KR20010040337A - Method of determining the function of nucleotide sequences and the proteins they encode by transfecting the same into a host - Google Patents

Abstract

The present invention relates to a method for rapidly determining the function of a nucleic acid sequence by infecting the nucleic acid sequence with a host organism for effective expression, and to analyze the function of the nucleic acid transfected into the host organism with the resulting phenotype and biochemical changes. In addition, the present invention provides a method for silencing endogenous genes by transfecting a host with a nucleic acid sequence for effective expression, and the present invention also provides RNA and viral vectors to express a library of nucleic acid sequence variants. Provided are methods for selecting the desired function of a protein, and the present invention also provides a method for inhibiting endogenous proteases of a plant host.

Description

METHOD OF DETERMINING THE FUNCTION OF NUCLEOTIDE SEQUENCES AND THE PROTEINS THEY ENCODE BY TRANSFECTING THE SAME INTO A HOST}

This application is a partial consecutive application of US patent application Ser. No. 09 / 008,186, filed January 16, 1998, which is incorporated in its entirety.

The plant genome project is of great interest comparable to the human genome project. Precious and basic agricultural plants, including but not limited to corn, soybeans and rice, for example, are targeted by the project because the information gained from this increases global food production and the quality of agricultural products. This is because it turns out to be very beneficial for the purpose of improving the value and value. The US Congress is considering starting a corn genome project. By elucidating the genetic traits hidden in the corn genome, the project can help to understand and combat common diseases of cereal crops. It has also been greatly encouraged by efforts to increase grain yields and manipulate plants into plants that are resistant to drought, pests, salts and other extreme environmental conditions. The development is very important given that the world population will double in 2050. Currently, the four types that provide 60% of all human food are wheat, rice, corn and potatoes, and the strategy to increase the productivity of these plants is to determine how the unknown gene sequences work as a result of genetic research. It depends on whether you find it quickly. Moreover, the information makes it possible to identify products and genes useful for the health of humans and animals, such as, for example, drugs.

One strategy that has been proposed to assist such efforts is to create an expressed sequence tag (EST) database that can be used to identify expressed genes. Accumulation and analysis of expression sequence tags is an important component of genomic research. EST data can be used to identify gene products, thus accelerating gene cloning. Various sequence databases can be achieved by describing and storing relationships between enormous amounts of sequence information resulting from ongoing sequencing efforts. Some have suggested sequencing 500,000 ETS for corn and 100,000 ETS for rice, wheat, oats, barley and sugarcane respectively. Efforts to sequence the genome of the plant species depend on these computer data shared with the resulting sequence data without a doubt. Arabidopsis thaliana is an attractive target for discovering the function of genes because a very large set of ESTs has already been made in this organism, and the sequence tag is more than 50% of the expected Arabidopsis gene. to be.

It has been proposed to measure some important grain genome sizes (with respect to microbes and humans). This includes Oryza sativa (rice) with about 430 million bases or about 20,000 genes, Sorghum bicolor with about 760 million bases or about 30,000 genes. (Rice), Zea mays (corn) with about 2 billion bases or about 30,000 genes and Triticum aestivum (wheat) with about 16 billion bases or about 30,000 genes This includes.

If gene function can be determined, the potential for using the resulting sequence information is enormous. It is operable with agricultural commercial seeds for the delivery of numerous desirable traits to food and fiber crops, thereby improving agricultural production and global food supply. Research and development on commercial seeds have been primarily focused on improving traditional plant varieties, but interest in biotechnology on plant traits has also increased. For both monocotyledonous and dicotyledonous plants, knowledge of the associated genome and the gene function contained in the plant is essential for understanding the positive effects from the technique.

Genomic research has potentially greatly influenced seeds. For example, gene profiling in cotton can understand the gene morphology that is mainly expressed in fiber cells. Genes and promoters derived from these genes are important in the genetic engineering of cotton fibers for increased strength or "built-in" fiber color. In plant cultivation, gene profiling combined with physiological characterization can identify markers that are becoming increasingly important for markers that aid cultivation. Analyzing the DNA sequence of specific crops for genes that are important for yield, quality, health, appearance, color, taste, etc., is crucial for crop improvement.

Research has been conducted in the field of developing suitable vectors for expressing exogenous DNA and RNA in plant hosts. US Patent Nos. 4,885,248 and 5,173,410 to Ahlquist describe preliminary work to design a delivery vector useful for delivering exogenous genetic material for expression in a plant host. Additional aspects of hybrid RNA viruses and RNA transformation vectors are disclosed in Alquist et al. In US Pat. Nos. 5,466,788, 5,602,242, 5,627,060, and 5,500,360, all of which are incorporated by reference in their entirety. Donson et al., U.S. Pat.Nos. 5,316,931, 5,589,367 and 5,866,785, describe for the first time a plant Barrier's vector suitable for systemic expression of mushroom exogenous genetic material in plants, which is incorporated in its entirety. Donson et al. Disclose plant viral vectors with heterologous subgenomic promoters that promote systemic expression of exogenous genes. Carlington et al., US Pat. No. 5,491,076, also disclose certain potyvirus vectors useful for expressing exogenous genes in plants. Expression vectors disclosed by Carlington et al. Are characterized by utilizing the specific ability of viral polyprotein proteases to cleave heterologous proteins from viral polyproteins. This includes fortiviruses such as the Tobacco Etch Virus. Additionally suitable vectors are disclosed in U.S. Patent 5,811,633 and U.S. Patent Application 08 / 324,003, all of which are incorporated in their entirety.

The composition of plant RNA viruses for the introduction and expression of non-viral exogenous genes in plants is described by Methods in Enzymology 118: 659 (1986), Guzman et al. Communications in Molecular. Biology: Viral Vectors, Cold Spring Harbor Laboratory, pages 172-189 (1998), Dowson et al. Virology 172: 285-292 (1989), Takamatsu et al. 6: 307-311 (1987), French et al., Science 231: 1924-1297 (1986), and Takamatsu et al., FEBS Letters 269: 73-76 (1990). However, it is impossible for such viral vectors to show intracellular plant spreading and the expression of nonviral exogenous genes in many plant cells in the whole plant. Moreover, many of these viral vectors have been found to be unstable to sustain nonviral exogenous genes. However, Donson et al., U.S. Pat.Nos. 5,316,931, 5,589,367 and 5,866,785, Turpen et al., U.S. Patent 5,811,653, Carlington et al. U.S. Patent 5,491,076 and U.S. Pat. Viral vectors disclosed in Application 08 / 324,003 can infect plant cells with exogenous genetic material, enable global spreading in plants, and express nonviral exogenous genes contained locally or in whole plant cells. It turned out to be possible. Similarly, better infectious and enhanced locally or wholly expressed additional mediators of exogenous genetic material can be developed independently or by enhancing the vectors disclosed in the patent and the above-mentioned patent application. All patents, patent applications, and references cited in this application are hereby incorporated in their entirety.

Recombinant plant virus nucleic acids and recombinant viruses, such as Barryrus exemplified by Donson et al., Which infect plant cells and express the exogenous genetic material as a whole, are generally native plant virus subgenomic promoters, at least one nonnative plant subgenomic promoter, Plant viral coat protein coding sequence and at least one non-native nucleic acid sequence. The value of using such plant viral nucleic acids which express non-native nucleic acids in a plant host as a whole is important. Combined with a reasonable design to explain the function of the non-native nucleic acid in more detail, the method would be a significant advance in understanding the large amount of sequence information generated by sequencing efforts.

Summary of the Invention

A first aspect of the invention involves transfecting a nucleic acid sequence into an organism to locally or globally express the nucleic acid sequence, thereby determining the function of the gene in the host organism, such as bacteria, yeast, plants or animals, and the proteins encoded by the gene. It is about how to. The inventors have determined how to determine the function of the nucleic acid sequence and the protein encoded by the nucleic acid sequence by transfecting the organism with the nucleic acid of interest, thereby describing in more detail the function of the nucleic acid, including the gene, and as a result the genome. You will be able to quickly access the information in the field.

In one embodiment, the nucleic acid is introduced into a plant host. Here, the plant host may be a monocotyledonous plant or a dicotyledonous plant, plant tissue or plant cell. Preferably, the nucleic acid is introduced by plant viral nucleic acid. The plant viral nucleic acid is suitable for the maintenance and transcription or expression of non-native nucleic acid sequences, and can be transcribed or expressed locally or in whole in the plant host. In particular, particularly preferred recombinant plant viral nucleic acids useful in the methods of the invention include native plant virus subgenomic promoters, plant virus coat protein coding sequences and at least one non-native nucleic acid sequence.

Any viral vector used in accordance with the present invention may be encapsulated with a coat protein encoded by a recombinant plant virus. Recombinant plant virus nucleic acids or recombinant plant viruses can be used to infect a suitable host such as a plant. Recombinant plant viral nucleic acids can be replicated in the host, can be spread locally or entirely in the host, and can be transcribed or expressed in a nonnative nucleic acid in the host to produce the desired product. Such products include, for example, useful polypeptides or proteins containing enzymes, complex biomolecules, ribozymes, or polypeptides or protein products resulting from positive or antisense RNA expression. Moreover, in an alternative embodiment, the nucleic acid of interest can be expressed in the genomic DNA or RNA of a viral vector, thereby leaving it under genomic promoter control.

Any other viral vector used in accordance with the present invention consists of a synthetic animal virus or part thereof. Likewise, the animal viral vector is useful for infecting a suitable host such as an animal. Recombinant animal viral nucleic acids are capable of transcription or expression of non-native nucleic acids in a host to produce in-host replication, global or local spreading in the host, and the desired product.

In another embodiment, the methods of the present invention use a viral expression vector encoding at least one protein, which is non-native for vectors that are released from at least one polyprotein expressed due to proteolysis by this vector. At least one protein is encoded.

In another preferred embodiment according to the invention, a recombinant plant virus is used which encodes to express the fusion of the plant virus coat protein and the amino acid product of the nucleic acid of interest.

In another preferred embodiment according to the method of the invention, the nucleic acid sequence of interest comprising the gene can be placed in a suitable vector construct, such as a virus, that infects the host organism. In other words, the method may be practiced without consideration of the position of the nucleic acid sequence of interest in the vector used to infect the host organism. It is to be understood that the present invention is not limited to any particular varial construct, but specifically uses all possible constructs. Those skilled in the art will appreciate that the above embodiments merely represent many of the constructs useful for locally or totally expressing a nucleic acid in a host organism, such as a plant. All such constructs are included within the scope of this invention.

Those skilled in the art will readily appreciate that there are many ways to determine the function of a nucleic acid once it has been expressed locally or in whole, such as in a plant, plant cell, transgenic plant, animal or animal cell. In a first embodiment, the function of the nucleic acid can be determined by complementarity analysis. In other words, the function of the nucleic acid of interest can be determined by observing a gene or endogenous gene that has altered or augmented the function of the gene by introducing the nucleic acid of interest. A discussion of this phenomenon is presented in Napoli et al. The Plant Cell 2: 279-289 (1990). In a second embodiment, the function of the nucleic acid can be determined by analyzing biochemical changes in the accumulation of the substrate or product from the enzymatic reaction according to one of the methods known in the art. In a third embodiment, the function of the nucleic acid can be determined by observing phenotypic changes in the host by methods including morphological analysis or macroscopic analysis or microscopic analysis. In a fourth embodiment, the function of the nucleic acid can be determined by observing a change in the biochemical pathway that can be changed in the host organism as a result of nucleic acid expression. In a fifth embodiment, the function of the nucleic acid can be determined using techniques known in the art to observe the inhibition of expression of endogenous genes in the cytoplasm of cells as a result of nucleic acid expression. In a sixth embodiment, the function of the nucleic acid can be determined using techniques known in the art to observe changes in RNA or protein profiles as a result of nucleic acid expression. In a seventh embodiment, the function of the nucleic acid can be determined by selecting organisms, such as cells or tissues of plants or humans, which can maintain or increase viability in the presence of harmful toxic substrates such as, for example, herbicides and pharmaceutical components. have.

A second aspect of the invention relates to a method of introducing an nucleic acid into a host by viral nucleic acid, such as a plant or animal viral nucleic acid suitable for expressing the nucleic acid in a transgenic host, such that the endogenous gene is not expressed in the host. In one embodiment, the host is a plant, but one of ordinary skill in the art will appreciate that other hosts may be used, such as, for example, bacteria, yeast, and animals including humans. This method uses the principle of not expressing the posttranscriptional gene of the endogenous host gene homolog. Since the replication mechanism of the transfected non-native nucleic acid produces sense and antisense RNA sequences, the location of the non-native nucleic acid insert is not critical to ensuring that the gene provided is not expressed. In particular, this embodiment is particularly useful for preventing the expression of a group of genes often found in plants. The prior art has not described an effective method for preventing the expression of multiple gene groups in plants.

A third aspect of the invention relates to a method of selecting the desired functions of RNA and protein using viral vectors expressing a library of nucleic acid sequence variants. Sequence variant libraries can be generated by ex vivo mutagenesis and / or recombination. Rapid ex vivo evolution can be used to enhance virus-specific or protein-specific functions. In particular, plant RNA viral expression vectors have a library comprising genes of nucleic acid variants, viruses, plants or other sources and are capable of determining, selecting and enhancing the desired denaturing effects in RNA or protein products. It can be used as a means applicable to. In a preferred embodiment, nucleic acid shuffling techniques can be used to construct shuffled gene libraries. Random, semi-random, or known sequences of Barrirus origin may be used to enhance the translation of exogenous genes, as well as the genetic stability of exogenous genes in expression vectors and the stability of exogenous genes in vivo that encode mRNA. It can also be inserted into a viral expression vector between sequences. Desired functions of RNA and proteins include promoter activity, replication properties, translational efficiency, (local and overall) mobility, signal pathways, or viral host ranges. Variations in the desired function can be determined by analyzing sequence variants in the viral vector.

Methods of increasing the expression of gene sequences in viral expression libraries can be achieved by avoiding genetic defects of proliferation in E. coli, for example, in one preferred embodiment of the invention, sequence libraries or individually aligned Cell-free methods can be used to clone sequences into viral expression vectors and to reconstruct an infected virus, where the final ligation product is transcribed and the resulting RNA is a plant or plant cell that discovers gene function or makes proteins. It can be used for inoculation / infection.

Techniques for screening sequence libraries include replication and virus migration, exogenous gene sequence retention in vectors, and new and enhanced virus-coding functions upon proper folding, activity and expression of protein products, new gene expression, effects on host metabolism, and It may be introduced into an RNA virus or RNA viral vector as a population or individual to identify individuals having plant resistance or susceptibility to exogenous plants.

Variants of native viral gene sequences or heterologous nucleotide sequences may be RNA viruses by many methods, such as screening a population of individual variants or batches of new features expressed by the virus itself or conferred on cells by host plants or viral vectors. Or RNA viral expression vectors. Variant populations include “hosts”: (1) protoplasts; (2) whole plants; Or (3) the inoculated leaves of the whole plant can be transfected as a population or as individual clones and obtained or lost due to protein expression (increase or decrease), RNA expression (increase or decrease), secondary metabolites or viral infections. Other host characteristics can be identified.

To treat a host with a substance resulting from downregulation in cell death or general metabolic function, a viral vector expressing a green fluorenscent protein (GFP) or other selectable marker gene and variant sequence simultaneously is a variant expressed from a viral vector. It can be used to quantitatively screen the level of resistance or sensitivity to a substance of interest conferred on the host by the sequence. By quantitative screen pools or individual infections, the virus containing a unique variant sequence that enables the supported metabolism of the host is identified by fluorescence under longwave ultraviolet light. Not imparting this phenotype does not fluoresce or is weak. In this way, a high yield screened in a multi-well dish in a plate reader is possible if the average fluorescence of the well is expressed as the ratio of absorbance (cell mass measurement). This technique allows for screening a population or individual, then obtaining the sequence of the viral vector conferring the desired properties by RT-PCR, and rescreening specific variant sequences in the secondary screen.

Transcription factors or factors affecting the signal transduction pathways of the host cell can be monitored using specific proteomic, mRNA or metaphysical characteristics that are transfected with the virus expression library and analyzed. Contributions of specific proteins or products to beneficial traits are known from the literature, but new modes of enhanced or reduced expression can in turn be identified by finding factors that respond to cellular signals that change that particular expression. For example, transcription factors that regulate expression of protective proteins, such as systemin peptides or protease inhibitors, can be identified by transfecting the host with a viral library, and expression of cysteamine or protease inhibitors or their RNAs may be identified. Can be analyzed directly. In contrast, the promoters needed for the gene to be expressed can be genetically fused with GFP and introduced into the host as transient expression constructs or into stable transgenic host cells / tissues. The resulting cells are transfected with a viral vector library. The host can be screened quickly after vector transfection after relative GFP expression. Similarly, a combination of transfecting a host with a viral library and treating a plant with methyl jasmonate can identify sequences that reverse or enhance gene induced events induced by this metabolite. This approach can be applied to other factors involved in promoting more biomaterials in plants such as Lipy or DET2. Expression of these factors may be assayed directly or via a promoter genetically fused to GFP. The technique allows screening of a population or individual, and then allows the sequence of the viral vector to confer the desired characteristics by RT-PCR, and to rescreen certain variant sequences in the secondary screen.

A fourth aspect of the invention relates to a method of inhibiting an endogenous protease of a plant host, comprising treating the plant host with a compound that induces the production of endogenous inhibitors of the endogenous protease. In one preferred embodiment, jasmonic acid can be used to treat plant hosts that induce the production of endogenous inhibitors of endogenous proteases. In another preferred embodiment, the expression of the exogenous nucleic acid or protein product thereof is increased by treating the plant host with the compound. In particular, protease inhibitor expression transforming hosts can be used to reduce proteolysis expressed by viral expression vectors. In a preferred embodiment, jasmonic acid can be used to treat plants infected with the viral expression vector to reduce proteolysis expressed by the viral expression vector.

A fifth aspect of the invention relates to the genes obtained by the invention and fragments, nucleotide sequences and gene products thereof. The invention is characterized by expressing a selected nucleotide sequence in a host organism. Those skilled in the art will readily appreciate that the gene product of the nucleotide sequence can be isolated using techniques known in the art. The gene product may exhibit biological activity such as drugs, herbicides and other similar functions.

The present invention relates generally to the field of molecular biology and plant genetics. In particular, the present invention relates to a method of determining the function of nucleotide sequences and genes by transfecting the nucleotide sequences and genes into a host.

1 shows a vector TT01 / PSY +.

2 shows the vector TTO1A / PDS +.

3 shows the vector TT01A / CaCCS +.

4 shows a vector TTU51 CTP CrtB.

5 shows the vector TTOSA1CTP CrtI491.

Figure 6 shows Erwinia herbola phytoen desaturase gene (plasmid pAU211).

7 depicts plasmid KS + / CrtI 491.

8 depicts plasmid pBS736.

9 depicts plasmid pBS 712.

Figure 10 depicts alcohol coral enzyme ZZA1 encoding the 72kDa gene product of genomic clones.

Figure 11 depicts plasmid TTOS1APE ZZA1.

12 depicts plasmid TTO1A 103L.

13 depicts plasmid TTU51A QSEO # 3.

14 depicts plasmid KS + TVCVK # 23.

15 depicts plasmid pBS735.

16 depicts plasmid pBS740.

17 depicts plasmid pBS723.

18 depicts plasmid pBS731.

19 depicts plasmid pBS740 AT # 120.

20 depicts the nucleotide sequence arrangement of 740 AT # 120 versus human ADP-ribosylation factor (ARF3) M33384.

21 depicts plasmid pBS740 AT # 88.

Figure 22 depicts the nucleotide sequence arrangement of L33574 mRNA for 740 AT # 88 versus rhodopsin.

FIG. 23 depicts the nucleotide sequence arrangement of X07797 Octopus mRNA for 740 AT # 88 versus rhodopsin.

24 depicts the protein sequence arrangement of 740 AT # 88 versus Arabidopsis yeast ORF ATTS2938.

25 shows the protein sequence arrangement of 740 AT # 88 versus Octopus Rhodopsin P31356.

FIG. 26 shows a comparison of amino acid sequences of 740 AT # 2441 versus Tobaco RAN-B1 GTP binding protein.

27 shows a nucleotide sequence comparison of 740 AT # 2441 versus human RAN GTP-binding protein.

28 is a schematic of cell free cloning.

A first aspect of the invention relates to a method of determining the function of a gene and the protein encoded by the gene in a host organism, such as a bacterium, yeast, plant or animal, by transfecting the nucleic acid sequence into the organism. The inventors have determined a method of determining the function of a nucleic acid sequence by transfecting an organism with a nucleic acid of interest, thereby describing in more detail the function of the nucleic acid, including genes, and as a result, the information spread throughout the genome field can be quickly utilized. To be able.

In one embodiment, the nucleic acid is introduced into a plant host. Preferably, the nucleic acid is introduced by plant viral nucleic acid. The recombinant viral nucleic acid is suitable for maintenance and transcription or expression of non-native nucleic acid sequences, and can be transcribed or expressed locally or in whole in a plant host. In particular, particularly preferred recombinant plant viral nucleic acids useful in the methods of the invention include native plant virus subgenomic promoters, plant virus coat protein coding sequences and at least one non-native nucleic acid sequence.

In a second embodiment, the plant viral nucleic acid used in the present invention is characterized by deletion of a native coat protein coding sequence and comprises a non-native plant virus coat protein coding sequence and a non-native promoter, preferably a non-native coat protein coding. It consists of a subgenomic promoter of the sequence and allows expression in a plant host, packaging of recombinant plant viral nucleic acid, and overall infection of the host by the recombinant plant viral nucleic acid. The recombinant plant viral nucleic acid contains one or more native or nonnative subgenomic promoters. Each nonnative subgenomic promoter is capable of transcription or expression of adjacent genes or nucleic acid sequences in a plant host, no recombination with each other, and no recombination with native genomic promoters. When containing one or more nucleic acid sequences, one or more non-native nucleic acids can be inserted adjacent to native plant virus subgenomic promoters, or native and non-native plant virus subgenomic promoters. Moreover, it can also be expected that two or more heterologous nonnative subgenomic promoters can be used. Non-native nucleic acid sequences can be transcribed or expressed in host plants under subgenomic control to produce the nucleic acid product of interest.

In a third embodiment, plant viral nucleic acids are used in the present invention, wherein native coat protein coding sequences can be placed adjacent to one non-native coat protein subgenomic promoter instead of non-native coat protein coding sequences.

In a fourth embodiment, plant viral nucleic acids are used in the present invention wherein a native coat protein gene is adjacent to its subgenomic promoter, and one or more nonnative subgenomic promoters can be inserted into the viral nucleic acid. The inserted non-native subgenomic promoters can transcrib or express adjacent genes in a plant host, are not capable of recombination with each other, nor are they capable of recombination with native subgenomic promoters. The nonnative nucleic acid sequence may be inserted into an adjacent nonnative subgenomic plant virus promoter to be transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the nonnative nucleic acid product. Alternatively, native coat protein coding sequences can be replaced with non-native coat protein coding sequences.

Viral vectors used according to the invention can be encapsulated with coat proteins encoded by recombinant plant viruses. Recombinant plant virus nucleic acids or recombinant plant viruses can be used to infect a suitable host such as a plant. Recombinant plant viral nucleic acids are replicable in the host, can be spread locally or entirely in the host, and can transcrib or express non-native nucleic acids in the host to produce the desired product. Such products include, for example, useful polypeptides or proteins containing enzymes, complex biomolecules, ribozymes, or polypeptides or protein products resulting from positive or antisense RNA expression. Moreover, the nucleic acid of interest can be under the control of a genomic promoter and thus can be expressed in the viral genome.

In another embodiment, the method comprises at least one non-native for a vector derived from at least one polyprotein expressed by a viral expression vector by proteolytic treatment catalyzed by at least one protease in the polyprotein. A virus expression vector encoding a protein is used, wherein the vector has at least one promoter, DNA having a sequence encoding at least one polyprotein from a polyprotein-producing virus, at least located at the 3'-end of the DNA. One restriction site, and a cloning vehicle. Additional embodiments are viruses that encode at least one protein that is non-native for a vector derived from at least one polyprotein expressed by a viral expression vector by proteolytic treatment catalyzed by at least one protease in the polyprotein. An expression vector is used, wherein the vector consists of at least one promoter, a DNA having a sequence encoding at least one polyprotein from a polyprotein-producing virus, located at the 3'-terminus of the cDNA and cloning carrier. It may include at least one restriction site. Preferred embodiments include the use of fortiviruses as polyprotein-producing viruses, particularly preferred uses tabacco etch virus (TEV). Such useful vectors according to the method of the invention are disclosed in more detail in US Pat. No. 5,491,076, which is hereafter incorporated in its entirety.

In another preferred embodiment according to the method a recombinant plant virus is used which encodes the expression of the fusion of the plant virus coat protein and the nucleic acid product of interest. The recombinant plant virus expresses high levels of the nucleic acid of interest. The position or positions at which the viral coat protein is bound to the amino acid product of the nucleic acid of interest are called fusion linkages. The product of the construct has one or more fusion linkages. The fusion linkage may be located at the carboxyl terminus of the viral coat protein, or the fusion linkage may be located at the amino terminus of the code protein portion of the construct. For example, the position of the nucleic acid of interest can be located internally to the 5 'and 3' ends of the nucleic acid sequence encoding the viral coat protein, and there are two fusion linkages. In other words, the nucleic acid of interest can be located 5 ', 3', top, bottom or inside of the coat protein. In some embodiments of the recombinant plant virus, "leaky" start codons or stop codons may occur at fusion linkages where sometimes the translation does not end. Certain recombinant plant viruses according to this embodiment of the invention are disclosed in more detail in US Patent Application Serial No. 08 / 324,003, which is hereafter incorporated in its entirety.

In another embodiment according to the present invention, the nucleic acid sequence or gene of interest can be located within a suitable vector construct, such as a virus that infects a host organism. In other words, the method can be practiced in a vector used to infect a host organism regardless of the position of the nucleic acid sequence of interest. The present invention is not limited to any particular viral construct, but contemplates using all constructs that are feasible. Specifically, one skilled in the art can choose to carry DNA or RNA containing any size and whole genome to measure function.

Those skilled in the art will appreciate that the above embodiments merely represent many of the constructs useful for locally or wholly expressing nucleic acids in host organisms such as plants. All such constructions can be considered to be within the scope of the present invention.

To provide a clearer and more consistent understanding of the specification and claims, the following definitions are set forth, including the scope of the terms used herein:

Adjacent: the position of the nucleotide sequence close to the defined sequence and the 5 'or 3' position of the defined sequence. In general, contiguous means within two or three nucleotides of a cited site.

Animal Cells: Single function cells found in animal organisms. Animal tissue refers to one or more cells grouped or organized to perform one or more functions. Animal organ means one or more tissues that are morphologically arranged to perform one or more functions in an organism.

Antisense Inhibition: One form of gene regulation based on cytoplasmic, nuclear or organelle inhibition of gene expression by being present in the cell of an RNA molecule complementary to at least a portion of the mRNA to be translated. Specifically, it can be thought that the DNA molecule is derived from an RNA virus or mRNA virus in the host cell genome or from a DNA virus.

Cell culture: A proliferating group of cells that grow continuously or discontinuously in undifferentiated or differentiated state.

Chimeric sequence or gene: A nucleotide sequence derived from at least two heterologous moieties. The sequence consists of DNA or RNA.

