KR20010012313A - Techniques and compositions for treating heart failure and ventricular remodeling by in vivo delivery of angiogenic transgenes - Google Patents

Abstract

Methods are provided for the treatment of patients with congestive heart disease (including congestive heart disease associated with expanded cardiomyopathy and severe coronary artery disease) and for preventing or alleviating harmful ventricular remodeling after myocardial infarction. Preferred methods of the present invention include in vivo delivery of genes encoding angiogenic proteins or peptides to the myocardium by direct injection into the heart of a vector containing the gene.

Description

TECHNIQUES AND COMPOSITIONS FOR TREATING HEART FAILURE AND VENTRICULAR REMODELING BY IN VIVO DELIVERY OF ANGIOGENIC TRANSGENES}

Three to four million adults in the United States have congestive heart disease (abbreviated as "CHF") and the incidence of CHF is reported to increase (Baughman, K., Cardiology Clinics 13: 27-34). , 1995). Each year, CHF is the most frequent non-selective cause of hospitalization in US hospitals, and 500,000 patients are diagnosed with discharge. Once the symptoms of heart disease become more severe, the prognosis is worse than most cancers, with 50% of those patients dying within two years (Braunwald, E. (ed), In: Heart Disease, WB Saunders, Philadelphia, page 471-485, 1988). Medical therapies can initially weaken symptoms of heart disease (such as edema, motor intolerance and shortness of breath), and in some cases, may prolong life. However, the prognosis for these diseases remains fearful even if medical treatment is advanced (Baughman, K., Cardiology Clinics 13: 27-34, 1995).

CHF is defined as an abnormal heart function that encounters metabolic needs by causing inadequate cardiac outflow (Braunwald, E. (ed), In: Heart Disease, W.B. Saunders, Philadelphia, page 426, 1988). Such symptoms include shortness of breath, fatigue, weakness, swelling of the legs and hypersensitivity to exercise. In physical experiments, patients with heart disease tend to have increased heart rate and respiratory rate, showing lar (indicative of fluid in the lungs), edema, jugular swelling, and generally cardiac hypertrophy. The most common cause of CHF is atherosclerosis, which causes blockage of the coronary arteries that supply the heart muscle. Ultimately, such blockade can lead to myocardial infarction (death of heart muscle) and subsequent loss of heart function and consequently cardiac arrest. Other causes of CHF include heart valve heart disease, high blood pressure, viral infections of the heart, alcohol and diabetes. In some cases, heart disease occurs without pronounced etiology, in which case it is called idiopathic.

Current treatments for CHF include pharmacological therapies, coronary angioplasty processes (such as coronary artery bypass surgery and angioplasty), and heart transplantation. Pharmacological treatments increase the contractile force of the heart (by using myelastic contractile agents such as digitalis and β-adrenergic receptor agonists) to reduce fluid accumulation in the lungs and elsewhere (by using diuretics), To reduce the work of the heart (by using agents that reduce systemic vascular resistance, such as angiotensive converting enzyme inhibitors). β-adrenergic receptor antagonists were also tested. Such pharmacological agents can improve symptoms and potentially prolong life, while in most cases the prognosis remains scary.

Some patients with heart disease from related coronary artery disease may benefit, at least temporarily, by angioplasty processes such as coronary artery bypass surgery and angiogenesis. Such processes are temporarily beneficial when the heart muscle is not dying but exhibits dysfunction due to inadequate blood circulation. If normal coronary blood circulation is restored, myocardium causing viable dysfunction will contract more normally and heart function will improve. However, due to inadequate microvascular beds, in patients suffering from CHF due to angioplasty, the cardiac function rarely returns to normal or near normal levels, although sometimes some improvement is noted.

Cardiac transplantation may be a suitable choice for relatively young patients without other serious illnesses, but this is a very expensive option, with only a small number of patients with cardiac disease. In summary, CHF has a very poor prognosis and is hardly compatible with current therapies.

Further complicating the physiological conditions associated with CHF are various natural adaptations that tend to occur in patients with cardiac dysfunction. Although these natural reactions initially improve cardiac function, they ultimately lead to problems that can worsen CHF, confuse treatment, and cause side effects in survival. There are three such adaptive reactions commonly observed in CHF: (i) volume retention induced by changes in sodium resorption, which expands plasma volume and initially improves cardiac outflow; (ii) swelling of the heart (from dilatation and hypertrophy), which can increase stroke volume while maintaining relatively normal wall tension; And (iii) increased tendency to increase heart rate and contractility by interacting with the heart's β-adrenergic receptors, thereby increasing the outflow of the heart, thereby increasing the adrenergic nerve endings impinging on the heart. Norepinephrine release. However, each of these three natural adaptations ultimately tends to fail for various responses. In particular, fluid retention tends to result in fluid retention in the lung that damages edema and respiration. Enlargement of the heart can lead to detrimental left ventricular remodeling with subsequent severe dilation and increased wall tension, thus exacerbating CHF. Finally, prolonged exposure of the heart to norepinephrine tends to make the heart unresponsive to adrenergic stimuli and is associated with poor prognosis.

