit)(Boehringer Mannheim, Indianapolis, IN)와 함께 기재된 프로토콜에 따라서 세척하였다. 예비 하이브리드화 및 하이브리드화 용액 둘 모두에서, 10mg/ml의 페놀/클로로포름-추출된 베이커 효모 tRNA가 포함되었다. 이러한 단계는 비특이적 신호를 현저하게 감소시켰다. 하이브리드화 후에, 조직을 50℃의 2X SSC에서 2회 세척하고, 이어서, 실온에서 6분 동안 RN아제 A로 소화시켰다. RN아제 A의 양을 각각의 프로브에 대해서 측정하였다(200ng/ml 내지 5㎍/ml 범위). 음성 대조 프로브는 세균 β-갈락토시다제 또는 네오마이신 포스포트랜스페라제에 대한 코딩서열을 포함한다. 모든 프로브는 길이가 약 200개 염기였으며 BlueScript SK+(Statagene, Inc., LaJolla, CA)의 SacI 부위 내로 클로닝되고, T3 측으로부터 전사되었다(선형화 후에). 유일한 예외는 974 염기이며 pmT 벡터 내로 클로닝된 TGF-β1이였다.The slides were heated in a vacuum oven at 60 DEG C for 1 hour and dewaxed by xylene for 3 consecutive 2 minute washes. The tissue was dehydrated in ethanol, protein removed by incubation in 0.2N HCl for 15 min, washed with PBS and incubated with 3 [mu] g / ml Proteinase K (Boehringer Mannheim, Indianapolis, Digested. Digestion was stopped by washing with 2 mg / ml glycine in PBS. After tissue dehydration (70%, 80%, 90%, 100% for 10 minutes each at room temperature) in graded ethanol solution, the tissue was prehybridized, hybridized, And washed according to the protocol described with the Genius in Situ Hybridization Kit (Boehringer Mannheim, Indianapolis, Ind.). Both prehybridization and hybridization solutions contained 10 mg / ml phenol / chloroform-extracted Baker's yeast tRNA. This step significantly reduced the nonspecific signal. After hybridization, the tissue was washed twice in 2X SSC at 50 DEG C and then digested with RNase A for 6 minutes at room temperature. The amount of RNase A was measured for each probe (ranging from 200 ng / ml to 5 / / ml). Negative control probes include a coding sequence for bacterial [beta] -galactosidase or neomycin phosphotransferase. All probes were about 200 bases in length and were cloned into the SacI site of BlueScript SK + (Statagene, Inc., LaJolla, Calif.) And transcribed from the T3 side (after linearization). The only exception was 974 bases and TGF-? 1 cloned into the pmT vector.
C. RN아제 보호 검정: 실험은 키트와 함께 제공된 프로토콜에 따라서 RPAⅡ 키트(Ambion, Inc., Austin, TX)를 사용하여 수행하였다. 프로브의 경우에, TGF-β1의 264 염기쌍을 사람 신장 cDNA 라이브러리(Clonetech, Palo Alto, CA)로부터 PCR에 의해서 증폭시켰다. 사용된 프라이머 세트는 GCA GAA GTT GGC ATG GTA G(서열번호 25)(하부) 및 GGA CAT CAA CGG GTT CAC TA(서열번호 26)(상부)였다. 단편을 PFU 중합효소(Stratagene)로 재증폭시키고, pBluescript SK+ 플라스미드(Stratagene)내로 블런트 말잔 연결시켰다. 안티센스 프로브를 T7 프로모터로부터 생성시켰다.C. RNase Preservation Assay: The experiment was performed using an RPA II kit (Ambion, Inc., Austin, Tex.) According to the protocol provided with the kit. For the probe, 264 base pairs of TGF- [beta] l were amplified by PCR from human renal cDNA library (Clontech, Palo Alto, Calif.). The primer set used was GCA GAA GTT GGC ATG GTA G (SEQ ID NO: 25) (lower) and GGA CAT CGG GTT CAC TA (SEQ ID NO: 26) (upper). The fragment was reamplified with PFU polymerase (Stratagene) and blunt-ended into pBluescript SK + plasmid (Stratagene). Antisense probes were generated from the T7 promoter.
D. 면역형광분석: 신선한 신장을 제거하고, 3mm 두께 절편으로 절단하고, 티슈 테크 OCT(Tissue Tek OCT) 수성 화합물(product number 4583, Miles Laboratories, Elkhart, IN)에 포매시키고, -150℃ 냉동기에 넣어 동결시켰다. 절편을 마이크롬 타입 HM505N(Zeiss, Inc., Walldorf, Germany) 저온유지장치를 사용하여 3미크론으로 절단하고, 폴리-L-리신-코팅된 슬라이드 상에서 해동시켰다. 슬라이드는 기저막 콜라겐 특이적 항체로 염색하는데 사용되는 경우에는 냉(-20℃) 95% 에탄올에 침지시키거나, 기저막 관련 단백질에 특이적인 항체로 염색하는 경우에는 냉(20℃) 아세톤에 침지시킴으로써 15분 동안 고정시켰다. 슬라이드를 밤새 공기 건조시키고, 사용될 때까지 -80℃에서 건조 저장하였다.D. Immunofluorescence analysis Fresh kidneys were removed and cut into 3 mm sections and embedded in Tissue Tek OCT aqueous compound (product number 4583, Miles Laboratories, Elkhart, IN) And frozen. The sections were cut to 3 microns using a microchrome type HM505N (Zeiss, Inc., Walldorf, Germany) cryostat and defrosted on poly-L-lysine-coated slides. The slides are immersed in 95% ethanol in cold (-20 ℃) when they are used for staining with basement membrane collagen-specific antibodies, or in 15 (15 ℃) acetone in case of staining with antibodies specific for basement membrane- Min. Slides were air dried overnight and stored dry at -80 ° C until used.
샘플을 주위온도에 도달하게 하고, 이어서 실온의 PBS(pH 7.4)중에서 3회 세척하였다. 타입 IV 콜라겐에 대한 항체로 염색하는 경우에, 조직을 0.1M 글리신과 6M 우레아(pH 3.5)로 예비 처리하여 단백질을 변성시키고 항원성 부위를 노출시켰다. 1차 항체의 적절한 희석액(실험적으로 측정됨)을 샘플에 가하고, 가습된 박스 중의 5℃에서 3시간 동안 반응되게 하였다. 항체를 PBS(pH 7.4)중의 5% 탈지 분유의 용액 내로 희석시켰다. 탈지 분유의 사용은 배경 형광을 실질적으로 감소시켰다. 샘플을 실온에서 각각 10분 동안 PBS(pH7.4)에서 4회 세척하여 1차 항체를 제거하고, 이어서, 적절한 FITC-콘쥬게이션된 2차 시약과 반응시켰다. 모든 2차 시약을 희석제로서 PBS중의 7% 탈지 분유를 사용하여 1:100 희석액으로 사용하였다. 2차 시약을 4℃에서 2시간 동안 반응시켰다. 슬라이드를 이어서 냉 PBS(pH7.4)로 4회 세척한 후에, 안티-페이드 마운팅 배지(anti-fade mounting media)(Vector Laboratories, Inc., Burlingame, CA)를 적용시켰다. 샘플을 투명한 손톱 광택제를 사용하여 유리 커버 슬립 하에 밀봉하였다. 슬라이드를 1000 배율로 사진 촬영하였다. 존스 실버 메텐아민 염색을 플라스틱 포매된 표본 상에서 수행하였다.Samples were allowed to reach ambient temperature and then washed three times in room temperature PBS (pH 7.4). When staining with antibodies against type IV collagen, the tissue was pretreated with 0.1 M glycine and 6 M urea (pH 3.5) to denature the protein and expose the antigenic site. A suitable dilution of the primary antibody (experimentally determined) was added to the sample and allowed to react for 3 hours at 5 캜 in a humidified box. The antibody was diluted into a solution of 5% skim milk in PBS (pH 7.4). The use of skim milk powder substantially reduced background fluorescence. Samples were washed 4 times in PBS (pH 7.4) for 10 minutes each at room temperature to remove the primary antibody and then reacted with the appropriate FITC-conjugated secondary reagent. All secondary reagents were used as 1: 100 dilutions in 7% skim milk powder in PBS as diluent. The secondary reagent was reacted at 4 ° C for 2 hours. The slides were then washed four times with cold PBS (pH 7.4) followed by anti-fade mounting media (Vector Laboratories, Inc., Burlingame, Calif.). The sample was sealed under a glass cover slip using a transparent nail polish. The slides were photographed at 1000 magnifications. Jones silver methenamine staining was performed on plastic embedding specimens.
COL4A1 및 COL4A2에 대한 염소 항혈청을 서던 바이로테크놀로지(Southern Biotechnology, Inc., Birmingham, AL)로부터 구매하였다. 이러한 항체는 제조자에 의해 교차 반응성에 대해서 시험되었고, 이들 사슬에 대한 다른 항체 제제에 대해서 관찰된 것과 일치하는 사구체에서의 염색 패턴을 생성시켰다[문헌: Miner and Sanes, J. Cell. Biol., 127:879-891, 1994]. 항-헤파린 술페이트 프로테오글리칸(HSPG) 항체는 EHS 마우스 종양으로부터 정제된 HSPG 코아 단백질에 대해서 발생된 랫트 모노클로날 항체이다. 항체는 제조자(Chemicon International, Temecula, CA)에 의해 웨스턴 블롯 및 도트 블롯 면역검정 및 문헌[문헌: Horiguchi et al., J. Histochem. Cytochem., 37:961-970, 1989]에 기재된 바와 같이 라미닌, 콜라겐 타입 IV, 피브로넥틴, 및 엔탁틴과의 교차 반응에 대해서 시험되었다. 안티-라미닌-1 항체는 토끼 항혈청이다. 면역원은 EHS 기저막으로부터 정제되었고 시그마 이뮤노케미칼스(Sigma Immunochemicals, St. Louis, MO)로부터 구매하였다. 제조자(Sigma)에 의해 수행된 도트 블롯 면역검정으로 콜라겐 IV, 피브로넥틴, 비트로넥틴, 및 콘트로이틴 술페이트 타입 A, B, 및 C에 대한 교차반응성의 부재를 확인하였다. 항-피브로넥틴은 사람 혈장으로부터 정제된 피브로넥틴에 대해서 생성된 토끼 항혈청이다. 이러한 항 피브로넥틴은 제조자(Sigma Immunochemicals)에 의해 도트 블롯 면역검정을 사용하여 콜라겐 IV, 라미닌, 비트로넥틴, 및 콘드로이틴 술페이트 A, B, 및 C에 대한 교차 반응성에 대해서 시험되었다. 항-엔탁틴은 면역원으로서 EHS 유도된 엔탁틴을 사용하여 생성시킨 랫트 모노클로날 항체이다. 이러한 시약은 업스테이트 바이오테크놀로지 인코포레이티드(Upstate Biotechnology Incorporated, Lake Placid, NY)로부터 구매하였으며, 웨스턴 블롯 분석에 의해서 다른 주요 기저막 성분과의 교차 반응성의 부재 뿐만 아니라 적절한 면역활성에 대해서 시험되었다[문헌: Ljubimov et al., Exp. Cell Res., 165:530-540, 1986].Chlorine antisera for COL4A1 and COL4A2 were purchased from Southern Biotechnology, Inc., Birmingham, AL. These antibodies were tested for cross-reactivity by the manufacturer and produced a staining pattern in the glomeruli consistent with those observed for other antibody preparations for these chains [Miner and Sanes, J. Cell. Biol., 127: 879-891, 1994). Anti-heparin sulfate proteoglycan (HSPG) antibody is a rat monoclonal antibody raised against HSPG core protein purified from EHS mouse tumors. Antibodies were detected by Western blot and dot blot immunoassay by the manufacturer (Chemicon International, Temecula, Calif.) And by Horiguchi et al., J. Histochem. Cytochem., 37: 961-970, 1989, for cross-reactivity with laminin, collagen type IV, fibronectin, and entmotin. The anti-laminin-1 antibody is a rabbit antiserum. The immunogen was purified from the EHS basement membrane and purchased from Sigma Immunochemicals (St. Louis, Mo.). The dot blot immunoassay performed by the manufacturer (Sigma) confirmed the absence of cross reactivity for collagen IV, fibronectin, vitronectin, and controitin sulfate types A, B, and C. Anti-fibronectin is a rabbit antiserum raised against fibronectin purified from human plasma. These anti-fibronectins were tested for cross-reactivity to collagen IV, laminin, bitronectin, and chondroitin sulfate A, B, and C using a dot blot immunoassay by the manufacturer (Sigma Immunochemicals). Anti-enstatin is a rat monoclonal antibody produced using EHS-induced enstatine as an immunogen. These reagents were purchased from Upstate Biotechnology Incorporated (Lake Placid, NY) and tested for proper immune activity as well as absence of cross reactivity with other major basement membrane components by western blot analysis [ Ljubimov et al., Exp. Cell Res., 165: 530-540, 1986).