Coding Sequence: When a deoxyribonucleotide or ribonucleotidic sequence is transcribed and translated or simply translated, a cellular polypeptide or ribonucleotide sequence is formed in which the cellular polypeptide is formed if translated.

Compatibility: Potential for use with systems of other ingredients. A vector or plant or animal viral nucleic acid compatible with a host is one that is replicable in the host. Coat proteins compatible with viral nucleotide sequences are those capable of encapsulating the viral sequence.

Complementarity Assay: As used herein, the term refers to observing the changes produced in an organism when the nucleic acid sequence is introduced into the organism after the selected gene has been removed or mutagenic such that it has no function for its normal role. Genes that are removed or complementary to mutagenic genes can be returned to the genetic phenotype of the selected gene.

Structural Expression: Gene expression characterized by a substantially constant or regular circulating gene former. In general, structurally expressed genes are not substantially induced by external stimuli.

Differentiated Cell: A cell substantially mature to perform one or more biochemical or physiological functions.

Dual Heterologous Subgenomic Promoter Expression System (DHSPES): a plus stranded RNA vector having a dual heterologous subgenomic promoter expression system that increases, decreases or changes protein, peptide or RNA expression, preferably US Pat. Nos. 5,316,931, 5,811,653, Vectors disclosed in 5,589,367 and 5,866,785.

Expressed sequence tag (EST): A relatively short single-pass DNA sequence obtained from one or more ends of a cDNA clone and RNA derived therefrom. It is at the 5 'or 3' position. EST is useful for identifying specific genes.

Expression: The term refers to the integrated meaning of one or more transcription, reverse transcription and translation.

Gene: A discontinuous nucleic acid that is essential for producing one or more cellular products or for performing intercellular or intracellular functions.

Gene Silencing: Reduction in Gene Expression. Viral vectors that express gene sequences from a host can induce gene silencing of homologous gene sequences.

Growth Cycle: The term is meant to encompass replication of the nucleus, organelles, cells and organs.

Host: A cell, tissue or organism capable of replicating a nucleic acid such as a vector or plant viral nucleic acid, which can be infected by a virus containing the viral vector or viral nucleic acid. The term may be considered to include prokaryotic cells, eukaryotic cells, organs, tissues or organisms. Hosts include bacteria, fungi, yeasts, animals (cells, tissues or organisms) and plants (cells, tissues or organisms).

Induction: The terms “induce”, “induced” and “inducible” generally refer to genes and promoters that are operably linked in a manner that relies on external stimulants such as molecules to actively transcrib or transduce genes. do.

Infection: The ability of a virus to deliver a nucleic acid of a virus to a host or to introduce a viral nucleic acid into a host, wherein the viral nucleic acid can be replicated and the viral protein synthesized so that new viral particles are bound. In this context, the terms "infectious" and "infectious" may be used interchangeably herein. In addition, the term is meant to include the ability to incorporate a selected nucleic acid sequence into the genome, chromosome or gene of a target organism.

Multigene family: A set of genes transmitted by replication or mutation from an ancestor gene. The genes may be clustered together on the same chromosome or may be scattered on different chromosomes. Examples of multigene families include histones, hemoglobin, immunoglobulins, histocompatibility antigens, actin, tubulin, keratin, collagen, heat shock proteins, saliva glue proteins, eggshell proteins, epidermal proteins, egg yolk proteins, and pasolin .

Nonnative: Any RNA or DNA that does not normally occur in the cell or organism in which the RNA or DNA is located. Examples include recombinant plant viral nucleic acids and genes or ESTs contained therein. In other words, the RNA or DNA sequence is non-native for viral nucleic acids. The RNA or DNA sequence does not normally occur in viral nucleic acids. In addition, RNA or DNA sequences are non-native for host organisms. In contrast, the term non-native does not mean that the RNA or DNA sequence should be simultaneously non-native for viral nucleic acids and host organisms. Specifically, the present invention can be thought of as locating RNA or DNA sequences native to the host organism into viral nucleic acids that are non-native.

Nucleic Acid: The term is meant to include DNA or RNA sequences below the complete gene sequence in the size of one or more nucleotides. The term includes all nucleic acids whether naturally occurring in a particular cell or organism or unnaturally occurring in a particular cell or organism.

Nucleic acid of interest: This term is interchangeable with the term "nucleic acid" and refers to a nucleic acid sequence whose function has been determined. The sequence is normally nonnative for viral vectors, but can be native or nonnative for host organisms.

Organisms: The organisms used in the present invention and the term "host organisms" specifically include animals including humans, plants, viruses, fungi and bacteria.

Phenotypic Trait: An observable, measurable or detectable property that results from the expression or suppression of a gene or genes.

Plant cells: structural and physiological units of plants that make up protoplasts and cell walls.

Plant organs: Clear and visually differentiated parts of plants, such as roots, stems or embryos.

Plant Tissue: Tissue of a plant in planta or in culture. The term includes whole plants, plant cells, plant organs, protoplasts, cell cultures, or groups of plant cells in organic form in structural and functional units.

Positive-Sense Inhibition: A gene regulatory form based on cytoplasmic inhibition of gene expression due to the presence of cells of an RNA molecule substantially homologous to at least a portion of the mRNA to be decoded.

Promoter: A 5'-position uncoated sequence substantially adjacent to a coding sequence involved in transcription initiation of the coding sequence.

Protoplasts: An isolated plant or bacterial cell without part or all of the cell wall.

Recombinant Plant Viral Nucleic Acid: A plant viral nucleic acid modified to contain a nonnative nucleic acid sequence. The non-native nucleic acid sequence may originate from or be synthesized purely from any organism, but may also include nucleic acid sequences naturally occurring in the organism into which the recombinant plant viral nucleic acid is introduced.

Recombinant Plant Virus: A plant virus comprising a recombinant plant virus nucleic acid.

Subgenomic promoter: promoter of subgenomic mRNA of a viral nucleic acid.

Substantial sequence homology: Represents nucleotide sequences that are substantially functionally identical to each other. The nucleotide difference between the sequences with substantial sequence homology affects the function of the RNA or gene product encoded by the sequence.

Holistic Infection: Represents an infection over a significant portion of an organism, including a spreading mechanism that involves migration to additional cells that are close or far from one infected cell, rather than just direct cell inoculation.

Transposon: A nucleotide sequence, such as a DNA or RNA sequence, which is positionally shiftable and gene, chromosome or in-genome.

Transgenic Plant: A plant comprising an exogenous nucleotide sequence inserted into a nuclear genome or organelle genome.

Transcription: Generation of RNA as complementary copies of DNA sequences or subgenomic mRNAs by RNA polymerase.

Vectors: Self-replicating RNA or DNA molecules that carry RNA or DNA fragments between cells such as bacteria, yeast, plant or animal cells.

Virus: An infectious agent consisting of a nucleic acid that is either unencapsulated with protein. The virus is a mono-, di-, tri-, or multi-partite virus.

In a preferred embodiment, the invention is directed to a plant host by a recombinant plant virus comprising a recombinant plant virus nucleic acid or by a recombinant plant virus nucleic acid containing one or more non-native nucleic acid sequences that are transcribed or expressed in infected tissues of the plant host. Infects. Coding sequence products are recovered from plants, produce phenotypic traits in plants, generate biochemical pathways in plants, or express endogenous genes in plants.

The present invention has numerous advantages. The present invention allows those skilled in the art to determine the function of an unknown nucleic acid sequence.

Chimeric genes and vectors and recombinant plant viral nucleic acids used in the present invention can be constructed using techniques well known in the art. Suitable techniques are described in Sambrook et al. (2nd ed.), Cold Spring Harbor Laboratory, Cold Spring Harbor (1982, 1989); Methods in Enzymol. (Vols. 68, 100, 101, 118, and 152-155) (1979, 1983, 1986 and 1987); and DNA Cloning, D.M. Clover, Ed., IRL Press, Oxford (1985). The medium composition is disclosed in Miller, J., Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, New York (1972), which is hereby incorporated by reference in its entirety. DNA manipulation and enzymatic treatment are performed according to the method recommended by the manufacturer in preparing the construct.

An important feature of the invention is that it contains one or more non-native subgenomic promoters that are replicable, local and / or global spreadable in a compatible plant host, and which are capable of transcription or expression of adjacent nucleic acid sequences in the plant host. Using recombinant plant viral nucleic acids. Recombinant plant viral nucleic acid may be further denatured to delete all or part of the native coat protein coding sequence, or may be further modified to contain a non-native coat protein coding sequence under the control of one of the native or non-native subgenomic promoters, Or may be further denatured so that the native coat protein coding sequence is placed under the control of the non-native plant virus subgenomic promoter. Recombinant plant viral nucleic acid has substantial sequence homology with the plant viral nucleotide sequence. A partial list of suitable viruses may be, or derived from, RNA, DNA or chemically synthesized RNA or DNA.

The first step of producing a recombinant plant viral nucleic acid according to the particular embodiment used in the present invention is to use a known conventional technique, in which one or more subgenomic promoters do not destroy the biological function of the plant viral nucleic acid without the plant virus. Altering the nucleotide sequence of a plant nucleic acid nucleotide sequence so as to be inserted into a nucleic acid. Subgenomic promoters are capable of transcribing or expressing adjacent nucleic acid sequences in a plant host infected by a recombinant plant viral nucleic acid or a recombinant plant virus. Native coat protein coding sequences may be deleted in some embodiments, and in other embodiments may be placed under the control of a non-native subgenomic promoter, or may be maintained in additional embodiments. When a non-native coat protein gene is deleted or inactivated, it is inserted under the control of one non-native subgenomic promoter or optionally under the control of a native coat protein gene subgenomic promoter. Non-native coat proteins can be encapsulated with a recombinant plant virus nucleic acid to produce a recombinant plant virus. Thus, a recombinant plant viral nucleic acid comprises a coat protein coding sequence under the control of one native or nonnative subgenomic promoter, which is a native or nonnative coat protein coding sequence. Coat proteins are involved in the overall infection of plant hosts.

Some viruses that meet this need and are therefore suitable for use in accordance with the methods of the present invention include, for example, Tobacco Mosaic Virus (TMV), Ribgrass Mosaic Virus (RGM), and Cowpiea. Mosaic virus (CMV), Alfalfa Mosaic virus (AMV), Cucumber Green Mottle Mosaic virus watermelon strain (CGMMV-W) and Oat Mosaic virus (OMV) Tobamovirus group viruses, such as, and bromo mosaic virus (BMV), broad bean mottle virus, and cowpea chlorotic mottle virus. Roham mosaic virus group virus is included. Additional suitable viruses include Rice Necrosis virus (RNV), such as Tomato Golden Mosaic virus (TGMV), Cassava Latent virus (CLV), and Maize streak virus (Maize). Geminiviruses such as Streak virus (MSV). The characteristics of each of the appropriate viruses in this group are described below. However, the present invention is not limited to the use of the specific virus, and the method of the present invention can be understood to include at least all plant viruses.

Tobamovirus Group

Tobacco Mosaic virus (TMV) is one of the tobamoviruses. TMV virions are tubular filaments and consist of coat protein sub-units arranged in single preferential helix with single stranded RNA inserted between helix turns. TMV infects not only tobacco but also other plants. TMV may be delivered mechanically and may remain infected with soil or dry leaf tissue for one year or more.

TMV virions may be inactivated in an environment of pH 3 or below or 8 or above or by formaldehyde or iodine. TMV preparation can be prepared from plant tissues by differential centrifugation after (NH ₄ ) ₂ SO ₄ precipitation.

The TMV single stranded RNA genome is about 6400 nucleotides in length, capped at the 5'-end and is not polyadenylation. Genomic RNA can act as an mRNA for a protein having a molecular weight of about 130,000 (130K) and another one produced by read-through having a molecular weight of about 180,000 (180K). Other genes are expressed during infection by the formation of monocystronic 3′-coterminal subgenomic mRNA, including one encoding the 17.5K coat protein (LCM) and another encoding the 30K protein (I ₂ ). 30K protein was detected in infected protoplasts, as described in Miller, J., Virology 132: 71 (1984), and in infected plants disclosed in Deom et al., Science 237: 389 (1987). Involve the movement of the virus from cell to cell. The functions of these two large proteins are not known, but they are believed to have functions in RNA replication and transcription.

Several double-stranded RNA molecules, including double-stranded RNA corresponding to the genome, I ₂ , LMC RNA, have been detected in plant tissues infected with TMV. Such RNA molecules are believed to be intermediates in genomic replication and / or mRNA synthesis processes that give rise to other mechanisms.

It has been suggested that some TMV assemblies occur in chloroplasts because transcripts of ctDNA are detected in purified TMV virions, but TMV assemblies are apparently generated in the cytoplasm of plant cells. TMV assembly initiation comprises a cyclic aggregate ("disk") of coat proteins (each disk consisting of 17 subunits in two layers) and a unique internal nucleation site in RNA; In the general strain of TMV is generated by the interaction between the region of about 900 nucleotide hairpins from the 3'-terminus. Any RNA, including subgenomic RNA containing the site, can be packaged in virions. The disk is expected to spiral upon interaction with RNA, and then the assembly (extension) proceeds faster in both directions (but 3'-direction than the 5'-direction from the nucleation site).

Another one of the tobamoviruses, the Cumcumber Green Mottle Mosaic Virus Watermelon Strain (CGMMV-W), is associated with the Cumcumber virus. Nozu et al. Virology 45: 557 (1971). The coat protein of CGMMV-W interacts with the RNA of both TMV and CGMMV to assemble viral particles in vitro. Kurisu et al., Virology 70: 214 (1976).

Some tobamovirus strains can be divided into two subgroups based on the assembly location of the origin. Subgroup I includes vulgare, OM and tomato strains, which have about 800-1,000 nucleotide assembly origin from the 3'-end and coat protein cistron of the RNA genome. Lebeurier et al. Proc. Natl. Acad. Sci. USA 74: 149 (1977); Fukuda et al. Virology 101: 493 (1980). Subgroup II includes CGMMV-W and cornpea strains (Cc), which have about 300-500 nucleotide assembly origin from the 3′-end and coat protein cistron of the RNA genome. The code protein cistron of CGMMV-W is located at 176-661 nucleotides from the 3'-terminus. The 3 ′ noncoding region is 175 nucleotides in length. The assembly origin is located in the coat protein cistron. Meshi et al., Virology 127: 54 (1983).

Broum Mosaic Virus Group

Broome mojik virus (BMV) is a branched, single-stranded RNA-containing plant virus, commonly referred to as bromovirus. Each type of bromovirus infects a narrow range of plants. Mechanical movement of bromoviruses occurs easily, and some species can be carried by beetles. In addition to BV, other bromoviruses include broad bean mottle virus and kaupy chlorotic mottle virus.

In general, bromovirus virions are icosahedrons of about 26 μm in diameter containing a single species of coat protein. The bromovirus genome has three linear positive-sense single stranded RNA molecules and the coat protein mRNA may be encapsulated. Each of the RNAs has a capped 5'-end and a structure similar to tRNA at the 3'-end, which contains tyrosine. Viral assembly occurs in the cytoplasm. The complete nucleotide sequence of BMV is described in Alquist et al. Mol. Biol. 153: 23 (1981), and is characterized.

Rice Necrosis Virus

Rice netrosis virus is a type of potato virus Y group or a kind of fortivirus. Rice netrosic virions are flexible filaments consisting of one type of coat protein (molecular weight is about 32,000 to about 36,000) and one linear positive-sense single stranded RNA molecule. Rice necrosis virus is carried by Polymyxa oraminis (eukaryotic intracellular parasites found in plants, algae and fungi).

Gemini Virus

Geminiviruses are a group of small single-stranded DNA-containing plant viruses with unique forms of virions. Each virion consists of a pair of equally sized particles (incomplete icosahedrons) consisting of a single type of protein (molecular weight is approximately 2.7-3.4 × 10 ⁴ ). Each geminivirus virion contains one circularly positioned-sense single stranded DNA molecule. In some geminiviruses (ie, cassava latent virus and empty golden mosaic virus), the genome is bifurcated and contains two single stranded DNA molecules.

Fortivirus

Fortiviruses are a group of plant viruses that produce polyproteins. Particularly preferred fortivirus is tobacco etch virus (TEV). TEV is a well characterized fortivirus and contains a 9.5 kb positive-stranded RNA genome that encodes a single large polyprotein that is processed by three virus-specific proteases. The nuclear protein "proteinase" is associated with the growth of several replication-related proteins and capsid proteins. Helper component-proteinase (HC-Pro) and 35-kDa protein catalyze or cleave at their respective C-terminus. In each of these proteins the proteolytic domain is located near the C-terminus. 35-kDa protease and HC-Pro are derived from the N-terminus of TEV polyprotein.

Another particularly useful virus according to some embodiments of the invention is characterized in that the virus is associated with an animal host. Some of these viruses are discussed below.

Alpha virus

Alphaviruses are a genus of viruses from the Togaviridae family. Most of the viruses that make up this genus are transmitted by mosquitoes and can cause disease in humans or animals. Some alphaviruses are grouped into three serologically defined complexes. Complex-specific antigens are bound to the E1 protein of the virus, and species-specific antigens are bound to the E2 protein of the virus.

The Semliki Forest virus complex includes Bebaru virus, Chikkununya Fever virus, Getah virus, Mayaro virus, and Oniongi Fever virus. (O'nyongyong Fever virus), Ross River virus, Sagiyama virus, Semliki Forest virus and Una virus. Venezuelan Equine Encephalomylitis virus complexes include Cabassou virus, Everrglades virus, Mucambo virus, Pixuna virus, and Venezuelan Equine Encephalomyelitis viruses are included. The Western Equine Encephalomyelitis virus complex includes Aura virus, Fort Morgan virus, Highlands J virus, kyzylagach virus and Sindbis virus. virus), Western Equine Encephalomyelitis virus and Whataroa virus.

Alphaviruses contain icosahedral nucleotides consisting of 180 copies of a single species of capsid protein complexed with plus-stranded mRNA. Alphaviruses grow when the preassembly nucleocapsid is surrounded by a lipid envelope comprising two virus-encoding linings, namely El and E2. The envelope is obtained when capsids assembled in the cytoplasm develop through the plasma membrane. The envelope consists of a lipid bilayer derived from a host cell.

It is claimed that half the basic amino-terminus of the capsid protein interacts with genomic RNA to stabilize the capsid interaction with genomic RNA or to initiate encapsulation. Strauss et al., Togaviridae and Flaviviridaei, Ed. S. Schlesinger & M. Scjlesinger, Plenum Press, New York, pp. 35-90 (1980). This assertion means that the origin of the assembly is located on the unencapsulated genomic RNA or at the amino-terminus of the capsid protein.

Studies with temperature-sensitive mutations in alphaviruses have shown that failure of cleavage of structural proteins prevents them from forming mature virions. Lindquist et al. Virology 151: 10 (1986) characterize temperature-sensitive mutations of Sindbis virus, t _s 20. Temperature sensitivity is obtained from AU change in nucleotide 9502. Ts damage provides PE2 cleavage of E2 and E3 and final mutation of progeny virions. Hahn and many other supra reported three temperature sensitive mutations in capsid proteins that prevent cleavage of precursor polyproteins at unacceptable temperatures. If the cleavage fails, no caps are formed and there is little envelope protein.

Defect interfering RNA (DI particles) of Sindbis virus is a help-dependent deletion mutation that inhibits replication of homologous standard viruses. Perrault, J., Microbiol. Immunol. 93: 151 (1981). DI particles have been found to be functional vectors that introduce at least one foreign gene into the cell. Levis, R., Proc. Natl. Acad. Sci. USA 84: 4811 (1987).

At least 1689 internal nucleotides of the DI genome can be replaced with an external sequence, yielding RNA capable of replication and encapsulation. Deletion of the DI genome does not destroy biological activity. A disadvantage of this system is that DI particles randomly rearrange internal RNA sequences and change their size. Monroe et al., J. Virology 49: 865 (1984). The expression of the gene inserted into the internal sequence is not much higher than expected. Levis et al. Have found that the replication of the inserted gene is good but low in translation. This is the result of the cleavage of the gene due to competition of the whole virus particle to the detoxification site and / or rearrangement through several channels.

Two species of mRNA are present in alphavirus-infected cells: the 42S mRNA region, which is packaged with native virions and acts as a message for nonstructural proteins, 26S mRNA encoding structural polypeptides. 26S mRNA is homologous to the 3 'third of 42S mRNA. It is translated into 130K polyprotein which is co-detoxified and treated with capsid protein and two glycosylated membrane proteins, E1 and E2.

The 26S mRNA of Eastern Equine Encephalomyelitis (EEE) strain 82V-2137 has been described by Chang et al. In J. Gem. Virol. 68: 2129 (1987). The 26S mRNA region encodes the capsid proteins, E3, E2, 6K and El. The amino terminus of the capsid protein is believed to stabilize the interaction of the capsid with mRNA or to interact with genomic RNA to initiate encapsulation.

Uncleaved E3 and E2, called PE2, are inserted into the host ER during protein synthesis. PE2 is believed to have the same region as at least five alphaviruses that interact with nucleocapsid during virus morphogenesis.

The 6K protein is believed to act as a signal sequence involved in the movement of the E1 protein across the membrane. The E1 protein is believed to mediate the anchor of the E1 protein to viral fusion and viral envelopes.

Rhino virus

Renovirus is a viral species of the family Picornaviridae. Linoviruses are acid labile and are therefore rapidly inactivated at pH values below about 6. Renoviruses generally infect mammalian upper respiratory tracks.

Human rhinoviruses are the main source of common colds and there are many forms. Rhinoviruses can be propagated in a variety of human cell media, with a suitable growth temperature of about 33 ° C. Most rhinovirus strains are stable below room temperature and can tolerate freezing. Linoviruses can be inactivated by tincture of citric acid, iodine or phenol / alcohol mixtures. The complete nucleotide sequence of human linovirus 2 (HRV2) is sequenced. The genome consists of 7102 nucleotides with 6450 nucleotides long open reading frame (ORF), starting at 611 nucleotides from the 5′-end and stopping at 42 nucleotides from the poly (A) track. Three capsid proteins and cleavage sites were identified.

Renovirusson RNA is single stranded and positioned-sense. The RNA is not capped but is bound to the small virus-coding protein, virion-protein genomic binding (VPg) at the 5'-end. Detoxification is believed to produce a single polyprotein that is broken by proteolytic cleavage to yield individual viral proteins. The icosahedral virus capsid contains 60 copies of four viral proteins, VP1, VP2, VP3 and VP4, respectively, surrounding the RNA genome. Medappa K. Virology 44: 259 (1971).

The analysis of 610 nucleotides of the long ORF shows several short ORFs. However, since only two sequences show homology with the three stereotypes of HRV2, HRV14 and poliovirus, no function can be assigned to the translated protein. Both sequences are important for viral life cycles. These are 16 base stretches starting at 436 in HRV2 and 23 base stretches starting at 531 in HRV2. Cutting or removing these sequences from the rest of the nonstructural protein can produce unpredictable effects in assembling mature virions.

Capsid proteins of HRV2: VP4, VP3, VP2 and VP1 start at nucleotides 611, 818, 1601 and 2311, respectively. The cleavage point between VP1 and VP2A is thought to be around nucleotide 3255. Skern et al., Nucleic Acids Research 13: 2111 (1985).

Human rhinovirus type 89 (HRV89) is very similar to HRV2. This includes 7152 nucleotide genomes with a large single ORF of 2164 codons. Detoxification begins at nucleotide 619 and stops at 42 nucleotides prior to poly (A) track. Capsid structural proteins, VP4, VP2, VP3 and VP1 are first translated. Decryption of VP4 begins at 619. Cleavage sites are as follows:

VP4 / VP2 825 measured

VP2 / VP3 1627 measured

VP3 / VP1 2340 measured

VP1 / P2-A 3235 assumption

Ducchler et al., Proc. Natl. Acad. Sci. USA 84: 2605 (1987).

Poliovirus

Polioviruses are the generator of human acute gray beard and are one of three groups of enteroviruses. Heteroviruses are species of the family Picornaviridiea (linovirus family). Most enteroviruses replicate primarily in the gastrointestinal tracks of mammals, which can infect other tissues. Many enteroviruses can be propagated in the renal cell medium of humans or monkeys and in certain cell lines (eg, HeLa, Vero, WI-e8). Enteroviruses can be inactivated using heat (about 50 ° C.), formaldehyde (3%), hydrochloric acid (0.1N) or chlorine (about 0.3-0.5 ppm free residue Cl ₂ ).

The complete nucleotide sequence of poliovirus PV2 (Sab) and PV3 (Sab) has been determined. These are 7439 nucleotides and 7434 nucleotides in length. There is a long single ORF starting at over 700 nucleotides from the 5'-end. Poliovirus translation produces a single polyprotein cleaved by proteolytic treatment. Kitamura et al., Nature 291: 547 (1981).

These homologous sequences in the untranslated region play an essential role in viral replication such as:

1. Virus-specific RNA synthesis;

2.virus-specific protein synthesis; And

3. Packing

Toyota H. et al., J. Mol. Biol. 174: 561 (1984).

The structure of the poliovirus stereotype is very high in sequence homology. Its coding sequence encodes the same protein in the same order. Therefore, structural protein genes are similarly arranged. For PV1, PV2 and PV3, polyproteins begin to detox around 750 nucleotides. The four structural proteins VP4, VP2, VP3 and VP1 start at approximately 745, 960, 1790 and 2495, respectively, and the VPI ends at approximately 3410. They are separated in vivo by proteolytic cleavage rather than at stop / start codons.

Simian virus 40

Simian virus 40 (SV40) is a polyomavirus species virus, first isolated from Rhesus monkey kidney cells. The virus is usually found in the cells in latent form. Simian virus 40 is usually nonpathogenic in natural hosts.

Simian virus 40 virions are made by assembly of three structural proteins, VP1, VP2 and VP3. Girard et al., Biochem. Biophys. Res. Commun. 40:97 (1970); Prives et al., Proc. Natl. Acad. Sci. USA 71: 302 (1974); Jacobson et al., Proc. Natl. Acad. Sci. USA 73: 2747 (1976). The three corresponding viral genes consist of a partial overlapping method. These consist of the late gene portion of the genome. Tooze J. Moleculat Biology of Tumor Viruses Appendix A The SV40 Nucleotide Sequence, 2nd Ed. Part 2, pp. 799-831 (1980), Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Capsid proteins VP2 and VP3 are encoded by nucleotides 545-1601 and 899-1601, respectively, both of which can be read in the same frame. Thus VP3 is a subset of VP2. Capsid protein VP1 is encoded by nucleotide 1488-2574. The end of the VP2-VP3 ORF overlaps the VP by 113 nucleotides, but can read between the two frames. See, above, by Tooze J., Wychowski et al., J. Virology 61: 3862 (1987).

Adenovirus

Adenovirus type 2 is either adenovirus family or adenovirus. This family of viruses is a non-envelope linear double stranded DNA-containing virus that infects mammals or birds.

Adenovirus virions consist of icosahedral capsids in which the DNA genome is tightly bound to basic (arginine-rich) viral polypeptide VII. The capsid consists of 252 capsomere: 240 hexons (each capsomere is surrounded by 6 different capsmeres) and 12 fentons, one at each vertex, each 5 'peripene Surrounded by Tonal 'Hexon). Each Fenton consists of Fenton bases (consisting of viral polypeptides III) associated with one (for mammalian adenovirus cases) or two (most bird adenoviruses) glycoprotein fibers (viral polypeptide IV). The fiber can act as hemagglutinin and is the binding site for virions to host cell-surface receptors. Each hexon consists of three viral polypeptide II molecules; Most of them consist of icosahedrons. Several other minor polypeptides occur in virions.