Angiogenesis is generally referred to the development and differentiation of blood vessels. Many proteins, typically referred to as "angiogenic proteins", are known to promote angiogenesis. Such angiogenic proteins include fibroblast growth factor (FGF) family, vascular endothelial growth factor (VEGF) family, platelet-induced growth factor (PDGF) family, insulin-type growth factor (IGF) family, and others (hereinafter And as described in more detail in the art). For example, members of the FGF and VEGF families have been recognized as regulators of angiogenesis during growth and development. The role of promoting angiogenesis in their mature animals has recently been investigated (discussed below). Angiogenic activity of the FGF and VEGF families is reasonably well established at the time of setting up protein infusion. For example, acidic FGF ("aFGF") proteins in collagen-coated matrices have been shown to result in well-vascularized and normally perfused structures when placed in the abdominal cavity of mature mice (Thompson, et al., PNAS, 86: 7928-7932, 1989). Infusion of basic FGF ("bFGF") protein into the coronary arteries of mature dogs during coronary artery occlusion has reportedly resulted in decreased myocardial dysfunction, smaller myocardial infarction, and increased vascular quality in risky beds. (Yanagisawa-Miwa, et al., Science, 257: 1401-1403, 1992). Similar results have been reported in animal models of myocardial ischemia using bFGF protein (Harada, et al., J. Clin. Invest., 94: 623-630, 1994; Unger, et al., Am. J. Physiol., 266: H1588-H1595, 1994). Parallel increases in blood circulation were seen in dogs treated with VEGF protein (Banai, et al., Circulation 89: 2183-2189, 1994). Difficulties associated with the potential use of such protein infusion to promote angiogenesis of the heart include the proper form and concentration and the form in which the protein is required for the uptake and promotion of angiogenic effects in cardiomyocytes. And ensuring concentration is maintained. Another difficulty is that repeated infusion of proteins is required.

In vivo gene transfer into the myocardium using plasmids, retroviruses, adenoviruses and other vectors has been published (see Barr, et al., Supplement II, Circulation, 84 (4): Abstract 1673, 1991). : Barr, et al., Gene Therapy, 1: 51-58, 1994; French et al., Circulation, 90 (5): 2414-2424 (1994); French et al., Circulation, 90: 1517 Abstract No. 2785 (1994); Giordano et al., Clin.Res., 42: 123A (1994); Giordano et al., J. Investigative Med., Supplement 2, 43: 287A (1995); Guzman et al., Circulation Research 73 (6): 1202-1207 (1993); Kass-Eisler et al., PNAS (USA) 90: 11498-11502 (1993); Muhlhauser et al., Human Gene Therapy, 6: 1457-1465 (1995) Muhlhauser et al., Circulation Research, 77 (6): 1077-1086 (1995); French et al., Circulation, 90 (5): 2402-2413 (1994); Rowland et al., Am. Thorao.Surg , 60 (3): 721-728 (1995)). In general, these reported methods have one or more of the following defects: inadequate transduction efficiency and transgene expression; Significant immune response to the vector used, including inflammation and tissue necrosis; And importantly, the relative inability to target transduction and transgene expression to the heart (ie, gene transfer also causes the transgene to be delivered to non-heart sites such as the liver, kidneys, lungs, brain and testes of the test animal). Results). After direct injection into the myocardium through a needle inserted into the myocardium wall, it was demonstrated that there was an inflammatory infiltrate in the heart (French et al., Circulation, 90 (5): 2414-2424 (1994)).

One method of treating certain forms of congestive heart disease associated with β-adrenergic signaling has been demonstrated by Hammond et al. (Hammond et al., US patent application Ser. No. 08 / 708,661, Sep. 5, 1996). Filed). The method involves the genes encoding elements of the β-adrenergic signaling pathway delivered to the heart of a patient suffering from a heart disease associated with a decrease in β-adrenergic signaling. Methods for treating various forms of heart disease such as myocardial ischemia and peripheral vascular disease have been published by Hammond et al. In PCT publication WO96 / 26472 (published September 6, 1996).

One form of congestive heart disease is associated with coronary artery disease (“CAD”) and is severe in category or sudden in that it results in the development of chronic or acute heart disease. In such patients, extensive and / or sudden blockage of one or more coronary arteries prevents adequate blood from flowing into the myocardium, resulting in severe ischemia and sometimes myocardial infarction or even death of the heart muscle. The resulting myocardial necrosis tends to involve progressive chronic heart disease or acute low leakage conditions, both of which are associated with high mortality.

Some forms of congestive heart disease have been particularly problematic because the cause of the disease remains unknown or untreated. One such example is "dilated cardiomyopathy" (or referred to hereinafter as DCM). DCM is typically a heart disease diagnosed by the formation of other characteristic heart diseases, such as coronary artery occlusion, or the discovery of left and / or right ventricle with an extended and low contractile force in the absence of a history of myocardial infarction. Patients with DCM may experience angina even if they do not have severe coronary artery disease. In some of these cases, the cause of DCM is known or estimated. For example, cardiomyopathy in the family (eg, cardiomyopathy, such as those associated with progressive muscular dystrophy, muscular dystrophy, Friedreich's ataxia, and hereditary dilatation myocardial disease), infections that cause myocardial inflammation (such as by various viruses, bacteria, and other parasites) ), Non-infectious inflammation (such as autoimmune diseases, peripartum cardiomyopathy, inflammation due to hypersensitivity reactions or transplant rejection), metabolic disorders causing myocarditis (including nutritional, endocrine and electrolyte abnormalities), and myocarditis Exposure to eliciting toxic agents (such as alcohols, as well as certain chemotherapeutic drugs and catecholamines). In most cases, however, in approximately 80% of cases, the cause of DCM remains unknown, and therefore the disease is referred to as "idiopathic dilated cardiomyopathy". The development of DCM raises several important therapeutic interests, including progressive myocardial injury, hemodynamic inability associated with an enlarged heart, precursors to systemic embolism, and the risk of ventricular arrhythmias. Conventional angiografts are not arbitrary for the treatment of dilated cardiomyopathy because obstructive coronary artery disease is not a primary problem. Even for patients where the cause of DCM is known or presumed, the damage is typically not easily reversed. For example, in the case of adriamycin-induced cardiotoxicity, cardiomyopathy is generally irreversible, resulting in death of more than 60% of the suffering patients. For most patients with DCM, the cause of the disease itself is unknown. As a result, no treatment is generally applied for DCM. Doctors routinely alleviate the symptoms present in patients with DCM (e.g., dilute the fluid retention with diuretics, and / or reduce the need for oxygen and nutrients in the heart muscle using angiotensin converting enzyme inhibitors. By). As a result, approximately 50% of patients with DCM die from sudden cardiac arrest associated with ventricular arrhythmias, sometimes within two years after diagnosis.