면역형광 및 존스 염색된 이미지를 기록하고 어플라이드 이미징 사이토비젼 울트라 이미지 분석 시스템(Applied Imaging Cytovision Ultra image analysis system)(Applied Imaging Inc.)와 인터페이스된 올림프스 BH2 RFLA 형광현미경을 사용하여 처리하였다. 이미지는 고분해능 흑백 비디오 카메라를 사용하여 포착하였다. 이들 이미지를 시스템 소프트웨어를 사용하여 변화시켰다. 이미지를 처리하는데 있어서, 현미경상에서 직접적으로 관찰된 형광에 아주 근접되도록 주의를 하였다.Immunofluorescence and Jones stained images were recorded and processed using an Olympus BH2 RFLA fluorescence microscope interfaced with an Applied Imaging Cytovision Ultra image analysis system (Applied Imaging Inc.). Images were captured using a high resolution black and white video camera. These images were changed using system software. In the processing of the images, care was taken to closely approximate the fluorescence directly observed on the microscope.
E. 이뮤노퍼옥시다제 검출(Immunoperoxidase Detection): 이뮤노퍼옥시다제 검출 방법을 관상간극(tubulointerstitium)중의 피브로넥틴 및 콜라겐 타입 I 뿐만 아니라 사구체중의 TGF-β1에 대한 면역염색에 사용하였다. 콜라겐 타입 I 항체는 토끼 항-마우스이며, 바이오지너시스, 인코포레이티드(Biogenesis, Inc.)(Sandown, NH)로부터 구매하였다. 항혈청을 이뮤노퍼옥시다제 염색을 위하여 1:100 희석액으로 사용하였다. 사용된 피브로넥틴 항체는 면역형광염색에 대한 것과 동일한 항체를 사용하였으며(시그마 케미칼 컴파니(Sigma Chemical Company, St. Louis, MO)로부터의 토끼 항-사람 피브로넥틴 항혈청), 1:100 희석액으로 사용하였다. 2차 시약을 벡터 라보라토리즈(Vector laboratories)(Burlingame, CA)로부터 구매한 비오티닐화된 항-토끼 항체이며, 1:100의 희석액으로 사용하였다. 조직을 파라핀에 포매시키고(원위치 하이브리드화에 대해서 기재된 방법과 동일한 방법을 이용), 3미크론으로 절단시켰다. 탈파라핀화된 절편을 100mM 트리스-HCl(pH 7.4)중의 5㎍의 프로테이나제 K(Boehringer Mannheim, Indianapolis, IN)로 예비 처리하여 에피토프를 노출시켰다. 프로테이나제 소화는 PBS중의 2mg/ml 글리신중에서 30초 동안 인큐베이팅함으로써 중지시켰다. 탈왁스화된 프로테이나제 K-처리된 조직을 PBS로 3회 세척하고, 1차 항체와 실온에서 1시간 동안 반응시키고, PBS로 3회 세척하고, 이어서 비오티닐화된 2차 항체와 실온에서 1시간 동안 반응시켰다. PBS(pH7.4)로 3회 세척한 후에, 슬라이드를 스트렙트아비딘 호스 라디쉬 퍼옥시다제(streptavidin horse radish peroxidase)(3㎍/ml, Vector Laboratories)와 함께 실온에서 30분 동안 인큐베이팅하였다. PBS로 3회 세척한 후에, 항체 결합을 제조자에 의해 기재된 방법에 따라서 AEC 기질 시스템(Vector AEC SK-4200, Vector Laboratories)으로 현색시켰다.E. Immunoperoxidase Detection: Immunoperoxidase detection method was used for immunostaining TGF-β1 in glomeruli as well as fibronectin and collagen type I in tubulointerstitium. The collagen type I antibody is a rabbit anti-mouse, purchased from Biogenesis, Inc. (Sandown, NH). Antiserum was used as a 1: 100 dilution for immunoperoxidase staining. The used fibronectin antibody used was the same antibody for immunofluorescence staining (rabbit anti-human fibronectin antiserum from Sigma Chemical Company, St. Louis, MO) as a 1: 100 dilution. Secondary reagents were biotinylated anti-rabbit antibodies purchased from Vector laboratories (Burlingame, Calif.) And used as a 1: 100 dilution. Tissues were embedded in paraffin (using the same procedure described for in situ hybridization) and cut to 3 microns. The deparaffinized sections were pretreated with 5 μg of Proteinase K (Boehringer Mannheim, Indianapolis, IN) in 100 mM Tris-HCl (pH 7.4) to expose the epitope. Proteinase digestion was stopped by incubating for 30 seconds in 2 mg / ml glycine in PBS. The dewaxed proteinase K-treated tissue was washed three times with PBS, reacted with the primary antibody for one hour at room temperature, washed three times with PBS, and then incubated with the biotinylated secondary antibody at room temperature For 1 hour. After three washes with PBS (pH 7.4), the slides were incubated with streptavidin horse radish peroxidase (3 ug / ml, Vector Laboratories) at room temperature for 30 minutes. After washing three times with PBS, antibody binding was developed with an AEC substrate system (Vector AEC SK-4200, Vector Laboratories) according to the method described by the manufacturer.
TGF-β1의 경우에, 1차 항체는 PBS(모든 항체에 대해 희석제로서 사용되었다)중의 7% 탈지 분유로 1:15 희석액으로 사용된 치킨 α-사람 TGF-β1이었다. 이를 실온에서 3시간 이상 반응시켰다. 2차 항체는 TGF-β1(Vector Laboratories Burlingame, CA)에 대한 비오티닐화된 염소 항-치킨이었으며, 1:100 희석액으로 적용되었으며, 1시간 이상 동안 반응시켰다. 3회 세척 후에, 이뮤노퍼옥시다제 검출을 AEC 키트(Vector LAboratories, Burlingame, CA)를 사용하여 수행하였다.In the case of TGF-? 1, the primary antibody was chicken α-human TGF-β1 used as a 1:15 dilution in 7% skim milk in PBS (used as diluent for all antibodies). This was reacted at room temperature for 3 hours or more. The secondary antibody was a biotinylated goat anti-chicken against TGF-β1 (Vector Laboratories Burlingame, Calif.), Applied as a 1: 100 dilution and allowed to react for at least 1 hour. After three washes, the Immunoperoxidase detection was performed using an AEC kit (Vector LAboratories, Burlingame, Calif.).
실시예 1Example 1
앨포트/α1 인테그린 이중 돌연변이체의 생산Production of Alport / a1 integrin double mutants
앨포트 증후군의 상염색체형에 대한 마우스 모델을 본 발명 이전에 기재된 문헌[Cosgrove et al., Genes Dev., 10:2981-2992, 1996]에 기재된 바와 같이 COL4A3 프로콜라겐 유전자의 표적화된 돌연변이발생에 의해서 생성시켰다. 이러한 마우스 모델은 본원에서 "앨포트 마우스(Alport mouse)"라 일컬어지며, 접수 번호 2908로 바 하버, 메인(Bar Harbor, Maine)에 소재하는 잭슨 라보라토리즈(Jackson Laboratories)로부터 입수가능하다. 129 Sv/J 배경 상태에 있는 이러한 α3(IV) 녹아웃 마우스를 교잡하여(순종 129 Sv에 이어서 순종 129 Sv인 인테그린 α1 영(null) 마우스로 5회 연속 역교잡), 97.5% 이상 순종 129 Sv인 "이중 녹아웃" 마우스를 생성시켰다. α1 녹아웃 마우스는 미국 캘리포니아 라졸라(LaJolla, CA)에 소재하는 스크립스 인스티튜트(Scripps Institute)의 험프레이 가드너(Humphrey Gardner)에 의해서 제공되었고, 문헌[Gardner et al., Dev. Biol., 175:301-313, 1996]에 기재되어 있다.A mouse model for autosomal form of Alport syndrome is shown in the targeted mutagenesis of the COL4A3 procollagen gene as described in the prior art [Cosgrove et al., Genes Dev., 10: 2981-2992, 1996] ≪ / RTI > This mouse model is referred to herein as an " Alport mouse ", available from Jackson Laboratories, Bar Harbor, Maine, under accession number 2908. These α3 (IV) knockout mice in the 129 Sv / J background state were hybridized (consecutive 129 Sv followed by consecutive five consecutive reverse hybridization with 129 Sv integrin α1 null mice), over 97.5% obese 129 Sv A " double knockout " mouse was created. alpha 1 knockout mice were provided by Humphrey Gardner of the Scripps Institute, LaJolla, Calif., and are described by Gardner et al., Dev. Biol., 175: 301-313, 1996.
실시예 2Example 2
마우스 모델중의 앨포트 신장 질환 진행의 검정Test of Alport's kidney disease progression in mouse model
본 실시예에서 연구된 마우스는 콜라겐 α3(IV)을 발현시키지 않으며 α1 인테그린(잭슨 라보라토리즈(Jackson Laboratories, Bar Harbor, Maine)로부터 얻음)에 대해서는 정상인 앨포트 마우스, 및 콜라겐 α3(IV) 또는 인테그린 α1을 발현시키지 않는 이중 녹아웃(즉, 이중 돌연변이체)을 포함한다. 이중 돌연변이체는 97.5% 129 Sv 및 2.5% Sv/J 배경이었다.The mice studied in this example do not express collagen alpha 3 (IV) and are normal adult mice for alpha 1 integrin (obtained from Jackson Laboratories, Bar Harbor, Maine) and collagen alpha 3 (IV) or And a double knockout (i.e., a double mutant) that does not express integrin alpha 1. The double mutants were 97.5% 129 Sv and 2.5% Sv / J background.
마우스로부터 일주일 간격으로 뇨를 수집하고, 단백질 분석을 방법 부분에서 기재하고 있는 바와 같이 수행하였다. 도 1에 도시된 바와 같이, 콜라겐 α3(IV)을 발현시키지 않으며 α1 인테그린에 대해서 정상인 동물의 경우에, 단백뇨의 발증에 의해서 측정되는 앨포트 신장 질환 발병에 대한 평균 주령(6 마리에 대한 연구)은 3.5주 내지 4주였다. 단백뇨는 신속하게 진행하여, 6조 내지 6.5주의 주령에서 피크 수준에 도달하였다. 이러한 제노타입의 동물(9 마리가 시험됨)은 주령 9주를 초과하여 생존하지 못했다. 혈액 우레아 질소 수준(BUN)은 주령 7 내지 7.5주에서 상승하였다. 이중 돌연변이체(4 마리가 이들 측정에 시험됨)에서, 단백뇨의 발증은 주령 5 내지 5.5주였으며, 보다 서서히 진행되어, 9주 내지 9.5주에 피크 수준에 도달하였다. 신부전증에 기인된 평균 사망 주령은 15주 내지 16.5주였다. 발병된 동물은 주령 10 내지 11주에서 BUN이 상승하였다.Urine was collected from mice at weekly intervals and protein analysis was performed as described in the Methods section. As shown in FIG. 1, in the case of animals that do not express collagen alpha 3 (IV) and are normal for alpha 1 integrin, the average weekly (six studies on) the onset of Alport's kidney disease as measured by the onset of proteinuria, Was from 3.5 weeks to 4 weeks. Proteinuria progressed rapidly, reaching a peak level at 6 to 6.5 weeks of age. These genotypic animals (9 tested) did not survive beyond 9 weeks of age. The blood urea nitrogen level (BUN) increased from 7 to 7.5 weeks old. In a double mutant (four tested in these measurements), the onset of proteinuria was between 5 and 5.5 weeks old and progressed more slowly, reaching a peak level between 9 and 9.5 weeks. The average age of death due to renal failure was 15 to 16.5 weeks. BUN was elevated at 10 to 11 weeks of age in the affected animals.
실시예 3Example 3
이중 녹아웃 마우스 모델의 특성화Characterization of a dual knockout mouse model
세 가지의 상이한 동물 세트(정상 대조군, α3(IV) 유전자를 발현시키지 않으며 α1 인테그린에 대해서 정상인 동물(앨포트 마우스), 및 이중 돌연변이체)를 많은 상이한 기술을 이용하여 주령 4 내지 7주에서 분석하였다.Three different animal sets (normal controls, animals that did not express the? 3 (IV) gene and normal to the? 1 integrin (Alport mouse), and double mutants) were analyzed at 4 to 7 weeks old using many different techniques Respectively.