The adenovirus dsDNA genome is covalently bound to the hydrophobic 'terminal protein' TP (molecular weight of about 55,000 Da) at the 5'-end of each strand; The DNA has different lengths of inverted terminal residues in different adenoviruses. For most adenoviruses tested, the 5'-terminal residue is dCMP.

During the replication cycle, virions bind to specific cell-surface receptors through the fibers and enter the cells by endocytosis or by direct penetration into the plasma membrane. Most capsid proteins are removed from the cytoplasm. The virion core enters the nucleus, where the uncoated releases the viral DNA with little virion polypeptide. Viral gene expression then begins. Viral dsDNA has genetic information on both strands. Initial genes (E1a, E1b, E2a, E3, E4 regions) are expressed before viral DNA expression begins. Later genes (L1, L2, L3, L4 and L5 regions) are expressed only after DNA synthesis has begun. Intermediate genes (E2b and Iva ₂ ) are expressed in DNA synthesis or in absence. The El la region codes for proteins involved in the regulation and transformation of the expression of other early genes. RNA transcripts are capped (to m ⁷ G ⁵ ppp ⁵ N) before being transported to the cytoplasm for translation and polyadenylation in the nucleus.

Viral DNA replication requires terminal proteins, TP and virus-encoding DNA polymerases, and other viral and host proteins. TP is synthesized as an 80K precursor, pTP, which covalently binds to the initial replicating DNA strand. pTP cleaves into mature 55K TP upon virion assembly; At this stage, pTP reacts with the dCTP molecule and covalently binds to the dCMP residue, whose 3 'OH is believed to act as a primer to initiate DNA synthesis. Late gene expression to synthesize viral structural proteins is achieved by stopping cellular protein synthesis, and viral assembly can be made up to 10 ⁵ virions per cell.

In addition to the plant and animal viruses described above, bacterial and yeast intracellular virus expression systems can also be used. For bacterial viral expression systems, Munishin et al., Nature 333 (6172: 473-5 (1998) and Priano et al., J, Mol. Biol. 271 (3): 299-310 ( 1997), and for yeast viral expression, Janda et al., Cell 72 (6): 961-70 (1993) and Ishikawa et al., J. Viol. 71 (10): 7781-90 ( 1997) The teachings of this reference are later incorporated into the full text.

Suitable plant viral nucleic acids can be used to prepare recombinant plant viral nucleic acids for use in the present invention, which are merely examples of such suitable plant viruses. The nucleotide sequence of a plant virus is denatured by inserting one or more subgenomic promoters into the plant viral nucleic acid using conventional techniques. Subgenomic promoters function in certain host plants. For example, if the host is tobacco, other viruses including TMV, TEV or subgenomic promoters can be used. The inserted subgenomic promoter must be compatible with the TMV nucleic acid and can be transcribed or expressed in contiguous nucleic acid sequences in tobacco. Native coat protein genes can be maintained and nonnative nucleic acid sequences can be inserted to make fusion proteins.

Native or non-native coat protein genes can be used for recombinant plant viral nucleic acids. Any non-native nucleic acid used may be located adjacent to one of the native subgenomic promoters or other available subgenomic promoters. In the case of native coat proteins, non-native coat proteins can encapsulate the recombinant plant viral nucleic acid and spread the recombinant plant viral nucleic acid in the host plant as a whole. The coat protein is chosen to provide a global infection in the plant host of interest. For example, the TMV-U1 coat protein provides a global infection in N. tabacum.

Recombinant plant viral nucleic acids can be prepared by cloning viral nucleic acids. If the viral nucleic acid is DNA, it can be cloned directly into a suitable vector using conventional techniques. One technique is to bind the replication origin to viral DNA that is compatible with the transfected cells. If the viral nucleic acid is RNA, a full length DNA copy of the viral genome is first produced by known methods. For example, viral RNA is transcribed into DNA using reverse transcriptase to produce double stranded DNA prepared using subgenomic DNA fragments and DNA polymerases. The cDNA is then cloned into the appropriate vector and cloned into the cells to be transfected. Optionally, cDNA ligation with the vector is transcribed directly into the infected RNA in vitro. cDNA fragments are mapped, if necessary, and combined with appropriate sequences to produce a full length DNA copy of the viral RNA genome. Thereafter, the DNA sequence for the subgenomic promoter with or without coat protein is inserted into the nucleic acid which is not essential according to the specific embodiment of the invention used. Sites that are not essential are those that do not affect the biological properties of the plant viral nucleic acid. Since the RNA genome is an infectious agent, cDNA is located adjacent to the appropriate promoter for RNA to be produced in the producing cell. If the capped RNA is an infectious agent, the RNA is capped using conventional techniques. In addition, the capped RNA can be packaged ex vivo with a coat protein added from TMV to prepare assembled virions. The assembled virion can then be used to inoculate a plant or plant tissue.

Optionally, uncapped RNA can also be used in embodiments of the invention. In contrast to the techniques practiced in the scientific literature and issued patents (Alquist et al., U.S. Pat.No. 5,466,788), uncapped transcripts for viral expression vectors infect both plants and plant cells. Although capping increases the efficiency of infection, it is not necessary to infect viral expression vectors in plants. In addition, to construct an infectious viral vector, nucleotides may be added between the transcriptional start site of the promoter and the cDNA start site of the viral nucleic acid. One or more nucleotides may be added. In a preferred embodiment of the invention, the inserted nucleotide sequence comprises G at the 5'-end. In a particularly preferred embodiment, the inserted nucleotide sequence is GNN, GTN, or (GNN) _x or (GTN) _x .

Another feature of recombinant plant viral nucleic acids useful in the present invention is that the nucleic acid consists of one or more nucleic acid sequences capable of being transcribed into a plant host. The nucleic acid sequence is a native nucleic acid sequence generated in the host organism or a non-native nucleic acid sequence that does not normally occur in the host organism. The nucleic acid sequence is located adjacent to one of the non-native viral subgenomic promoters and / or the native coat protein gene promoter depending on the specific embodiment used. Nucleic acids can be inserted by conventional techniques, or nucleic acid sequences can be inserted into native coat protein coding sequences such that fusion proteins are produced. The nucleic acid sequence to be transcribed can be transcribed as RNA capable of controlling phenotypic expression by antisense or positive-cent mechanisms. Optionally, the nucleic acid sequences in the recombinant plant viral nucleic acid can be transcribed or translated in plant hosts that produce phenotypic features. In addition, the nucleic acid sequence may encode the expression of one or more phenotypic features. Recombinant plant viral nucleic acid comprising the nucleic acid sequence can be constructed using conventional techniques so that the nucleic acid sequence is in the proper position in the viral subgenomic promoter used.

The double stranded DNA of the recombinant plant viral nucleic acid or the complementary copy of the recombinant plant viral nucleic acid is cloned into the cell to be transfected. If the viral nucleic acid is RNA, the nucleic acid (cDNA) is first bound to a promoter compatible with the producing cell. Recombinant plantvirus nucleic acid is cloned into a suitable vector compatible with the producing cell. In this way, only RNA copies of the chimeric nucleotide sequence are produced in the producing cell. For example, when plant cells are transfected, a CaMV promoter can be used. Optionally, the recombinant plant viral nucleic acid is inserted into a vector adjacent to a promoter compatible with the producing cell. If the viral nucleic acid is a DNA molecule, it can be cloned directly into the producing cell by binding to a replication origin compatible with the cell being transfected. In this way, DNA copies of chimeric nucleotide sequences can be made in transfected cells.

Another optional case of making a recombinant plant viral nucleic acid is to prepare one or more nucleic acids (ie, to produce nucleic acids that are essential for forked virus vector constructs). In this case, each nucleic acid requires its own assembly origin. Each nucleic acid can be subtracted to include subgenomic promoters and non-native nucleic acids.

Optionally, inserting the nonnative nucleic acid into a single split viral nucleic acid can produce two nucleic acids (ie, the nucleic acid necessary to make a two split viral vector). This is advantageous when it is desired to separate the replication and transcription or expression of the nucleic acid of interest from the vector and translation of some of the coding sequences of the native nucleic acid. Each nucleic acid must have its own assembly origin.

The host may be infected with the recombinant plant virus by conventional techniques: suitable techniques include leaf abrasion, in-solution ablation, high speed water spray, other host damage and water, including the recombinant plant virus. Host seed uptake is included, but is not limited to. More specifically, suitable techniques include the following techniques:

(a) Hand inoculation: Hand inoculation of the encapsulated vector is carried out with celite or diamond (usually about 1%) using a pH neutral, low molar concentration of phosphate buffer. 1-4 drops of the preparation are dropped on the top of the surface of the leaves, gently rubbed.

(b) Mechanical Inoculation of Plant Bed: Plant bed inoculation can be carried out by spraying the vector solution with a tractor-operated mower (gas propulsion) while cutting the leaves. Optionally, the plant bed is cut and the vector solution is immediately sprayed with the cut leaves.

(c) High pressure spraying of single leaves. Single plant inoculation is sprayed onto the leaves with a narrow, regulated spray (50 psi, 6-12 inches from the leaves) containing about 1% carborundum in a buffer vector solution.

(d) Vacuum filtration. Inoculation can be accomplished by allowing the host organism to be substantially affected by a vacuum pressure environment to promote infection.

(d) High speed robot inoculation. Particularly applicable when the organism is a plant, each organism can be cultured in a mass array such as a microtiter plate. Then, a machine such as a robot can be used to transfer the nucleic acid of interest.

An alternative method of introducing a recombinant plant protein nucleic acid into a plant host is called agroinfection or agrobacterial-mediated transformation (argo-infection), as disclosed in Grimmsley et al. Nature 325: 177 (1987). It is also known as a technique). This technique takes advantage of the general characteristics of Agrobacteria, which transplant plants by moving parts of DNA (T-DNA) to host cells, where it is integrated into nuclear DNA. T-DNA is determined by a border sequence that is 25 base pairs long and the DNA between the border DNA sequences is transferred to plant cells. Insertion of the recombinant plant viral nucleic acid between T-DNA border sequences results in the transfer of the recombinant plant viral nucleic acid into the plant cell, where the recombinant plant viral nucleic acid is replicated and then spread throughout the plant. Agro-infection is characterized by the presence of potato spindle tuber viroid (PSTV) (Gardner et al., Plant Mol. Biol. 6: 221 (1986); CaV (Grimsley et al., Proc. Natl. Acad. Sci. USA 83: 3282 (1986)). MSV (Grimsley et al., Nature 325: 177 (1987)), and Lazarowitz, S., Nucl.Acids Res. 16: 229 (1988) digitaria streak virus (Donson et al. , Virology 162: 248 (1988)), wheat dwarf virus (Hayes et al., J. Gen. Viol. 69: 891 (1988)) and TGMV (tomato golden mosaic virus) (Elmer et al., Plant Mol. Biol. 10: 225 (1998) and Garner et al., EMBO J. 7: 899 (1988)), thus agro-infection of susceptible plants is This can be achieved using virions comprising recombinant plant viral nucleic acids based on the nucleotide sequence of any one of the viruses .. Particle impact or electrosplation, which are known in the art. oration) or other method may be used.

Infection can be accomplished by positioning the selected nucleic acid sequence into an organism such as E. coli, or yeast. The mechanism can secondary transfer of the selected nucleic acid sequence into the host organism. In particular, this is a viable embodiment when the host organism is a plant. Similarly, infection can be accomplished by first packaging selected nucleic acid sequences in the pseudovirus. The method is disclosed in WO 94/10329, which is incorporated in its entirety. The teachings of this reference are effective against bacteria, and those skilled in the art will appreciate that the same method can be readily applied to other organisms.

Those skilled in the art will readily appreciate that there are many ways to determine the function of a nucleic acid once it is expressed in a host such as a plant. In one embodiment, the function of the nucleic acid can be determined by complementary analysis. In other words, the function of the nucleic acid of interest can be determined by observing an endogenous gene or a gene whose function has been replaced or increased in function by introducing a nucleic acid of interest. This principle is discussed in Naples et al. The Plant Cell 2: 279-289 (1990), which is incorporated in its entirety. This is taught in WO 97/42210, which is incorporated in its entirety. In a second embodiment, the function of the nucleic acid can be determined by analyzing the biochemical change in the accumulation of the substrate or product from the enzymatic reaction according to any of the methods known in the art. In a third embodiment, the function of the nucleic acid can be determined by observing phenotypic changes in the host using methods including morphological, macroscopic, microscopic analysis. In a fourth embodiment, the function of the nucleic acid can be determined by observing changes in biochemical pathways that can be denatured in the host as a result of local and / or global expression of the non-native nucleic acid. In a fifth embodiment, the function of the nucleic acid can be determined using techniques known in the art that can observe inhibition of gene expression in the cytoplasm of cells as a result of expression of non-native nucleic acids.

A particularly useful method of determining gene function is to observe the phenotype in the whole plant when a particular gene function is not expressed. Useful phenotypic features in plant cells that can be observed microscopically or macroscopically or by other methods include improved resistance to herbicides, improved resistance to extreme heat or cold, drought, salinity or osmotic pressure; Improved resistance to pests (insects, nematodes or arachnids) or diseases, enzymes or secondary metabolite production; Male or female propagation; Too small; Rapid development; Improved output, growth, hybrid stress, nutritional quality, flavor or processing characteristics, and the like. Other examples include the production of important proteins or other commercially useful products such as lipases, melanin, pigments, alkaloids, antibodies, hormones, drugs, antibiotics, and the like. Another useful phenotypic feature is the production of degradation or inhibitory enzymes, which can be used to inhibit or hinder the root development of malt, or can be used to determine the responsiveness or non-responsiveness to drugs administered to a person as a whole. Phenotypic features may be secondary metabolites, where secondary metabolite production is a desired product in a bioreactor.

Another particularly useful method of determining the function of a transfected nucleic acid into a host is to measure the silencing of the gene. Typically, knockout of functional genes has been achieved by inactivation due to insertion of transcribable elements into the chromosome or by arbitrary integration of T-DNA, and by the characterization of conditional homologous- recessive mutations obtained upon backcross. This is taught in WO 97/42210, which is incorporated in its entirety. As an alternative conventional knockout assay, EST / DNA libraries of organisms such as, for example, Arabidopsis thaliana can be assembled into plant virus transcriptional plasmids. The DNA sequence in the transcription plasmid library is then introduced into the plant cell as part of a functional RNA virus that post-transcribes homologous target genes. EST / DNA sequences can be introduced into plant viral vectors in either positive or negative sense directions, and directions can be direct or optional based on cloning strategies. High throughput, automated cloning schemes based on robots can be used to assemble and characterize the library. Double stranded RNA is also an effective stimulant of gene silencing / interpression in transgenic plants. Gene silencing / interpression of plant genes can be induced by delivering RNA capable of base pairing with itself to form a double stranded region. This approach can be used with plant or non-plant genes that complement the identification of the function of a particular gene sequence.

A particular problem with gene silencing in plant hosts is that many plant genes exist in multiple gene families. Thus, effective silencing of gene function is particularly problematic. However, according to the present invention, nucleic acids can be inserted into the genome to effectively silence specific gene functions or to silence the functions of multiple gene families. It is currently believed that about 20% of plant genes exist in multiple gene families. A single nucleotide sequence of about 20 to 100 or more bases having about 70% or more homology may silence the entire plant gene family with two or more homologous genes.

Some aspects of the "gene silencing" effect are discussed in detail in US patent application Ser. No. 08 / 260,546 (1995/12/21 published WO 95/34668), the disclosure of which is incorporated in its entirety. RNA can reduce expression of target genes by interacting with inhibitory RNAs with target mRNAs generated in the cytoplasm and / or cell nucleus.

Full-length cDNAs are available from public and private repositories, or can be extracted with viral vectors for expressing nucleic acids in host organisms from field samples for inserting unknown ORFs, and used as selective antisense gene knockouts. It is possible. This technique can be performed by PCR amplification and by cDNA cloning without homology with gene sequences in public and private databases. cDNAs selected from corn, rice, soy canola and other grain species can be used to assemble the cDNA library. This method can be used to find useful dominant gene phenotypes from new cDNA libraries through gene expression.

The EST / cDNA library of an organism such as Arabidopsis saliana can be assembled against a plant virus transcriptional plasmid background. The cDNA in the transcriptional plasmid library can then be introduced into plant cells as cytoplasmic RNA for posttranscriptional silencing of endogenous genes. The EST / cDNA sequence can be introduced into the plant virus transcriptional plasmid in the plus direction or antisense direction (or both directions) and the direction is based on a direct or optionally cloning strategy. A high yield, automated cloning strategy using a robot can be used to assemble the library. The EST clone can be inserted after the cloned subgenomic promoter to be expressed as a subgenomic transcript during viral replication in plant cells. Alternatively, the EST / cDNA sequence can be inserted into the genomic RNA of a plant viral vector to be expressed as genomic RNA during viral replication in plant cells. The EST clone library is then transcribed into infectious RNA and inoculated with each platelet of Arabidopsis saliana (or other plant species). Viral RNAs comprising the original library-derived EST / cDNA sequences are present at high enough concentrations in the cytoplasm to enable posttranscriptional gene silencing of endogenous plant-gene homologs. Since the replication mechanism of the virus produces both sense and antisense RNA sequences, the orientation of the EST / cDNA insert is normally irrelevant in that it produces the desired gene-silent phenotype in the tissue. Partial cDNA sequences cloned into plant viral vectors in the sense direction have already been presented to compare gene silencing phenotypes (Kumagai et al., Proc. Natl. Acad. Sci. USA 92: 1679 (1995) ), Which is integrated into the specialty. This phenotype is similar to gene silencing through co-suppression observed in transgenic plants.

The plant tissue is then used for sophisticated biochemical analysis to determine whether the metabolic pathway is carried out by EST / DNA gene silencing and in particular whether the steps in a given metabolic pathway are carried out by EST / DNA gene silencing do. Biochemical analysis is performed in a high-throughput, fully automated method using, for example, a robot. Suitable biochemical assays include MALDI-TOF, LC / MS, GC / MS, two-dimensional IEF / SDS-PAGE, ELISA or other assays. The clones in the EST / plant viral vector library can then be functionally classified based on the metabolic pathways performed or visual / selectable phenotypes generated in plants. The method allows for the rapid determination of gene function for unknown EST / DNA sequences of plant origin. The method can then be used to quickly identify the function of a full-length DNA with unknown gene function. Functional verification of unknown EST / DNA in plant libraries quickly identifies similar unknown sequences in expression libraries for other crop species based on sequence homology.

Large amounts of DNA sequence information are generated in shared domains and entered into related databases. Intersequence binding occurs in several predicted species to perform similar biochemical or regulatory functions. In addition, there is a link between the predicted enzymatic activity and visually represented biochemical and regulatory pathways. Likewise, there is a binding between the predicted enzymatic or regulatory activity and known small molecule inhibitors, actives, substrates or substrate analogs. Phenotypic data from expression libraries expressed in the transfected host are autocoupled in the relevant database. This allows for faster discovery of genes with similar predictive roles that are important in other grains or grains.

Complete classification of gene functionality for fully sequenced eukaryotic organisms has been established for yeast. The taxonomy is modified for plants and subdivided into appropriate categories. The tissue structure is used to quickly identify herbicide target loci conferring a dominant lethal phenotype and is useful for designing rational herbicide programs.

A second aspect of the present invention is a method of silencing endogenous genes in a host by introducing the nucleic acid into the host with a viral nucleic acid suitable for producing partial and full expression of the main nucleic acid. In one embodiment, the host is a plant, but those skilled in the art will appreciate that other hosts may also be used. The method uses the principle of post-transcriptional gene silencing as above for endogenous host gene homologs. Since the replication mechanism produces both sense and anti-sense RNA sequences as above, the orientation of the non-native nucleic acid inserts is not critical to providing gene silencing.

Details describing some aspects of the "gene silencing" effect are provided in U.S. Patent Application Serial No. 08 / 260,546 (WO 95/34668 (1995.12.21)), which is hereby incorporated by reference in its entirety. do. RNA can reduce expression of target genes through inhibitory RNA interaction with target mRNAs occurring in the cytoplasm and / or nucleus of the cell.

Silencing of endogenous genes can be obtained with homologous (but not identical) sequences from unrelated plant species. For example, the Nicotiana benthamiana gene for phytoene desaturation enzyme (PDS) can be silenced by transfection with some tomato cDNA (clone in positive or antisense direction) for PDS. . Tomato PDS cDNA is 92% homologous at the nucleotide level, but can provide effective gene silencing in unrelated plant species (Kumagai et al., Proc. Natl. Acad. Sci. USA 92: 1679 (1995)). Identifying EST / cDNA gene function in Arabidopsis thaliana can be extrapolated to similar EST / cDNA sequences of unknown function present in other libraries (eg, soybean, corn, rice, rape, etc.). .

A third aspect of the invention is a method of selecting RNAs and proteins of desired function using viral vectors to express a library of nucleic acid sequence modifications. Libraries of sequence modifications can be produced by in vitro mutagenesis and / or recombination. Rapid in vitro evolution can be used to enhance virus-specific or protein-specific functions. In particular, plant RNA virus expression vectors produce a library containing modifications of nucleic acids, genes from viruses, plants or other sources, and the plant or virus so that the desired effect of change in the RNA or protein product can be determined, selected and enhanced. It is used as a tool to be applied to plant cells. In a preferred embodiment, nucleic acid shuffling techniques are used to prepare shuffled gene libraries. Random, semi-random or known sequences of the viral origin are inserted into the viral expression vector between the native viral sequence and the foreign gene sequence, as well as the stability of the mRNA encoding the external gene in vivo and the translation of the external gene, as well as the external gene in the expression vector. Increases the genetic stability of the. Desired functions of RNA and proteins include, among others, promoter activity, replication properties, translational efficacy, migration properties (some and all), signaling pathways or viral host ranges. Desired functional modifications can be identified by analyzing infected plants, and mutation properties can be determined by analysis of sequence modifications in viral vectors.

A method of increasing the reproduction of gene sequences in viral expression libraries can be achieved by bypassing the genetic bottleneck of breeding in E. coli. For example, in one of the preferred embodiments of the present invention, the cell-free method can be used to clone a sequence library or each arranged sequence into a viral expression vector and to reconstruct an infectious virus so that the final binding product can be transcribed and The resulting RNA can be used for plant or plant cell inoculation / infection, where the result is gene function discovery or protein production.

Techniques for screening sequence libraries can be introduced in clusters or individually, parallel to RNA viruses or RNA viral vectors to identify new ones, and can be used for replication and viral migration, retention of external gene sequences in vectors and proper conjugation, activity of protein products. And viral-coded functions in expression, new gene expression, effects on host metabolism, and resistance or sensitivity of plants to exogenous agents.

Modifications in the sequences of native viral genes or heterologous nucleotide sequences are individually assigned to a host plant or cell by a viral vector or in batches for a new property present by the virus itself or in groups of individuals in parallel or in parallel. As a means for introduction into the RNA virus or RNA virus expression vector by a number of methods. Variant clusters are “hosts”: 1) protoplasts; 2) whole plants; Or 3) transfected with clusters or individual clones with the inoculated leaves of the whole plant and can be used to express protein (increase or decrease), RNA expression (increase or decrease), secondary metabolites or other hosts as a result of viral infection. Various traits can be selected, including gain or loss characteristics.

To treat the host with an agent that causes cell death or downregulation in general metabolic function, a viral vector simultaneously expressed with a green fluorescent protein (GFP) or other selectable marker gene and a modified sequence is added to the modified sequence expressed from the viral vector. It is used to quantitatively select the level of resistance or susceptibility to agents provided on the host. By quantitatively selecting pools or individual infection cases, viruses containing the only modified sequence that sustain the metabolic life of the host are identified by fluorescence under long wavelength UV light. Those that do not provide the phenotype fail or rarely fluoresce. In this method, high power sorting in a multi-well dish in a plate reader is possible, where the average fluorescence of the wells is expressed as a percentage of absorbance (measures the cell mass), thereby providing comparable quantitative values. This technique allows selection of populations or individuals, releasing sequences from viral vectors conferring desired traits by RT-PCR, and reselecting specific modified sequences in secondary selection.

The function of factors or transcription factors contributing to the signal transduction pathway of the host cell is measured using specific proteomic mRNA or metanomic traits analyzed post-infection by virus expression libraries. The contribution of specific proteins or products to various traits is known in the literature, but new methods of enhancing or decreasing expression could be identified by finding factors that respond to cellular signals that in turn alter specific expression. For example, expression of a protective protein or protease inhibitor, such as a cystemine peptide, can be confirmed by infecting the host with a viral library, and expression of a cystemine or protease inhibitor or their RNA can be analyzed directly. Conversely, a promoter capable of reacting to express the genes can be genetically fused to the green fluorescent protein and introduced into the host as a transient expression construct or introduced into a stable transformed host cell / whole. The resultant cells were transfected with the viral vector library. The host can now be rapidly selected by relevant GFP expression after vector transfection. Similarly, combining plants with methyl jasmonate and host transfection with a viral library can identify sequences that reverse or enhance the transduction induced by the metabolite. This approach can be applied to other factors involved in high biomass promotion in plants such as Lipy or DET2. Expression of these factors can be analyzed directly or can be genetically fused to GFP via a promoter. The technique will allow selection of populations or individuals, freeing sequences from viral vectors conferring the desired traits by RT-PCR, and reselecting certain modified sequences in secondary selection.

A fourth aspect of the invention is a method of inhibiting an endogenous protease of a plant host, comprising treating the plant host with a compound that induces the production of an endogenous inhibitor of the endogenous protease. In a preferred embodiment, jasmonic acid is used to treat the plant host to induce the production of endogenous inhibitors of endogenous proteases. In another preferred embodiment, treating the plant host with a compound increases the reproducibility of the exogenous nucleic acid or protein product thereof. In particular, transgenic host expression protease inhibitors are used to reduce degradation of proteins expressed by viral expression vectors. In a preferred embodiment, jasmonic acid is used to treat plants infected with the viral expression vector to reduce degradation of the protein expressed by the viral expression vector.

A fifth aspect of the present invention is a gene obtained by the method of the present invention and fragments, nucleotide sequences and gene products thereof. It is a feature of the present invention to express a selected nucleotide sequence in a host organism such as a plant. Those skilled in the art will appreciate that the gene product of the nucleotide sequence can be isolated using techniques known in the art. The gene product exhibits biological activity as pharmaceuticals, herbicides and other similar functionalities.

The following examples detail the invention in more detail. The present embodiments are mainly described in order to detail the present invention and are not to be considered as limiting.

Example 1

Intracellular inhibition of phytoene desaturating enzymes in transfected plants confirms that some tomato PDS sequences encode phytoene desaturating enzymes.