"Ventricular remodeling" sometimes occurs after myocardial infarction, resulting in poor ventricular function. After myocardial infarction has healed, the heart tends to expand and remodel. Such expansion or remodeling sometimes causes further impairment of ventricular function. Poor left ventricular function is the single precursor of concomitant outflow following myocardial infarction. Therefore, it would be beneficial to prevent remodeling of the ventricles after myocardial infarction. One approach to preventing ventricular remodeling is to treat patients suffering from myocardial infarction with angiotensin converting enzyme (“ACE”) inhibitors (McDonald, KM, Trans. Assoc. Am. Physicians 103: 229-235, 1990; Cohn , J. Clin. Cardiol. 18 (Suppl. IV) IV-4-IV-12, 1995). However, these agents are rather effective only in preventing harmful ventricular remodeling and therefore new treatments are required.

The present invention relates to methods and compositions for treating cardiovascular disease. More specifically, the present invention relates to techniques and polynucleotide constructs for treating heart disease and ventricular remodeling by in vivo delivery of angiogenic transgenes.

1 is a graph of the percent wall thickness during pacing in a swine model of congestive heart disease. Percent wall thickness was sequentially assessed in the interventricular septum and sidewall at intervals of 7 days prior to cardiac pacing (day 0) and as heart disease progressed (described in Example 1). Symbol represents an average value; Error bars indicate 1 SD. Two-way ANOVA (repeated measurement) indicates that% wall thickness was affected by the period of pacemaker (P <0.001) and area (P = .001). Furthermore, the pattern of change in% wall thickness was different between the two regions (P &lt; 0.0001). The mean value for the% wall thickness at each time point was tested for the difference between the two areas behind the hoc by the Tukey method; P values for these analyzes are displayed below the error bar.

2A and 2B are graphs showing blood flow in the lower pericardium during pacing in a swine model of congestive heart disease, as described in Example 1 below.

In FIG. 2A, the subendocardial (endo) hematoma was evaluated sequentially under the listed conditions along the x axis at the interventricular septum and sidewall. Day refers to the day in which the heart rate at which the measurement is obtained persists (0, onset of heart rate; 14, 14 days; 21-28, 21-28 days). PACE refers to whether blood flow measurements were obtained using activated (+) or deactivated (0) pacemarkers. Pacemaker pace was 225 bpm (see Table 3 below for values). Symbol represents an average value; Error bars indicate 1 SD. Two-way ANOVA (repeated measurement) indicates that the lower pericardial blood circulation was affected by the duration of pacemaker (P = .0001) and region (P = .017). Furthermore, the pattern of change in the lower pericardial blood circulation was different between the two regions (P <.006). The mean value for lower pericardial blood circulation at each time point was tested for differences between the two regions behind the hoc by means of the Tukey assay; P values for these analyzes are displayed below the error bar.

In FIG. 2B, pericardial lower pericardial blood circulation was sequentially evaluated at the interventricular septum and sidewall under the listed conditions along the x axis. Symbols and conditions are as for FIG. 2A (see Table 4 below for values). Two-way ANOVA (repeated measurement) indicates that pericardial lower pericardial blood circulation was affected by duration of pacemaker (P = .0001) and region (P = .0198).

FIG. 3A shows a meridional end-deflator wall evaluated sequentially in the interventricular septum and sidewall every 7 days as cardiac pacemaker (day 0) and as heart disease progresses (described in Example 1). A graph showing pressure. Two-way ANOVA (repeated measurement) indicated that systolic wall pressure was affected by the pacemaker period (P <.0001). However, the pattern of systolic wall pressure was similar in both areas. Measurements were made using deactivated pacemakers.

3B is a graphical representation of coronary vascular resistance during cardiac pacing in a swine model of congestive heart disease, as described in Example 1 below. The index of coronary vascular resistance was evaluated sequentially in the interventricular septum and sidewall under the listed conditions along the x axis. Symbols and conditions are as described in FIG. Two-way ANOVA (repeated measurement) indicates that coronary vascular resistance was affected by duration of pacemaker (P = .0001) and area (P = .013). Furthermore, the pattern of change in coronary vascular resistance was different between the two regions (P = .0012). The mean value for coronary vascular resistance at each time point was tested for the difference between the two areas behind the hawk by Tukey analysis. These analyzes indicated that coronary vascular resistance was higher at the side walls than at the diaphragm immediately after the onset of pacemaker (P value is indicated below the error bar).

4 schematically depicts the construction of an exemplary replication-deficient recombinant adenovirus vector useful for gene transfer into cells and the heart, as described in the Examples below.

FIG. 5 is a schematic diagram showing the structural recombination configuration of an adenovirus encoding a transgene. FIG.

6A and 6B are graphs showing local contractile function of treated animals, as described in Example 5 below. 6A shows the results of animals examined 2 weeks after gene delivery and FIG. 6B shows the results of animals investigated 12 weeks after gene delivery.

7A, 7B and 7C show diagrams corresponding to contrast ultrasound cardiac echoograms of the myocardium. White areas show contrast enhancement (more blood circulation) and dark areas show reduced blood circulation. 7A depicts acute LCx occlusion in normal pigs. FIG. 7B shows the difference in contrast enhancement between IVS and LCx phases 14 days after gene delivery with lacZ, which shows different hematogenesis in the two regions during atrial pacing (200 bpm). In FIG. 7C, the contrast enhancement was shown to be equivalent on IVS and LCx 14 days after gene delivery with FGF-5, indicating similar hematogenesis in both regions of atrial pacing. These results are illustrated in Example 5 below.