투과 전자 현미경 분석을 수행하여 기저막 통합성을 평가하였다. 주령 4주(데이터는 기재되지 않음)에서, 앨포트 동복자는 100%의 사구체 모세관 루프(loop)중에서 희박화된 기저막을 나타냈다. 이중 돌연변이체는 약간의 사구체 기저막(GEM) 희박화(즉, 불규칙적인 비후화, 박화, 및 분열)를 나타냈지만, 이는 드물고 거의 확장되어 있지 않았다. 이중 돌연변이 중의 약 20%의 사구체는 명백한 기저막 희박화를 전혀 나타내지 않았다. 이 시점에서 앨포트 마우스중의 약 5%의 사구체는 섬유증이지만, 이중 돌연변이 동복자에서는 섬유증 사구체가 발견되지 않았다. 도 2는 주령 7주까지의 이들 상이한 마우스의 사구체 기저막 손상 특성의 정도를 도시하고 있다. 전형적인 사구체 모세혈관 루프가 예시되고 있다. 이러한 발생 시점의 앨포트 마우스중의 사구체 기저막은 사실상 모든 사구체에서 심하게 손상되어 있다. 도 2B에서 전체 불규칙 비후화 및 박화, 및 족세포 푸트 프로세스(podocyte foot process)의 광범위한 소멸이 명백히 나타난다. 그러나, 이중 녹아웃에서는(도 2C), GBM은 대부분의 경우에 약간의 작은 불규칙성 이외에는 초미세구조적으로 정상이며, 족세포의 푸트 프로세스는 정상의 구조를 유지한다(도 2A의 정상 마우스에 대해서 화살표로 나타낸 영역을 도 2C에서의 이중 녹아웃 마우스와 비교). 이러한 시점에서, 앨포트 마우스에서 30% 내지 50%의 사구체가 섬유증인 반면, 이중 돌연변이 동물에서는 5% 미만이 섬유증이었다.Transmission electron microscopy analysis was performed to evaluate basement membrane integrity. At week 4 weeks (data not shown), the Alport adherent showed a diluted basement membrane in a 100% glomerular capillary loop. The dual mutants exhibited some glomerular basement membrane (GEM) dilatation (ie, irregular hypertrophy, thinning, and division), but this was rare and rarely extended. About 20% of the glomeruli in the double mutants did not show any apparent basement membrane dilatation. At this point, approximately 5% of glomeruli in Alport mice are fibrosis, but fibrosis glomeruli were not found in the double mutant. Figure 2 shows the extent of glomerular basement membrane damage properties of these different mice by week 7 weeks. A typical glomerular capillary loop is illustrated. The basement membrane of glomeruli in Alport mice at this time of occurrence is severely damaged in virtually all glomeruli. In FIG. 2B, the overall irregular hypertrophy and thinning, and the extensive disappearance of the podocyte foot process are evident. However, in the double knockout (Fig. 2C), GBM is super-microstructurally normal except for some small irregularities in most cases, and the foot process of the podocytes maintains the normal structure (arrows The area shown is compared to the double knockout mouse in Figure 2C). At this point, 30% to 50% of glomeruli in Alport mice were fibrosis, while in double mutant animals, less than 5% were fibrosis.
주령 7주의 마우스의 주사 전자 현미경 분석(데이타는 기재되지 않음)은 앨포트 마우스가 족세포의 푸트 프로세스의 현저한 팽화를 나타내어, 이들 세포의 정상적으로 안정하고 복잡한 구조를 파괴하였음을 나타내었다. 이러한 푸트 프로세스의 소멸은 앨포트 사구체신염에 대해서 기재되어 왔다. 이중 돌연변이에서는, 구조는 완벽하지 않지만, 대조 마우스로부터의 사구체에서 관찰된 구조와 아주 유사하였다. 이러한 푸트 프로세스의 팽화는 사구체 필터의 차단의 원인이며, 요독증을 초래한다. 따라서, 이러한 발견은 앨포트 동복자에 비하여 이중 돌연변이체에서 개선된 사구체 기능과 관련하여 현저하다.Scanning electron microscopy analysis (data not shown) of 7 weeks old mice showed that Alport mouse showed a significant expansion of the foot process of the podocyte, destroying the normally stable and complex structure of these cells. The disappearance of this foot process has been described for Alport glomerulonephritis. In double mutants, the structure was not perfect, but very similar to the structure observed in glomeruli from control mice. This enlargement of the foot process causes blocking of the glomerular filter and leads to uremic disorder. Thus, this finding is significant with respect to improved glomerular function in dual mutants as compared to Alport's copulation.
주령 7주의 마우스로부터 얻은 전체 신장의 파라핀 포매된 검경판을 존스 방법(Jones's Method)을 이용하여 염색하고 섬유증 사구체의 총수를 계수하였다(데이터는 기재되지 않음). 실질적으로는 앨포트 마우스로부터의 모든 사구체는 어느 정도 영향을 받았다. 대부분은 사구체 과세포충실성 및 메산쥼 매트릭스의 확장을 나타내었고, 약 1/3이 섬유증이었다. 반면, 이중 돌연변이 마우스로부터 사구체는 메산쥼 매트릭스 및 세포충실성에 관해서 대개 정상이었다. 약 25%는 메산쥼 세포 증식의 증거를 나타냈고, 5%는 섬유증이었다. 분석을 두 가지의 상이한 마우스 세트에서 반복하여 매우 유사한 결과를 얻었다.Whole-height paraffin embedded specimens from 7 week old mice were stained using the Jones's Method and the total number of fibrosed glomeruli was counted (data not shown). In effect, all glomeruli from Alport mice were affected to some extent. Most of them showed enlargement of glomerular taxa and mesangial matrix, and about one third of them were fibrosis. On the other hand, glomeruli from dual mutant mice were normal in terms of mesangial matrix and cell fidelity. Approximately 25% showed evidence of mesangial cell proliferation, and 5% had fibrosis. The assay was repeated on two different sets of mice to obtain very similar results.
면역형광 분석을 동일한 동물로부터 얻은 동결된 신피질을 사용하여 수행하였다. 이러한 조직을 앨포트 신장 질환 진행의 작용으로 GBM에서 축적되는 것으로 공지된 단백질에 특이적인 항체와 반응시켰다. 이들에는 라미닌-1(Lam-1)(1:200 희석액으로 사용됨), 콜라겐 α1(IV) 및 α2(IV) 사슬(COL 4A1,2)(1:15 희석액으로 사용됨), 피브로넥틴(Fib)(1:200 희석액으로 사용됨), 헤파린 술페이트 프로테오글리칸(HSP)(1:100 희석액으로 사용됨), 및 엔탁틴(ent)(1:200 희석액으로 사용됨)이 포함된다. 모든 항체를 PBS 중의 7% 탈지분유로 희석하였다. 결과를 도 3에 도시한다. 주령 7주에서, 모든 이들 성분은 대조군에 비하여 앨포트 마우스의 GBM에서 현저하게 상승하였다. 섬유증 사구체에서는, 모든 이들 성분이 풍부하였다. 이중 돌연변이체에서, 콜라겐 α1(IV) 및 α2(IV) 사슬에 대한 면역염색은 비섬유증 사구체내의 앨포트 마우스에 대한 면역염색과 대등하였다. 이러한 사항은 이중 돌연변이체에서 GBM의 타입 IV 콜라겐 조성이 앨포트 마우스에서의 조성(즉, 오직 콜라겐 α1(IV) 및 α2(IV) 사슬만을 포함)과 동일하기 때문에 예측되고 있다. 라미닌-1 및 헤파린 술페이트 프로테오글리칸에 대한 염색은 앨포트 마우스에 비하여 이중 돌연변이체의 GBM에서 현저하게 감소하였고(도 3F를 도 3E와, 도 3L을 도 3K와 각각 비교), 앨포트 마우스(도 3H)의 GBM에서 풍부한 이중 돌연변이(도 3I)의 GBM에서의 피브로넥틴에 대한 명확한 염색은 없었다. 이들 단백질에 대한 메산쥼 매트릭스에서의 면역염색은 이중 돌연변이체와 앨포트 마우스 사이에서 대등하였지만, 헤파린 술페이트 프로테오글리칸의 경우에, 메산쥼 염색은 정상의 대조(도 3J) 또는 앨포트 마우스(도 3K)에 비하여 이중 돌연변이(도 3L)에서 감소하였다.Immunofluorescence analysis was performed using frozen cinnabia from the same animal. These tissues were reacted with antibodies specific for proteins known to accumulate in GBM due to the action of Alport renal disease progression. These include laminin-1 (used as a 1: 200 dilution), collagen α1 (IV) and α2 (IV) chains (COL4A1,2) (used as a 1:15 dilution), fibronectin (Used as a 1: 200 dilution), heparin sulfate proteoglycan (HSP) (used as a 1: 100 dilution), and enstatin (used as a 1: 200 dilution). All antibodies were diluted in 7% skim milk powder in PBS. The results are shown in Fig. At 7 weeks of age, all these components were significantly elevated in the GBM of Alport mice as compared to the control. In the fibrosis glomeruli, all these components were abundant. In the double mutants, immunostaining for the collagen alpha 1 (IV) and alpha 2 (IV) chains was comparable to immunostaining for allport mice in nonfibrillary glomeruli. This is predicted because the type IV collagen composition of GBM in double mutants is identical to the composition in Alport mice (ie, only the collagen α1 (IV) and α2 (IV) chains are included). The staining for laminin-1 and heparin sulfate proteoglycans was significantly reduced in the GBM of double mutants compared to ALPT mice (Fig. 3F and Fig. 3L vs. Fig. 3K, respectively) 3H) of the double mutant (Figure 3I) enriched in GBM was not clearly stained for fibronectin in GBM. Immunostaining for these proteins in the mesangial matrix was comparable between the double mutants and allport mice, but in the case of heparin sulfate proteoglycans, mesangial staining was normal (Figure 3J) ) (Fig. 3L).
노턴 블롯 분석은 주령 7주의 정상 마우스, 앨포트 마우스 및 이중 돌연변이 마우스로부터의 전체 신피질로부터 분리된 RNA를 사용하여 수행하였다. 20㎍의 각각의 RNA 샘플을 아가로즈 겔에서 분별시키고, 모세관 블롯에 의해서 나일론으로 옮기고, 일부의 마우스 TGF-β1 cDNA에 상응하는 방사성 표지된 프로브에 하이브리드화시켰다. 일련의 높은 엄격성 세척 후에, 막을 X-레이 필름에 노출시켰다. 도 9는 TGF-β1은 앨포트 마우스(대조군인 왼쪽으로부터 두 번째 레인과 비교된 왼쪽으로부터의 4번째 레인)에서 유도된 반면, α1 인테그린 돌연변이(이중 녹아웃)(대조군인 왼쪽으로부터의 두 번째 레인과 비교된 왼쪽으로부터의 세 번째 레인)가 잠복된 앨포트 마우스에서는 유도되지 않음을 나타내고 있다. 이는 α1 저해제의 효과가 TGF-β1의 억제에 의해서 조정될 수 있는지를 생각하게 하는 데이터이다. 따라서, 이하 기재되고 있는 TGF-β1 저해제 실험은 이러한 문제를 명백히 밝혀내기 위하여 수행하였다.Norton blot analysis was performed using RNA isolated from whole cortex from 7 week old normal, alltx and double mutant mice. 20 μg of each RNA sample was fractionated on an agarose gel, transferred to nylon by capillary blotting, and hybridized to a radio-labeled probe corresponding to some mouse TGF-β1 cDNA. After a series of high stringency washes, the films were exposed to X-ray film. Figure 9 shows that TGF- [beta] l was induced in Alport mice (the fourth lane from the left compared to the second lane from the control), while the alpha 1 integrin mutation (double knockout) Compared to the third lane from the left) is not induced in latent albomas. This is data that suggests whether the effect of the? 1 inhibitor can be modulated by inhibition of TGF-? 1. Therefore, the TGF-beta 1 inhibitor experiment described below was carried out to clarify this problem.
실시예 4Example 4
단백뇨 이후 앨포트 신장 질환 진행에서 TGF-β1의 역할The role of TGF-β1 in the progression of Alport's kidney disease after proteinuria
조직은 C57B1/6 배경으로의 129 Sv/J 파운더(founder) 동물의 F-2 역교배로부터 얻었다(상기 참조). 실험은 2회 이상 수행하였다(두 가지의 상이한 동물 세트로부터의 표본 상에서). 본원에 기재된 데이터에 대한 결과는 명백하며 일관되었다.Tissues were obtained from F-2 reverse mating of 129 Sv / J founder animals in the C57B1 / 6 background (see above). Experiments were performed more than once (on a sample from two different animal sets). The results for the data described herein were clear and consistent.
이들 실험은 두가지 점을 예증하기 위하여 수행하였다. 첫 번째는 앨포트 신장 질환 진행의 작용으로 축적되는 매트릭스 단백질을 엔코딩하는 mRNA 및 TGF-β1 mRNA의 유도 사이에 일시적인 상호관련이 있는가이며, 두 번째는 이들 mRNA가 사구체에서 실질적으로 유도되는가 하는 것이다(신장의 습윤 중량의 단지 5%가 사구체이기 때문에, 전체 신피질중의 특이적 mRNA의 유도가 진행성 섬유증 및 사구체신염의 문제와 더욱 관련이 있다).These experiments were performed to illustrate two points. The first is whether there is a temporal correlation between the mRNA encoding matrix proteins accumulated by the action of Alport's kidney disease progression and the induction of TGF-? 1 mRNA, and the second is whether these mRNAs are substantially induced in the glomeruli Since only 5% of the wet weight of the kidney is a glomeruli, the induction of specific mRNA in the whole cortex is more related to the problems of progressive fibrosis and glomerulonephritis.