Isolation of Tomato Mosaic Virus cDNA. 861 base-pair fragments (5524-6384) from tomato mosaic virus (fruit necrosis strain F; tom-F) comprising putative coat protein subgenomic promoter, coat protein gene and 3'-terminus were primer 5'-CTCGCAAAGTTTCGAACCAAATCCTC-3 Separated by PCR using '(upstream) (SEQ ID NO: 1) and 5'-CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (SEQ ID NO: 2) and subcloned into the HincII site of pBluescript KS-. Hybrid virus consisting of TMV-Ul and ToMV-F was formed by exchanging BamH-KpnI ToMV fragments with pBGC152 to form plasmid TTO1. Insertion fragments were identified by dideoxynucleotide sequencing. The only AvrII site was PCR mutagenesis by the following oligonucleotide: 5'-TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA-3 '(upstream) (SEQ ID NO: 3), 5'-CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream) (SEQ ID NO: 4) Inserted downstream of the XhoI locus in the plasmid, TTO1A was formed.

Isolation of cDNA encoding tomato phytoene synthase and some cDNA encoding tomato phytoene desaturase. Some cDNAs have oligonucleotides: PSY, 5′-TATGTATGGTGCAGAAGAACAGAT-3 ′ (SEQ ID NO: 5), 5′-AGTCGACTCTTCCTCTTCTGGCAT C-3 ′ (SEQ ID NO: 6); Ripe tomatoes by polymerase chain reaction (PCR) using PDS, 5'-TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA-3 '(SEQ ID NO: 7) (upstream), 5'-AACTCGAGCGCTTTGATTTCTCCGAAGCTT-3' (SEQ ID NO: 8) It was isolated from fruit RNA. Approximately 3 × 10 ⁴ colonies from the Lycopersicon esculentum cDNA library were selected by colony hybridization using a ³² P labeled tomato phytoene synthase PCR product. Hybridization was performed at 42 ° C. for 48 h in 50% formamide, 5 × SSC, 0.02M phosphate buffer, 5 × Denhart's solution and 0.1 mg / ml sheared calf thymus DNA. The filter was washed with 0.1 × SSC, 0.1% SDS at 65 ° C. prior to autoradiography. PCR products and phytoene synthase cDNA clones were identified by dideoxynucleotide sequencing.

DNA sequencing and computer analysis. Pst I and BamH I fragments, including phytoene synthase cDNA and some phytoene desaturation enzyme cDNA Subclone with KS + (Stratagene, La Jolla, Calif.). Nucleotide sequencing of KS + / PDS # 38 and KS + / 5'3'PSY was performed by dideoxy termination using single-stranded template (Maniatis, Molecular Cloning, 1st Ed). Nucleotide sequencing and amino acid sequencing And DNA Inspector This was done using the ILE program.

Preparation of Tomato Phytoene Synthase Expression Vector. XhoI fragments containing tomato phytoene synthase cDNA were subcloned into TTO1. Vector TTO1 / PSY + (FIG. 1) contains phytoen synthase cDNA in the positive direction under the control of the TMV-U1 coat protein subgenomic promoter, whereas vector TTO1 / PSY contains phytoen synthase cDNA in the antisense direction do.

Composition of viral vectors containing some tomato phytoene desaturating enzyme cDNA. XhoI fragments containing some tomato phytoene desaturation enzyme cDNA were subcloned into TTO1. Vector TTO1A / PDS + (FIG. 2) contains phytoen synthase cDNA in the positive direction under the control of the TMV-U1 coat protein subgenomic promoter, whereas vector TTO1A / PDS contains the phytoen desaturase cDNA in the antisense direction. Include.

yen. Transfection and Analysis of N. benthamiana [TTO1 / PSY +, TTO1 / PSY-, TTO1Δ / PDS +, TTO1 / PDS-]. Infectious RNAs from TTO1 / PSY + (FIG. 1), TTO1 / PSY-TTO1 / PDS +, TTO1 / PDS + are described as described in Dawson et al., Proc. Natl. Acad. Sci. USA 83: 1832 (1986). As prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase. It was used to mechanically inoculate Ventamiana. Hybrid viruses are sprayed globally on all non-inoculated upper leaves as confirmed by transmission electron microscopy, local lesion infectivity analysis and polymerase chain reaction (PCR) amplification. Viral symptoms due to infection include plant growth arrest due to leaf deterioration and mild whitening as a whole. The leaves of plants transfected with TTO1 / PSY + turned orange and high levels of phytoene accumulated, while the leaves of plants transfected with TTO1Δ / PDS + and TTO1Δ / PDS- turned white. Agarose gel electrophoresis of PCR cDNA isolated from virion RNA and Northern blot analysis of virion RNA show that the vector remains in the extrachromosomal state and there is no detectable intramolecular rearrangement.

Purification and Analysis of Carotenoids from Transfected Plants. Carotenoids were entirely isolated from infected tissues and analyzed by HPLC chromatography. The carotenoids were extracted with ethanol and 25-cm Spherisorb using acetonitrile / methanol / 2-propanol (85: 10: 5) as a power generating solvent at a flow rate of 1 ml / min. It was confirmed by absorption spectra on ODS-1 5-m column and their peak retention times. They had the same retention time as synthetic phytoene standards and β-carotene standards from carrots and tomatoes. N transfected with TTO1 / PSY +. The phytoene peaks from Ventamiana had maximum absorbance at 276, 285 and 298 nm. Plants transfected with virus-coded phytoene synthase showed a 10-fold increase in phytoene compared to levels in uninfected plants. Sense and antisense RNA expression for some phytoene desaturation enzymes in transfected plants inhibited the synthesis of colored carotenoids and turned the infected leaves entirely white. HPLC analysis of the plants showed that phytoenes also accumulated. The white leaf phenotype was also found in plants treated with the herbicide norflurazon, which specifically inhibits phytoene desaturation enzymes.

The change in phytoene levels is the greatest increase in carotenoids (secondary metabolites) in genetically treated plants. Plants transfected with viral coded phytoene synthase showed a 10-fold increase in phytoene compared to levels in uninfected plants. The accumulation of phytoenes in plants transfected with positive-sense or antisense phytoene desaturation enzymes suggests that viral vectors can be used as potential mechanisms for manipulating pathways in the production of secondary metabolites via cytoplasmic antisense inhibition. do. The data are available from Kumagai et al. In Proc. Natl. Acad. Sci. USA 92: 1679-1683 (1995).

Example 2

Expression of bell pepper cDNA in the transfected plants confirms that it encodes capxanthine-capsorubicin synthase.

Biosynthesis of leaf carotenoids in Nicotiana ventamiana was modified by using RNA viral vectors to redirect the pathway to the synthesis of capxanthine, non-native chromosome-specific xanthophylls. The cDNA encoding capsanthine-capsorubin synthase (Ccs) was placed under transcriptional control of the tobamovirus subgenomic promoter. The leaves of the transfected plants expressing Ccs developed an orange phenotype and accumulated high levels of capxanthin. This phenomenon is associated with thylakoid film deformation and grana stacking reduction. Compared to the prevailing situation for chromosomes, capxanthine is not esterified so its high level is equilibrated by a concomitant decrease in main leaf xanthophyll, which shows autoregulation of the chloroplast carotenoid composition. Capxanthine is supplemented with the trimer and monomer light-harvesting complexes of Photosystem II. This demonstrates that advanced plant antenna complexes can accumulate non-native carotenoids, which provide important evidence for the functional modification of photosynthesis by the rational design of carotenoids.

Construction of Ccs Expression Vectors. The only XhoI, AvrII sites are oligonucleotides: 5'-GCCTCGAGTGCAGCATGGAAACCCTTCTAAAGCTTTTCC-3 '(upstream) (SEQ ID NO: 9), 5'-TCCCTAGGTCAAAGGCTCTCTATTGCTAGATTGCCC-3' (downstream) (SEQ ID NO: 10) PCR) mutagenesis was inserted into the bell pepper capsanthin-capsorubin synthase (Ccs) cDNA. The 1.6-kb XhoI, AvrII cDNA fragment was subcloned into TTO1A as shown by FIG. 3, thereby placing the plasmid TTO1A CCS + (FIG. 3) under the control of the TMV-U1 coat protein subgenomic promoter.

Carotenoid analysis. Twelve days after inoculation on 12 plant leaves, harvested and lyophilized. Results The non-saponified extract was evaporated to dryness under argon and weighed to determine the total lipid content. Pigmentation of the total lipid content was performed by HPLC and separated by thin layer chromatography on silica gel G using hexane / acetone (60v / 40v). Plants infected with TTO1A CCS + accumulate high levels of capxanthin (36% of total carotenoids).

Example 3

Expression of the bacterial CrtB gene in transfected plants confirms that it encodes phytoene synthase.

We found tobacco mosaic virus strain U1 (TMV-U1) (Goelet et al., Proc. Natl. Acad. Sci. USA 79: 5818-5822 (1982)) and tobacco mild green mosaic virus (TMGMV; U5 strain) (Solis). Et al., "The complete nucleotide sequence of the genomic RNA of the tobamovirus tobacco mild green mosaic virus" (1990)). Open reading frame (ORF) for Erwinia herbicola phytoene synthase (CrtB) (Armstrong et al., Proc. Natl. Acad. Sci. USA 87: 9975-9979 (1990)) Placed under the control of the tobacco mosaic virus (TMV) coat protein subgenomic promoter in TTU51. The construct also includes a gene encoding chloroplast target peptide (CTP) for a small subunit of ribulose-1,5-bisphosphate carbosylase (RUBISCO) (O'Neal et al., Nucl. Acids Res 15: 8661-8677 (1987)), called TTU51 CTP CrtB as shown in FIG. 4. Infectious RNA was prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase (Dawson et al., Proc. Natl. Acad. Sci. USA 83: 1832-1836 (1986)). It was used to mechanically inoculate Ventamiana. Hybrid virus was sprayed globally on all non-inoculated upper leaves and confirmed by local pathological infectivity assay and polymerase chain reaction (PCR) amplification. The leaves of the plants transfected with TTU51 CTP CrtB resulted in a totally sprayed orange staining during plant growth and virus replication.

The leaves of plants transfected with TTU51 CTP CrtB reduced the chlorophyll content beyond the slight decrease usually observed during viral infection (not shown). Because previous studies have taught that carotenoid and chlorophyll biosynthetic pathways are interrelated (Susek et al., Cell 74: 787-799 (1993)), we decided to compare the ratio of phytoene to chlorophyll synthesis. . Two weeks after inoculation, the chloroplasts of plants infected with TTU51 CTP CrtB transcripts were isolated and analyzed for enzyme activity. The synthesis ratio of phytoene synthase to chlorophyll was 0.55 in transfected plants and 0.033 in uninoculated plants (control). Phytoen synthase activity of plants transfected with TTU51 CTP CrtB was analyzed using isolated chloroplasts and labeled [ ¹⁴ C] geranylgeranyl PP. There was a significant increase in phytoene and unidentified C ₄₀ alcohols in CrtB plants.

Phytoene Synthetase Assay

Chloroplasts were prepared as previously described (Camera, Methods Enzymol. 214: 352-365 (1993)). Phytoen synthase assays were carried out using [ ¹⁴ C] geranylgeranyl PP (100,000 cpm) (prepared using GGPP synthase from red pepper expressed in E. coli), 1 mM ATP, 5 mM MnCl ₂ , 1 mM MgCl ₂ , Triton The culture mixture (0.5 mL final volume) buffered with Tris-HCL, pH 7.6, containing X-100 (20 mg per mg chloroplast protein) and a chloroplast suspension equivalent to 2 mg protein. After 2 hours of incubation at 30 ° C., the reaction product was extracted with chloroform methanol (Camera, supra), TLC was added on a silica gel plate made of benzene / ethyl acetate (90/10), and autoradiography was performed.

Chlorophyll Synthetase Assay

During the chlorophyll synthase assay, the isolated chloroplasts were dissolved by osmotic shock before incubation. [ ¹⁴ C] Reaction mixture consisting of bursted plasmid suspension equivalent to 50 mM Tris-HCL (pH 7.6), 5 MgCl ₂ , 1 mM ATP and 1 mg protein containing geranylgeranyl PP (100,000 cpm) (0.2 ml, Final volume) was incubated at 30 ° C. for 1 hour. The reaction product was analyzed as above.

Plasmid Composition

Chloroplast targeting, phytoene synthase expression vector, TTU51 CTP CrtB shown in FIG. 4, was prepared in several subcloning steps. First, the only SphI site is oligonucleotide CrtB MIS 5'-CCA AGC TTC TCG AGT GCA GCA TGC AGC AAG CGC CGC TGC TTG AC-3 '(SEQ ID NO: 11) and CrtB P300 5'-AAG ATC TCT CGA Polymerase chain reaction (PCR) mutagenesis using GCT AAA CGG GAC GCT GCC AAA GAC CGG CCG G-3 '(downstream) (SEQ ID NO: 12) (Saiki et al., Science 230: 1350-1354 (1985)) Was inserted into the initiation codon for the Hervinia herbicola phytoene synthase gene. PBluescript CrtB PCR Fragments from EcoRV Sites Plasmid pBS664 was prepared by subcloning with (Stratagene). Thereafter, the 938 bp SphI, XhoI CrtB fragment of pBS664 was identified for the small subunit of RUBISCO. It was subcloned into a vector comprising a sequence encoding a N. tabacum chloroplast targeting peptide (CTP). Next, the tobamovirus vector TTU51 was produced. The 1020 base pair fragment (TMGMV; U5 strain) of tobacco mild green mosaic virus comprising viral subgenomic promoter, coat protein gene and 3'-terminus is TMGMV primer 5'-GGC TGT GAA ACT CGA AAA GGT TCC GG-3 '( Upstream) (SEQ ID NO: 13) and 5'-CGG GGT ACC TGG GCC GCT ACC GGC GGT TAG GGG AGG-3 '(Downstream) (SEQ ID NO: 14) and the HincII site of Bluescript KS- Subclones and confirmed by dideoxynucleotide sequencing. The clone comprises 147 naturally occurring base pairs (SEQ ID NO: 15) comprising the entire upstream pseudoknot domain in the 3 'noncoding region. Hybrid virus cDNA consisting of TMV-U1 and TMGMV was prepared by exchanging 1-Kb XhoI-KpnI TMGMV fragments with TTO1 (Kumagai et al., Proc. Natl. Acad. Sci. USA 92: 1679-1683 (1995)) TTU51 was formed. Finally, the 1.1 Kb XhoI CTP CrtB fragment of pBS670 was subcloned into XhoI of TTU51 to form plasmid TTU51 CTP CrtB. Following CTP negative regulation, a 942 bp XhoI fragment comprising CrtB gene of pBS664 was subcloned into plasmid TTU51 to form TTU51 CrtB # 15.

Example 4

Expression of the bacterial phytoene desaturase (CrtI) gene in transfected plants provides resistance to norflurazone herbicides.

Erwinia phytoene desaturase (PDS) (Armstrong et al., 1990) encoded by the gene CrtI converts phytoenes into lycopene through four desaturation steps. Plant PDS is susceptible to bleach herbicide norflurazon, whereas Erbinia PDS is not inhibited by norflurazone (Miwawa et al., Plant J. 6 (4): 481-489 (1994)). The open reading frame (ORF) for CrtI was placed under the control of the tobacco mosaic virus (TMV) coat protein subgenomic promoter in vector TTOSA1. The construct also contains a gene encoding chloroplast targeting peptide (CTP) for the bovine subunit of ribulose-1,5-bisphosphate carboxylate (RUBISCO), called TTOSA1 CTP CrtI 491 # 7. Infectious RNA was prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase (Dawson et al., Proc. Natl. Acad. Sci. USA 83: 1832-1836 (1986)). It was used to mechanically inoculate Ventamiana. Hybrid virus was sprayed onto all non-vaccinated top leaves to confer resistance to norflurazone on the entire plant. Plants inoculated with TTOSA1 CTP CrtI 491 # 7 (FIG. 5) remained green instead of bleaching white and had higher levels of β-carotene compared to uninoculated control plants.

Plasmid constructs.

Chloroplast targeting of the bacterial phytoene desaturase expression vector, TTOSA1 CTP CrtI 491 # 7 (FIG. 5), was prepared as follows. First, oligonucleotide Crt I HSM1 5'-GA CAG AAG CTT TGC AGC ATG CAA AAA ACC GTT-3 '(SEQ ID NO: 16) and IQ419A 5'-CGC GGT CAT TGC AGA TCC TCA ATC ATC AGG C-3 Initiation codons for the Erbinia herbicola phytoen desaturase gene (plasmid pAU211, (FIG. 6)) by polymerase chain reaction (PCR) mutagenesis using '(downstream) (SEQ ID NO: 17). The only SphI site was inserted. A 1504 bp Crt PCR fragment was inserted between the EcoRV and HindIII sites to provide pBluescript Subcloned into (Stratagene) to form plasmid KS + / CrtI ^* 491 (FIG. 7). 1481 bp SphI, AvrII CrtI fragments from plasmid KS + / CrtI ^* 491 were then subcloned into the tobamovirus vector TTOSA1 to form TTOSA1 CTP CrtI 491 # 7.

Treatment and Results of Transfected Plants with Norflurazon

Seven days after virus inoculation, the plants were treated with 10 mg / ml Solicam. Sando Agro, Inc. norflurazone herbicide solution [(4-chloro-5- (methylamino) -2- (α, α, α-trifluoro-m-tolyl) -3 (2H) -pyrida Xenon)] was treated by adding to the leaves and soil every 4 days. Five days after initiation of the treatment, the uninfected plants became almost entirely white, especially in the upper leaves and growth point areas. The plants infected with TTOSA1 CTP CrtI 491 # 7 were still green and were almost identical to the appearance of the non-fluluzone-treated infected controls.

Leaf analysis

Viral expressed CrtI gene was sprayed throughout the plant by Northern blotting (Alwine et al., Proc. Natl. Acad. Sci. USA 74: 5350-5354 (1977)). Viral RNA was purified from the uninoculated upper leaves and probed with the 1.5 kb CrtI gene. Positive results were obtained in plants inoculated with TTOSA1 CTP CrtI 491 # 7.

Leaf tissues of TTOSA1 CTP CrtI 491 # 7 infected plants were tested for β-carotene levels. Treatment of non-inoculated control plants with norflurazone resulted in a significant decrease in β-carotene levels (7.7% of wild type levels). However, when plants already inoculated with the viral construct TTOSA1 CTP CrtI 491 # 7 were treated with norflurazon, β-carotene levels partially recovered (28.3% of wild type levels). This is similar to β-carotene levels (average 38.3% of wild type) in TTOSA1 CTP CrtI 491 # 7 samples that were not treated with norflurazone, which had little effect on β-carotene levels in plants that had already been transfected with herbicide noflurazone Show that you are not crazy. Expression of bacterial phytoene desaturating enzymes in infected tissue as a whole confers resistance to herbicide norflurazone.

Example 5

Expression of the 5-enolpyrubilicimate-3-phosphate synthase (EPSPS) gene in plants is roundup Confers resistance to herbicides.

Whole expression of recombinant 5-enolpyrubilizedmate-3-phosphate synthase (EPSPS) gene in plants through recombinant viral vectors Confers resistance to herbicides. In addition, della-Cioppa et al., "Genetic Engineering of herbicide resistance in plants", Frontiers of Chemistry: Biotechnology, Chemical Abstract Service, ACS, Columbus, OH, pp. See 665-70 (1989). The purpose of the experiment is to provide a method for expressing the EPSPS gene as a whole through a recombinant viral vector in a fully grown plant. Transfection plants that overproduce the enzyme EPSPS in plant tissues (roots, stems and leaves) It is resistant to herbicides. The present invention provides a method for preparing plasmid-targeted EPSPS in plants via RNA viral vectors. A double subgenomic promoter vector (Class I EPSPS) encoding the full-length EPSPS gene from Nicotiana Tabacum is shown in plasmid pBS736. The overall expression of Nicotiana Tabacum Class I EPSPS was found in Raundoop in whole plant and tissue cultures. Tolerates herbicides. 8 depicts plasmid pBS736.

Example 6

Cytoplasmic inhibition of the 5-enolpyrubilicimate-3-phosphate synthase (EPSPS) gene in plants blocks aromatic amino acid biosynthesis.

Cytoplasmic inhibition of the 5-enolpyrubilicimate-3-phosphate synthase (EPSPS) gene in plants blocks aromatic amino acid biosynthesis and It produces an overall bleaching phenotype similar to herbicides. In addition, della-Cioppa et al., "Genetic Engineering of herbicide resistance in plants", Frontiers of Chemistry: Biotechnology, Chemical Abstract Service, ACS, Columbus, OH, pp. See 665-70 (1989). A double subgenomic promoter vector (Class I EPSPS) encoding a 1097 base pair of antisense EPSPS gene from Nicotiana Tabacum is shown in plasmid pBS712. 9 depicts plasmid pBS712. Full expression of Nicotiana Tabacum Class I EPSPS gene in antisense direction It produces an overall bleaching phenotype similar to herbicides.

Example 7

Exemplary Supplementary Analysis

The transgenic or native plant mutant has a non-functional gene such as a gene that produces EPSP synthase. Plants lacking or missing the EPSP synthase gene could only grow in the presence of added aromatic amino acids. Transfection of a plant with a viral vector comprising a functional EPSP synthase gene or a cDNA sequence encoding the same causes the plant to produce a functional EPSP synthase gene product. The transfected plant could then grow normally without aromatic amino acids added to its environment. In the transfected plants, intraplant EPSP synthase mutations were supplemented with trans by viral nucleic acid sequences comprising native or external EPSP synthase cDNA sequences.

Example 8

Expression of the methyltropic yeast ZZA1 gene in transfected plants confirms that the alcohol oxidase is encoded.

Genomic clones encoding alcohol oxidase ZZA1, the first enzyme involved in methanol solubilization, were isolated from the Pichia pastoris strain described in Kumagai et al. Bio / Technology 11: 606-610 (1993). Sequencing shows that the gene encodes about 72-kDa polypeptide (FIG. 10). Amino acid sequence comparisons for Pichia pastoris AOX1 and AOX2 alcohol oxidases show that they exhibit 97.4% and 96.4% similarity with each other, respectively. An open reading frame (ORF) for alcohol oxidase from genomic clones comprising ZZA1 was placed under the control of the Tobamovirus subgenomic promoter in TTO1A, hybrid tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) vectors. Infectious RNA from TTO1APE ZZA1 (FIG. 11) is prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase and N. a. It was used to mechanically inoculate Ventamiana. 72-kDa protein was accumulated in infected tissue as a whole and analyzed by immunoblotting using Pichia pastoris alcohol oxidase as standard. No detectable cross-reactive protein could be found in uninfected N. ventmia or control plant extracts.

Isolation of Alcohol Oxidase Genes

300 ng of yeast Pichia pastoris genomic DNA digested by PstI and XhoI was 25-mer oligonucleotide (5'-TTG CAC TCT GTT GGC TCA TGA CGA T-3 ') corresponding to the nucleotide sequence of the AOXI promoter (SEQ ID NO: 18) and 26-mer oligonucleotides corresponding to nucleotide sequences derived from AOXI terminators (5'-CAA GCT TGC ACA AAC GAA CGT CTC AC-3 '). PCR conditions using the Termus aquaticus DNA polymerase (2.5U; Perkin-Elmer Setus) were initially cultured at 97 ° C. for 2 minutes, 97 cycles for 2 cycles (1 minute), and 45 ° C. (1 ° C). Minutes), 35 cycles (1 min) at 60 ° C. (1 min), 35 cycles (1 min) at 94 ° C., final DNA polymerase extension for 7 min at 60 ° C. (1 min) and 60 ° C. 3273 base pair fragments containing the ZZA1 gene were treated with phenol / chloroform and precipitated with ammonium acetate / ethanol. After digestion by SacI, fragments were purified by 1% low melting agarose electrophoresis and subcloned into the SacI / EcoRV site in pBluescript KS-. Alcohol oxidase genomic clone KS-AO7'8 'was characterized by restriction mapping and dideoxynucleotide sequencing.

Plasmid constructs.

The only XhoI, AvrII sites are oligonucleotides: 5'-CAC TCG AGA GCA TGG CTA TTC CCG AAG AAT TTG ATA TTA TCG-3 '(SEQ ID NO: 20) and 5'-TCC CTA GGT TAG AAT CTA GCA AGA Insertion into Pichia pastoris clone KS-AO7'8 by polymerase chain reaction (PCR) mutagenesis using CCG GTC TTC TCG-3 '(downstream) (SEQ ID NO: 21). The 2.0-kb XhoI, AvrII ZZA1 PCR fragment was subcloned into pTTO1APE to form plasmid TTO1APE ZZA1.

Example 9

Rapid high-level expression of rice OS103 cDNA in transfected plants confirms that it encodes glycosylated rice α-amylase.

The open reading frame (ORF) for rice α-amylase from cDNA clone pOS103 (O'Neill et al., Mol. Gen. Genet. 221: 235-244 (1990)) was determined by TTO1A (Kumagai et al., Proc. Natl. Acad. Sci. USA 92: 1679-1683 (1995)), hybrid tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV) vectors under the control of the tobamovirus subgenomic promoter. Infectious RNA from TTO1A 103L (FIG. 12) was prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase. It was used to mechanically inoculate Ventamiana. Hybrid viruses are sprayed entirely onto non-inoculated upper leaves as evidenced by transmission electron microscopy, local lesion infectivity analysis and PCR amplification. Viral symptoms include plant growth arrest due to leaf deterioration and mild whitening as a whole. 46-kDa α-amylase accumulates at a level of at least 5% total soluble protein and was analyzed by immunoblotting using yeast expressed α-amylase as standard. No detectable cross-reactive protein could be found in uninfected N. ventmia or control plant extracts. The expression level of recombinant enzymes produced in transfected plants was at least 10 times higher than the amount of thermostable bacterial α-amylase produced in transfected tobacco. α-amylase was purified using ion exchange chromatography and its structural and biological properties were analyzed. The secreted protein had an approximately relative molecular weight of 46 kDa, cross reacted with anti-α-amylase antibodies, and hydrolyzed starch and oligomaltose in in vitro assays.

Transfected yen. Recombinant enzymes from Ventamiana were glycosylated at asparagine residues via N-glycoside linkages. Transfection n. Ventamiana and S. S. cerevisiae and blood. Heterologous α-amylase from transgenic strains of P. pastoris was treated with endo-H and compared by Western blot / SDS-PAGE analysis. s. Serenity and blood. There was an equivalent increase in fluidity for the enzyme expressed in the pastoris. The degree of change in fluidity suggests that while yeast expressed enzymes are hyperglycosylated, recombinant proteins from transfected plants are similar to those of native rice α-amylases. While it is known that mannose-rich and complex oligosaccharide side chains are covalently bound to mature rice seed α-amylase (Mitsui et al., Plant Physiol, 82: 880-884 (1986)), actual carbohydrate compositions and recombinant plant glycoproteins The structure of is determined.

MALDI-TOF analysis is yen. It was shown that Ventamiana had a relative molecular weight (M _r ) of 46,064 Da. M _r of α-amylase measured by MALDI-TOF was 918 Da larger than M _r derived from amino acid sequence (PCGENE). The change in molecular weight (ΔM _r ) of the plant expressed enzyme was smaller than the ΔM _r of α-amylase produced in yeast. The results suggest that glycosylation forms differ between foreign proteins expressed in plants and foreign genes secreted in yeast.

Plasmid constructs.