FIG. 8 shows before and after 14 ± 1 day gene delivery with lacZ (control gene) and FGF-5 and 12 weeks after FGF-5 gene delivery in five animals (as described in Example 5), heart rate Peak contrast, expressed as the ratio of peak image intensity in the ischemic region (on LCx) divided by the peak image intensity of the interventricular septum (IVS), measured from the video image using a computer-based image analysis program during tuning (200 bpm) The ratio (correlation of blood circulation) is shown. Hemostasis to the ischemic phase was maintained at 50% of normal after gene transfer using control genes, but increased to more than 2-fold normal after gene transfer using FGF-5 (p = 0.0018), with at least 12 effects. Lasted for weeks.

9 depicts vascular numbers quantified by microscopic analysis in ischemic and non-ischemic regions after gene transfer with FGF-5 and lacZ (described in Example 5). The capillary counts surrounding each fiber in the ischemic and non-ischemic regions of animals that received the FGF-5 gene (p <0.038) increased compared to animals that received the lacZ gene.

10A, 10B and 10C show gels demonstrating DNA, mRNA and protein expression after delivery of angiogenic transgenes to the myocardium (as described in Example 5) according to the present invention. FIG. 10D depicts a gel following PCR amplification showing no detectable levels of genes were delivered to the retina, liver or skeletal muscle of treated animals (as described in Example 5).

FIG. 11 shows biomarkers using different angiogenic gene constructs, FGF-4, FGF-5 and FGF-2LI +/- sp (ie, FGF-2LI plus or negative secretion signal peptide), as described in Examples 6 and 7. This is a comparison of the wall thickness of the gene transfer.

12 shows that improved function in the ischemic region (as indicated by the wall thickness) after FGF-4 gene delivery was associated with improved local perfusion.

FIG. 13 shows a comparison of perfusion (blood circulation) from the results of infusion of FGF-4, FGF-5 or FGF-2LI +/- sp (ie FGF-2LI plus or minus signal peptide), as described in Example 6 below do.

FIG. 14 shows the comparison of wall thickness as a result of gene transfer using FGF-2 plus (FGF-2LI + sp) or negative secretion signal peptide (FGF-2LI-sp), as described in Example 7 below.

Detailed Description of the Preferred Embodiments

Justice

"Heart disease" is clinically defined as a disease in which the heart does not provide adequate blood circulation to meet metabolic needs. Symptoms include mild breath, fatigue, weakness, leg swelling, and motor hypersensitivity. In physical investigations, patients with heart disease tend to have increased heart rate and respiratory rate, showing lar (indicative of fluid in the lungs), edema, jugular swelling, and generally cardiac hypertrophy. Patients with heart disease suffer from high mortality rates; Typically 50% of patients die within two years of symptom onset. In some cases, heart disease is associated with severe coronary artery disease (“CAD”), and as described herein and in the art, typically involves either myocardial infarction and progressive chronic heart disease or an acute low leakage condition. Cause. In other cases, heart disease is associated with dilated cardiomyopathy (as described below) without being associated with severe coronary artery disease.

"Expanded cardiomyopathy" (or used herein as DCM) is a heart that is typically diagnosed by the discovery of left and / or right ventricle that is diminished and lacks contractile force without other specific forms of heart disease such as a history of coronary occlusion or myocardial infarction. Type of disease. DCM is associated with symptoms of poor ventricular function and heart disease. In these patients, chamber dilation and thinning of the walls generally cause high tension in the left ventricular wall. Although there is no typical obstructive coronary artery disease, these patients sometimes complain of angina. Other symptoms include increased breathing, fatigue, weakness, leg swelling and hypersensitivity. Many such patients exhibit these symptoms even at some active state or at rest, and are thus characterized by severe, ie, "type-III" or "type-IV" heart disease, respectively. In physical experiments, patients with DCM tend to increase their pulsating and respiratory rates and show lar (indicative of fluid in the lungs), edema, jugular swelling, and generally cardiac hypertrophy. Echocardiography is typically used for the diagnosis of DCM. Patients with DCM experience angina even if they do not have serious coronary artery disease. In some cases, the cause of DCM is known or estimated. Examples of such cases include, for example, cardiomyopathy in the family (eg, cardiomyopathy, such as those associated with progressive muscular dystrophy, muscular dystrophy, Friedreich's ataxia, and hereditary dilated cardiomyopathy), infections that cause myocardial inflammation, and non-infectious inflammation (such as autologous). Immune diseases, peripartum cardiomyopathy, inflammation due to hypersensitivity or transplant rejection, metabolic disorders (including nutritional, endocrine, and electrolyte abnormalities) and toxic agents (such as alcohols, and also certain chemotherapeutic drugs and catecholamines) ) Is exposed. In most cases (approximately 80%), the cause of DCM remains unknown and the disease is therefore referred to as "idiopathic dilatation cardiomyopathy".

As used herein, the terms "having a therapeutic effect" and "successful treatment" have essentially the same meaning. In particular, if a patient suffering from heart disease receives or loses an observable and / or measurable decrease in one or more of the above-described symptoms after receiving an angiogenic factor transgene according to the method of the present invention, Patients suffering from the heart disease (associated with severe CAD or DCM) are successfully "treated" for that disease. Reduction of these signals or symptoms may also be felt by the patient. Thus, indicators of successful treatment of such heart disease include patients who exhibit or feel angina, fatigue, weakness, relentless breathing, leg swelling, larva, cardiac or respiratory rate, edema, or symptoms of any one of jugular swelling. do. The patient also has greater exercise tolerance, a smaller heart with improved ventricular and cardiac function, and generally fewer hospital visits with respect to heart disease. Preferably, improvement of heart function is suitable to meet the metabolic needs of the patient, and the patient does not exhibit symptoms at some activity or at rest. Many of these signals and symptoms are readily visible to the naked eye and / or measurable by basic procedures familiar to the physician. One indicator of improved cardiac function is increased blood circulation, especially in the heart region, formerly an ischemic area, which is also an indicator of successful treatment. As will be described below, blood circulation in the patient is determined by thallium imaging (Braunwald in Heart Disease, 4 ^th ed., Pp. 276-311, Saunders, Philadelphia, 1992) or by ultrasound cardiac echocardiography (Examples 1 and 5, and can be measured by Sahn, DJ, et al., Circulation, 58: 1072-1083, 1978). Blood circulation before and after angiogenic gene delivery can be compared using these methods. Improved cardiac function is associated with reduced signals and symptoms as noted above. In addition to the echocardiography, the emission fraction (LV) can be measured by nuclear (non-aggressive) techniques as is known in the art.