주령 6주에서 시작하여 주령 12주까지 2주 간격으로 앨포트 동물과 대조 동복자의 신장으로부터 전체 RNA를 분리하였다. 본 연구에 사용된 F2 마우스에서의 단백뇨는 마우스가 주령 약 5.5 내지 6주일 때 시작되었다(데이터는 기재되지 않음). RNA를 변성된 아가로즈 겔 상에서 분별시키고, 나일론 지지체로 옮기고, α1(IV) 또는 α2(IV) 콜라겐 사슬, 엔탁틴, 라미닌 β1 또는 β2 사슬, 피브로넥틴, 또는 TGF-β1에 특이적인 방사성 표지된 프로브로 프로빙하였다. 도 4에서의 결과는 라미닌 β1을 제외하고는 상기 모든 단백질에 대한 mRNA가 앨포트 마우스 모델에서의 단백뇨의 발증 후에 유도됨을 예시한다.Total RNA was isolated from adult kidneys and control kidneys starting at week 6 and week 12 until week 12. Proteinuria in F2 mice used in this study started when the mice were about 5.5 to 6 weeks old (data not shown). The RNA is fractionated on a denatured agarose gel and transferred to a nylon support and labeled with a radiolabeled probe specific for the? 1 (IV) or? 2 (IV) collagen chain, enstatin, laminin? 1 or? 2 chain, fibronectin, or TGF-? Lt; / RTI > The results in FIG. 4 illustrate that mRNA for all of the above proteins, except for laminin beta 1, is induced after the onset of proteinuria in the Alportmouse model.
상기와 동일한 시간경과에 대한 노턴 블롯을 또한 라미닌 α1, 라미닌 β2, 라미닌 γ1, 헤파린 술페이트 프로테오글리칸 코아 단백질, 및 콜라겐 α4(IV), 및 α5(IV) 사슬(데이터는 기재되지 않음)에 대해서 수행되었다. 이들 다른 기저막 단백질에 대한 mRNA 수준에서의 현저한 차이는 대조군을 돌연변이체와 비교하는 경우에 명확하지 않았다.The Norton blot for the same time lapse as above was also performed on laminin alpha 1, laminin beta 2, laminin gamma 1, heparin sulfate proteoglycan core protein, and collagen alpha 4 (IV), and alpha 5 (IV) . Significant differences in mRNA levels for these other basement membrane proteins were not apparent when the control was compared to the mutants.
노턴 분석의 결과는 시간경과 동안의 특이적 mRNA 발현에서의 상대적인 변화를 직접적으로 정량하는 인영상기를 사용함으로써 분석되었다. 도 5는 특이적 mRNA 수준의 유도가 주령 6주, 또는 비뇨기 공간내의 단백질이 F2 마우스에서 최대수준에 달하는 시간 부근에서 최초로 나타남을 예시하고 있다[문헌: Cosgrove et al., Genes Dev., 10:2981-2992, 1996]. 8주까지, mRNA 수준이 피크가 되며, TGF-β1과 피브로넥틴을 엔코딩하는 mRNA는 각각 대조군의 마우스에 비해서 6.6 배 및 9.4배 더 유도되었다. 콜라겐 α1(IV), α2(IV), 및 엔탁틴에 대한 mRNA 수준은 모두 8주까지 3배 유도되었다. 반면, 라미닌 β1 및 β2 사슬을 엔코딩하는 mRNA에서의 현저한 변화는, 동일한 전체 RNA 노턴 블롯에 의해서 측정될 때, 신장 질환 진행중의 어느 시점에서도 관찰되지 않았다.The results of the Norton analysis were analyzed by using the Infrared spectrophotometer to directly quantify relative changes in specific mRNA expression over time. Figure 5 illustrates that induction of specific mRNA levels first appears at week 6, or near time, where proteins in the urinary space reach maximum levels in F2 mice [Cosgrove et al., Genes Dev., 10: 2981-2992, 1996]. By 8 weeks, mRNA levels peaked and mRNAs encoding TGF-β1 and fibronectin were induced 6.6-fold and 9.4-fold more, respectively, than control mice. MRNA levels for collagen alpha 1 (IV), alpha 2 (IV), and enstatin were all three fold induced up to 8 weeks. On the other hand, significant changes in mRNA encoding the laminin [beta] l and [beta] 2 chains, when measured by the same total RNA Norton blot, were not observed at any time during kidney disease progression.
TGF-β1을 엔코딩하는 mRNA, 또는 상이한 기저막 성분이 특정의 사구체 세포유형에서 유도되었는지를 시험하기 위해서, mRNA에 특이적인 디곡시게닌-표지된 안티센스 프로브를 사용하여 원위치 하이브리드화를 수행하였다. PBS중의 4% 파라포름알데히드에 의한 심장 관류 후에 10주 된 F2 앨포트 마우스 및 정상의 대조 동복자로부터 신장을 수집하여, 방법 부분에 기재된 원위치 하이브리드화 분석을 위해서 처리하였다. 안티센스 프로브는 콜라겐 α1(IV), TGF-β1, 피브로넥틴, 엔탁틴, 또는 라미닌 β1 사슬의 NC1 도메인에 특이적이었다. 세균 β-갈락토시다제에 특이적인 프로브를 비특이적 결합에 대한 대조(음성 대조)로서 사용하였는데, 그 이유는 이러한 프로브를 노턴 블롯(데이터는 기재되지 않음)상에서 전체 마우스 신장 RNA에 하이브리드화시키지 않았기 때문이다. 대조 프로브를 각각의 특이적 프로브와 동일한 시간에서 하이브리드화시키고, 하이브리드화 과정 후에 동일한 농도의 RN아제 A로 처리하였다. RN아제 A 처리를 α1(IV), TGF-β1, 및 피브로넥틴에 대해서는 0.25㎍/ml으로 수행하였고, 엔탁틴 및 라미닌 β1에 대해서는 3㎍/ml로 수행하였다. 결과를 도 6에 나타내었다.In-situ hybridization was performed using mRNA-specific digoxigenin-labeled antisense probes to test whether mRNA encoding TGF-? 1, or different basement membrane components were induced in a particular glomerular cell type. After cardiac perfusion with 4% paraformaldehyde in PBS, kidneys were collected from 10-week-old F2 allmouth mice and normal control subjects and processed for in situ hybridization analysis as described in the method section. The antisense probes were specific for the NC1 domain of collagen alpha 1 (IV), TGF-beta 1, fibronectin, enstatin, or laminin beta 1 chain. A probe specific for bacterial [beta] -galactosidase was used as a control (negative control) for non-specific binding because such probes were not hybridized to whole mouse kidney RNA on Norton blots (data not shown) Because. Control probes were hybridized at the same time as each specific probe and treated with the same concentration of RNase A after the hybridization procedure. RNase A treatment was performed at 0.25 / / ml for α1 (IV), TGF-β1, and fibronectin, and at 3 μg / ml for enstatin and laminin β1. The results are shown in Fig.
도 6의 결과는, 시험된 모든 특이적 mRNA의 경우에, COL4A3 녹아웃 마우스(앨포트 마우스)에서의 사구체의 내장 상피 세포(족세포)에서 상승된 수준이 명백하게 관찰됨을 예시하고 있다. 콜라겐 α1(IV) 사슬의 경우에, 대조에서 mRNA의 발현이 사구체의 메산쥼 세포 및 내피 세포 둘 모두에서 관찰되는데(도 6A), 이러한 결과는 이들 분자가 성숙한 동물에서 국재되어 있는 곳과 일치하고 있다. 돌연변이체에서는, 대조 샘플에서의 메산쥼 세포 염색과 비교하여 보다 어둡게 염색되는 것으로 입증되는 바와 같이, 메산쥼 매트릭스에서의 발현이 상승될 수 있지만, 대조 및 돌연변이체 사이의 가장 명백한 차이는 족세포에 상응하는 사구체의 외부 경계선에 늘어선 염색된 세포의 고리이다(도 6B). 대조 사구체에서의 피브로넥틴 발현은 메산쥼 세포에서 주로 관찰되었다(도 6D). 메산쥼 세포에서의 염색이 또한 돌연변이체에서 관찰되지만, 족세포는 명백하게 현저한 수준의 피브로넥틴 mRNA를 발현하고 있다(도 6E). TGF-β1의 발현은 대조 동물의 사구체에서 아주 약하지만, 약간의 특이적 염색이 대조 동물의 메산쥼 세포에서 관찰된다(도 6G). 돌연변이 체에서, TGF-β1 mRNA 수준은 메산쥼 세포, 내피세포, 및 또한 족세포에서 현저하게 상승되었다(도 6H). 엔탁틴의 경우에, mRNA가 대조군의 족세포에 국재화되는데, 이는 이 단백질이 GBM에 특이적으로 국재화되어 있기 때문에 예측할 수 없는 것이 아니다. 우연히도, 약간의 메산쥼 세포 특이적 염색이 대조군 동물에서 관찰된다. 돌연변이체에서의 내장 상피 세포의 염색이 상승된 발현을 나타내는 듯하지만, 이러한 사항은 정량적인 검정이 아니며, 대조와 돌연변이체 사이의 차이가 넘 작아 명확하지 않다(도 6J를 도 6K와 비교).The results of FIG. 6 illustrate that elevated levels in intestinal epithelial cells (podocytes) of glomeruli in COL4A3 knockout mice (Alport mice) are clearly observed in the case of all the specific mRNAs tested. In the case of the collagen? 1 (IV) chain, mRNA expression in the control is observed in both mesangial and endothelial cells of the glomeruli (Fig. 6A), consistent with where these molecules are localized in mature animals have. In the mutants, although expression in the mesangial matrix may be elevated, as evidenced by darker staining compared to mesangial cell staining in control samples, the most obvious difference between the control and mutants is that in the pancreatic cells Is a loop of stained cells lined up at the outer boundary of the corresponding glomeruli (Fig. 6B). Fibronectin expression in the control glomeruli was mainly observed in mesangial cells (Fig. 6D). Staining in mesangial cells is also observed in the mutants, but the pod cells apparently express a significant level of fibronectin mRNA (Fig. 6E). Expression of TGF- [beta] 1 is very weak in the glomeruli of control animals, but some specific staining is observed in the mesangial cells of control animals (Fig. 6G). In mutants, TGF-beta 1 mRNA levels were significantly elevated in mesangial, endothelial, and also progenitor cells (Fig. 6H). In the case of enstatin, mRNA is localized to the pancreatic cells of the control, which is not unpredictable because this protein is specifically localized to GBM. Incidentally, some mesangial cell-specific staining is observed in control animals. Although staining of visceral epithelial cells in the mutants may represent elevated expression, this is not a quantitative assay, and the difference between the control and the mutant is less clear (Fig. 6J vs. Fig. 6K).
노턴 블롯은 라미닌 β1 사슬에 대한 mRNA 수준이 시간경과를 통하여 시종일관 대조 대 돌연변이체에서 변화되지 않았음을 나타냈다. 이러한 동일한 메시지에 대한 원위치 하이브리드화 분석은 대조 신장으로부터의 사구체에서 예측되는 메산쥼 세포 특이적 국재화를 예시하였다(도 6M). 그러나, 돌연변이 마우스로부터의 사구체에서는, mRNA가 내장 상피 세포에서 명백하게 유도된다(도 6N).The Norton blot showed that the level of mRNA for the laminin β1 chain was not changed in the control versus mutant over time. In situ hybridization analysis of this same message demonstrated mesangial cell-specific localization predicted by glomeruli from control elongation (Figure 6M). However, in the glomeruli from mutant mice, mRNA is apparently induced in intestinal epithelial cells (Fig. 6N).
조직 샘플을 주령 3주 및 5주에서 수거하고, 동일한 프로브를 사용한 원위치 하이브리드화에 의해서 분석하였다. 이들 사구체에서의 염색 패턴은 정상의 동복자 패턴과는 식별할 수 없었다(데이터는 기재되지 않음). 이러한 결과는 족세포에서의 이들 유전자의 활성화가 단백뇨의 개시 후에 발생됨을 시사한다.Tissue samples were collected at week 3 and week 5 and analyzed by in situ hybridization using the same probe. The staining patterns in these glomeruli were indistinguishable from normal cotyledon patterns (data not shown). These results suggest that activation of these genes in podocytes occurs after onset of proteinuria.
사이토카인의 활성 이소형에 특이적인 항체를 사용한 이뮤노퍼옥시다제 검출에 기초한 TGF-β1 단백질 데이터는 TGF-β1 mRNA에 대한 원위치 하이브리드화 분석에 의해서 얻은 데이터를 입증한다(도 7B의 면역염색을 도 7A와 비교). 이러한 결과는 족세포내의 TGF-β1 mRNA의 상승된 발현이 상승된 단백질로 번역됨을 설명하고 있다.TGF-β1 protein data based on detection of an immune oxidase using an antibody specific for the active isoform of cytokines demonstrate data obtained by in situ hybridization analysis of TGF-β1 mRNA (see FIG. 7B for immunohistochemistry 7A). These results demonstrate that elevated expression of TGF-β1 mRNA in podocytes is translated into elevated protein.