Oligonucleotides: 5'-CTC TCG AGA TCA ATC ATC CAT CTC CGA AGT GTG TCT GC-3 '(SEQ ID NO: 22) and 5'-TCC CTA GGT CAG ATT TTC TCC CAG ATT GCG TAG C-3' By PCR mutagenesis using (downstream) (SEQ ID NO: 23), only XhoI, AvrII sites were inserted into rice α-amylase pOS103 cDNA. The 1.4-kb XhoI, AvrII OS103 PCR fragment was subcloned with pTTO1A to form plasmid TTO1A 103L.

Purification, Immunological Detection and In Vitro Analysis of α-amylase.

Ten days after inoculation, total soluble protein was added to the upper, uninoculated yen. It was isolated from 10 g of Ventmia or leaf tissue. The leaves were frozen with liquid nitrogen and triturated in 20 ml of 5% 2-mercaptoethanol / 10 mM Tris-bis propane at pH 6.0. Centrifuge the suspension and POROS the supernatant containing recombinant α-amylase. It was bound to 50HQ ion exchange columns (PerSeptive Biosystems). α-amylase was eluted with a linear gradient of 0.01 M NaCl in 50 mM Tris-bis propane at pH 7.0. Α-amylase eluted in fraction 16, α-amylase eluted in fraction 17 and its enzymatic activity were analyzed (Sigma Kit # 576-3). Fractions containing substances that cross-react with α-amylase antibodies are centrifrep-30 (Amicon) and the buffer was exchanged by diafiltration (50 mM Tris-bis propane, pH 7.0). The samples were then loaded onto POROS HQ / M columns (Perceptive Biosystems), eluted with a linear gradient of 0.0-1 M NaCl in 50 mM Tris-bis propane at pH 7.0 and analyzed for α-amylase activity. Fractions containing material cross-reacting with α-amylase antibodies were concentrated with Centriprep-30 and buffers exchanged by diafiltration (20 mM sodium acetate / HEPES / MES, pH 6.0). The samples were then finally loaded onto POROS HS / M columns (Perceptive Biosystems), eluted with a linear gradient of 0.0-1 M NaCl in 20 mM sodium acetate / HEPES / MES at pH 6.0 and analyzed for α-amylase activity. Total soluble plant protein concentration was measured using bovine serum albumin as standard. Proteins were analyzed on 0.1% SDS / 10% polyacrylamide gels and transferred by electroblotting to nitrocellulose membrane for 1 hour. The blotted membrane was incubated for 1 hour with a 2000-fold dilution of anti-α-amylase antiserum. Using the standard protocol, antiserum S. Increased in rabbits against cerevisiae expressed rice α-amylase. Improved chemiluminescent horseradish peroxidase-linked, goat anti-rabbit IgG assay (Cappel Laboratories) was performed according to the manufacturer's (Amersham) specification. The membrane exposure time of the blotted membrane was less than 10 seconds. Quantification of total recombinant α-amylase in the extracted leaf samples was measured (using 1 second exposure of the blotted membrane) by comparing crude extract chemiluminescent signals against signals from known quantities of α-amylase. Blotted membranes provided the same quantitative results for short and long chemiluminescence exposures.

Analysis of Post-Translational Modifications of Recombinant α-amylase.

About 5 μg of recombinant protein was dissolved in 1M acetic acid and analyzed for flight matrix-assisted laser desorption / ionization time (MALDI-TOF) (Karas et al., Anal. Chem. 60: 2299-2301 (1988)). . During treatment with endo-B-N-acetylglucose aminase H (endo H), 2 μg of recombinant α-amylase was denatured in 0.5% SDS / 1% β-mercaptoethanol at 100 ° C. for 10 minutes. After addition of 500 U of Endo H (New England Biolabs), the samples were incubated in 50 mM sodium citrate (pH 5.5 @ 25 ° C) for 4 hours at 37 ° C, followed by Western blot analysis using anti-α-amylase antiserum. .

Example 10

Expression of the cucumber cucumber cDNA clone pQ21D in the transfected plants is confirmed to encode α-tricosanthin.

The inventors have developed plant viral vectors that advance the expression of α-tricosanthin in transfected plants. An open reading frame (ORF) for α-tricosanthin from genomic clone SEO was placed under the control of the TMV coat protein subgenomic promoter. Infectious RNA from TTU51A QSEO # 3 (FIG. 13) was prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase. Ventamiana was used to mechanically inoculate. Hybrid viruses are sprayed globally on all non-inoculated upper leaves as evidenced by local lesion infectivity analysis and PCR amplification. Viral symptoms include plant arrest and modification of tissue leaves by mild bleaching. 27-kDa α-tricosanthin accumulated in the upper leaves (14 days after inoculation) and cross reacted with the anti-tricosanthin antibody.

Plasmid constructs.

0.88-kb XhoI, AvrII fragments comprising α-tricosanthin coding sequence are oligonucleotide QMIX: 5'-GCC TCG AGT GCA GCA TGA TCA GAT TCT TAG TCC TCT CTT TGC-3 '(SEQ ID NO: 24) And PCR mutagenesis using Q1266A 5'-TCC CTA GGC TAA ATA GCA TAA CTT CCA CAT CA AAGC-3 '(SEQ ID NO: 25) from Trichosanthes kirilowii Mazimowicz. Amplified from isolated genomic DNA. The α-tricosanthin open reading frame was confirmed by dideoxy sequencing and was placed under the control of the TMV-U1 coat protein subgenomic promoter by subcloning into TTU51A to form plasmid TTU51A QSEO # 3.

In vitro transcription, inoculation and analysis of transfected plants.

yen. Ventamiana plants were inoculated with in vitro transcripts of Kpn I-digested TTU51A QSEO # 3 as described above (Dawson et al., Supra). N. Infected with TTU51A QSEO # 3 transcript. The virion was isolated from the Ventamiana leaves.

Purification, Immune Detection, and In Vitro Analysis of α-tricosanthin.

Two weeks after the inoculation, the upper unvaccinated yen. Total soluble protein was isolated from the Ventamiana leaf tissue and analyzed from cross-reactivity to α-tricosanthin antibody. Proteins from totally infected tissues were analyzed on a 0.1% SDS / 12.5% polyacrylamide gel and transferred by electroblotting for 1 hour with nitrocellulose membrane. The blotted membranes were incubated with 2000-fold dilutions of goat anti-α-tricosanthin antiserum for 1 hour. Improved chemiluminescent wasabi peroxidase-bound rabbit anti-goat IgG assay (Cappel Laboratories) was performed according to the manufacturer's (Amersham) specification. The membrane exposure time of the blotted membrane was less than 10 seconds. Short and long chemiluminescence exposure of the blotted membrane gave the same quantitative results.

Example 11

Expression of human β-globulin cDNA clones in transfected plants is confirmed to encode hemoglobin.

Hemoglobin expression vector (RED1) was formed in several subcloning steps. Insert the only SphI site into the initiation codon for human β-globulin and oligonucleotide 5'-CAC TCG AGA GCA TGC TGC ACC TGA CTC CTG AGG AGA AG-3 '(upstream) (SEQ ID NO: 26) and 5'- The XbaI site was placed downstream of the stop codon by PCR mutagenesis using CGT CTA GAT TAG TGA TAC TTG TGG GCC AGC GCA TTA GC-3 '(downstream) (SEQ ID NO: 27). The 452 bp SphI-XbaI hemoglobin fragment was subcloned into the SphI-AvrII site of the modified tobamovirus vector. The construct is a 1020 bp fragment from the tobacco mild green mosaic virus (TMGMV; U5 strain), including the viral subgenomic promoter, coat protein gene, and TMGMV primer 5'-GGC TGT GAA ACT CGA AAA GGT TCC GG-3 '(upstream) ) (SEQ ID NO: 28) and 5'-CGG GGT ACC TGG GCC GCT ACC GGC GGT TAG GGG AGG-3 '(downstream) (SEQ ID NO: 29). In this vector, an artificial 40 base pair 5 ′ non-dock coat protein leader was fused to a hybrid cDNA encoding rice α-amylase signal peptide and human β-globulin.

Hybrid sequences encoding the β-chain of rice α-amylase signal peptide and human hemoglobin were placed under the control of the tobacco mosaic virus (TMV-U1) coat protein subgenomic promoter. Infectious RNA was prepared in vitro, N. It was applied directly to Ventamiana. One to two weeks after inoculation, the transfected plants accumulate recombinant hemoglobin. 16-KDa β-globin accumulated throughout infected leaves and analyzed by immunoblotting using human hemoglobin as standard. Recombinant hemoglobin was detected in transfected plants using rabbit anti-human hemoglobin antibody. Uninfected yen. No cross-reacting proteins could be detected in the Ventmia or control plants. Β-globin from the transfected plants moved simultaneously with the real human standard and was shown to form homodimers. The results suggest that the rice α-amylase signal peptide is eliminated and can rapidly secrete functional hemoglobin in transfected plants.

Example 12

a. Construction of Tobamovirus Vectors for Expression of Heterologous Genes in A. thaliana.

Virions prepared as crude extracts of tissues from turnips infected with RMV. Ventamiana, Yen. Tabacum, A. It was used to inoculate tagliana and rapeseed (canola). Two to three weeks after transfection, the whole infected plants were analyzed by immunoblotting using purified RMV as standard. Total soluble plant protein concentration was measured using calf serum albumin as standard. Protein was analyzed on 0.1% SDS / 12.5% polyacrylamide gel and transferred to nitrocellulose membrane for 1 hour by electroblotting. The blotted membranes were incubated for 1 hour with a 2000-fold dilution of anti-ribgrass mosaic virus coat antiserum. Using the standard protocol, antiserum was increased in rabbits against purified RMV coat protein. Improved chemiluminescent wasabi peroxidase-bound goat anti-rabbit IgG assay (Cappel Laboratories) was performed according to the manufacturer's specification. The membrane exposure time of the blotted membrane was less than 10 seconds. Uninfected yen. No cross-reacting protein could be detected in the Ventmia or control plant extracts. 18kDa protein is entirely infected. Ventamiana, Yen. Tabacum, A. Cross-reacted with anti-RMV coat antibodies from Tagliana and Rapeseed (Canola). The result is RMV yen. Ventamiana, Yen. Tabacum, A. Demonstrates total infection of tagliana and rapeseed (canola).

Plasmid constructs.

Lipgrass Mosaic Virus (RMV) is a member of the Tobamovirus family that infects Abranaaceae plants. Some RMV cDNAs, including the 30K subgenomic promoter, 30K ORF, the cote subgenomic promoter, the coat ORF and the 3'-terminus, are oligonucleotide TVCV 183 × 5'-TAC TCG AGG TTC ATA AGA CCG CGG TAG GCG G-3 '( Upstream) (SEQ ID NO: 30) and TVCV KpnI 5'-CGG GGT ACC TGG GCC CCT ACC CGG GGT TTA GGG AGG-3 '(downstream) (SEQ ID NO: 31) and were separated by KS + Subcloned into the EcoRV site of to form plasmid KS + TVCV # 23 (FIG. 14). RMV cDNA was characterized by restriction mapping and dideoxy nucleotide sequencing. Some nucleotide sequences are as follows:

1543 base pairs from some RMV cDNAs were compared to Rapese mosaic virus (ORMV) (PCGENE). Nucleotide sequence identity was 97.8%. RMV 30K and coat ORF were compared to ORMV and amino acid identity was 98.11% (30K) and 98.73% (coat), respectively. Some RMV cDNAs, including the 5'-terminus and part of a transcriptase, are oligonucleotides RGMV1 5'-GAT GGC GCC TTA ATA CGA CTC ACT ATA GTT TTA TTT TTG TTG CAA CAA CAA CAA C-3 '(upstream) (SEQ ID NO: : 33) and PGR 132 5′-CTT GTG CCC TTC ATG ACG AGC TAT ATC ACG-3 ′ (SEQ ID NO: 34) using RT-PCR from RMV RNA. RMV cDNA was characterized by dideoxy nucleotide sequencing. Some nucleotide sequences, including the T7 RNA polymerase promoter and a portion of the RMV cDNA, are as follows:

The uppercase letter is the nucleotide sequence of RMV cDNA. Lowercase letters are the nucleotide sequence of the T7 RNA polymerase promoter. The nucleotide sequences of the 5 'and 3' oligonucleotides are underlined.

Full-length infectious RMV cDNA clones were oligonucleotides RGMV1 5'-GAT GGC GCC TTA ATA CGA CTC ACT ATA GTT TTA TTT TTG TTG CAA CAA CAA CAA C-3 '(SEQ ID NO: 36) and RG1 APE Obtained by RT-PCR from RMV RNA using 5′-ATC GTT TAA ACT GGG CCC CTA CCC GGG GTT AGG GAG G-3 ′ (SEQ ID NO: 37). RMV cDNA was characterized by dideoxy nucleotide sequencing. Some nucleotide sequences, including the T7 RNA polymerase promoter and a portion of the RMV cDNA, are as follows:

The uppercase letter is the nucleotide sequence of RMV cDNA. The nucleotide sequences of the 5 'and 3' oligonucleotides are underlined. Full-length infectious RMV cDNA clones are oligonucleotides RGMV1 5'-gat ggc gcc tta ata cga ctc act ata gtt tta ttt ttg ttg caa caa caa caa c-3 '(SEQ ID NO: 39) and RG1 APE 5' -ATC GTT TAA ACT GGG CCC CTA CCC GGG GTT AGG GAG G-3 '(downstream) (SEQ ID NO: 40) was obtained by RT-PCR from RMV RNA.

Example 13

Arabidopsis thaliana cDNA library construct in a double subgenomic promoter vector.

The Arabidopsis thaliana cDNA library was obtained from the Arabidopsis Biological Resource Center (ABRC). Four libraries from ABRC were size-segmented with inserts of 0.5-1 kb (CD4-13), 1-2 kb (CD4-14), 2-3 kb (CD4-15) and 3-6 kb (CD4-16). All libraries are advanced and used by several 12 groups to isolate genes. PBluescript from the Lambda ZAP II vector Phagemids were agglomerated and the library was recovered as a plasmid according to standard procedures.

CDNA inserts in CD4-13 (lambda ZAP II vector) were recovered by digestion with NotI. In most cases disassembly by NotI liberates the entire Arabidopsis thaliana cDNA insert because the original library is assembled with the NotI adapter. NotI is an 8-base cutter that rarely cuts plant DNA. To insert NotI fragment into transcription plasmid, pBS735 transcription plasmid (FIG. 15) was digested by PacI / XhoI, oligonucleotides 5′-TCGAGCGGCCGCAT-3 ′ (SEQ ID NO: 41) and 5′-GCGGCCGC-3 ′ ( To the adapter DNA sequence formed from SEQ ID NO: 42). The resulting plasmid pBS740 (FIG. 16) contains the only NotI restriction site for bidirectional insertion of NotI fragments from the CD4-13 library. The recovered colonies were Qiagen BioRobot 9600 Prepared from above for plasmid miniprep together. BioRobot 9600 Plasmid DNA preps carried out on the above run in a 96-well format and produce transcriptional DNA. Arabidopsis cDNA libraries were transformed from plasmids and analyzed by agarose gel electrophoresis to identify clones with inserts. Clones with inserts are transcribed in vitro, en. Is inoculated onto Ventamiana and / or Arabidopsis thaliana. Selected leaf beds of transfected plants are then biochemically analyzed.

Example 14

Expression and targeting of chloroplasts of green fluorescent proteins in Arabidopsis thaliana via recombinant viral nucleic acid vectors.

The gene encoding green fluorescent protein (GFP) was fused at the N-terminus to the chloroplast transfer peptide (CTP) sequence of RuBPCase to form plasmid pBS723 (FIG. 17). Plasmid pBS723 was modified by PCR mutagenesis to form the only PacI site upstream of the ATG start codon of CTP-GFP gene fusion. PCR amplification products from plasmid pBS723 digested PacI / SalI and were cloned into plasmid GFP-30B / clone 60 (also degraded by PacI / SalI) to form plasmid pBS731 (FIG. 18). Plasmid pBS731 was linearized at the unique KpnI restriction site and transcribed into infectious RNA with T7 RNA polymerase according to standard procedures. Infectious RNA transcripts inoculated on Nicotiana ventamiana plants showed full expression in the upper leaves of CTP-GFP within 6 days. Plants infected with RNA transcripts from plasmid pBS731 were harvested by crushing the leaves with mortar and pestle to obtain recombinant virions derived from pBS731 infectious RNA transcripts. Virions from pBS731 were inoculated onto the leaves of Arabidopsis thaliana. The inoculated leaves of Arabidopsis thaliana plants showed strong green fluorescence under UV light, indicating that the CTP-GFP reporter gene was successfully expressed.

Example 15

High throughput robot.

Inoculation of organisms such as plants is carried out using means of high throughput robotics. For example, Arabidopsis thaliana grew in microtiter plates such as standard 96-well and 384-well microtiter plates. The robot control arm then moves the plate containing the organisms to a colony picker or other robot that delivers the inoculum to each plant in the well. By this method, inoculation was carried out in ultrafast and high throughput methods. In the case of plants, it is preferred that at least the organism becomes a sprouted seed within a development cycle that makes it accessible to the cells to be transfected. The equipment used in the automated robotic manufacturing line is an electronic multichannel pipetmen, Qiagen BioRobot 9600 , Robbins Hydra liquid handler, Flexys Colony Picker, New Brunswick automated plate pourer, GeneMachines HiGro shake incubator, New Brunswick floor shaker, three Qiagen BioRobots, MJ Research PCR machines (PTC-200, Tetrad), ABI 377 sequencer and Tecan There are robots of the type that include, but are not limited to, the Genesis RSP200 liquid handler.

Example 16

Genomic DNA library constructs in recombinant viral nucleic acid vectors.

Genomic DNA reproduced in BAC (bacterial artificial chromosomes) or YAC (yeast artificial chromosomes) libraries was obtained from the Arabidopsis Biological Resource Center (ABRC). BAC / YAC DNA can be mechanically sized, bound to adapters with adhesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors. Optionally, the mechanically sized granular genomic DNA can be blunt-terminated with a recombinant viral nucleic acid vector. The recovered colonies were Qiagen BioRobot 9600 Can be prepared for plasmid miniprep. BioRobot 9600 Plasmid DNA preparations carried out above were assembled into a 96-well format to produce transcription amounts of DNA. Recombinant viral nucleic acid / Arabidopsis genomic DNA libraries were analyzed by agarose gel electrophoresis (template quantification step) to identify clones with inserts. Clones with inserts can then be transcribed in vitro, N. May be inoculated on Ventamiana and / or Arabidopsis thaliana. Selected leaf beds from transfected plants can be biochemically analyzed.

Genomic DNA from Arabidopsis contains on average all 2.5 kb (kilobases) of gene. 0.5-2.5 kb of genomic DNA fragments obtained by random shearing of DNA were shotgun assembled in a recombinant viral nucleic acid expression / knockout vector library. Given a genome size of Arabidopsis of about 120,000 kb, the random recombinant viral nucleic acid genomic DNA library needs to contain a minimum of 48,000 independent inserts of 2.5 kb in size to obtain a 1 × protect of the Arabidopsis genome. Optionally, the random recombinant viral nucleic acid genomic DNA library needs to contain a minimum of 240,000 independent inserts of 0.5 kb size in order to obtain 1 × protects of the Arabidopsis genome. Combining recombinant viral nucleic acid expression / knockout vector libraries from genomic DNA rather than cDNA can overcome the known difficulties encountered with rare clones in cDNA libraries and low mRNA uptake. Knockout vector libraries made from recombinant viral nucleic acid expression / genomic DNA have been particularly useful as gene silencing knockout libraries. And knockout vector libraries made with DHSPES expression / genomic DNA were particularly useful for expressing gene deletion introns. And other plant species with medium to small genomes (eg, roses, about 80,000 kb) have been particularly useful for knockout vector libraries made from recombinant viral nucleic acid expression / genomic DNA. Recombinant viral nucleic acid expression / knockout vector libraries could be prepared from existing BAC / YAC genomic DNA or from newly-prepared genomic DNA for specific plant species. Alternatively, the recombinant viral nucleic acid expression / knockout vector library could be made from genomic DNA from animals including yeast, bacteria or humans.

Example 17

Genomic DNA or cDNA library constructs in a DHSPES vector, and transfection of each clone from said vector library on T-DNA targeted or transposon targeted or mutant plants.

Transfection of each clone from genomic DNA or cDNA library constructs in recombinant viral nucleic acid vectors, and vector libraries on T-DNA-targeted or transposon-targeted or mutant plants is performed according to the method of Example 16. The protocol can be readily prepared with complementary mutations introduced by random insertion mutations in T-DNA sequences or transposon sequences.

Example 18

Preparation of malaria CTL epitopes genetically fused to the C terminus of TMVCP.

blood. Malaria immunity induced in mice by irradiated sporoziote of P. yoelii is dependent on CD8 + T lymphocytes. Clone B is blood. Joel and P. One cytotoxic T lymphocyte (CTL) cell clone that has been shown to recognize epitopes present in all of the P. berghei CS proteins. Clone B has the following amino acid sequence; It recognizes SYVPSAEQILEFVKQISSQ (SEQ ID NO: 43) and protects against infection from two types of malarial sporozoites when the mice are bilaterally transfected. Structures of genetically modified tobamoviruses designed to carry the malaria CTL epitope fused to the surface of virions are described below.

Structure of Plasmid pBGC289. 0.5 kb fragment of pBGC11 was PCR amplified using 5 'primer TB2ClaI5' and 3 'primer C / -5AvrII. The amplified product was cloned into the SmaI site of pBstKS + (Stratagene Cloning Systems) to form pBGC214.

PBGC215 was formed by cloning 0.15kb AccI-NsiI fragment of pBGC214 into pBGC235. 0.9 kb NcoI-KpnI fragment from pBGC215 was cloned into pBGC152 to form pBGC216.

The 0.07 kb synthetic fragment annealed PYCS.2p into PYCS.2m and the resulting double-stranded fragment. It was formed by coding a Yoeli CTL malaria epitope, treated with mung bean nuclease, and cloned into the AvrII site of pBGC215 at the blunt end to form a unique AatII site to form pBGC262. A 0.03 kb synthetic AatII fragment was formed by annealing TLS.1EXP into TLS.1EXM and the resulting double-stranded fragment, encoding the leak-stop sequence, and the stuper sequence used to facilitate cloning was cloned into AatII digested pBGC262. To form pBGC263. PBGC262 was digested by AatII and bound to itself to remove 0.02 kb stepper fragments to form pBGC264. The 1.0 kb NcoI-KpnI fragment of pBGC264 was cloned into pSNC004 to form pBGC289.

Virus TMV289 prepared by the transcription of in vitro plasmid pBGC289 contains a leak stop signal that removes four amino acids from the C terminus of the wild-type TMV coat protein gene, thus cutting the cleaved coat protein and coat protein at a ratio of 20: 1. It is expected to be synthesized with CTL epitopes fused at the ends. The recombinant TMVCP / CTL epitope fusion in TMV289 has a stop codon translated as amino acid Y (amino acid residue 156). The amino acid sequence of the coat protein of virus TMV216 produced by the transcription of in vitro plasmid pBGC216 is cleaved by four amino acids. Epitope SYVPSAEQILEFVKQISSQ (SEQ ID NO: 43) is calculated to be about 0.5% by weight of virion using the same assumption confirmed by quantitative ELISA analysis.

Proliferation and Purification of Epitope Expression Vectors. Infected transcripts were synthesized from KpnI-straightening pBGC289 using T7 RNA polymerase and cap (7mGpppG) according to the manufacturer (New England Biolabs).

Increased quantitation of the recombinant virus was found in Sample ID No. Obtained by incubating TMV289.11B1a. Fifteen tobacco plants were cultivated for 33 days with post-inoculation 595 g of harvested leaf biomass containing no more than two inoculated leaves. Purified Sample ID No.TMV289.11B2 was recovered (383 mg) in a yield of 0.6 mg per gram biomass. Therefore, 3 g of 19-mer peptide was obtained per g biomass extracted. Tobacco plants infected with TMV289 accumulated more than 1.4 micromoles of peptide per kg of leaf tissue.

Product analysis. Partial identification of the sequence of the epitope coding region of TMV289 was performed by sample ID no. Obtained by restriction analysis of PCR amplified cDNA using viral RNA isolated from TMV289.11B2. The presence of protein in TMV289 with the expected flow capacity of cp fusion at 20 kD and cp cleaved at 17.1 kD was confirmed by denaturing polyacrylamide gel electrophoresis.

Example 19

Identification of nucleotide sequences involved in plant growth regulation by cytoplasmic inhibition of gene expression using virus induced RNA.

Antisense RNA was used to downregulate gene expression in transgenic and transfected plants. The effect of antisense on the inhibition of eukaryotic expression was first demonstrated by Izant et al. (Cell 36 (4): 1007-1015 (1984)). Since then, downregulation of numerous genes from transfected plants has been reported. And it has been demonstrated that "simultaneous-inhibition" of genes occurs in transfected plants containing sense RNA by readthrough transcription, which is located on the opposite strand of DNA from a promoter away from it (Van der Krol et al. Many, Plant Cell 2 (4): 291-299 (1990) and Naopli et al., Plant Cell 2: 279-289 (1990)).

In this Example and Examples 20 and 21, (1) a method for producing sense / antisense RNA using an RNA viral vector, (2) a method for preparing virus-induced sense / antisense RNA in the cytoplasm, (3) A method of inhibiting expression of endogenous plant proteins in the cytoplasm by viral antisense RNA, (4) a method of "co-inhibiting" expression of endogenous plant proteins in the cytoplasm by viral RNA, and (5) genetically engineered antisense traits It can be seen how to make transfected plants containing viral antisense RNA much earlier than the time required to obtain the infected plants. Overall infection and expression of viral antisense RNA takes place about 4 days after inoculation, while it takes months or more to produce a single transfected plant. This example demonstrates that positive strand viral vectors that replicate alone in the cytoplasm can be used to identify genes involved in plant growth regulation by inhibiting expression of specific endogenous genes. This example may be used to characterize specific genes and biochemical pathways in transfected plants using RNA viral vectors.

Tobamovirus vectors have been developed for heterologous expression of uncharacterized nucleotides in transfected plants. Some Arabidopsis thaliana cDNA libraries were placed under transcriptional control of the Tobamovirus subgenomic promoter in RNA viral vectors. Colonies from the transformed E. coli were automatically picked up using a Flexis robot and transferred to a 96 well round bottom block containing 50 μg / ml of good broth (TB) Amp. About 2000 plasmid DNA was isolated from the culture overnight using a biorobot, and infectious RNA from 430 independent clones was added directly to the plant. One to two weeks after inoculation, transfected Nicotiana and Ventiana plants were visually examined for changes in growth rate, form and color. Plant sets transfected with 740 AT # 120 were severely inhibited in development. DNA sequencing shows that the clone contains Arabidopsis GTP binding protein open reading frame (ORF) in the antisense direction. This demonstrates that episomal RNA viral vectors can be used to carefully manipulate signal transfection pathways in plants. And, the results show that Arabidopsis antisense transcript. Suggests that it may be able to stop the expression of the Ventamiana gene.

Construction of Arabidopsis thaliana cDNA Library in RNA Virus Vectors.

Arabidopsis thaliana CD4-13 cDNA library was digested by NotI. DNA fragments of 500-1000 bp were separated by perelution and subcloned into the NotI site of pBS740. E. coli C600 competent cells were transformed with pBS740 AT library, and colonies containing Arabidopsis cDNA sequences were selected on 50 μg / ml LB Amp. Recombinant C600 cells were picked up automatically using a Flexis robot and transferred to a 96 well round bottom block containing 50 μg / ml of good Broth (TB) Amp. About 2000 plasmid DNA was isolated from the culture overnight using a biorobot (Qiagen) and infectious RNA from 430 independent clones was added directly to the plant.