"Ventricular remodeling" sometimes occurs after myocardial infarction and is typically characterized by the following: After myocardial infarction has healed, continuous ischemia that occurs in the border region between the infarcted portion and normal tissue and other factors, leads to swelling and / or remodeling of the remaining heart tissue, which was originally referred to as infarct swelling. Dilation of the entire heart occurs in about 50% of patients who have experienced such an infarction. This expansion, or remodeling, causes additional impairment of ventricular function. Remodeling can occur as early as 1 to 2 weeks after infarction, but typically occurs within months after myocardial infarction.

"Hazardous left ventricular remodeling" (or simply "harmful remodeling") refers to ventricular dilatation after myocardial infarction and can lead to severe heart disease. Using the treatment methods described herein, it is anticipated that such deleterious remodeling may be prevented or at least substantially alleviated. Even if ventricular remodeling has already begun, it is still desirable to induce angiogenesis because the development of microvascular and increase in blood circulation can still offset ventricular dysfunction. Harmful ventricular remodeling in patients suffering from myocardial infarction is "prevented" if there is no loss of seal and no symptoms of heart disease (described above under "heart disease") occur. Harmful ventricular remodeling is alleviated if existing symptoms of heart disease are reduced to any observable or measurable. For example, the patient will breath less and exhibit improved exercise tolerance. Methods of evaluating improvement of heart function and reduction of symptoms are essentially similar to those described above for DCM. The prevention or alleviation of deleterious ventricular remodeling as a result of improved parallel hematopoiesis and ventricular function is expected to occur within a few weeks after delivery of the angiogenic gene in vivo to the patient using the methods described herein.

"Polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotide or deoxyribonucleotide, or one of its analogs. As the term refers to the primary structure of a molecule, it includes double- and single-stranded DNA as well as double- and single-stranded RNA. Also included are modified polynucleotides, such as methylated and / or capped polynucleotides.

"Recombinant" means that when applied to a polynucleotide, the polynucleotide is the product of various combinations of cloning, restriction and / or ligation steps, and other processes that result in a structure that is distinct from polynucleotides found in nature.

"Gene" or "transgene" refers to a polynucleotide or portion of a polynucleotide that contains a sequence encoding a protein. In most situations, it will also be desirable for the gene to include a promoter operably linked to the coding sequence to effectively promote transcription. As is well known in the art, enhancers, refreshers, and other regulatory sequences may also be included to regulate the activity of the gene.

The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to polymers of amino acids of any length. These terms also include proteins that are post-translationally modified through reactions including glycosylation, acetylation and phosphorylation.

An “angiogenic peptide or protein” refers to any protein or peptide that promotes angiogenic or angiogenic activity, ie angiogenesis. Blood vessels that occur in angiogenesis include capillaries, the smallest inner diameter vessels having a diameter of about 8 microns, and larger inner diameter vessels having a diameter of at least about 10 microns. Angiogenic activity can be measured by measuring blood circulation, increased myocardial function, or the presence of blood vessels, using procedures described herein or known in the art. For example, capillary number or density can be quantified in animals visually or by microscopic analysis of tissue sites (see Example 5). Myocardial blood circulation was measured by radioactive microsphere techniques as described in the literature.

Roth, DM, et al., Am. J. Physiol. 253: H1279-H1288, 1987 or Roth, DM, et al., Circulation 82: 1778-1789, 1990). Myocardial blood circulation can also be quantified by thallium imaging, for example, which involves perfusion of the heart with radionuclide thallium as described by Braunwald (Braunwald in Heart Disease, 4 ^th ed., Pp. 276-311, Saunders, Philadelphia, 1992). Cells in the heart have affinity for thallium. Absorption of thallium is clearly correlated with blood circulation. Therefore, reduced absorption refers to reduced blood flow as occurs in an ischemic state lacking perfusion. In conscious individuals, angiogenic activity can be readily assessed by contrast ultrasound echocardiography as described in Examples 1 and 5 below and in the literature (Sahn, DJ, et al., Circulation 58: 1072). -1083, 1978). Improved myocardial function can be measured by measuring the thickness of the wall, for example by ultrasound cardiac echocardiography through the thoracic cavity. Angiogenesis is "promoted" if the increase in angiogenic activity is measurable after receiving the angiogenic transgene compared to before being treated with the transgene in the patient's heart. Angiogenic peptides include peptide precursors that are post-translationally processed into active peptides. Preferably, the angiogenic protein or peptide is a fibroblast growth factor (FGF) family (but not limited to them) aFGF (also known as FGF-1), bFGF (also known as FGF-2), FGF-4, FGF Members of the vascular endothelial growth factor (VEGF) family, including but not limited to the VEGF-A family (e.g., VEGF-121, VEGF-145, VEGF-165, VEGF-) Members of the VEGF-B family (such as VEGF-167 and VEGF-186), members of the VEGF-C family; Members of the platelet-induced growth factor (PDGF) family (such as PDGF A or PDGF B), or members of the insulin-type growth factor (IGF) family. However, genes encoding any protein or peptide that exhibit angiogenic activity measurable, for example, by the methods mentioned above, appear useful in the methods of the invention. Angiogenic peptides or proteins include “derivatives” and “functional equivalents” of angiogenic proteins such as, for example, FGFs, VEGFs, PDGFs and IGFs. Derivatives of such angiogenic proteins or peptides are peptides that have similar amino acid sequences and to some extent retain one or more activities of related angiogenic proteins or peptides. Useful derivatives generally have substantial sequence similarity (at the amino acid level) to regions or domains of proteins involved in angiogenic activity. "Sequence similarity" refers to the similarity observed between the amino acid sequences of two different proteins or peptides regardless of peptide origin. As is well known in the art, there are many amino acid substitutions that are essentially "conservative" in nature, where the substituted amino acids are relatively similar (eg in size and charge) to the original amino acids. Substantial sequence similarity is typically at least 30% sequence identity to a related angiogenic protein or peptide (generally measured for stretches of 10 or more amino acids), preferably 70%, more preferably 90%, Most preferably comprises 95% sequence similarity. As is also well known in the art, conservative additions or deletions are those located in regions or domains of proteins that are not generally considered to be involved in activity, in this case promoting angiogenesis. By "functional equivalent" is meant a protein or peptide having an activity that can replace one or more activities of a particular angiogenic protein or peptide. Preferred functional equivalents retain all of the activity of a particular angiogenic protein or peptide; However, functional equivalents may have stronger or weaker activity than wild-type peptides or proteins as measured in angiogenesis assays when measured quantitatively. Preferred functional equivalents are those that are within 1% to 10,000%, more preferably between 10% and 1000%, even more preferably between 50% and 200% of the activity of the angiogenic protein or peptide or subunit involved. Have As is known in the art, various techniques, including computer modeling, can be utilized to assess the likely impact of such variants; Prospective candidates can be easily screened for retention of angiogenic potential using in vitro and / or in vivo assays as described herein.