RN아제 보호 분석은 사이토카인에 대한 mRNA 수준이 앨포트 대 대조 환자로부터의 사람 신피질에서도 상승되는지를 측정하기 위해서 수행하였다. 사람 앨포트 신피질을 15세 소년으로부터 이식수술 동안 제거하였다. 표본은 중간 수준으로 난절(scarification)하였으며, 약 50%의 사구체 섬유증이 있었다. 표본을 즉시 제거하여 액체 질소중에서 스냅 동결시켰다. 정상의 사람 신장 RNA은 클로네테크(Clonetech)(Palo Alto, CA)로부터 구매하였고, 정상의 사람 공급원 컬렉션으로부터의 집단 샘플이었다. 앨포트 표본으로부터의 RNA를 마우스 신장에 사용된 방법과 동일한 방법을 사용하여 분리하였다. RNA를 아가로즈 겔 상에서 10㎍으로 분별시키고 에티듐 브로마이드로 겔을 염색(물 중의 10㎍/ml)함으로써 통합성에 관하여 시험하였다. 정상의 샘플 및 앨포트 샘플 모두는 28S 및 18S 리보솜 RNA 밴드의 상대적인 양을 기준으로 손상이 없었다. RN아제 보호 시험을 상기 방법에 따라서 수행하였다. 도 8에서의 데이터는 대조군과 비교하여 사람 앨포트 신피질에서 TGF-β1 mRNA의 3 내지 4배 상승을 예시한다. 이러한 결과는 사이토카인이 사람 앨포트 신장에서도 과발현되고 있음을 입증한다. 이러한 데이터는 본 기술이 인체에 적용될 가능성을 실증하고 있다.RNase protection analysis was performed to determine whether mRNA levels for cytokines were elevated in ALP versus human cortex from control patients. The human Alportocin was removed from the 15-year-old boy during transplant surgery. The sample was scarified to a moderate level and had about 50% of glomerulonephrosis. The specimen was immediately removed and snap frozen in liquid nitrogen. Normal human kidney RNA was purchased from Clonetech (Palo Alto, Calif.) And was a population sample from the normal human source collection. RNA from the Alport sample was isolated using the same method used for mouse elongation. RNA was fractionated to 10 상에서 on agarose gel and tested for integrity by staining the gel with ethidium bromide (10 ug / ml in water). Both normal and alport samples were intact based on the relative amounts of 28S and 18S ribosomal RNA bands. The RNase inhibition test was performed according to the above method. The data in FIG. 8 illustrate a 3- to 4-fold increase in TGF-? 1 mRNA in human alphal cortex compared to the control. These results demonstrate that cytokines are also overexpressed in human albatross kidneys. These data demonstrate the potential of the technology to be applied to the human body.
실시예 5Example 5
α1β1 인테그린을 차단하기 위한 중화 항체의 용도Use of neutralizing antibodies to block alpha 1 beta 1 integrin
리간드와 α1β1 인테그린의 상호작용을 차단할 수 있는 가용성 약제가 α1 유전자 녹아웃 돌연변이에서와 동일한 앨포트 신장 질환 발병에 대한 효과를 생성시킬 수 있음을 설명하고자 하는 예로서, 문헌[Fabbri et al., Tissue Antigens, 48:47-51, 1996]에 기재된 항체를 얻었다. 이러한 항체를 주령 2주에서 시작하여 앨포트 마우스내로 주사(400ng/주사, 주 3회, 복강내)하였다. 동물을 주령 6주에 모아서, 기저막을 투과 전자 현미경분석으로 분석하였다. 도 10에서 입증되고 있는 바와 같이, 이들 처리된 동물의 기저막은 대개 규칙적이며, 정상의 3층 외관을 가지고 있었다. 항체에 대한 면역반응에 기인하는 내피 세포 팽화가 관찰되었다. 이들 결과는 인테그린 α1β1 수용체를 차단하는 가용성 약제가 이중 녹아웃 마우스주에서 관찰되는 바와 동일한 방식으로 앨포트 GBM 질환 진행을 지연시킬 것임을 설명하고 있다.As an example to illustrate that a soluble agent capable of blocking the interaction of a ligand with an integrin integrin can produce an effect on the onset of Albert kidney disease as in the alpha 1 gene knockout mutant, Fabbri et al., Tissue Antigen , 48: 47-51, 1996]. These antibodies were injected (400 ng / injection, three times per week, intraperitoneally) into Alport mice starting at week 2. The animals were harvested at 6 weeks of age and the basement membrane was analyzed by transmission electron microscopy. As demonstrated in Figure 10, the basement membrane of these treated animals was usually regular and had a normal three-layer appearance. Endothelial cell swelling due to an immune response to the antibody was observed. These results demonstrate that soluble agents that block the integrin [alpha] 1 [beta] l receptor will retard ALTOBM disease progression in the same manner as observed in the double knockout mouse strain.
실시예 6Example 6
앨포트(129 Sv/J) 마우스 모델에서 TGF-β1 억제 단독에 의한 효과Effect of TGF-β1 Inhibitor alone in the Alport (129 Sv / J) mouse model
실험 프로토콜은 FK506(2㎍/체중g, 복강내 주사, Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan), 또는 가용성 TGF-β1 수용체(25㎍/주사, 꼬리 정맥을 통하여 정맥내 주사, Biogen Inc., Cambridge, MA)을 주령 3주에서 시작하여 주 2회 주사하는 것이었다. 신장을 주령 7주에 수집하여 기재된 분석을 실시하였다.The experimental protocol was as follows: intravenous injection via FK506 (2 ug / g body weight, intraperitoneal injection, Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan) or soluble TGF- ., Cambridge, Mass.) Were injected twice a week starting at week 3. Kidneys were collected at 7 weeks of age and analyzed.
다양한 조건하에서 기저막의 초미세구조에 대한 투과 전자 현미경 분석이 도 11에 도시되어 있다. 도 11A는 정상의 미처리된 동물로부터 얻은 사구체 모세혈관 루프를 나타낸다. 규칙적인 푸트 프로세스와 3층 기저막 염색을 주지해야 한다. 도 11B는 전형적인 주령 7주의 129Sv/J 앨포트 마우스로부터의 모세혈관 루프를 나타낸다. GBM의 팽화된 푸트 프로세스 및 전체적인 소상 비후화(gross focal thickening)를 주지해야 한다. 도 11C는 FK506으로 처리된 주령 7주의 앨포트 마우스로부터의 전형적인 모세혈관 루프를 예시하는 도면이다. 기저막 비후화가 없음이 명백하며, 이는 약물이 GBM에서의 매트릭스 축적율을 감소시키는 것을 시사한다. 그러나, 푸트 프로세스 구조의 명백한 결핍과 함께 푸트 프로세스에서 현저한 정도의 팽화 존재한다. 동일한 결과가 TGF-β1 가용성 수용체를 주사한 마우스에서 관찰된다(도 11D). 이러한 데이터는 TGF-β1 저해제가 불규칙적인 GBM 비후화를 억제할 수 있지만, 진전된 앨포트 GBM 질환과 관련된 푸트 프로세스 구조에서의 변화를 억제할 수 없음을 예시한다.Transmission electron microscopy analysis of the microstructure of the basement membrane under various conditions is shown in Fig. Figure 11A shows a glomerular capillary loop obtained from normal, untreated animals. Regular foot processes and 3-layer basement membrane staining should be noted. Figure 11B depicts a capillary loop from a 129Sv / J altomouse of typical week 7 weeks. It should be noted that GBM's expanded foot process and overall gross focal thickening. FIG. 11C is a diagram illustrating a typical capillary loop from a 7 week old Alport mouse treated with FK506. It is evident that there is no basolateral hypertrophy, suggesting that the drug reduces the matrix accumulation rate in GBM. However, there is a significant degree of puffing in the foot process with an apparent lack of foot process structure. The same results are observed in mice injected with TGF-? 1 soluble receptors (FIG. 11D). These data illustrate that TGF- [beta] 1 inhibitors can suppress irregular GBM hypertrophy, but can not inhibit changes in the foot process structure associated with advanced ALT GBM disease.
일부의 신장 표본을 주사 전자 현미경으로 관찰하였다. 사구체를 신피질의 동결 파쇄에 의해서 노출시키고, 보우만 캡슐(Bowman's capsule)을 제거하여, 사구체의 모세혈관을 덮고 있는 족세포의 외층을 노출시켰다. 정상의 사구체는 도 12A에 도시되고 있으며, 도 12A에서 족세포의 복잡한 구조는 가지화 푸트 프로세스가 모세혈관 루프 주위를 둘러싸고 있다는 명백한 증거이다. 전형적인 주령 7주의 앨포트 마우스에서, 사구체의 족세포의 표면은 미세한 필라멘트성 가지가 팽화에 의해 소실되어 명백하게 결여되어 있다(도 12B). TGF-β1에 대한 가용성 수용체 또는 FK506으로 처리된 앨포트 동물에서, 사구체의 표면은 미처리된 앨포트 마우스에서의 표면과 매우 동일하다(도 12C). 이러한 결과는 TGF-β1만의 차단은 진전된 앨포트 사구체 질환과 관련된 푸트 프로세스 구조의 변화에 대하여는 방지하지 않음을 명백하게 입증하고 있다.Some kidney specimens were observed with a scanning electron microscope. The glomeruli were exposed by freezing of the renal cortex and the Bowman's capsule was removed to expose the outer layer of pods covering the capillaries of the glomeruli. The normal glomeruli are shown in Fig. 12A, and the complex structure of the pod cells in Fig. 12A is clear evidence that the divider foot process surrounds the capillary loop. In a typical 7 week old Alport mouse, the surface of the glomeruli cell line is clearly lacking due to the disappearance of fine filamentous branches by expansion (Fig. 12B). In albumin animals treated with soluble receptors for TGF- [beta] 1 or FK506, the surface of the glomeruli is very similar to the surface in untreated Alport mice (Fig. 12C). These results clearly demonstrate that blockade of TGF-? 1 alone does not prevent changes in the foot process structure associated with advanced Alport glomerular disease.
단백뇨는 약물 처리 동안 일주일 간격으로 수집한 동결건조된 뇨의 폴리아크릴아미드 겔 전기영동에 의해서 측정하였다. 상기한 바와 같이, 뇨중의 알부민의 존재 및 다량의 알부민은 사구체 필터의 통합성에 대한 종합적인 펑가를 제공한다. 도 13은 TGF-β1 저해제의 투여가 단백뇨의 발증을 지연시키지만, 뇨중 알부민의 높은 수준으로의 진행은 매우 신속(1주일)하게 발생됨을 설명하고 있다. 이러한 결과는 TGF-β1 저해제가 단독으로 사용되는 경우 단백뇨의 발증은 지연시키지만 사구체 필터를 개선시키지는 않음을 시사한다. 이러한 특성은 이들 저해제가 상기기재되고 도 11 및 도 12에 설명되고 있는 족세포의 푸트 프로세스 소멸을 방지하지 못하는 것과 직접적으로 관련되는 듯하다.Proteinuria was measured by polyacrylamide gel electrophoresis of lyophilized urine collected weekly during drug treatment. As mentioned above, the presence of albumin in urine and a large amount of albumin provide a comprehensive overview of the integrity of the glomerular filter. Figure 13 demonstrates that administration of a TGF- [beta] 1 inhibitor delayed the onset of proteinuria but progressed rapidly to high levels of urinary albumin (one week). These results suggest that TGF-β1 inhibitors may delay the onset of proteinuria when used alone but not improve glomerular filtration. This property appears to be directly related to the fact that these inhibitors do not prevent the foot process extinction of the pedigree cells described above and illustrated in Figures 11 and 12. [
정상의 동복자에게 약물을 투여한 결과 주사하지 않은 정상의 마우스와 비교할 때 식별가능한 차이가 없었음을 주지해야 한다.It should be noted that the administration of the drug to normal subjects did not have a discernible difference when compared to a non-injected normal mouse.