Isolation of genes encoding GTP binding protein.

One to two weeks after inoculation, transfected Nicotiana Ventamiana plants were visually examined for changes in growth rate, morphology and color. Plants transfected with 740 AT # 120 (FIG. 19) were severely disrupted in development.

DNA sequencing and computer analysis.

A 782 bp NotI fragment of 740 AT # 120 was characterized, including ADP-ribosylation factor (ARF) cDNA. The DNA sequence of the NotI fragment of 740 AT # 120 is as follows:

Nucleotide sequencing of 740 AT # 120 was performed by dideoxy termination using double stranded templates (Sanger et al., Proc. Natl. Acad. Sci. USa 74 (12): 5463-5467 (1977)). Nucleotide sequence analysis and amino acid sequence comparisons were performed using the DNA Strider, PCGENE and NCBI Blast programs. The nucleotide sequence from 740 AT # 120 was compared to human ADP-ribosylation factor (ARF3) W3384 (FIG. 20).

Isolation of cDNA encoding Nicotiana Ventamiana ADP-ribosylation factor.

Some cDNAs from Nicotiana ventamiana leaf RNAs have the following oligonucleotides: ATARFM1X, 5′-GCC TCG AGT GCA GCA TGG GGT TGT CAT TCG GAA AGT TGT TC-3 ′ (SEQ ID NO: 45) and ATARFA181A, 5'-TAC CTA GGC CTT GCT TGC GAT GTT GTT GGA GAG-3 '(downstream) (SEQ ID NO: 46) was isolated by polymerase chain reaction (PCR). Full-length cDNA encoding ARF was isolated by selecting cDNA libraries by colony hybridization using ³² P labeled Arabidopsis thaliana ARF PCR products. Hybridization can be performed at 42 ° C. for 48 hours in 50% formamide, 5 × SSC, 0.02M phosphate buffer, 5 × Denhardt solution, and 0.1 mg / ml shear calf thymus DNA. The filter was washed in 0.1 × SSC, 0.1% SDS at 65 ° C. prior to autoradiography. PCR products and ARF cDNA clones were demonstrated by dideoxynucleotide sequencing.

Example 20

Identification of nucleotide sequences involved in plant development regulation by cytoplasmic inhibition of gene expression using virus induced RNA.

This example can be used to carefully manipulate episomal RNA virus vectors in plant signal transfection pathways. And, the results show that Arabidopsis antisense transcript. Suggests that it may be able to stop the expression of the Ventamiana gene.

Some Arabidopsis thaliana cDNA libraries were placed under transcriptional control of the Tobamovirus subgenomic promoter in RNA viral vectors. Colonies from the transformed E. coli were automatically picked up using a Flexis robot and transferred to a 96 well round bottom block containing 50 μg / ml of good broth (TB) Amp. About 2000 plasmid DNA was isolated from the culture overnight using a biorobot, and infectious RNA from 430 independent clones was added directly to the plant. One to two weeks after inoculation, transfected Nicotiana and Ventiana plants were visually examined for changes in growth rate, form and color. Plant sets transfected with 740 AT # 88 developed a white phenotype on infected leaf tissue. DNA sequencing shows that the clone contains Arabidopsis G-protein coupled receptor open reading frame (ORF) in the antisense direction.

Construction of Arabidopsis thaliana cDNA in RNA Virus Vectors.

Arabidopsis thaliana CD4-13 cDNA library was digested by NotI. DNA fragments of 500-1000 bp were separated by perfusation and subcloned into the NotI site of pBS740. E. coli C600 eligible cells were transformed with pBS740 AT library, and colonies containing Arabidopsis cDNA sequences were selected at 50 μg / ml LB Amp. Recombinant C600 cells were picked up automatically using a Flexis robot and transferred to a 96 well round bottom block containing 50 μg / ml of good Broth (TB) Amp. About 2000 plasmid DNA was isolated from the culture overnight using a biorobot (Qiagen) and infectious RNA from 430 independent clones was added directly to the plant.

Isolation of genes encoding G-protein coupled receptors.

One to two weeks after inoculation, transfected Nicotiana Ventamiana plants were visually examined for changes in growth rate, morphology and color. Plants transfected with 740 AT # 88 (FIG. 21) developed a white phenotype on infected leaf tissue.

DNA sequencing and computer analysis.

A 750 bp NotI fragment of 740 AT # 88 containing G-protein coupled receptor cDNA was characterized. The DNA sequence of the NotI fragment (750 bp) of 740 AT # 88 is as follows:

Nucleotide sequencing of 740 AT # 88 was performed by dideoxy termination using double stranded template (Sanger et al., Proc. Natl. Acad. Sci. USa 74 (12): 5463-5467 (1977)). Nucleotide sequence analysis and amino acid sequence comparisons were performed using the DNA Strider, PCGENE and NCBI Blast programs. Amino acid sequences derived from 740 AT # 88 were compared with Arabidopsis EST ORF ATTS2938 (FIG. 24) and Octopus rhodopsin P31356 (FIG. 25).

Example 21

Identification of the nucleotide sequence involved in the regulation of plant growth by cytoplasmic inhibition of gene expression using viral induced RNA.

Antisense RNA was used to downregulate gene expression in transgenic and transfected plants. The purpose of this example is again to demonstrate that positive strand viral vectors replicating alone in the cytoplasm can be used to identify genes involved in the regulation of plant growth by inhibiting the expression of specific endogenous genes. This example will enable the characterization of biochemical pathways and specific genes in transfected plants using RNA viral vectors.

The protocol of this embodiment is similar to that of Examples 19 and 20. Tobamovirus vectors have been developed for heterologous expression of uncharacterized nucleotide sequences in transfected plants. Some Arabidopsis thaliana cDNA libraries were placed under transcriptional control of the Tobamovirus subgenomic promoter in RNA viral vectors. Colonies from transformed E. coli were automatically picked up using a Flexis robot and transferred to a 96 well round bottom block containing 50 μg / ml of good broth (TB) Amp. About 2000 plasmid DNA was isolated from the culture overnight using a biorobot, and infectious RNA from 430 independent clones was added directly to the plant. One to two weeks after inoculation, transfected Nicotiana and Ventiana plants were visually examined for changes in growth rate, form and color. The plant set transfected with 740 AT # 120 had white leaf development and severely hampered development. DNA sequencing shows that the clone contains Arabidopsis GTP binding protein open reading frame (ORF) in the positive direction. This demonstrates that episomal RNA viral vectors can be used to carefully manipulate signal transfection pathways in plants.

Construction of Arabidopsis thaliana cDNA Library in RNA Virus Vectors.

Arabidopsis thaliana CD4-13 cDNA library was digested by NotI. DNA fragments of 500-1000 bp were separated by perelution and subcloned into the NotI site of pBS740. E. coli C600 eligible cells were transformed with pBS740 AT library, and colonies containing Arabidopsis cDNA sequences were selected at 50 μg / ml LB Amp. Recombinant C600 cells were picked up automatically using a Flexis robot and transferred to a 96 well round bottom block containing 50 μg / ml of good Broth (TB) Amp. About 2000 plasmid DNA was isolated from the culture overnight using a biorobot (Qiagen) and infectious RNA from 430 independent clones was added directly to the plant.

Isolation of genes encoding GTP binding protein.

One to two weeks after inoculation, transfected Nicotiana Ventamiana plants were visually examined for changes in growth rate, morphology and color. Plants transfected with 740 AT # 2441 developed white leaf and severely inhibited development.

DNA sequencing and computer analysis.

NotI fragment of 740 AT # 2441 was characterized, including the RAN GTP binding protein ORF cDNA. The DNA sequence (350bp) of the NotI fragment of 740 AT # 2441 is as follows:

Nucleotide sequencing of 740 AT # 2441 was performed by dideoxy termination using double stranded templates (Sanger et al., Proc. Natl. Acad. Sci. USa 74 (12): 5463-5467 (1977)). Nucleotide sequence analysis and amino acid sequence comparisons were performed using the DNA Strider, PCGENE and NCBI Blast programs. The nucleotide sequence from 740 AT # 2441 was compared with the tobacco RAN-B1 GTP binding protein (FIG. 26). The nucleotide sequence from 740 AT # 2441 was compared with human RAN GTP-binding protein (FIG. 27).

Example 22

Gene silencing / simultaneous-inhibition of genes derived by delivering RNA that can base pair itself in to form a double stranded region.

Gene silencing was used to downregulate gene expression in transgenic plants. Recent experimental evidence suggests that double-stranded RNA is an effective promoter of gene silencing / co-inhibition in transgenic plants. For example, Waterhouse et al. (Proc. Natl. Acad. Sci. USA 95: 13959-13964 (1998)) indicate that viral resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Described. Gene silencing / co-inhibition of plant genes is induced by carrying RNA that can base pair in itself to form a double stranded region.

This example shows (1) a method of generating an RNA viral vector capable of producing RNA capable of forming a double stranded region, and (2) a method of silencing plant genes using the viral vector.

Step 1: Preparation of the DNA sequence to generate an RNA molecule capable of base pairing on its own after being transcribed. Two identical or nearly identical ds DNA sequences may be joined together in reverse (ie head to tail, or tail to head direction) with respect to each other, with or without homologous binding nucleotide sequences. The resulting DNA sequence can then be cloned into cDNA copies of the plant viral vector genome.

Step 2: Cloning, screening, transcription of the main clone using methods known in the art.

Stage 3: Infected plant cells with transcripts from clones.

As the virus expresses the foreign gene sequence, RNA from the foreign gene will base pair on itself to form a double stranded RNA region. This approach can be used with plant or non-plant genes and can be used to silence homologous plant genes to help identify the function of a particular gene sequence.

Example 23

Preparation of Non-Infective Eastern Hemp Encephalomyelitis Virus Nucleotide Sequence

Genetic engineering of eastern hemp encephalomyelitis virus is described by Garoff et al., Curr. Opin. Biotechnol. 9 (5): 464-9 (1998); Virology 239 (2): 389-401 (1997) by Pushko et al. And J. Virol, Davis et al. 70 (6): 3781-7 (1996), which is hereby incorporated by reference. Full-length cDNA copies of the eastern hemp encephalomyelitis virus (EEEV) genome are described in Chang et al. Virol. It can be prepared as described in 68: 2129 (1987) and inserted into the PstI site of pUC18. The sequence for the viral coat protein and its contiguous El and E2 glycoprotein infectious agents is located in the corresponding region for the 26S RNA region. Vectors containing cDNA copies of the EEEV genome are digested with appropriate restriction enzymes and exonucleases to delete the coding sequence (structural protein coding sequence) of the coat protein and the El and E2 proteins.

For example, structural protein coding sequences are removed by partial digestion with MboI and recombination so that important portions of the structural genes are removed. Optionally the vector is cut at the 3'-end of the viral structural gene. Subsequently the viral DNA is removed by digestion with Bal31 or cocci S1 nuclease up to the start codon of the structural protein sequence. And a DNA sequence comprising the 3'-tail sequence of the virus is linked to the remaining 5'-end. Deletion of the coding sequence for the structural protein is confirmed by isolating EEEV RNA and using it to infect horse cell culture. The isolated EEEV RNA was found to be non-infectious under natural conditions.

Optionally, the coding sequence for the coat protein is deleted and the sequence for the El and E2 glycoproteins is in a vector comprising a cDNA copy of the EEEV genome. In this case, the coat protein coding sequence is partially digested with MboI and removed by recombination to reattach to the 3'-tail of the virus. This will remove an important part of the coat protein gene.

The second alternative method for removing coat protein sequences is to cut the vector at the 3'-end of the viral coat protein gene. The viral DNA is removed by digestion with Bal31 or cocci S1 nuclease up to the start codon of the coat protein sequence. The synthetic DNA sequence comprising the 3'-tail sequence is linked to the remaining 5'-terminus.

Deletion of the coding sequence for the coat protein is confirmed by separating EEEV RNA and using it to infect horse cell culture. The isolated EEEV RNA was found to be non-infectious under natural conditions.

Example 24

Preparation of Non-Infectious Syndbis Virus nucleotide Sequences

Gene manipulation of Sindbis virus is described in Garr et al., Curr. Opin. Biotechnol. 9 (5): 464-9 (1998); Agapov et al., Proc. Natl. Acad. Sci. USA 95 (22): 12989-94 (1998); Frolov et al., J. Virol. Apr; 71 (4): 2819-29 (1997), which is hereby incorporated by reference in its entirety. Full-length cDNA copies of the Sindbis virus genome are prepared as described in Lindquist et al. Virology 151: 10 (1986) and inserted into the SmaI site of the plasmid derived from pBR322. The sequence for the viral coat protein and contiguous El and E2 glycoprotein infectious agents is located in a region corresponding to the 26S RNA region. A vector comprising a cDNA copy of the Sindbis virus genome is digested with appropriate restriction enzymes and exonucleases to delete the coding sequence for the structural protein.

For example, structural protein coding sequences are removed by partial digestion with BinI and recombination to remove important portions of structural genes. Optionally, the vector is cut at the 3'-end of the viral nucleic acid. The viral DNA is removed by digestion with Bal31 or aureus S1 nuclease up to the start codon of the structural protein sequence. The synthetic DNA sequence comprising the 3'-tail sequence of the virus is linked to the remaining 5'-terminus. Deletion of the coding sequence for the structural protein is confirmed by isolating Sindbis RNA and using it to infect the cell culture of algae. It was found that the isolated Sindbis RNA was non-infectious under natural conditions.

Optionally, the coding sequence for the coat protein is deleted and the sequence for the E1 and E2 glycoproteins is in a vector comprising a cDNA copy of the Sindbis genome. In this case, the coat protein coding sequence is partially digested with AfiII to reattach to the 3'-tail of the virus and removed by recombination.

The second alternative method of removing the coat protein sequence is to cut the vector at the 3'-end of the viral nucleic acid. The viral DNA is removed by digestion with Bal31 or S. aureus nuclease up to the start codon of the coat protein sequence (same start codon for the sequence for all structural proteins). The synthetic DNA sequence comprising the 3'-tail sequence is linked to the remaining 5'-terminus.

The deletion of the coding sequence for the coat protein is confirmed by isolating Sindbis RNA and using it to infect the cell culture of algae. The isolated sindbis RNA was found to be non-infectious under natural conditions.

Example 25

Preparation of Non-Communicative Western Hemp Encephalomyelitis Virus Nucleotide Sequences

Genetic engineering of Western hemp encephalomyelitis virus is described in Garr et al., Curr. Opin. Biotechnol. 9 (5): 464-9 (1998) and J. Virol. 71 (1): 613-23 (1997) by Weaver et al., Both of which are hereby incorporated by reference. A full-length cDNA copy of the Western hemp encephalomyelitis virus (WEEV) genome can be found in Proc. Natl. Acad. Sci. USA 85: 5997 (1988). The sequence for the viral coat protein and its contiguous El and E2 glycoprotein infectious factors is located in the corresponding region for the 26S RNA region. Vectors containing cDNA copies of the WEEV genome are digested with appropriate restriction enzymes and exonucleases, resulting in deletion of the coding sequence (structural protein coding sequence) of the coat protein and the El and E2 proteins.

For example, the structural protein coding sequence is removed by partial digestion with Naci and recombination so that an important portion of the structural protein sequence is removed. Optionally the vector is cut at the 3'-end of the structural protein DNA sequence. The viral DNA is removed by digestion with Bal31 or cocci S1 nuclease up to the start codon of the structural protein sequence. The 3'-tail DNA sequence of the virus is linked to the remaining 5'-end. Deletion of the coding sequence for the structural protein is confirmed by separating the WEEV RNA and using it to infect Vero cell culture. The isolated WEEV RNA was found to be non-infectious under natural conditions.

Optionally, the coding sequence for the coat protein is deleted and the sequences for the E1 and E2 glycoproteins are in a vector comprising a cDNA copy of the WEEV genome. In this case, the coat protein coding sequence is removed by partial digestion with HgiAI to reattach to the 3'-tail of the virus and recombination.

The second alternative method of removing only the coat protein sequence is to cut the vector at the 3'-end of the viral coat protein sequence. The viral DNA is removed by digestion with Bal31 or aureus S1 nuclease up to a significant portion of the coat protein sequence. The synthetic DNA sequence comprising the 3'-tail sequence is linked to the remaining 5'-terminus.

The deletion of the coding sequence for the coat protein is confirmed by separating the WEEV RNA and using it to infect Vero cell culture. It has been found that the isolated WEEV RNA is non-infectious, for example biologically included, under natural conditions.

Example 26

Preparation of Uninfected Monkey Virus 40 Nucleotide Sequence

Genetic engineering of monkey viruses is described by Piechaczek et al., Nucleic Acids Res. 27 (2): 426-428 (1999) and Chittenden et al. J. Virol. 65 (11): 5944-51 (1991), both of which are hereby incorporated by reference. A full length cDNA copy of the monkey virus 40 (SV40) genome was prepared and produced by Wychowski et al. J. Virol. 61: 3862 (1987) is inserted into the AccI site of plasmid pCW18. The nucleotide sequence of the viral coat protein (VP1) is located between positions 1488 and 2574 of the genome. Vectors containing DNA copies of the SV40 genome are digested with appropriate restriction enzymes and exonucleases to delete the coat protein coding sequence.

For example, the VP1 coat protein coding sequence is removed by partial digestion with BamHI nuclease and treated with EcoRI to fill the Klenow enzyme and round again. Deletion of the coding sequence for coat protein VP1 is confirmed by separating SV40 RNA and using it to infect monkey cell culture. The isolated SV40 RNA was found to be non-infectious, ie biologically contained under natural conditions.

Example 27

New Conditions for Preparing Infectious Viral Vectors Derived from In Vitro RNA Transcripts

This example describes a method for preparing highly infectious viral vector transcripts comprising 5 'nucleotides for viral vectors.

The library structure of subgenomic cDNA clones of TMV and BMV is described in Dawson et al. Proc. Natl. Acad. Sci USA 83: 1832-1836 (1986) and Ahlquist et al. Proc. Natl. Acad. Sci USA 81: 7066-7070 (1984). ). The nucleotide is added between the transcriptional initiation site of the promoter and the initiation site of the cDNA of the TMV in in vitro transcription in the case of T7, maximizing transcription product yield and not requiring capping the viral transcript to confirm infectivity. Do not. A suitable sequence is the T7 promoter ... TATAG ^ TATTTT ...., where ^ indicates that base progression is the transcription initiation site, and the bold letters are the first base of the TMV cDNA. Three approaches are available: 1) addition of G, GG or GGG between the transcription initiation site and the TMV cDNA (... TATAGGTATTT ... and linked sequences); 2) addition of G and any base (GN or N2) or G and two optional bases (GNN or N3) between the transcription initiation site and the TMV cDNA (... TATAGNTATTT ... and bound sequence); 3) Addition of GT and one optional base between transcription initiation site and TMV cDNA (... TATAGTNGTATTT ... and bound sequence). The use of any base is based on the hypothesis that a particular base is very suitable for additional nucleotides attached to the cDNA, because it is complementary to the usual non-template base attached at the 3'-end of the TMV (-) strand RNA. . This recovers if there is an initiation error in the wild type sequence. GTN mimics two possible sites for initiation added and native sequences and utilizes transcription initiation errors in vivo to repair native TMV cDNA sequences. This approach involves cloning the GFP expressing the TMV vector sequence into a vector comprising excess G, GG or GGG using standard molecular biology techniques. Likewise, the full length PCR of TMV expressing clone 1056 causes the addition of N2, N3 and GTN bases between the T7 promoter and TMV cDNA. As a result, the PCR product is cloned into a pUC-based vector. Encapsulated and uncapsulated transcripts are prepared in vitro and inoculated into wild type and 30k expressing transgenes of tobacco protoplasts or Nicotiana benthamiana plants. The results indicate that excess G, ... TATAGGTATTTT ...., or GTC, ... TATAGTCGTATTTT ... are found to be acceptable as additional 5 'nucleotides on the 5' of the TMV vector RNA transcript, and are not capped or encapsulated. It is infectious in protoplasts and plant shapes as transcripts. Different sequences can be screened to discover different options. Clearly, infectious transcripts can be derived from excess 5 'nucleotides.

Other derivatives based on the mechanical function of the estimation of the GTN strategy to obtain a GTC function vector use a number of GTN motifs that advance the 5'most nt of the viral cDNA, or a larger region at the 5'-end of the TMV genome. It is a duplicate. For example: TATA ^ GTNGTNGTATT ... or TATA ^ GTNGTNGTNGTNGTATT ... or TATA ^ GTATTTGTATTT ... In this way, replication mediated repair mechanisms are possible using multiple recognition sequences at the 5'-end of the transcription RNA. do. Replicated progeny show the result of reverse transcription that yields the wild type virus 5 ′ viral sequence, but include some or all of the additional base sequence introduced. The strategy can be applied in the range of RNA viruses or RNA viral vectors of various genetic arrangements derived from the wild type viral genome. It is required to use a specific sequence for the sequence of the virus used as a vector.

Example 28

Infectivity of uncapsulated transcripts

Two TMV-based viral expression vectors initially consisted of pBTI 1056 comprising the T7 promoter by viral cDNA sequence (... TATAGTATT ...) and pBTI SBS60- including the T7 promoter (underlined) by excess guanine residues. 29, and in the viral cDNA sequence (... TATAGGTATT ...). Both expression vectors express the Circle 3 shuffled green fluorescent protein (GFPc3) in the localized infection site and in the entire infected tissue of the infected plant. Transcription of each plasmid is performed in the absence of a cap analog (not capped) or in the presence of at least 8 times the concentration of an RNA cap similar to rGTP (cap). Transcription is mixed with the abrasive and inoculated onto Nb plants expressing the expanded old leaves of wild-type Nicotiana ventamiana (Nb) plants and the TMV UI 30k mobile protein transgene (Nb 30k). Four days after inoculation (dpi) long wavelength UV light is used to determine the number of infected sites on the leaves of the inoculated plants. Overall, uninfected tissues are monitored at 4 dpi for the appearance of structural infection indicating tube migration of the inoculated virus. Table 1 discloses data from one representative experiment.

structure Local infection Systemic infection Nb Nb 30k Nb Nb 30k pBTI1056 Cap 5 6 Capped Capped Not encapsulated 0 5 Not encapsulated Capped PBTI SBS60-29 Cap 6 6 Capped Capped Not encapsulated One 5 Capped Capped

Nicotiana tabacum protoplasts are infected with a capped or uncapsulated (not described above) transcript of pBTI SBS60 comprising a T7 promoter by viral cDNA sequence (TATAGTATT ...). The expression vector also expresses the GFPc3 gene in infected cells and tissues. Nicotiana tabacum protoplasts are transfected with 1 mcl of each transcript. Approximately 36 hours after infection, the transfected protoplasts can be seen showing cells showing GFPc3 expression under UV irradiation. Approximately 80% of cells transfected with capped PBTI SBS60 transcript show GFP expression, while 5% of cells transfected with uncapsulated transcript show GFP expression. The experiment is repeated with a large amount of uncapsulated inoculum. In this case, a high proportion of cells was found to infect> 30% with uncapsulated transcripts, and> 90% of cells infected with higher capped transcripts.

The results indicate that, for scientific literature and registered patents (US Pat. No. 5,466,788 to Ahlquist et al.), Uncapsulated transcripts for viral expression vectors were infected in both plants and plant cells, but with somewhat specific infectivity. Had Therefore, capping is not a prerequisite for infection of viral expression vectors in plants, and capping only increases the efficiency of infection. When this reduced efficiency is overcome to some extent, it provides an in vitro excess transcription product in an infection response to a plant or plant cell.

Expression of the 30k migrating protein of TMV in transgenic plants has the unexpected effect of equating the relative specific infectivity of the uncapsulated transcript versus the capped transcript. Mechanisms other than these effects are not fully understood, but show the RNA binding activity of the mobile protein which stabilizes infected intracellular gapped transcripts in pre-clone cellular degradation.

Excess guanine residues located between the first base of the viral cDNA and the T7 promoter increase the amount of RNA transcript as predicted by previous work with phage polymerase. The polymerases tend to be initiated more efficiently in ... TATAGG or ... TATAGGG than in ... TATAG. This has a direct effect on the relative infectivity of uncapsulated transcripts, where more amounts are synthesized per reaction to enhance infectivity.

Data on cap dependent transcripts of pBTI1056 GTN # 28

TMV-based viral expression vector pBTI 1056 GTN # 28 comprising a T7 promoter (underlined) by GTC base (in deep letters), and a viral cDNA sequence (... TATAGTCGTATT ...). The expression vector expresses Circle 3 shuffled green fluorescent protein (GFPc3) in localized infection sites and in the entire infected tissue of infected plants. The vector is transcribed in vitro with or without cap analogs (uncapsulated) or in the presence (capsulated). Transcription is mixed with the abrasive and inoculated on Nb plants expressing the expanded old leaves of wild-type Nicotiana ventamiana (Nb) plants and the TMV UI 30k mobile protein transgene (Nb 30k). Four days after inoculation (dpi) long wavelength UV light is used to determine the number of infected sites on the leaves of the inoculated plants. Overall, uninfected tissues are monitored at 4 dpi for the appearance of systemic infection indicating tube migration of the inoculated virus. Table 2 discloses data from two representative experiments at 11 dpi.

structure Local infection Systemic infection Nb Nb 30k Nb Nb 30k 30k Experiment 1pBTI1056 GTN # 28 Cap 18 25 Capped Capped Not encapsulated 2 4 Capped Capped Experiment 2pBTI1056 GTN # 28 Cap 8 12 Capped Capped Not encapsulated 3 7 Capped Capped

The data additionally support the claims relating to the use of uncapsulated transcripts to initiate infection with plant virus expression vectors, and the introduction of excess nonviral nucleotides at the 5′-end of the in vitro transcript is not capped. It has been demonstrated that it does not interfere with the infectivity of untranscribed transcript.

Example 29

Method of inhibiting endogenous proteolytic activity in plants in vivo

Induced awareness and response cascades in plants form an essential relationship between environmental stress and plant survival responses. Many products are caused by environmental stimuli or pathogen infection, including but not limited to proteases, protease inhibitors, alkaloids and other metabolites. Annu, Glazebrook et al. Rev. Gen. 31: 547-569 (1997); Grahm et al. J. Biol. Chem. 260: 6555-6560 (1985) and Ryan et al. rev. Cell Dev. Biol. 14: 1-17 (1998), all later incorporated by reference. The components of the recognition and reaction pathways are hardly understood, but have surprising real value for influx properties in genetically improved crops. Traditional methods of mutagenesis or biochemistry progress slowly and greatly improve our understanding. However, if the pathway is described, understood and developed, the faster the discovery method, the more experienced the problem. Viral expression vectors, which may inhibit the expression of certain endogenous host genes or may overexpress the gene product, provide a unique way to discover the properties of the gene of the product contributing to the reaction pathway.