A "heterologous" component refers to a component that is introduced into or in a different entity from where it was originally located. For example, polynucleotides derived from one organism and introduced into different organisms by genetic engineering techniques are heterologous polynucleotides that, if expressed, can encode heterologous polypeptides. Similarly, a promoter or enhancer removed from its native coding sequence and operably linked to a different coding sequence is a heterologous promoter or enhancer.

As used herein, "promoter" refers to a polynucleotide sequence that controls the transcription of a gene or coding sequence to which it is operably linked. The majority of promoters derived from a variety of different sources, including constitutive, inducible and inhibitory promoters, are known in the art (also found in databases such as GenBank), on their own or in cloned polynucleotide sequences. May be utilized (eg from other commercial or individual sources as well as from deposits such as ATCC).

As used herein, an "enhancer" refers to a polynucleotide sequence that enhances the transcription of a gene or coding sequence to which it is operably linked. The majority of enhancers derived from a variety of different sources are known in the art (also found in databases such as GenBank) and can be utilized on their own or in cloned polynucleotide sequences (eg, as well as other commercial or individual sources). From deposits such as ATCC). Many polynucleotides that contain promoter sequences (such as commonly used CMV promoters) also include enhancer sequences.

"Operably linked" means that two or more components are placed in a parallel state, and the components described in this regard are used to function in their intended manner. A promoter is operably linked to a gene or coding sequence if the promoter controls the transcription of the gene or coding sequence. Although operably linked promoters are generally located upstream of the coding sequence, they do not necessarily have to be contiguous. An enhancer is operably linked to a coding sequence if the enhancer increases the transcription of the coding sequence. An operably linked enhancer may be located upstream, within, or downstream of the coding sequence. The polyadenylation sequence is operably linked to the coding sequence if it is located at a downstream end of the coding sequence such that transcription proceeds through the coding sequence to the polyadenylation sequence.

"Replicon" refers to a polynucleotide that contains a origin of replication that enables replication of the polynucleotide in a suitable host cell. Examples include replicons of target cells (such as chromosomes of the nucleus and mitochondria) and extrachromosomal replicons (such as replicating plasmids and episomes) into which heterologous nucleic acids can be incorporated.

As used herein, "gene delivery", "gene delivery", and the like are terms that refer to the introduction of an exotic polynucleotide (sometimes also called a "transgene") into a host cell, regardless of the method of introduction. Such methods include various well-known techniques such as vector-mediated gene delivery (such as by viral infection / transformation, or various other protein-based or lipid-based gene delivery complexes) and "naked" polynucleotides. Techniques that facilitate delivery (such as electroporation, "gene gun" delivery, and various other techniques used to introduce polynucleotides). The introduced polynucleotide may be stable or temporarily maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide contains a replication origin consistent with the host cell or is incorporated into the replicon of the host cell, such as an extrachromosomal replicon (such as a plasmid) or a nuclear or mitochondrial chromosome. . Many vectors are known in the art and are known to be able to mediate gene delivery to mammalian cells as described herein.

As used herein, "in vivo" gene delivery, gene delivery, gene therapy, and the like are such that a vector comprising an exogenous polynucleotide is introduced directly into an organism, such as a human or non-human mammal, such that the exogenous polynucleotide is such an organism. Is a term referring to being introduced into cells in vivo.

A "vector" (sometimes referred to as a gene delivery or gene delivery "vehicle") refers to a complex of macromolecules or molecules containing a polynucleotide to be delivered to a host cell in vitro or in vivo. The polynucleotide to be delivered will comprise the coding sequence of interest in gene therapy. Vectors include, for example, viral vectors (such as adenovirus (Ad), adeno-associated virus (AAV), and retroviruses), liposomes and other lipid-containing complexes, and polynucleotides to host cells. There are other macromolecular complexes that can mediate things. The vector may further comprise other components or functions that further regulate gene delivery and / or gene expression, or otherwise provide beneficial properties to the targeted cell. Such other components include, for example, components that affect binding or targeting to a cell (including components that mediate cell-type or tissue-specific binding); Components that influence uptake of the vector nucleic acid by the cell; Components that influence the positioning of the polynucleotide in the cell after uptake (eg, agents that mediate the positioning of the nucleus); And components that influence the expression of polynucleotides. Such components can also include detectable and / or selectable markers that can be used, for example, to detect and select cells that absorb and express nucleic acids delivered by the vector. Such components may be provided as a natural feature of the vector (eg, the use of specific viral vectors having components or functions that mediate binding and uptake), or the vector may be modified to provide such functions. A wide variety of such vectors are known in the art and are generally available.