실시예 7Example 7
이중 녹아웃 (DKO) 마우스에 대한 TGF-β1 저해제의 효과Effect of TGF-β1 Inhibitor on Double Knockout (DKO) Mice
마우스(콜라겐 α3(IV) 및 인테그린 α1 유전자 양자 모두가 없는 DKO 마우스)에게 주령 약 4주에 시작하여 TGF-β1 저해제 FK506(2㎍/체중g, 주 2회, 복강내 주사) 또는 비오겐사의 TGF-β1 가용성 수용체(주사당 25㎍, 주 2회, 정맥내 주사)을 주사하였다. 신장을 주령 약 10주에 수집하여 분석하였다. 주령 10주 시점을 선택하였고, 이는 이중 녹아웃에서 전형적으로 GBM의 현저한 불규직적인 비후화가 관찰되는 정도까지 질환이 진행되고, 동물이 말기의 신부전증으로 진행되기 시작하기 때문이다. 따라서, TGF-β1 저해제가 추가의 보호 잇점을 제공한다면, 이러한 잇점은 GBM 질환 진행의 말기에 명백할 것이다. 투과 전자 현미경 분석은 저해제를 주사한 마우스와 미처리된 이중 녹아웃 마우스 사이에서 아주 명백하고 일관된 차이를 나타냈다. 이러한 차이의 전형적인 예는 도 14에 설명되어 있다. 도 14B는 주령 10주의 이중 녹아웃 마우스에서의 사구체 모세혈관 루프의 전형적인 특징을 설명하고 있다. 주지할 만한 사항은 앨포트 사구체신염을 진행시키는 기저막 비후화 특성의 현저한 포켓이다. 족세포의 푸트 프로세스는 진행 질환 상태에서도 잘 발육된 슬릿 횡경막과 함께 고도의 규칙적인 구조를 지니고 있다. 이중 녹아웃 마우스의 이러한 특성은 앨포트 마우스에서는 없는 특성이다(푸트 프로세스를 도 12B에 도시된 푸트 프로세스와 비교).(DKO mice lacking both collagen alpha 3 (IV) and integrin alpha 1 genes), starting at about 4 weeks per week and infusing the TGF- beta 1 inhibitor FK506 (2 [mu] g / body weight g, twice a week, intraperitoneally) TGF-? 1 soluble receptor (25 μg per week, twice a week, intravenous injection) was injected. Kidneys were collected and analyzed at about 10 weeks of age. A 10 week old age was chosen because the disease progresses to such an extent that a significant uneven obesity of GBM is typically observed in a double knockout and the animal begins to progress to terminal renal failure. Thus, if TGF-beta 1 inhibitors provide additional protection benefits, these benefits will be apparent at the end of the GBM disease progression. Transmission electron microscopy showed a very clear and consistent difference between the mice injected with the inhibitor and the untreated double knockout mice. A typical example of such a difference is illustrated in FIG. Figure 14B illustrates typical characteristics of a glomerular capillary loop in a 10 week old double knockout mouse. It is important to note that this is a significant pocket of basement membrane hyperplasia that promotes Alport's glomerulonephritis. The foot process of podocytes has a highly regular structure with slit diaphragm well developed even in advanced disease condition. This characteristic of a dual knockout mouse is characteristic of an Alport mouse (compare the foot process with the foot process shown in FIG. 12B).
이중 녹아웃 마우스가 TGF-β1 저해제로 처리되는 경우에, 소상 GBM 비후화 및 푸트 프로세스 소멸의 현저한 감소가 있었다(도 14C는 FK506으로 처리된 마우스이며, 도 14D는 가용성 TGF-β1 수용체로 처리된 마우스이다). 대부분 사구체의 GBM은 완전하게 정상인 초미세구조를 지니지 못하지만(도 14D에서 명백한 중간의 GBM 불규칙성을 주시), 이 발생 단계에서 미처리된 이중 녹아웃 동물(도 14B)의 대부분의 사구체 모세혈관에서 명백한 GBM 비후화의 현저한 포켓이 완전히 결여되어 있다. 이러한 방식으로 시험된 약 25%의 사구체에서, TGF-β1 저해제는 DKO 사구체가 정상의 마우스의 사구체와 구별될 수 없을 정도로 사구체 초미세구조를 회복시켰다(도 15A는 주령 10주 정상 마우스의 GBM을 나타내며; 도 15B는 FK506으로 처리된 주령 10주 이중 녹아웃의 GBM을 나타낸다). 이러한 결과가 비조작된 앨포트 동물 모델에서 말기 신부전의 평균 주령의 2주 후라는 것을 검토하여 보면, 이러한 결과는 실제로 독특하고 놀라운 발견이다.When double knockout mice were treated with the TGF- [beta] l inhibitor, there was a significant reduction in small phase GBM hypertrophy and foot process extinction (Figure 14C is mouse treated with FK506 and Figure 14D shows mice treated with soluble TGF- to be). Most GBMs of the glomeruli do not have a perfectly normal superficial structure (see the apparent intermediate GBM irregularity in Figure 14D), but the apparent GBM thickening in most glomerular capillaries of untreated double knockout animals (Figure 14B) It is completely lacking in the remarkable pockets of fire. In about 25% of the glomeruli tested in this manner, the TGF- [beta] 1 inhibitor restored the glomerular hyperfine structure to such an extent that the DKO glomeruli could not be distinguished from the glomeruli of normal mice (Figure 15A) 15B shows the GBM of a 10 week old double knockout treated with FK506). Considering that these results are two weeks after the mean week of end-stage renal failure in an untreated ALP animal model, these results are actually unique and surprising findings.
단백뇨는 이들 동일한 마우스에서 치료 동안 매주 수집하여 시험하였다. 샘플(1ml의 약 1/2과 동일)을 폴리아크릴아미드 겔 상에서 전기영동에 의해서 분석하였다. 알부민을 쿠마시 블루로 염색하여 가시화시켰다. 도 16에 나타낸 결과는 FK506(도 16D) 또는 TGF-β1에 대한 가용성 수용체(도 16B)에 의한 두 처리 모두가 미처리된 이중 녹아웃 마우스(도 16A)에 비해서 사구체 필터의 성능을 상당히 개선시킴을 설명하고 있다. 도 16C는 FK506으로 처리된 정상의 마우스에 대한 뇨중 단백질을 나타낸다. 주목할 만한 사항은 FK506으로 처리된 DKO 마우스 및 정상 마우스 둘 모두(도 16D)에서 모든 시점에서 명백한 확산 군의 밴드이다. 이러한 결과는 약물로 처리된 마우스에서 항상 관찰되며, 이는 이식 후에 약물로 처리된 일부 환자에서 보고된 신독성 효과와 관련되는 듯하다[문헌: Solez et al., Transplantation, 66:1736-1740, 1998].Proteinuria was collected and tested weekly during treatment in these same mice. Samples (equivalent to about 1/2 of 1 ml) were analyzed by electrophoresis on polyacrylamide gels. Albumin was visualized by staining with Coomassie blue. The results shown in FIG. 16 demonstrate that both treatments with FK506 (FIG. 16D) or soluble receptors (FIG. 16B) for TGF-β1 significantly improve the performance of glomerular filter compared to untreated double knockout mice (FIG. 16A) . Figure 16C shows urinary protein for normal mice treated with FK506. Notable are the bands of the apparent diffusion group at all time points in both the DKO mouse treated with FK506 and the normal mouse (Fig. 16D). These results are always observed in drug-treated mice, which seems to be related to the nephrotoxic effect reported in some patients treated with drugs after transplantation (Solez et al., Transplantation, 66: 1736-1740, 1998) .
실시예 8Example 8
앨포트 사구체신염의 발병 및 진행을 지연시키는 α1 인테그린 차단제 및 TGF-β1 저해제의 상승효과에 대한 메카니즘Mechanisms for synergistic effects of alpha 1 integrin blockers and TGF-beta 1 inhibitors that delay the onset and progression of Alport's glomerulonephritis
도 11, 도 12 및 도 14에 예시된 데이터에서는, α1 인테그린 차단제가 TGF-β1 차단제와 상승 작용하는 이유는 α1 저해가 개선된 족세포 푸트 프로세스 구조를 유도하는 반면, TGF-β1 저해는 GBM에서의 감소된 매트릭스 침착을 유도하기 때문임을 시사한다. 도 17은 족세포 푸트 프로세스 구조를 개선시키는데 있어서의 α1 인테그린 차단제의 역할을 보다 실증하기 위하여 제공된다. 신피질은 도 12에 설명된 것과 동일한 방식으로 제조하였다. 도 17A는 주령 7주의 정상 마우스로부터 얻은 사구체의 표면을 도시하고 있다. 도 17B는 주령 7주의 앨포트 마우스로부터 얻은 사구체를 도시하고 있다. 푸트 프로세스 소멸에 기인된 족세포 구조의 상실을 주지해야 한다. 도 17C는 주령 7주의 이중 녹아웃 마우스로부터 얻은 사구체의 표면을 도시하고 있다. 정상의 푸트 프로세스 구조의 거의 완벽한 회복을 주시해야 한다. 이들 데이터는 푸트 프로세스가 이중 녹아웃 마우스에서 우수한 형태를 나타내는 도 14B에 도시된 투과 전자 현미경에 의해서 제공된 횡단면도와 일치되고 있다.In the data exemplified in Figures 11, 12 and 14, the α1 integrin blocker synergizes with the TGF-β1 blocker, while the α1 inhibition leads to an improved podocyte foot process structure, while the TGF- Lt; RTI ID = 0.0 > matrix deposition. ≪ / RTI > Figure 17 is provided to further demonstrate the role of the alpha 1 integrin blocker in improving the pancreatic foot process structure. The renal cortex was prepared in the same manner as described in Fig. Figure 17A shows the surface of the glomeruli obtained from normal mice of 7 weeks old. Figure 17B shows the glomeruli from week 7 albmouth mice. It should be noted that loss of podocyte structure due to foot process disappearance. Figure 17C shows the surface of the glomeruli from a 7 week old double knockout mouse. It should be noted that almost complete recovery of the normal foot process structure is observed. These data are consistent with the cross-sectional view provided by the transmission electron microscope shown in Fig. 14B, in which the foot process exhibits a good shape in a double knockout mouse.
실시예 9Example 9
α1 인테그린 차단 효과α1 integrin blocking effect
상기 현상에 대한 가능한 메카니즘을 시험하는데 있어서, 라미닌 사슬을 평가하였다. 사구체 기저막에서 발견되는 주된 라미닌은 라미닌 11이라는 것이 공지되어 있기 때문에[문헌: Miner et al., J. Cell Biol., 137:65-701, 1997], 앨포트 GBM에서의 새로운 라미닌의 출현은 GBM에 대한 족세포 결합의 상실에 원인이 될 수 있는 것으로 생각되었다. 사실, 앨포트 GBM의 라미닌 조성을 시험하는 경우, 정상의 마우스에서 메산쥼 매트릭스에만 배타적으로 국재화되는 것이 정상인 라미닌 α2 사슬이 앨포트 마우스의 GBM에서 발견되었다. 도 18은 이중 형광 표지화 프로토콜을 이용하여 면역염색된 일련의 사구체 패널을 도시하고 있다.In testing the possible mechanism for this phenomenon, the laminin chain was evaluated. Since the main laminin found in the glomerular basement membrane is known to be laminin 11 [Miner et al., J. Cell Biol., 137: 65-701, 1997] Which may be responsible for the loss of podocyte binding. Indeed, when testing the laminin composition of ALPTOBM, the laminin alpha2 chain, which is normally localized exclusively in the mexanic acid matrix in normal mice, was found in GBM of ALPTMO mice. Figure 18 shows a series of glomerular panels immunostained using dual fluorescent labeling protocols.
이중 형광 분석에서, 신선한 신피질을 티슈 테크(Tissue Tek) 수성 포매 화합물에 포매시키고, 스냅 동결시켜 저온유지장치에서 4미크론으로 절단하였다. 슬라이드를 냉(-20℃) 100% 아세톤에서 10분 동안 후고정시키고, 이어서 밤새 공기 건조시켰다. 조직을 PBS중에서 각각 10분 동안 3회 세척함으로써 재수화시켰다. 1차 항체를 함께 7% 탈지 분유(BioRad)로 희석시켰다. 항-엔탁틴 항체(Chemicon Inc.)를 1:200의 희석액으로 사구체 기저막에 대한 공지된 마아커로 사용하였다. 라미닌 α2 사슬 특이적 항체는 피터 유르첸코 박사(Dr. Peter Yurchenco, Robert Wood Johnson Medical School, Piscataway, NJ)로부터 얻었다. 라미닌 α2 사슬에 대한 이러한 항체의 특이성은 문헌[Cheng et al., J. Biol. Chem., 272:31525-31532, 1997]에 설명되어 있다. 항체는 1:10의 농도로 사용하였다. 1차 항체를 가습된 디쉬 중에서 4℃에서 밤새 반응시켰다. 슬라이드를 냉 PBS 중에서 10분 동안 3회 세척한 다음, 함께 첨가한 2차 항체와 반응시켰다. 2차 항체는 라미닌 α2의 경우 텍사스 레드-콘쥬게이션된 항-토끼, 엔탁틴의 경우 FITC-콘쥬게이션된 항-랫트이었고, 이들 둘 모두 1:100 희석액(Vector Laboratories, Burlingame, CA)으로 사용하였다. 2차 시약을 4℃에서 4시간 동안 반응시켰다. 슬라이드를 PBS로 각각 10분 동안 3회 세척하고, 한방울의 벡타쉴드 항-페이드 마운팅 배지(Vectashield anti-fade mounting media)(Vector Laboratories, Burlingame, CA)를 글래스 커버슬립 하에서 밀봉하기 전에 적용시켰다. 각각의 항체에 대한 이미지를 사이토비젼 울트라 이미지 분석 시스템(Cytovision Ultra image analysis system)(Applied Imaging, Inc.)과 인터페이스된 BH-2 에피형광분석 현미경을 사용하여 디지털적으로 중첩시켰다.In dual fluorescence analysis, fresh cinnabolium was embedded in a Tissue Tek aqueous foam compound and snap frozen and cut to 4 microns in a cryogenic holding device. The slides were postfixed in cold (-20 < 0 > C) 100% acetone for 10 minutes and then air dried overnight. Tissues were rehydrated by washing three times in PBS for 10 minutes each. The primary antibody was diluted with 7% skim milk powder (BioRad). Anti-enstatin antibody (Chemicon Inc.) was used as a known marker for glomerular basement membrane with a 1: 200 dilution. Laminin α2 chain specific antibodies were obtained from Dr. Peter Yurchenco (Robert Wood Johnson Medical School, Piscataway, NJ). The specificity of this antibody for the laminin [alpha] 2 chain is described in Cheng et al., J. Biol. Chem., 272: 31525-31532, 1997). The antibody was used at a concentration of 1:10. The primary antibody was reacted overnight at 4 ° C in a humidified dish. The slides were washed 3 times in cold PBS for 10 minutes and then reacted with the secondary antibody added together. The secondary antibodies were Texas red-conjugated anti-rabbit for laminin alpha 2 and FITC-conjugated anti-rat for enstatin, both used as 1: 100 dilutions (Vector Laboratories, Burlingame, CA) . The secondary reagent was reacted at 4 ° C for 4 hours. Slides were washed 3 times for 10 minutes each in PBS and a drop of Vectashield anti-fade mounting media (Vector Laboratories, Burlingame, Calif.) Was applied before sealing under glass cover slip. Images for each antibody were digitally superimposed using a BH-2 epifluorescence microscope interfaced with a Cytovision Ultra image analysis system (Applied Imaging, Inc.).