This example describes a method of inhibiting endogenous plant proteases that interfere with the expression and purification of recombinant proteins in plants. In particular, this example discloses a method of inhibiting proteolytic activity in planta against degradation of viral vector-expressing recombinant proteins. The method also applies to the protection of recombinant proteins expressed through stable transformation systems or endogenous plant proteins. Viral vectors are prepared to include an N-terminal signal peptide sequence. The sequence relates to recombinant proteins via secondary pathways to the cell surface and accumulates in intercellular fluid (IF) in plants (Kermode, Critical Reviews in Plant Sciences 15 (4): 285-423 (1996), Ref. Is subsequently incorporated). In some cases, target proteins are abnormally degraded in vivo. Three examples include mammalian growth hormones, single chain antibodies and avian interferons. Retention time in IF in vivo leads to accumulation of degradation products, such as detection by immunoblotting. Degradation is either complete in vivo or continued in vitro for IF extraction (simultaneous application of U.S. Patent Application No. 09 / 037,751, hereafter incorporated by reference). It was found that at least 40-50% of the expressed protein was degraded in the quantification of Western blot using UVP gelbase / gelblot-pro software.

We have designed an in vitro experiment to inhibit plant proteolytic activity. If we add a protease inhibitor to the in vitro isolated IF fraction, we can further inhibit degradation of our recombinant protein. In addition, when we treat IF fractions in virus infected plants that are not related to proteolytic inhibitors and culture them with known infectious proteins, we inhibit proteases and protect proteins from degradation.

In order to observe degradation in vivo by plant proteases that are inhibited by protease inhibitors, we devise experiments to inhibit this activity in planta. Three possible ways of inhibiting proteases are:

1. Recombinant Expression of Protease Inhibitors

The activity of plant proteases can be inhibited by recombinant expression of plant protease inhibitors secreted into IF based on the following results:

(1) The present inventors clone the tomato protease inhibitor gene with our viral vector (J. Biol. Chem. 264: 17734-17738 (1989) by Wingate et al., Incorporated herein by reference). We demonstrated that expression of the recombinant inhibitor protein is in the IF fraction by Western detection. Virus-expressing protease inhibitors protect our recombinant (E. coli-induced) mammalian growth hormone protein strands that are known to be affected by plant proteases in in vitro assays;

(2) virus-expressing protease inhibitors inhibit IF-local proteases in vivo as detected on Zymogram gelatin tris-glycine gels; And

(3) Viral vector protease inhibitor constructs and viral vector mammalian growth hormone constructs are inoculated together to express partial protection of growth hormone in IF and whole leaf protein.

Another possible approach is to combine the transgenic plant and the virus-expressing protein. One is to inoculate a viral vector protease inhibitor construct in a transgenic plant expressing a target protein or to make a protease inhibitor transgenic plant and to inoculate with a viral vector construct expressing a target sequence.

2. Induction of Endogenous Protease Inhibitors

One also uses inducers to induce endogenous preparation of plant protease inhibitors. Jasmonic acid (JA), for example, is produced by general plant defense mechanisms and it is known to induce specific protease inhibitors (J. Mol. Gen. Genet. 241: 595-601 (1993) by Lightner et al. Incorporated by reference). Exogenous use of JA used to induce plant defense responses in Nicotiana attenuata to combat herbivore attacks (Baldwin, PNAS, 95 (14): 8113-8118 (1998), later for reference) Integrated). To protect against specific endogenous proteolysis of the recombinant protein, the plant material is treated with JA to induce the synthesis of proteolytic inhibitors and inoculated with viral vector constructs expressing the target sequence.

Desired phenotypes in host plants used in gene discovery programs using viral expression vectors reduce proteolytic activity in cell substrates, secretory pathways or apoplasts, thereby increasing the half-life of the virus produced protein. This is influenced by virally expressed proteins on biochemistry, growth and growth. Fast or mature degradation reduces the amount of protein expressed below the acceptable limits necessary for a measurable effect. Transgenic expression of protease inhibitors, such as those induced by structural pathways (Ann. Rev. Cell Dev. Biol. 14: 1-17 (1998) by Ryan et al.), Provides for specific degradation processes by continuously supplying inhibitors. Slow down Conversely, as outlined in the above examples, JA is treated with viral vector infected plants, induces response pathways and expresses various inhibitors in infected / treated plants. In both ways, by inducing specific protease inhibitor expression or reaction cascades, the half-life of many proteins, which is a requirement for detecting new functions of gene products, is increased.

Example 30

Selection of optimal RNA and protein activity by the use of viral vectors to express a library of sequence variants produced by in vitro mutagenesis and / or recombination

DNA manipulation is a repair mutagenesis method, and in vitro recombination involves performing any fractionation and recombination of the gene of interest to produce related but not identical gene sequences. U.S. by Stemmer et al. Patents 5,830,721 and 5,811,238, hereafter incorporated by reference. Fractionation is performed by treatment of DNA sequences with a finite amount of nuclease, and recombination usually requires two steps: first, a primer-free PCR that allows reattachment of fragments based on local homology, and primers that enter the PCR to full length. The combined section of is recovered. There are many advantages of this approach: (1) Gene or sequence function can be optimized or improved without first determining the position in the sequence requiring alteration; (2) Several generations of "enhanced" sequences can provide suitable choices, creating suitable frames that cannot be obtained by the natural environment; (3) All kinds of mutations are randomly distributed through the gene sequence and "saturated" to provide the gene of the sequence provided. Nature Biotech, Crameri et al. 14: 315 (1996); Nature Biotech, Crameri et al. 15: 436 (1997); Zhang et al., Proc. Natl. Acad. Sci. USA 94: 4504 (1997); Zhao and Arnold, Proc. Natl. Acad. Sci. USA 94: 7997 (1997).

DNA engineering has been successfully applied to prokaryotic or cellular systems to select sequences of desired protein activity. However, it has not been demonstrated that the engineered sequences can be introduced quickly and highly through organisms through methods essential to the full potential of the technique. In this example, the inventors describe the use of plant viral expression vectors to achieve a population of engineered DNA sequences, and, in the host host, sequences having desired properties are selected and further characterized. The properties identified by the engineered sequences selected were proved to be inherited by later viruses.

Two aspects that can be improved in viral expression vectors are as follows: (1) they can migrate locally and globally by easy methods in plants, and (2) require higher levels of foreign gene expression. Both functions can potentially be affected by transformation to 30 kDa ORF. Functions within the 30 kDa coding region include the mobile protein (MP), viral origin of the virion combination, and the subgenomic promoter used for coat protein synthesis. It is used for the expression of foreign gene sequences in most tobamovirus vectors. It has been demonstrated that natural variation in viral individuals can be a substrate for the selection of improved properties, and viral vectors lead to surprising improvements in their performance. This work additionally shows that single or multiple amino acid substitutions in the 30 kDa ORF provide an important effect on the mobility of the viral vector. Genomically, viral functions such as integrated whole RNA and protein sequences have been suggested that individual components, such as the 30 kDa ORF, or the entire plant viral genome should be engineered to enhance plant viral vector performance. The manipulations in this document can be selected for gene products with optimized activity using plant viral vectors against foreign genetic entities engineered by inoculation on plants. Plant viral vectors are a way to shuttle genes to plants to select optimized activity. Other methods, transient or stable expression methods, match the capabilities of plant viral vectors and develop genes optimized for plant activity.

Experiments capable of demonstrating the ability of plant viruses to house libraries of sequence variants focus on optimizing coding sequences for 30 kDa transfer proteins at TMV U1 for mobility in Nicotiana tabacum, and subgenomic promoter activity was used to coat protein mRNA preparation. Results in. The p30B GFP, a base expression vector, is used in a modified manner as desired for engineered vectors. TMV U1 infectious cDNA (bases 1-5756), wherein the p30B GFP vector comprises a 5'NTR, a transcriptase gene (126 and 183 kDa protein), a mobile protein gene coupled to a subgenomic promoter and an RNA leader derived from the U1 coat protein gene to be. The next RNA leader is the only PacI site and the green fluorescent protein (GFP) gene. The only XhoI locus following, a clone with a portion of TMV U1 3'NTR, followed by a 3'NTR in subgenomic promoter, coat protein gene and TMV U5 species.

The first phase of the project calls for constructing the vector to reintroduce the engineered DNA fragment. The polymerase chain reaction (PCR) is used to amplify DNA fragments in the TMV vector p30B consisting of a T7 promoter, a 5'-nontranslated region (NTR) and a reading frame for 126 and 183 kDa kinase proteins. The 5 ′ primer covers the initial base of the T7 promoter and TMV genome, and the second primer modifies the periphery codon for 30 kDa MP of TMV. This connects DNA fragments as AvrII to a modified vector called 30B GFP d30K to digest the fragments with PacI restriction endonuclease.

The modification inserts the modified 30kDa gene segment into a viral vector and expresses it in plant cells, tissues or plants. Wild type GFP ORF is a reporter gene, which is directly corrected to the level of GFP protein present in plant tissues as observed under long wavelength UV light. This is evidenced by the expression of other viral vectors expressing GFP, each with a different intensity of the subgenomic promoter, infected in plants, and the level of GFP by Western blotting and UV fluorescence using anti-GFP antibodies. Is measured.

Manipulation of 30kDa gene is described in Crameri et al. Nature Biotech. 15: 436 (1997), which includes the following steps. A 30kDa gene segment containing coat protein RNA leader is amplified in the tobamovirus expression vector using primers: TMVU1 30k5'A (5'-GGCCCTAGGATGGCTCTAGTTGTTAAAGG-3 '(SEQ ID NO: 49) and 3-5' Pac primer ( 5'-GTTCTTCTCCTTTGCTAGCCATTTAATTAATGAC-3 ') (SEQ ID NO: 50) The PCR DNA product is gel separated and incompletely digested with DNase I. DNA fragments of 500 bp or less are separated by using DEAE blotting paper technology and eluted. Purified DNA fragments are mixed with taq DNA polymerase and "recombined" for 40 cycles. "Recombination" reactions are appropriately analyzed by gel electrophoresis for DNA bands of 800-850 bp. Recombination "reaction is carried out PCR using primers TMV U1 30K 5'A and 3-5'Pac hybridized to the terminal DNA terminus of the recombinant fragment. The recombinant fragment is gel-separated and restriction enzymes AvrII and PacI (terminal) In primer Decomposes to place the material), it is cloned into the p30B d30k ANP digested with PacI and AvrII.

Ligation of genes engineered with p30B d30k ANP provides a library of sequences containing between 100 and 50,000 in five separate experiments. Viral vectors with a library of variant 30 kDa coding regions are transcribed with T7 RNA polymerase and inoculated with 0.5 × 10 ⁶ nicothia or tabacum protoplasts per sample by standard PEG transfection. Twenty-four hours after inoculation with the cells, as desired, various intensities of GFP fluorescence are shown in the individual cells, showing possible effects on subgenomic promoter activity and possible other levels of GFP accumulation. Cells are incubated for 48 hours of inoculation, harvested by centrifugation, digested using freeze / record, and ground with a mortar. The virions accumulated in the protoplasts are released by polishing.

And wild-type transgenic nicotiana tabacum c.v. expressing the protoplast extract expressing TMV U1 30kDa transfer protein. Inoculate the leaves of MD609. Locally infected sites are observed 3 to 5 days after inoculation and express GFP. GFP fluorescence of various intensities varies with what is observed with the wild type GFP gene as observed in the viral expression of the engineered GFP gene of Crameri et al. Nature Biotech. (1996) (GFPc3). The generation of viruses expressing various enhanced GFP fluorescence between libraries test 1/200 to 1/50 infectious foci depending on the library tested. Local infection sites with enhanced GFP fluorescence are cut from the leaves and inoculated to Nicotiana Ventamiana plants. The bright localally infected variants are purified from inoculated leaves of plants contaminated with virus that express less GFP protein. The virus expressing the brighter GFP protein was found to express higher amounts of GFP protein in the whole tissue than in the starting p30B GFP virus. Sequencing and gene studies did not accumulate mutations in the GFP gene, and the effect was that the subgenomic promoter regulates the mutation in TMV U1 30 kDa ORF. GFP accumulation in engineered variants with a brighter GFP phenotype is 3,4 times more than that produced by p30B GFP as measured by quantitative western blotting of plant extracts using anti-GFP sera. The data demonstrated that manipulation can be used to enhance cis-acting function of RNA sequences, and plant RNA virus expression vectors are an effective method for shuttle differentiation of sequence variants in whole plants and plant cells.

Protoplast extracts isolated by transfection with a viral library showed half of wild-type Nicotiana tabacum c.v. Inoculate MD609 and Nicotiana Ventamiana leaves. In the other half, the virus derived from p30B GFP is inoculated. Several loci resulting from infection of the virus, including engineered 30kDa ORFs, grow faster than average in p30B GFP. Depending on the virus library analyzed it appears at frequencies from 1/100 to 1/500 infected Foci. The more correctly grown infection foci were cleaved and fresh nicotiana tabacum c.v. MD609 plants are inoculated. As a control, p30B GFP group were inoculated with aged plants of similar size. The p30B GFP vector does not migrate entirely on tobacco plants. However, several engineered 30kDa ORF variant vectors, which prove to be rapidly growing local infection sites, can migrate throughout tobacco plants. It is first moved from the phloem source tissue and defined by circular points and ducts in the leaf flakes. The mobility is regenerated in multiple inoculations of individual viral variants. Sequence analysis of viruses comprising engineered 30kDa ORFs that are capable of global migration in Nicotiana tabacum plants has demonstrated that local amino acid substitutions exist and are due to altered migration phenotypes.

Recovery manipulation of the top 5-10% of the GFP expression vectors demonstrating improved ability to invade Tobacco's entire tissues can lead to synergistic bimutation, leading to expression or viral migration. Likewise, 30kDa ORFs, including most potential subgenomic promoters and most possible mobility in tobacco, can be engineered to have two properties with the same 30kDa ORF. Phenotypes that can be analyzed have, for example, substrate or product accumulation in the plantar protein activity, ie the migration activity of the 30 kDa protein, the enzymatic activity or other surrogate properties in the planta or plant extract. The data demonstrate the power of viral expression vectors, an effective way to shuttle sequence variants into plants, and select genes that encode desired modified properties. The method finds the hidden activity, enhances the isolated activity of the enzyme or eliminates allosteric inhibition of the enzyme activity. It may be added to certain plant genes or genes from other sources to optimize the activity of the desired agronomic, pharmaceutical or growth effect caused by the modified gene.

Example 31

Cloning of compositions that can be used for cloning of libraries in viral vectors and / or for introduction into host cells for expression of sequences

Viral vector clones can be integrated into lambda phage or cosmid clones for the use of amplification-based cell removal, cloning, and library constructs by direct transcription and recording of individual clones. Likewise, incorporation into cis-acting components or plant DNA expressed in plant cells can be included in the plasmid for use in DNA inoculation for direct expression, avoiding conditions of transcription of vector cDNA or constructs of dedicated plant transformation vectors. Can be.

Viral vectors are a housing library method of sequences that can be identified for new gene discovery. However, the library is first prepared in a plasmid or phage shuttle vector before cleavage and introduction into the viral vector. Likewise, sequences are identified in the host using viral vectors, but must be subcloned into a suitable eukaryotic expression vector before they have the same properties as the vector infected host that exhibit stable properties in the host by gene integration. Additional difficulties to overcome are: (1) the structure of the library to represent the clones most effectively in the cDNA library, (2) to obtain maximum infection efficiency with the bacterial host (if used), and (3) transfection with bacteria And collecting DNA samples that do not require transcription of linked DNA. Incorporation of viral vectors into cosmid clones or lambda phages themselves (two later referred to as phagemids) results in a bowl of primary generated library sequences, a source for linking transcription, high efficiency bacterial transfection and high eukaryotic hosts. It is a multipurpose vector to cause expression in. Using conventional cloning methods, 5 'of the viral vector inserted into one cancer of phagemid DNA is cloned into an asymmetric restriction enzyme containing a unique adhesion sequence (N's) (eg BstXI: CCANNNNNNTGG). The 3 'end of the vector will be inserted into another arm with an asymmetric restriction (e.g., BstXI: CCANNNNNNTGG) containing a unique second adhesion sequence (N). The vector is cleaved at a restriction site (eg BstXI) determined within the site for foreign sequence expression in the viral vector. The 5'-terminus of the viral cDNA can be appropriately fused as a promoter for in vitro transcription (eg T7) or in vivo expression (eg suitable higher eukaryotic RNA polymerase promoter). The 3′-end of the viral cDNA terminates with ribozyme for in vitro degradation and / or terminates with a 3′-terminator in a gene of the host organism leading to the termination of transcription in vivo. Next to the promoter and terminator sequences are left and right T-DNA boundaries that facilitate the integration of the sequences between the plant genomic DNA. It is a cos sequence that allows for complete regeneration of phagemids as soon as they are ligated in the presence of foreign library DNA containing two unique adhesion sequences at the ends of each cancer. The library DNA fragments are prepared by PCR amplification using the determined restriction sites (eg BstXI) and create unique adhesion ends that are complementary to the phagemid-vector female sites integrated in the PCR primers. The 5 'and 3' primers have a unique recognition sequence in the BstXI restriction site (N) that matches the adhesion site on each side of the viral vector. The site switches on a second set of PCR primers and amplifies the DNA to connect to the pyrimidide-virus vector cancer in the "sense" and "antisense" directions. The construct enhances the efficiency of in vitro ligation and uses the original linkage mix as a template for E. coli transformation, plant transformation, in vitro lambda packaging at 10 ⁹ pfu / mcg or In vitro transcription is allowed. In this way, the flexibility for the vector and its identification is maximized. In this way the inventors create a complex library and run the analysis simultaneously.

Example 32

Enhancement of Host Plant Performance with Viral Expression Systems Through Species Hybridization

The purpose of this example is to enhance host plants by the introduction of foreign genetic material through species hybridization. Host plant species are varied that can support the expression of sequences inserted into plant viral vectors. Several species can support high specific activity, for example Nicotiana or Ventiana, but with relatively low biomass. Other species, for example yen. Tabacum has high biomass and / or other desired properties for growth on a farm, but with relatively low particularly active expression sequences. In this embodiment, the desired properties of two or more species are combined by means of hybridization between species by standard methods. After doubling the fertilization with chromosomes, it is desirable for the primary hybrid to have the proper properties, or to reverse cross to select or screen for each generation for the desired properties. Infiltrate Tabacum's excellent biomass into N. Ventiana, perform N. Ventiana's excellent viral vector performance. Penetrate into Tabacum. The viral expressing green fluorescent protein (GFP) is one example useful for screening the level of total expression in candidate hybridized plants.

Many hybrids are possible, especially the Nicotiana genus. For example yen. Ventamiana and Yen. Tabacum, Yen. Ventamiana and Yen. Clebellandi and N. Ventamiana and Yen. Excelsior, Yen. Ventamiana and Yen. Africana, Yen. Clebellandi and Y. Africana, Yen. Umbratica and N. Africana, N. Unbratica and Yen. Autophora, n.vigelobii and n. Have a hybrid among excelsior. In addition, hybrids with two or more parents are possible. For example, the inventor has a yen. Ventamiana / Tabacum / African and N. Have Ventamiana / Klevellandi / Tabacum.

Example 33

Library of Heterologous Nucleic Acid Sequences in DHSPES Constructs Prepared in Restriction-Endonuclease-Free and Cell-Free Methods

The goal of this example is to avoid the possible problem of preparing a library of DHSPES constructs comprising heterologous sequences and using restriction enzymes for the passage of constructs generated through E. coli and for the production of inserted nucleic acids.

Typically, DNA fragments are prepared by restriction endonuclease treatment and linked to DHSPES vectors with complementary ends. However, as a population of complex DNA molecules, the one found in the cDNA library is used as the starting material, and the given restriction endonuclease is used to process the insert DNA to make appropriate ends for linking to the cloning vector and to recognize the enzyme. The sequence has a certain frequency in the individual and makes the molecule to withstand the entangled sequence after digestion.

The passage of certain plasmid-based virus clones through E. coli was observed to destabilize the plasmids in certain proportions.

The cause of this instability is not clear, but it may be related to insertion size, sequence, or toxicity resulting from expression of the gene in the hidden promoter sequence present in the DHSPES viral sequence.

To avoid the problems mentioned above, libraries of DHSPES constructs with cDNA molecules are prepared in a restriction endonuclease-free and E. coli-free manner. The system is included as a DHSPES structure of molecules with unconventional internal restriction sites. The method of "cell-free cloning" will result in a DHSPES-induced virus comprising genes that are not tolerated by E. coli in conventional cloning approaches.

Essentially, cell-free cloning is put into a combination of some viral sequences with DNA fragments in a form from which infectious viral RNA molecules can be obtained upon in vitro transcription. In one system, the viral sequence is two "cancer"; It is separated into left arm and right arm. The left cancer is encoded by the T7 RNA polymerase promoter, viral sequence coding transcriptase, gene-coding proteins and subgenomic promoters that can regulate the expression of the desired genes. The right cancer comprises a viral coat protein capable of controlling expression and a ribozyme sequence that produces a sequence of the viral genome encoding the sequence, a viral 3 ′ nontranslated region, the desired 3 ′ end on the transcribed molecule. A schematic for cell free cloning is shown in FIG. 28.

The left and right cancers are asymmetric (non-palindrical, self-incompatible), respectively, and the two cancers are derived from PCR products, cDNA reactions, and the like, and interposed together. The insertion has ends that are compatible with the left and right arms. The ends of the molecules allow the linkages to be combined in the proper form to the left and right arms to be inserted, to obtain infectious viral transcripts. The sequences contained in the inserts are in the right direction and, at the genomic location, are expressed from virus in plant cells.

In particular, the right arm has a biotin group that is synthesized by PCR and incorporated into a reversible (3 ') primer. The resulting biotinylated PCR product representing the right cancer is immobilized on streptavidin paramagnetic beads. Treatment of DNA with T4 DNA polymerase and one dNTP (in the presence of dGTP) provides 5 ′ eggplant to have the exonuclease activity of the polymerase. Insertion DNA, restriction fragments or cDNAs, which are PCR products, are treated with T4 DNA polymerase with one dNTP to make 5 'branches at its ends; 3 'interacts with 5' of the right arm. The 5 'end of the insert DNA has a interaction with the left arm 3' end, which is similarly produced.

Intracombinatorial ligation of the virus on paramagnetic beads is carried out continuously, the implant is ligated first to the fixed right arm and the bead complex is ligated to the left arm. After successive washings, in vitro transcription is performed to prepare infectious RNA transcripts.

In this cell-free method, a replication-competitive virus expressing the GFP gene is produced. Biotinylated right cancers are prepared using PCR. Immobilized on avidin coated paramagnetic beads, treated with T4 DNA polymerase and one nucleotide (dGTP) to make the appropriate 5 'branches, and the right cancer treated with T4 DNA polymerase and dCTP to make the interaction 5' branches Linked to the PCR product encoding the GFP gene. A DNA fragment consisting of the left arm of the virus is bound to the resulting DNA-bead complex to produce a full length viral clone that can be used as a template in in vitro transcription. After enzymatic manipulation of magnetic bead-bound DNA, the DNA-bead complex is washed by precipitation in the magnetic field and resuspension in appropriate buffer. In addition, after each operation, analysis was carried out in a certain amount to confirm whether a desired reaction occurred. Infectious RNA products of transcription are introduced into the protoplasts of the tobacco cell suspension culture. Fluorescence emitted by GFP encoded by viral clones 12-18 hours after protoplast infection was observed in most cells, confirming that RNA transcripts derived from DNA-bead complexes are infectious and consequently combined Virus-encoding DNA molecules are combined in the desired form and virally replicated and expressed in inserted foreign gene sequences.

Example 34

Use of microcrystalline sequences to increase the genetic stability of foreign genes in viral expression vectors

Insertion of a foreign gene sequence into a viral expression vector is an optional arrangement of sequences that interfere with normal viral function, resulting in genetic deletion of the foreign sequence. This is contrary to the use of expression vectors to express gene sequences stably in plants. The sequencing method greatly increased the likelihood of expression of the viral expression vector so as to confirm that it would "block" the functional viral sequence from the adverse effect of the insertion of foreign gene sequences. It also aids in the identification of "blocking" sequences that simultaneously enhance the stability of the mRNA encoding the foreign gene or the translation of the foreign gene product. The example below demonstrates how a library of any sequence is introduced into a foreign gene sequence comprising a viral vector. Upon analysis, the set of sequences to be introduced provides a foreign gene sequence predominant in genetic deletion to maintain stability in the viral vector as soon as a series of passages are performed. By using an undetermined sequence to enhance the stability of the foreign gene sequence, one skilled in the art can assume that the undetermined sequence is to be used by those skilled in the art to improve the translation of the foreign gene and the stability of encoding mRNAs.

There is little genetic stability of ubiquitin fusion (Ubiq hGH) to hGH in human growth hormone gene (hGH) or tobamovirus expression vector p30B, and stable virus production cannot be produced by continuous passage infection on plants, hGH Detect expression of recombinant protein. The locus is the PacI locus (underlined) in the viral vector below. This sequence is known as the leader sequence and is derived from the coding region of the native leader and native TMV U1 coat protein genes. In this leader, the normal coat protein ATG is modified with the Aga sequence (underlined in GTTTTAAATAgaTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATTAATTAAATG ... (hGH gene)). It is known that certain sets of leader sequences (TCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCA) increase genetic stability and gene expression when compared to viral constructs lacking leader sequences. The initiation site for subgenomic RNA synthesis was found in GTTTT ... Oligonucleotide RL-1 (GTTTTAAATAGATCTTACN (20) TTAATTAAGGCC) is used as a primer having homology with the NcoI / ApaI region of the TMV genome to amplify a portion of the TMV shift protein. The number of sequences is cloned into the ApaI and PacI sites of the p30B hGH vector. A vector containing an undetermined sequence that leads the hGH gene is transcribed and inoculated on Nicotiana Ventamiana plants. After 14 days of inoculation, the whole leaves are ground and the plant extracts are inoculated into the second set of plants. If viral symptoms appear in the second set of plants, Western blot analysis is used to detect whether hGH or Ubiq-hGH fusion is present in the series of inoculated leaves. Several variants comprising a new sequence in the untranslated leader sequence have been identified that combine with a virus having genetic stability and successful passage of hGH expression on plants inoculated with a series of passage viruses. Whereas the parental control, p30B hGH and p30B Ubiq-hGH are not. Viruses derived from the unidentified sequence library, p30B hGH virus # 2 and # 5, are genetically stable upon virion passage, and likewise, p30B Ubiq hGH shows Ubiq-hGH expression as soon as a series of virions pass. Again, this property is not observed in the starting viruses p30B hGH and p30B Ubiq hGH. The sequence around the rudder is determined and compared to that of the control viral vector.

* Show the same sequence in all viruses.

The determined primers of the N (20) region of the oligonucleotides introduced during PCR amplification and the ends of the initiation are shown.

Transcribed undetermined leader constructs are transmissible as viruses, but not parental 30B vectors that do not have a native leader. The properties of any reader show that each is unique and easily utilizes multiple solutions to solve RNA-based stability problems. Likewise, introducing any sequence can also increase the efficiency of translation.