"Recombinant viral vector" refers to a viral vector comprising one or more heterologous genes or sequences. Since many viral vectors exhibit size-limits associated with packaging, heterologous genes or sequences are typically introduced by replacing one or more portions of the viral genome. Such viruses may be deficient in replicon, in which the deleted function (s) are provided in trans during virus replication and encapsulation (eg containing helper virus or genes necessary for replication and / or encapsulation). By using packaging cell lines). Modified viral vectors are also described in which the polynucleotide to be delivered is carried out of the virus particle (Curiel, DT, et al., PNAS 88: 8850-8854, 1991).

Virus "packaging" as used herein refers to a series of intracellular events that lead to the synthesis and assembly of viral vectors. Packaging typically is a replication of the "proviral genome", or a recombinant pro-vector typically referred to as a "vector plasmid" (recombinant polynucleotides that can be packaged in a manner similar to the viral genome, typically with appropriate viral "packaging sequences" Replication of both sides), followed by encapsulation or other coating of nucleic acid. Therefore, when the appropriate vector plasmid is introduced into the packaging cell line under appropriate conditions, it can be replicated and assembled into viral particles. The viral "rep" and "cap" genes found in many viral genomes are the genes encoding the replication and encapsulation proteins, respectively. A "replicating-deficient" or "replicating-incompetent" viral vector is a virus that does not have one or more of the functions required for replication and / or packaging or is altered such that the viral vector cannot initiate viral replication following uptake by the host cell. Say vector. To prepare a stock of such replication-deficient viral vectors, a "packaging cell line" modified to contain genes encoding missing functions that virus or pro-viral nucleic acid can be supplied in-trans. Can be introduced. For example, such packaging genes can be stably integrated into the replicon of the packaging cell line or they can be transformed by a helper virus containing a "packaging plasmid" or genes encoding missing functions. Can be introduced.

A "detectable marker gene" is a gene that allows cells containing the gene to be specifically detected (eg, distinguished from cells that do not contain a marker gene). Many various such markers are known in the art. Preferred examples of markers are detectable marker markers that encode proteins that appear on the cell surface to facilitate simple and rapid detection and / or cell sorting. For example, the lacZ gene encoding beta-galactosidase can be used as a detectable marker, whereby cells transformed with the vector containing the lacZ gene are detected by staining as described below. It becomes possible.

A "selectable marker gene" is a gene that allows a cell containing the gene to be specifically selected or vice versa when there is a corresponding selection agent. For example, an antibiotic resistance gene may be used as a positive selectable marker marker gene that allows the host cell to be selected positive when there is a corresponding antibiotic. Selectable marker markers may be positive, negative or dual. Positive selectable markers allow selection of the cell containing the marker, while negative selectable marker genes allow the cell containing the marker to be selectively removed. Various such markers are described, including dual markers (ie positive / negative) (WO 92/08796, published May 29, 1992, WO 94/28143, published December 8, 1994). Such marker markers may provide an additional measure of control that may be advantageous with respect to gene therapy.

"Vascular structure" or "vascular" refers to a system of tubes that carries blood (and lymphatic fluid) through the mammal's body.

"Vascular" refers to all vessels of the mammalian vascular system, such as arteries, arterioles, capillaries, small veins, veins, sinus and vasava vasorum. In a preferred aspect of the present invention, vectors containing angiogenic transgenes are introduced directly into a vascular conduit that supplies blood to the myocardium. Such vascular conduits include coronary arteries as well as tubing such as saphenous veins or internal mammary artery grafts.

"Artery" refers to the blood vessel through which blood passes from the heart. Coronary arteries supply tissue to the heart itself, while other arteries supply blood to the rest of the body. The general structure of an artery consists of a lumen surrounded by multiple arterial walls.

"Individual" or "patient" refers to a mammal, preferably a large mammal, most preferably a human.

As used herein, “treatment” or “treatment” refers to the administration of an individual patient to an agent that can induce a prophylactic, therapeutic or other beneficial effect on an individual.

As used herein, "gene therapy" refers to the administration of a vector comprising a therapeutic gene to an individual patient.

"Therapeutic polynucleotide" or "therapeutic gene" refers to a nucleotide sequence that, when administered to an individual, can induce a prophylactic, therapeutic or other beneficial effect in the individual.

references

The practice of the present invention will use prior art, such as molecular biology in the art, unless otherwise indicated. Such techniques are explained fully in the literature:

Additional literature describing delivery and surgical transport that can be used in the present invention includes:

Additional literature describing cell types found in blood vessels and vasculature that may be useful in the present method include: W. Bloom & D. Fawcett, A Textbook of Histology (VBSaunders Co. 1975 ).

Several publications have argued for the use of gene transfer for the prevention of diseases including heart disease. See, eg, the following references.

The documents cited in the above sections are hereby incorporated by reference to the extent that these documents teach techniques used in the practice of the present invention.

Inclusion of References

References cited in this application, including patents, published applications, and other publications, are incorporated herein by reference.

Detailed Description of Various Preferred Embodiments

Various preferred aspects of the invention are summarized below and further described and illustrated in the following detailed description and drawings.

The present invention provides for the introduction of transgenes encoding angiogenic proteins into a patient's myocardium, thereby preventing congestive heart disease including coronary artery disease (CAD) and severe heart disease associated with myocardial infarction as well as dilated cardiomyopathy ("DCM"). A method and composition for treating and for preventing or alleviating harmful ventricular remodeling.