사구체 기저막 특이적 항원(엔탁틴)은 녹색이지만, 라미닌 α2 사슬은 붉은색이다. 반면, 엔탁틴 및 라미닌 α2 공동 국재화 염색은 황색이다. 도 18의 I군에서, 패널 A는 주령 7주의 정상 마우스로부터 얻은 면역염색을 나타낸다. 여기서 라미닌 α2가 메산쥼 매트릭스에 배타적으로 국재화된다. 패널 B는 주령 7주의 앨포트 동복자에서의 염색을 설명하고 있다. 화살표로 나타낸 모세혈관 루프는 뚜렷하게 황색으로 염색되어, 앨포트 마우스에서, 라미닌 α2가 메산쥼 매트릭스 및 사구체 기저막 모두에 국재화되어 있음을 설명하고 있다. 패널 C는 FK506으로 처리된 129Sv/J 앨포트 마우스로부터의 사구체에서의 면역염색을 나타낸다(피질은 상기 실험에 사용되어 도 11, 도 12, 및 도 13에 표시된 동물로부터 얻었다). 여기서, 다시, 대부분의 사구체 모세혈관 루프는 황색이며, 이는 TGF-β1 활성의 저해가 앨포트 마우스의 GBM중의 라미닌 α2의 축적을 방지하지 못함을 나타낸다. 그러나, 주령 7중의 이중 녹아웃 마우스에서는, 사구체 모세혈관 루프에서 라미닌 α2 면역염색이 없었다(패널 D, 화살표). 족세포 표면상에서 우세한 인테그린 수용체는 인테그린 α3β1이다[문헌: Patey et al., Cell Adhesion and Communication, 2:159-167, 1994]. 이러한 인테그린은 대체로 GBM에 대한 족세포 결합 및 정상의 푸트 프로세스 구조의 유지에서 중요한 역할을 하는 것으로 생각된다[문헌: Smoyer and Mundel, J. Mol. Med., 76:172-183, 1998]. 예를 들어, 인테그린 α3 유전자를 녹아웃시키면 족세포 푸트 프로세스 구조의 완전한 말소가 초래되는 것으로 최근 밝혀졌다[문헌: Kreidberg et al., Development, 122:3537-3547, 1996]. 더욱 최근에는, 가용성 α3β1 인테그린 수용체가 생성되어, 고도의 친화성으로 라미닌 α5 사슬 함유 라미닌(α5, β2, 및 γ1 사슬을 포함하는 이종삼량체인 라미닌-11과 유사)에 결합하지만, α2 사슬 함유 라미닌에는 결합하지 않는 것으로 밝혀졌다[문헌: Eble et al., Biochemistry, 37:10945-10955, 1998]. 이러한 정보를 취합하면, 본원에 제공된 데이터는, 앨포트 마우스에서, GBM중의 라미닌 α2 함유 라미닌의 진행성 침착이 인테그린 α3β1 수용체를 통한 감소된 유착을 초래하는 결과, 푸트 프로세스 소멸을 초래하는 모델을 지지한다. 인테그린 α1 사슬의 차단은 GBM에서 라미닌 α2 사슬의 침착을 감소 또는 소실시켜, 정상의 푸트 프로세스 구조의 소실을 억제한다.The glomerular basement membrane-specific antigen (entatin) is green, but the laminin α2 chain is red. On the other hand, encrustin and laminin α2 co-localization is yellow. In group I of FIG. 18, Panel A shows immunostaining obtained from normal mice of 7 weeks old. Wherein laminin < RTI ID = 0.0 > a2 < / RTI > Panel B illustrates the staining of the 7 week old Alter copter. The capillary loops indicated by arrows are stained with a distinct yellow color, demonstrating that, in Alport mice, laminin [alpha] 2 is localized to both the mesangial matrix and the glomerular basement membrane. Panel C shows immunostaining in glomeruli from 129Sv / J alt mice treated with FK506 (the cortex was used in this experiment and was obtained from the animals shown in Figures 11, 12 and 13). Here again, most of the glomerular capillary loops are yellow, indicating that inhibition of TGF-? 1 activity does not prevent the accumulation of laminin? 2 in GBM of Alport mice. However, there was no laminin alpha 2 immunostaining in the glomerular capillary loop in the case of a double knockout mouse in the 7th week (panel D, arrow). The predominant integrin receptor on the cell surface is the integrin [alpha] 3 [beta] l [Patey et al., Cell Adhesion and Communication, 2: 159-167, 1994]. Such integrins are generally thought to play an important role in podocyte binding to GBM and maintenance of the normal foot process structure (Smoyer and Mundel, J. Mol. Med., 76: 172-183, 1998]. For example, knocking out the integrin alpha 3 gene has recently been shown to result in complete erasure of the podocyte foot process structure [Kreidberg et al., Development, 122: 3537-3547, 1996]. More recently, soluble α3β1 integrin receptors have been generated which bind to laminin α5 chain-containing laminin (similar to laminin-11, a heterotrimeric chain comprising α5, β2, and γ1 chains) with high affinity, but α2 chain containing laminin (Eble et al., Biochemistry, 37: 10945-10955, 1998). Given this information, the data provided herein supports a model that results in foot process extinction as a consequence of the progressive deposition of laminin alpha 2-containing laminin in GBM results in reduced adhesion through the integrin [alpha] 3 [beta] 1 receptor in Alport mice . Blockage of the integrin alpha 1 chain reduces or eliminates the deposition of the laminin alpha 2 chain in GBM, thereby suppressing the loss of normal foot process structure.
이러한 점을 보다 더 실증하기 위해서, 정상의 동복자와 비교하여 주령 2주의 Sv/J 앨포트 마우스에서의 라미닌 α2 사슬 분포를 평가하였다. GBM 질환 진행의 이러한 매우 초기 단계에서, 사구체의 약 절반 상에 드물게 분포된 GBM 비후화의 주목할 만한 "포켓(pocket)"이 있었다. GBM 비후화의 그러한 한 포켓을 도 19B에 도시한다. GBM 및 족세포 푸트 프로세스는 이러한 발생 단계에서 사구체의 비감염된 영역에서는 형태적으로 정상이지만, 소상 비후화의 영역에서는, GBM 질환 발달의 보다 후기에 인식되는 보다 일반화된 변화와 같이, 푸우트 프로세스가 팽화되고 소멸된다. 이는 라미닌 α2 침착이 족세포와 접촉된 소상 유착의 상실을 초래하는 경우, 주령 2주 앨포트 마우스에서의 라미닌 α2의 소상 침착물이 관찰된다는 것으로 요약된다. 이는, 사실 도 18 Ⅱ군에 예시된 경우이다. 패널 B상의 화살표는 주령 2주의 앨포트 마우스의 GBM에서 라미닌 α2의 소상 침착을 나타낸다. 이는 앨포트 마우스 모델에서 검출된 가장 이른 분자적 변화(선천적인 유전자 돌연변이로부터 유발되는 타입 Ⅳ 콜라겐 조성의 변화 이외에)이며, 검출가능한 GBM 손상의 발증와 정확하게 상응한다.To further demonstrate this point, we evaluated the distribution of laminin a2 chains in Sv / J altxt mice at 2 weeks old compared to normal subjects. At this very early stage of GBM disease progression, there was a notable " pocket " of GBM hyperplasia that was rarely distributed on about half of the glomeruli. One such pocket of GBM depletion is shown in Figure 19B. The GBM and podocyte foot processes are morphologically normal in the uninfected areas of the glomeruli at this developmental stage, but in the area of small-phase hypertrophy, as in the more generalized changes later in the development of GBM disease, It expands and disappears. It is summarized that when laminin [alpha] 2 deposition results in loss of small phase adhesion in contact with podocytes, a pellet deposit of laminin [alpha] 2 is observed in week 2 Alportmouse. This is actually the case as exemplified in the 18 Ⅱ group. The arrow on panel B represents the pellet deposition of laminin alpha 2 in the GBM of Alport mouse in week 2. This is the earliest molecular change detected in the Alport mouse model (in addition to the change in type IV collagen composition resulting from the congenital genetic mutation) and corresponds exactly to the detection of detectable GBM damage.
실시예 10Example 10
TGF-β1 저해제의 α1 인테그린 차단제와의 상승 효과Synergistic effect of TGF-β1 inhibitor with α1 integrin blocker
도 3에 도시되고 있는 바와 같이, 앨포트 신장 질환 발병의 작용으로 GBM 및 간질내에 축적되는 매트릭스에는 콜라겐 α1(IV) 및 α2(IV) 사슬, 피브로넥틴, 및 엔탁틴이 포함된다. 도 20(각각의 겔의 처음 두 레인)에 도시되어 있는 바와 같이, 각각의 이들 단백질을 엔코딩하는 mRNA는 정상의 대조군과 상대적으로 앨포트 신장에서 유도된다. TGF-β1 저해제의 주사는 유도의 정도를 실질적으로 감소시킨다(도 20의 마지막 두 레인의 겔). 이는 TGF-β1 저해제로 처리된 Sv/J 앨포트 마우스에서 관찰된 기저막 비후화의 감소의 원인이 될 수 있다(도 11에 도시됨).As shown in Fig. 3, the matrix accumulating in GBM and epilepsy due to the onset of Alport's kidney disease involve collagen alpha 1 (IV) and alpha 2 (IV) chains, fibronectin, and entmotin. As shown in Figure 20 (the first two lanes of each gel), the mRNA encoding each of these proteins is induced in Alport's kidney relative to the normal control. Injection of the TGF- [beta] l inhibitor substantially reduces the degree of induction (gel of the last two lanes of FIG. 20). This may cause a decrease in basement membrane hyperplasia observed in Sv / J altox mice treated with TGF-? 1 inhibitors (shown in FIG. 11).