To select an undetermined sequence that increases the translational efficiency of the foreign gene or increases the stability of the mRNA encoding the foreign gene derived from the viral expression vector, to find an undetermined sequence with the desired function of the selectable marker. Can be used. The amount of GFP protein is related to the fluorescence level seen under UV light at long wavelengths, and the amount of herbicide-tolerant gene product is related to the viability of the plant cell or plant upon treatment with the herbicide. Therefore, cells that can survive even higher amounts of individual viruses or herbicides expressing higher levels of fluorescence and the introduction of microcrystalline sequences around the GFP or herbicide resistance genes. In this way, cells comprising viruses with higher foreign gene activity are purified, sequenced and characterized through assays such as sequencing and Northern and Westen blotting, stability of mRNA and abundance of foreign genes of interest. Approach

Example 35

How to use structural promoters or fusion-regulated reporter genes as surrogate markers to identify genes put into a gene regulatory apparatus

In this embodiment, the present inventors provide a method for producing a transgenic host expressing a reporter gene under the control of various promoter forms; 2) A method of using a host capable of identifying a gene from a library expressed in a viral expression vector that can alter gene regulation will be disclosed.

The initial structure of the reporter gene expression cassette is GFP (fluorescence in live plants under long wavelength UV light), GUS (fluorescence and color analysis under detected tissue), herbicide tolerance gene (live or dead phenotype upon treatment with herbicide) or in the art. It will be necessary to identify suitable reporter genes, including other known gene products. Promoter sequences express RNA in structural or induced conditions. Examples of regulated promoters are examples of tomato or potato protease inhibitor type I genes (J. Biol. Chem. 260: 6555-6560 (1985) by Graham et al.). The promoter is regulated in the presence of a herbivore or jasmonic acid, which is lethal to plant tissue. Structural promoters can be readily identified by one of ordinary skill in the art having knowledge of related literature. Using appropriate reporter genes, a combination of inducible or structural promoters is integrated into two plant transformation vectors, transformed into Agrobacterium, and transformed into Nicothia or Ventiana leaves. For identification of appropriate gene constructs in regenerated tissue, primary transformants are self-pollinated to obtain the first stable line of analytical plants.

The cDNA library, full length for gene overexpression or gene segments for sense or antisense based gene inhibition are linked to viral expression vectors by conventional molecular biotechnology. The library can be inoculated by the method described in the patent application. Once inoculated, the host with the inducible promoter fused to the reporter gene remains uninduced and monitors for abnormal expression of the reporter gene in the tissue, including the replicating virus. If a host comprising a structural promoter fused to a reporter gene is used, the goal is to monitor the hyper or hipo-expression conditions of the reporter gene. In this way, genes with pathways that can induce or up-regulate the activity of specific promoters can be identified by surrogate markers of reporter gene expression. Conversely, genes that down-regulate or stop reporter gene expression have been identified as products that signal pathways that react or adversely affect promoter activity. Overexpression or suppression Positive or negative regulators can be used to isolate vectors containing sequences that affect reporter gene expression, and the foreign genes involved are sequenced and analyzed by bioinformatic methods.

Example 36

Methods of Inducing Expression of Selective Splicing Variants to Discover Biological Effects in Host Organisms and Using the Host Organisms as a Source of New cDNA Libraries, Selectively Enriched with Splice Variants of Gene

Transcription of nuclear genes in higher eukaryotic organisms is a primary RNA transcript that includes coding (exon) and non-coding (intron) information. The crucial step in RNA growth before release into the cytoplasm for translation is to concatenate the introns in the primary transcript and create a continuous exon for the coding of the desired product. Although conjugation occurs at defined sites in a particular gene, many genes can be conjugated to produce multiple protein products with discrete functions. Methods of conjugating introns to different sets and splicing differently the dexterity and arrangement of exons for the same primary transcript are known. This is a powerful method, and in terms of gene economy, can be done in higher organisms to encode multiple functions in one gene cistron. Selective splicing is regulated by small nuclear RNAs and bound proteins. This factor is due to the nature of the mature mRNA to be remanufactured in the selection and splicing method of conjugation sites used in primary RNA transcripts. Many selective splicing produces a rate or tissue specific RNA capable of translating a particular protein product with unique activity. Selective splicing of Drosophila transcription factors is well known for sex determination as the fetus grows. For reference, general selective splicing is described in Lopez, Ann, Rev. Genetics, 32 (1998).

Since selectively conjugated mRNAs encode proteins with different functions, it is interesting to investigate hosts that lack factors or hosts that no longer express these factors. It is difficult to accurately and effectively represent the diversity in standard cDNA libraries prepared in unaltered eukaryotic hosts. However, the use of viral expression vectors that overexpress or inhibit the expression of factors involved in the splicing method can increase the proportion of mRNA selectively conjugated in the host organism. Central gene libraries are prepared in plants for RNA splicing methods to sense and overexpress and sense or antisense the factors with potential and practical activity. The genotypes were the SF2 / ASF-type of the conjugate (PNAS 92: 7672-7676 (1995), such as Lopato, the RS-rich species of the conjugate (The Plant Cell 8: 2255-2264 (1996), Lapato et al.), And Other splicing species, as evidenced in the literature for lower or higher eukaryotes, such gene libraries will be subcloned into viral expression vectors, and the viral libraries will be inoculated individually or as pools on plants or plant cells. Individual or group of conjugated particles are overexpressed, or suppressed in plant cells, and a new form of splicing will emerge due to the role of the protein in the selective conjugation of many transcription factors, conjugates or other gene products. Expression vectors and high levels of expression that can achieve the ability to infect all cell types in a plant can increase the overall level of mRNA selectively expressed in the plant. Transfected plants will be used as a starting point for the isolation of poly A (+) RNA in the preparation of abundant cDNAs for selective spliced genes, with alterations in selective splicing typically occurring in non-transfected plants. Rather than splicing a few introns in the primary mRNA, the cDNA library abundantly above can be cloned into a viral expression vector, and the function of the new splicing form of the gene in plants infected with the vector library. Can be analyzed.

In this example, plietropic of factors having selective or common conjugation functions in a plant-derived viral library comprising new conjugated mRNAs derived from plants or derived from a primary viral library with the original splicer gene. ) You can discover the function.

Similar methods can induce new cDNA libraries by using viral vectors to express factors resulting from transcriptional regulation of genes in plants. In this embodiment, target cloning of electronic factors can be linked to viral expression vectors. Such families include homeodomains, Zn fingers, leucine zippers and other transcription factor families that appear in the prokaryotic or eukaryotic genome. Ann. Rev. Plant Phys and Plant Mol. Schwechheimer et al. Biol. 49 (1998). The gene library is subcloned into a viral expression vector and the virus library will be seeded individually or as a pool on the plant or plant cells. Once individual or group of transcription factors are overexpressed or exhibited suppressed expression in plant cells or plants, new gene expression patterns will be induced. This usually indicates a high percentage of cDNA present at low levels in gradually regulated plant tissues. However, having a high level of expression made by viral expression vectors and the ability to infect all cell types in plants induces tissue specific cDMA to levels much higher than normal and normal levels. Transfected plants will be used as a starting point for the isolation of poly A (+) RNA for cDNA structures that are enriched in selectively low or gradually expressed cDNAs. The cDNA is used to prepare an expression or gene suppression library rich in rare or abnormally expressed cDNA. The rich cDNA library can be cloned into viral expression vectors and the function of the new splicing form of the gene will be analyzed in plants transfected with the vector library.

Although the present invention has been described with reference to the preferred embodiments, it is understood that various modifications may be made without departing from the spirit of the invention. In addition, it is understood that the present invention applies to all (+) strand RNA viral vectors.

Claims (117)

(a) introducing a nucleic acid sequence into a host organism by a viral nucleic acid capable of expressing the nucleic acid sequence; And (b) observing a change resulting from expression of the nucleic acid sequence in the organism. The method of claim 1, (c) a method for determining the function of a nucleic acid sequence in an organism, comprising the additional step of recovering the expressed product of the nucleic acid sequence. The method of claim 2, And the expressed product is selected from the group consisting of peptides, proteins, polyproteins, enzymes, ribozymes, antibodies and antigens. A functional RNA, DNA or amino acid sequence molecule, which is recovered by the method according to claim 1. The method of claim 1, The observation step is a method for determining the function of the nucleic acid sequence in the organism, characterized in that consisting of complementarity analysis. The method of claim 1, Wherein said observing step comprises analyzing the biochemical changes in the accumulation of the substrate or product in the enzymatic reaction. The method of claim 1, And said observing step comprises measuring a phenotypic change in the host transfected with the nucleic acid. The method of claim 1, Wherein said observing step comprises no change in one or more biochemical pathways in the host transfected with the nucleic acid. The method of claim 6, Analyzing biochemical changes determines the function of nucleic acid sequences in living organisms, characterized by a method selected from the group consisting of MALDI-TOF, LC / MS, GC / MS, two-dimensional IEF / SDS-PAGE and ELISA. How to. The method of claim 1, And said observing step comprises observing the inhibition of endogenous gene expression in the cytoplasm of the cell resulting from the expression of the nucleic acid. The method of claim 1, And said observing step comprises comparing the RNA expression profile in the nucleus of the cell comprising the selected nucleic acid with the intracellular RNA expression profile not comprising the selected nucleotide sequence. The method of claim 1, And said observing step comprises comparing the RNA expression profile in the cytoplasm of the cell comprising the selected nucleic acid with the intracellular RNA expression profile not comprising the selected nucleotide sequence. The method of claim 1, And said observing step comprises comparing the RNA expression profile in the organelle of the cell comprising the selected nucleic acid with the intracellular RNA expression profile not comprising the selected nucleotide sequence. The method of claim 1, The observation step is to determine the function of the nucleic acid sequence in the organism, characterized in that the comparison of the protein expression profile in the cytoplasm of the cell containing the selected nucleic acid sequence and the protein containing the selected nucleotide sequence Way. The method of claim 1, Wherein said viral nucleic acid consists of a native plant virus subgenomic promoter, a plant virus coat protein coding sequence, and at least one non-native nucleic acid sequence. The method of claim 1, The viral nucleic acid consists of a native plant virus subgenomic promoter, at least one non-native plant virus subgenomic promoter and a plant virus coat protein coding sequence, wherein the native plant virus subgenomic promoter initiates transcription of the plant virus coat protein sequence. And wherein said non-native plant virus subgenomic promoter initiates transcription of the operably linked nucleic acid sequence in the host plant, wherein said recombinant plant virus nucleic acid is expressed locally or entirely in the host plant. How to determine the function of a sequence. The method of claim 1, The viral nucleic acid consists of a native plant virus subgenomic promoter, at least one non-native plant virus subgenomic promoter, and a plant virus coat protein coding sequence, wherein the native plant virus subgenomic promoter is operable for transcription of the nucleic acid sequence operably linked. Wherein the non-native plant virus subgenomic promoter initiates transcription of the plant virus coat protein sequence in the host plant, wherein the viral nucleic acid and the recombinant plant virus nucleic acid are expressed locally or entirely in the host plant. Method of determining the function of nucleic acid sequences in living organisms. The method of claim 1, Wherein said viral nucleic acid comprises a nucleic acid sequence of interest, said nucleic acid sequence of interest is transcribed into genomic DNA or RNA of a recombinant plant viral nucleic acid. The method of claim 1, The nucleic acid sequence is a method for determining the function of the nucleic acid sequence in the organism, characterized in that consisting of all or part of the cDNA library of the organism. The method of claim 19, The method of determining the function of the nucleic acid sequence in the organism, characterized in that the cDNA library is normalized or removed. The method of claim 1, The nucleic acid in the organism, wherein the viral nucleic acid is selected from the group consisting of fortivirus, tobamovirus, bromovirus, rice necrosis virus, geminivirus, rhinovirus, poliovirus, monkey virus, polyomavirus and adenovirus. How to determine the function of a sequence. The method of claim 1, Wherein said viral nucleic acid comprises nucleic acid fusion of a first nucleic acid sequence encoding a viral coat protein and a second nucleic acid sequence. The method of claim 1, The viral nucleic acid is a method for determining the function of the nucleic acid sequence in the organism, characterized in that present in the transgenic plant. The method of claim 1, Wherein said viral nucleic acid consists of the nucleic acid sequence of interest and at least a portion of the viral genome. The method of claim 21, Wherein said nucleic acid sequence is present in the viral genomic DNA or RNA of a viral nucleic acid. The method of claim 1, The host organism is a method for determining the function of the nucleic acid sequence in the organism, characterized in that the plant or plant cells. The method of claim 1, Wherein said host organism is selected from the group consisting of animals, animal cells, plants, plant cells, bacteria and fungi. The method of claim 1, Wherein said host organism is a cell or tissue derived from a tissue, organ or organism treated with a drug or chemical or infected with a disease-causing agent. A nucleic acid is an antisense or positive-sense to an endogenous gene, the method of silencing one or more endogenous genes in an organism, cell or tissue characterized by the step of introducing the nucleic acid into the organism by a viral nucleic acid suitable for expressing the nucleic acid. . The method of claim 29, Wherein said nucleic acid acts to silence a gene or multigene. 10. A method of silencing one or more endogenous genes in an organism, cell or tissue. The method of claim 29 or 30, A method of silencing one or more endogenous genes in an organism, cell or tissue, wherein the expression consists in recovering the primary or secondary metabolites affected by gene silencing. A functional RNA, DNA or amino acid-containing molecule, which is recovered in a method according to any one of claims 29 to 31. The method of claim 29, A method of silencing one or more endogenous genes in an organism, cell or tissue, wherein said host is selected from the group consisting of plants, animals, bacteria and yeasts. The method of claim 29, The host organism is a method of silencing one or more endogenous genes in an organism, cell or tissue, characterized in that the cells or tissues derived from a tissue, organ or organism treated with a drug or chemical or infected with a disease-causing agent. The method of claim 29, The viral nucleic acid is suitable for local or total expression of a non-native nucleic acid and consists of a native plant virus subgenomic promoter, at least one non-native plant virus subgenomic promoter and a plant virus coat protein coding sequence, wherein the native plant virus The subgenomic promoter initiates the transcription of the operably linked nucleic acid sequence, the non-native plant virus subgenomic promoter initiates the transcription of the plant virus coat protein sequence in the host plant, and the recombinant plant viral nucleic acid in the host plant. A method of silencing one or more endogenous genes in an organism, cell or tissue characterized in that they are expressed locally or in whole. The method of claim 29, The viral nucleic acid consists of a native plant virus subgenomic promoter, at least one non-native plant virus subgenomic promoter and a plant virus coat protein coding sequence, wherein the native plant virus subgenomic promoter initiates transcription of the plant virus coat protein sequence. Wherein said non-native plant virus subgenomic promoter initiates transcription of a nucleic acid sequence operably linked to a host plant, wherein said recombinant plant virus nucleic acid is expressed locally or in whole in a host plant. A method of silencing one or more endogenous genes in a tissue. The method of claim 29, The viral nucleic acid is selected from the group consisting of fortivirus, tobamovirus, bromovirus, rice necrosis virus, geminivirus, rhinovirus, poliovirus, monkey virus, polyomavirus and adenovirus. Or silencing one or more endogenous genes in a tissue. (a) cloning one or more expressed sequence tag cDNAs with a viral nucleic acid suitable for expression of one or more expressed sequence tag cDNAs in a living organism; (b) infecting the organism with the viral nucleic acid consisting of the expressed sequence tag cDNAs; And (c) observing a change resulting from expression of the nucleic acid sequence in the organism. The method of claim 38, (d) a method for determining the function of a nucleic acid sequence in an organism, comprising the additional step of recovering the expressed product of the nucleic acid sequence. A functional DNA, RNA or amino acid molecule, which is recovered by the method according to claim 38 or 39. The method of claim 38, The observation step is a method for determining the function of the nucleic acid sequence in the organism, characterized in that consisting of complementarity analysis. The method of claim 38, Wherein said observing step comprises analyzing the biochemical changes in the accumulation of substrate or product in the enzymatic reaction. The method of claim 38, And said observing step comprises measuring a phenotypic change in the host transfected with the nucleic acid. The method of claim 38, Wherein said observing step comprises no change in one or more biochemical pathways in the host transfected with the nucleic acid. The method of claim 42, Analyzing biochemical changes determines the function of nucleic acid sequences in living organisms, characterized by a method selected from the group consisting of MALDI-TOF, LC / MS, GC / MS, two-dimensional IEF / SDS-PAGE and ELISA. How to. The method of claim 38, And said observing step comprises observing the inhibition of endogenous gene expression in the cytoplasm of the cell resulting from the expression of the nucleic acid. The method of claim 38, And said observing step comprises comparing the RNA expression profile in the nucleus of the cell comprising the selected nucleic acid with the intracellular RNA expression profile not comprising the selected nucleotide sequence. The method of claim 38, And said observing step comprises comparing the RNA expression profile in the organelle of the cell comprising the selected nucleic acid with the intracellular RNA expression profile not comprising the selected nucleotide sequence. The method of claim 38, The observation step is to determine the function of the nucleic acid sequence in the organism, characterized in that the comparison of the protein expression profile in the cytoplasm of the cell containing the selected nucleic acid sequence and the protein containing the selected nucleotide sequence Way. The method of claim 38, The observation step is to determine the function of the nucleic acid sequence in the organism, characterized in that the comparison of the RNA expression profile in the cytoplasm of the cell containing the selected nucleic acid sequence and the cell containing no selected nucleic acid sequence Way. (a) alter the genome of a host organism; (b) introducing the nucleic acid sequence of interest; And (c) observing a change resulting from expression of the nucleic acid sequence in the organism. The method of claim 51, wherein (d) a method for determining the function of a nucleic acid sequence in an organism, comprising the additional step of recovering the expressed product of the nucleic acid sequence. 53. A functional DNA, RNA or amino acid sequence, which is recovered by the method according to claims 51 or 52. The method of claim 51, wherein Mutagenesis of the host organism's genome is performed by introducing one or more transition factor DNA sequences into the organism. The method of claim 51, wherein The observation step is a method for determining the function of the nucleic acid sequence in the organism, characterized in that consisting of complementarity analysis. (a) introducing a nucleic acid into the transgenic plant; And (b) observing the change resulting from the expression of the nucleic acid sequence in the transgenic plant. The method of claim 56, wherein (c) a method of confirming the function of the nucleic acid sequence in the transgenic plant, characterized in that it comprises an additional step of recovering the expressed product of the nucleic acid sequence. 58. A functional DNA, RNA or amino acid sequence molecule, which is recovered by the method according to claims 56 or 57. The method of claim 56, wherein The transgenic plant is a method of confirming the function of the nucleic acid sequence in the transgenic plant, characterized in that consisting of at least one non-native transfer factor DNA sequence. (a) growing a plant under a first acceptable condition; (b) exposing the plant of step (a) to constraints for a period of at least about one cycle of growth cycle; (c) transferring the plant of step (b) to a second acceptable condition for a period of at least about one cycle of growth cycle; And (d) selecting a plant with a lethal mutation and identifying a plant carrying a lethal mutation that is sensitive to the constraints and essential for the survival of the organism. How to identify gene function in plants. The method of claim 60, after step (d), (e) an additional step complementary to the transgenic plant carrying recessive or dominant conditional lethal mutations by transfection with a viral vector comprising a functional copy of the mutated gene A method for confirming gene function in a transgenic plant carrying a conditional lethal mutation in a gene. The method of claim 60, After step (e), (f) a further step of correcting the mutation or isolating complementary viral vector genes, characterized in that the method of confirming the gene function in the transgenic plant carrying a conditional lethal mutation in the gene. . 63. The method of claim 62, After the step of isolating the gene, the method comprises the steps of: (i) identifying the function of the gene, (ii) identifying the product expressed by the gene, and (iii) sequencing the gene. A method for identifying gene function in a transgenic plant carrying a conditional lethal mutation in the gene. The method of claim 60, Wherein said first acceptable condition comprises a complete growth medium for plant tissues, plant cells or plant organs. The method of claim 60, Wherein said first acceptable condition comprises a growth medium with low osmotic power. A method for identifying gene function in a transgenic plant carrying a conditional lethal mutation in a gene. The method of claim 60, Wherein said first acceptable condition comprises a temperature of less than about 5-15 ° C. at an appropriate growth temperature for the wild type. The method of claim 60, The restriction condition identifies a gene function in a transgenic plant that carries a conditional lethal mutation in the gene, characterized in that it comprises a temperature between at least about 15 ° C. and at an appropriate growth temperature for the organism and an appropriate growth temperature for the organism. How to. The method of claim 60, Wherein said second acceptance condition is substantially the same as said first acceptance condition. 16. A method of identifying a gene function in a transgenic plant carrying a conditional lethal mutation in a gene. The method of claim 60, Method of confirming the gene function in the transgenic plant carrying a conditional lethal mutation in the gene, characterized in that the plant cell in the growth step (a) is a replica of the plant cell treated on the plant leaf disk. The method of claim 60, And wherein said time period in step (c) is identical to a growth cycle of at least one cycle. The method of claim 60, In the step (a) the plant is a method for identifying the gene function in the transgenic plant carrying a conditional lethal mutation in the gene, characterized in that selected from the group consisting of monocotyledonous plants and dicotyledonous plants. The method of claim 60, Wherein said plant in step (a) is mutated by insertional mutagenesis into a T-DNA or transgenic nucleic acid sequence. The method of claim 72, Wherein said plant is mutated with a mutagenesis agent selected from the group consisting of nucleic acid alkylating agents, inserts, ionizing radiation, heat and sound. . The method of claim 73, wherein The alkylating agent and intercalating agent are methanesulfonate, methyl methanesulfonate, methylnitrosoguanidine, 4-nitroquinoline-1-oxide, 2-aminopurine, 5-bromouracil, ICR 191 and other actinic derivatives, etis A method for confirming gene function in a transgenic plant carrying a conditional lethal mutation in a gene, characterized in that it is selected from the group consisting of dium bromide, nitrous acid and N-methyl-N'-nitroso-N-nitroguanidine. (a) growing a plant under a first acceptable condition; (b) exposing the plants of step (a) to constraints for at least the same period as the one cycle growth cycle; (c) transferring the plant of step (b) to a second acceptable condition for at least the same period of one cycle of growth; (d) selecting plants with genes that cause conditional lethal mutations; And (e) identifying the gene product corresponding to the conditional lethal mutation, and identifying the target gene product of the pesticide or herbicide compound, wherein the target gene product of the antibacterial agent, herbicide, pesticide or fungicide compound is identified. How to. 76. The method of claim 75 wherein Wherein said restriction comprises changing temperature, wherein the conditional lethal mutation is a temperature-sensitive lethal mutation. 16. A method of identifying a target gene product of an antibacterial agent, herbicide, pesticide or fungicide compound. 76. The method of claim 75 wherein The method identifies a target gene product of an antimicrobial agent, herbicide, pesticide or fungicide compound, comprising at least 50 plants in steps (a)-(c). Inserting at least one nucleotide between the cDNA initiation site of the viral nucleic acid and the transcription start site of the promoter sequence of the viral nucleic acid. The method of claim 78, A method for preparing an infectious viral vector, characterized in that one nucleotide is inserted. The method of claim 78, A method for preparing an infectious viral vector, characterized in that two nucleotides are inserted. The method of claim 78, A method for preparing an infectious viral vector, wherein three nucleotides are inserted. 80. The method of claim 79 wherein The method of producing an infectious viral vector, characterized in that the inserted one nucleotide is G. 82. The method of claim 80 or 81, Wherein said inserted nucleotide comprises a G at the 5′-end. The method of claim 78, Wherein said inserted nucleotide is GNN, GTN, or a plurality thereof. The method of claim 78, The viral nucleic acid is selected from the group consisting of fortivirus, tobamovirus, bromovirus, rice necrosis virus, rhinovirus and poliovirus. A functional RNA, DNA or amino acid containing molecule, which is recovered by the method according to claim 78. Transcribing the viral nucleic acid in the absence of a cap analog. Transcribing the viral nucleic acid in the presence of a cap analog. 88. The method of claim 87, And said viral nucleic acid comprises a sequence encoding a mobile protein. 88. The method of claim 87, Wherein said viral nucleic acid further comprises at least one nucleotide between the cDNA initiation site of the viral nucleic acid and the transcription initiation site of the promoter sequence of the viral nucleic acid. 88. The method of claim 87, The viral nucleic acid is selected from the group consisting of fortivirus, tobamovirus, bromovirus, rice necrosis virus, rhinovirus and poliovirus. 89. A functional RNA, DNA or amino acid containing molecule, which is recovered by the method according to claim 87 or 88. A method of inhibiting an endogenous protease of a plant host, comprising treating the plant host with a compound that induces the preparation of an endogenous inhibitor of the protease. 94. The method of claim 93, And said compound is jasmonic acid. 94. The method of claim 93, Treatment of a plant host with a compound increases the exogenous nucleic acid or its protein product. 94. The method of claim 93, The viral host is selected from the group consisting of fortivirus, tobamovirus, bromovirus, rice necrosis virus, gemini virus, rhinovirus, poliovirus, monkey virus, polyomavirus and adenovirus. A method of inhibiting endogenous proteases. A functional RNA, DNA or amino acid containing molecule, which is recovered by the method according to claim 93. A method for enhancing the expression of foreign sequences in a plant host, characterized in that it comprises a hybridization step between species. (a) preparing a viral expression vector consisting of a library comprising variants of nucleic acid sequences; (b) introducing a viral nucleic acid library into the plant host by expressing variants of the nucleic acid sequence; And (c) observing the change resulting from expression of the variant of the nucleic acid sequence. The method of claim 99, wherein (d) an additional step of sequencing one or more variants of the nucleic acid sequence. The method of claim 99, wherein And said library comprises any variant of a nucleic acid sequence. The method of claim 99, wherein Wherein said library comprises known variants of the nucleic acid sequence. The method of claim 99, wherein Wherein said library is prepared by manipulating nucleic acid. The method of claim 99, wherein Wherein said nucleic acid is non-native for viral expression vectors. The method of claim 99, wherein Wherein said nucleic acid is native to a viral expression vector. The method of claim 99, wherein A method of utilizing the function of a nucleic acid sequence in a plant host, characterized in that the mobility of the nucleic acid sequence is utilized. The method of claim 99, wherein A method of utilizing the function of a nucleic acid sequence in a plant host, characterized in that a promoter of the nucleic acid sequence is utilized. The method of claim 99, wherein A method of utilizing the function of a nucleic acid sequence in a plant host, characterized in that a host range of nucleic acid sequences is utilized. The method of claim 99, wherein A method of utilizing the function of a nucleic acid sequence in a plant host, characterized in that the signal function of the nucleic acid sequence is utilized. The method of claim 99, wherein A method of utilizing the function of a nucleic acid sequence in a plant host, wherein the replication stability of the nucleic acid sequence is utilized. The method of claim 99, wherein A method of utilizing the function of a nucleic acid sequence in a plant host, characterized in that the efficiency of translation of the nucleic acid sequence is optimized. The method of claim 99, wherein Wherein said library is prepared by a cell-free method. The method of claim 99, wherein The viral expression vector is a plant host, characterized in that selected from the group consisting of fortivirus, tobamovirus, bromovirus, rice necrosis virus, geminivirus, rhinovirus, poliovirus, monkey virus, polyomavirus and adenovirus. A method of utilizing the function of a nucleic acid sequence within. A functional RNA, DNA or amino acid containing molecule, which is recovered by the method according to claim 99 or 100. A method of increasing a nucleic acid sequence in a viral expression library, comprising propagating the library in the absence of E. coli. At least one reporter gene is fused to at least one constituent or derived promoter in a viral expression vector. (a) preparing a viral expression vector comprising a non-native nucleic acid sequence; (b) infecting a plant host with said viral expression vector; (c) measuring transcription or treating one or more RNA molecules in a plant host; And (d) synthesizing a cDNA library from one or more RNA molecules.