유사한 노턴 블롯 세트가 TGF-β1 저해제로 처리되지 않거나 처리된 이중 녹아웃 마우스로부터의 신장으로부터 얻은 RNA를 사용함으로써 수행되었다. 이에 사용된 마우스는 도 14에 나타낸 데이터를 유도하는데 사용된 마우스와 동일한 마우스이므로, 약물 주사 프로토콜은 실시예 7에 기재되어 있다. TGF-β1 저해제의 투여가 주사하지 않은 대조 마우스 대 이중 녹아웃 마우스에 비해서 매트릭스 단백질을 엔코딩하는 mRNA의 수준을 현저하게 변화시키지 않는다는 것은 도 21에 나타낸 데이터로부터 명백하다. 그러나, 프로브에 첨가할 메탈로프로테이나제 저해제 Timp-3를 엔코딩하는 mRNA의 발현에 대해서는 두드러진 효과가 있다(도 21, 마지막 줄). 레인 1 및 레인 2에서 입증되는 바와 같이, 대조 마우스와는 상대적으로 주령 10주 미처리 이중 녹아웃 마우스의 신장에서의 Timp-3 발현에는 두드러진 감소가 있다(인영상 분석을 기준으로 9배 차이). Timp-3 발현의 이러한 감소는 FK506(레인 3 및 레인 4) 또는 TGF-β1 가용성 수용체(레인 5 및 레인 6)가 주사된 이중 녹아웃 마우스에서 관찰되지 않는다. Timp-3 발현에 대한 이러한 동일한 효과는 Sv/J 마우스(도 20, 마지막 줄)에서 관찰되며, 이는 앨포트 마우스에서의 Timp-3 mRNA의 억제를 저해시키는 능력은 α1 인테그린 및 TGF-β1의 이중 저해의 결과가 아닌 TGF-β1 저해 저해제의 결과임을 예시한다.A similar set of Norton blots was performed by using RNA obtained from kidneys not treated with TGF-? 1 inhibitors or treated from double knockout mice. The drug injection protocol is described in Example 7, since the mouse used here is the same mouse used to derive the data shown in Fig. It is evident from the data shown in Fig. 21 that administration of the TGF- [beta] 1 inhibitor does not significantly change the level of mRNA encoding the matrix protein as compared to untreated control mice versus double knockout mice. However, there is a noticeable effect on the expression of mRNA encoding the metalloproteinase inhibitor Timp-3 to be added to the probe (Figure 21, last line). As evidenced in lane 1 and lane 2, there is a significant reduction in the expression of Timp-3 in the kidney of a 10 week old untreated dual knockout mouse relative to the control mice (9-fold difference from baseline analysis). This reduction in the expression of Timp-3 is not observed in double knockout mice injected with FK506 (lane 3 and lane 4) or TGF-? 1 soluble receptors (lane 5 and lane 6). This same effect on the expression of Timp-3 was observed in Sv / J mice (Fig. 20, last row), indicating that the ability to inhibit the inhibition of Timp- Lt; RTI ID = 0.0 > TGF-ss1 < / RTI >
이러한 관찰의 기능적인 중요성은 Timp-3이 매트릭스 메탈로프로테이나제의 조절제라는 사실에 기초하며, 신장 기저막 항상성 및 질환중의 항상성의 상실에 중요한 인자인 것으로 시사되었다[문헌: Esposito et al., Kidney Int., 50:506-514, 1996; and Elliot et al., J. Am. Soc. Nephrol., 10:62-68, 1999]. Timp-3 메탈로프로테이나제 저해제의 발현의 감소는 메탈로프로테이나제 활성의 상응하는 증가를 초래할 것이다. 이러한 증가는 기저막 손상을 유발하여, 매트릭스의 부수적인 축적과 함께 TGF-β1를 활성화시킬 수 있다. 이러한 사이클을 파괴하면 관찰되었던 GBM 형태의 회복에 의해서 나타나는 기저막 항상성을 회복시킬 수 있다(도 11, 도 14 및 도 15).The functional significance of these observations is based on the fact that Timp-3 is a modulator of matrix metalloproteinases and has been suggested to be an important factor in renal basement membrane homeostasis and loss of homeostasis in disease [Esposito et al. Kidney Int., 50: 506-514, 1996; and Elliot et al., J. Am. Soc. Nephrol., 10: 62-68, 1999). A decrease in the expression of the Timp-3 metalloproteinase inhibitor will result in a corresponding increase in metalloproteinase activity. This increase may cause basal membrane damage, which may activate TGF-β1 with ancillary accumulation of the matrix. Destroying this cycle can restore the basement membrane homeostasis caused by the recovery of the observed GBM form (Figs. 11, 14 and 15).
실시예 11Example 11
TGF-β1 저해제로 처리된 이중 녹아웃 마우스에서의 간질성 섬유증의 억제Inhibition of interstitial fibrosis in double knockout mice treated with TGF-beta1 inhibitor
매트릭스 단백질의 상향조절 및 신장 섬유증에서의 TGF-β1의 역할은 잘 입증되어 있다[문헌: Yand et al., J. Am. Soc. Nephrol., 5:1610-1617, 1994; Border and Ruoslahti, J. Clin. Invest., 90:1-7, 1992]. 이중 녹아웃 마우스에서, 신장 간질성 섬유증은 지연되지만, 주령 약 10주에서는 광범위하게 퍼졌으며, 주령 약 15주에서는 말기 신부전증으로 진행된다. TGF-β1 저해제를 주사한 동물을 간질성 섬유증에 대한 3개 마아커를 사용하여 분석하고, 저해제로 처리되지 않은 주령 10주의 이중 녹아웃 동물과 직접 비교하였다. 실시예 7에서의 도 14를 생성하도록 사용된 프로토콜과 동일한 프로토콜을 이용하여 동물에게 주사하였다. 도 22, 도 23 및 도 24의 경우에, 패널 A는 대조이며, 패널 B는 미처리된 이중 녹아웃이고, 패널 C는 FK506으로 처리된 이중 녹아웃이며, 패널 D는 TGF-β 가용성 수용체로 처리된 이중 녹아웃이다. 모든 이들 도면은 신피질의 저배율 50배 확대도이다. 도 22는 매트릭스의 표준 조직화학적 염색인 존스 실버 메텐아민 염색이다. 이는 매트릭스가 미처리된 마우스에서 신피질의 간질에 축적됨을 입증한다(패널 B를 패널 A와 비교). 그러나, TGF-β1 저해제로 처리된 동물로부터의 신피질은 대조군과 구별 불가능하여 섬유증이 거의 없거나 없음을 나타냈다. 신장 간질 섬유증에 대해서 일반적으로 사용된 분자 마아커는 콜라겐 타입 I 및 피브로넥틴을 포함한다[문헌: Yamamoto et al., Kidney Int., 45:916-927, 1994]. 도 23은 콜라겐 타입 I에 대한 면역염색을 예시하고 있다. 명백하게는, 콜라겐 타입 I은 미처리된 동물의 신피질의 간질에 축적된다(패널 B를 패널 A의 대조군과 비교). 도 23의 패널 B 및 C는 FK506 또는 가용성 수용체 각각으로 처리된 이중 녹아웃 마우스의 신장에서의 콜라겐 타입 I 축적의 상대적인 부재를 예시하고 있다. 동일한 시나리오가 미처리된 이중 녹아웃(도 24B)의 피질, 및 대조와 유사하게 TGF-β1 저해제를 주사한 마우스(도 24 패널 C 및 D)의 신피질에 풍부한 피브로넥틴에 대해서 유효하다. 종합적으로는, 이들 데이터는 인테그린 알파 1 차단제와 병용한 TGF-β1 저해제는 앨포트 마우스 모델에서의 간질 섬유증을 방지(또는 지연)하는데 효과적임을 나타낸다.The upregulation of matrix proteins and the role of TGF-? 1 in renal fibrosis have been well documented [Yand et al., J. Am. Soc. Nephrol., 5: 1610-1617,1994; Border and Ruoslahti, J. Clin. Invest., 90: 1-7, 1992). In double-knockout mice, kidney interstitial fibrosis is delayed, but widespread in about 10 weeks of age and progresses to end-stage renal failure in about 15 weeks of age. Animals injected with the TGF-? 1 inhibitor were analyzed using 3 markers for interstitial fibrosis and directly compared to 10 week old double knockout animals not treated with inhibitor. Animals were injected using the same protocol as that used to generate Figure 14 in Example 7. In the case of Figures 22, 23 and 24, Panel A is the control, Panel B is the untreated double knockout, Panel C is the double knockout treated with FK506, Panel D is the double treated with TGF- It is a knockout. All these figures are low magnification 50x magnification of the neocortex. 22 is Jones silver methenamine staining, a standard histochemical stain of the matrix. This demonstrates that the matrix accumulates in the epilepsy of the cortex in untreated mice (panel B compared to panel A). However, the renal cortex from animals treated with the TGF-? 1 inhibitor was indistinguishable from the control and showed little or no fibrosis. Molecular markers commonly used for kidney fibrosis include collagen type I and fibronectin [Yamamoto et al., Kidney Int., 45: 916-927, 1994]. Fig. 23 illustrates immunostaining for collagen type I. Fig. Apparently, collagen type I accumulates in the neocortical epilepsy of untreated animals (compare panel B to control in panel A). Panels B and C in Figure 23 illustrate the relative absence of collagen type I accumulation in kidneys of dual knockout mice treated with FK506 or soluble receptors, respectively. The same scenario is valid for the cortex-enriched fibronectin of the cortex of untreated double knockout (Fig. 24B) and mice injected with TGF-? 1 inhibitor similar to control (Fig. 24 panels C and D). Collectively, these data indicate that TGF-beta 1 inhibitors in combination with integrin alpha 1 blockers are effective in preventing (or delaying) epileptic fibrosis in the Alportmouse model.
본원에 참조되고 있는 모든 참조문헌, 특허, 특허출원, 및 공개문헌은 본원에 참조로 인용되고 있는 것이다. 당업자라면 본 발명이 특정의 구체예 및 실시예와 함께 상기되고 있지만, 본 발명이 제한되는 것이 아니며, 기재된 구현예, 실시예 및 용도와는 다른 다양한 구현예, 실시예, 용도, 변화 및 변형이 본 발명의 범위를 벗어나지 않으면서 가능할 수 있다는 것을 인지할 수 있을 것이다.All references, patents, patent applications, and publications referenced herein are incorporated herein by reference. While the present invention has been described in connection with the specific embodiments and examples for those skilled in the art, it is not intended that the invention be limited, and that various implementations, embodiments, uses, variations and modifications other than the described implementations, It will be appreciated that the invention may be practiced without departing from the scope of the invention.
Claims (33)
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US8658798P | 1998-05-22 | 1998-05-22 | |
US60/086,587 | 1998-05-22 | ||
US8876698A | 1998-06-02 | 1998-06-02 | |
US09/088,766 | 1998-06-02 | ||
US9/088,766 | 1998-06-02 | ||
US15048598A | 1998-09-09 | 1998-09-09 | |
US9/150,485 | 1998-09-09 | ||
US09/150,485 | 1998-09-09 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20010052390A true KR20010052390A (en) | 2001-06-25 |
KR100574597B1 KR100574597B1 (en) | 2006-04-28 |
Family
ID=27375439
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020007013144A KR100574597B1 (en) | 1998-05-22 | 1999-05-19 | Use of ?1?1 integrin receptor inhibitors and tgf-?1 inhibitors in the treatment of kidney disease |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR100574597B1 (en) |
HK (1) | HK1038886B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20150064072A (en) * | 2012-10-09 | 2015-06-10 | 레굴루스 테라퓨틱스 인크 | Methods for treatment of alport syndrome |
-
1999
- 1999-05-19 KR KR1020007013144A patent/KR100574597B1/en not_active IP Right Cessation
-
2002
- 2002-01-22 HK HK02100508.3A patent/HK1038886B/en not_active IP Right Cessation
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20150064072A (en) * | 2012-10-09 | 2015-06-10 | 레굴루스 테라퓨틱스 인크 | Methods for treatment of alport syndrome |
KR20200118245A (en) * | 2012-10-09 | 2020-10-14 | 사노피 | Methods for treatment of alport syndrome |
Also Published As
Publication number | Publication date |
---|---|
HK1038886A1 (en) | 2002-04-04 |
HK1038886B (en) | 2005-09-23 |
KR100574597B1 (en) | 2006-04-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6492325B1 (en) | Use of α1β1 integrin receptor inhibitors and TGF-β1 inhibitors in the treatment of kidney disease | |
KR101999756B1 (en) | Methods for reducing cd36 expression | |
EP1079843B1 (en) | Use of alfa1beta1 integrin receptor inhibitors and tgf- beta1 inhibitors in the treatment of kidney disease | |
Sayers et al. | Role for transforming growth factor-β1 in Alport renal disease progression | |
US20090191210A1 (en) | Method for inhibiting tumor invasion or spreading in a subject | |
Chen et al. | Preservation of basal AcSDKP attenuates carbon tetrachloride-induced fibrosis in the rat liver | |
US7261881B1 (en) | Modulation of angiogenesis and wound healing | |
US7763580B2 (en) | Methods for treating conditions associated with the accumulation of excess extracellular matrix | |
WO1999059614A1 (en) | Modulation of angiogenesis and wound healing | |
US20230287430A1 (en) | Use of pi3kc2b inhibitors for the preservation of vascular endothelial cell barrier integrity | |
KR100574597B1 (en) | Use of ?1?1 integrin receptor inhibitors and tgf-?1 inhibitors in the treatment of kidney disease | |
US20040101902A1 (en) | Inhibition of Egr-1 expression by ppar-gamma agonists and related compositions and methods | |
WO2001002003A1 (en) | Method of treating psoriasis with il-15 antagonist | |
US6635738B2 (en) | Compounds which prevent neuronal cell death and uses thereof | |
IL139687A (en) | Use of ??1??1 integrin receptor inhibitors and tgf-??1 inhibitors for the preparation of pharmaceutical compositions for the treatment of kidney disease | |
MXPA00011409A (en) | Use of alpha 1 beta 1 integrin receptor inhibitors and tgf-bgr;1 inhibitors in the treatment of kidney disease | |
JP2009533318A (en) | Inhibitors of membrane type 1 matrix metalloproteinases for the treatment of insulin-dependent diabetes | |
Rodgers | New Insights into the Mechanism of Alport Glomerular and Tubulointerstitial Pathogenesis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
LAPS | Lapse due to unpaid annual fee |