In the method of the present invention for treating congestive heart disease, vector constructs containing genes encoding angiogenic proteins or peptides are targeted to the patient's heart, where synthesis of exogenous angiogenic proteins of the myocardium is prevented. It promotes angiogenesis and thereby improves heart dysfunction by improving blood circulation through newly formed blood vessels. Improved cardiac function ultimately leads to reduced or eliminated symptoms of heart disease and prolongs life beyond the expected mortality rate within two years of severe CHF.

Preferred methods use vector constructs and / or delivery methods that result in coordinated expression of relatively limited angiogenic proteins in the myocardium of the patient. Examples of angiogenic proteins include the FGF family (FGF-1, FGF-2, FGF-4, FGF-5 and FGF-6, more preferably FGF-2, FG-4 and FGF-5) Member of; Members of the vascular endothelial growth factor (VEGF) family, including but not limited to members of the VEGF-A family (eg, VEGF-121, VEGF-145, VEGF-165, VEGF-189 and VEGF-206), VEGF-B Members of the family (such as VEGF-167 and VEGF-186) and members of the VEGF-C family; Members of the platelet-induced growth factor (PDGF) family; And members of the insulin-like growth factor (IGF) family.

Preferred vectors useful for use in the present invention include viral vectors, lipid-based vectors, and other vectors capable of delivering DNA in vivo to cells that do not divide. Presently preferred are viral vectors, in particular replication-deficient viral vectors such as replication-deficient adenovirus (Ad) vectors and adeno-associated virus (AAV) vectors. In view of ease of manufacture and use in the present invention, replication-deficient adenovirus vectors are currently most preferred.

Preferred means of in vivo delivery in the present invention (particularly for vector constructs that would otherwise not be targeted for delivery and / or expression to be limited to the myocardium) would be to inject the vector directly into the vessel that feeds the myocardium, preferably coronary It is injected into the artery. Such infusion uses a catheter introduced substantially deep (typically at least about 1 cm) into the lumen of one or two coronary arteries or one or more saphenous veins or other ducts delivering blood to an internal mammary artery graft or myocardium. It is done by Infusion not deep enough into the coronary arteries can result in the virus becoming distributed in arteries throughout the body.

Preferably, a viral vector stock that does not contain wild-type viruses is placed in the lumen of one or two types of coronary arteries (or grafts and other vascular conduits), preferably of the two coronary arteries (or grafts and other blood vessels) Conduit) and preferably by injecting deeply in an amount of 10 ⁶ to 10 ¹⁴ viral particles (more preferably 10 ⁸ to 10 ¹² viral particles) as measured by an optical density meter. In particular, cardiomyocytes are transformed locally with genes encoding proteins that promote angiogenesis in the affected myocardium, thereby maximizing the therapeutic efficiency of gene transfer, and unwanted effects and viral proteins at sites other than the heart. It is possible to minimize the possibility of an inflammatory response to. Vector constructs targeted specifically to the myocardium, such as myocardial-specific binding or uptake components, and / or angiogenic protein transgenes under the control of myocardial-specific transcriptional regulatory sequences (eg, vascular myocyte-specific promoters); The incorporating vector can be used in place of, or in combination with, that particular injection technique as a further limiting means of expression of the myocardium, particularly of the blood vessels. For vectors capable of eliciting an immune response, additional techniques may also be used to limit the potential for extracardiac expression, but it is preferred to inject the vector directly into the blood vessels supplying the myocardium.

The patient may be administered angiogenic gene therapy at any time in the case of CHF. However, it is more preferable to receive the drug within about 1 to 4 weeks after the occurrence of myocardial infarction. Administration is preferably via a single (one) intra-coronary injection (eg in each coronary artery), and one or more injections may sometimes be necessary.

As described in detail below, the inventors have found that the use of such a technique with vectors containing angiogenic protein transgenes has not been observed for any effect on non-cardiac tissues and without generating an inflammatory response. In addition, it has been found to effectively promote coronary angiogenesis and effectively enhance the functioning of the myocardium of large mammalian hearts. Two weeks after angiogenic gene delivery, myocardial blood circulation improved and ischemia improved, thereby enhancing myocardial function. These beneficial effects lasted for at least 12 weeks. For example, we used a single intracoronary injection (injecting about 10 ¹¹ vector particles) and observed that the angiogenic proteins were properly expressed to produce therapeutic benefits without toxicity. As myocardial blood circulation is enhanced, our analysis shows that high yield transduction of at least 60% of myocardial cells in vivo can be achieved using this procedure.

Adenovirus-mediated gene delivery generally does not result in stable integration of transgenes into the host genome. Therefore, transgene expression is relatively transient (although the vector appears to exist for up to five months). However, in the method of treatment of the present invention for the above-mentioned heart diseases, transient expression of angiogenic transgenes is generally adequate to achieve therapeutic goals. Indeed, for the purposes of the present invention, transient expression is generally preferred over stable integration in terms of safety since transient expression can avoid destruction of the host genome. As the experimental example demonstrates below, cross gene expression was maintained long enough to allow for parallel vascular development and concomitant recovery of normal heart function. Therefore, the angiogenic factor gene need not be present in the transformed cells for more than a few weeks to produce a therapeutic effect. Once new blood vessels are formed, continued expression of adventitious angiogenic proteins will not be necessary to maintain new blood vessel structure and increased blood flow.

Therefore, the in vivo transgene delivery technique provided by the present invention effectively avoids the need for multiple injections or injections of angiogenic proteins. Localized transduction and transgene expression made by the methods of the invention can also avoid the potentially deleterious effects of angiogenesis in non-cardiac tissue such as the retina.

Another aspect of the invention is a method for preventing or alleviating ventricular remodeling in a patient after myocardial infarction, which method comprises a vector construct containing a gene encoding an angiogenic protein or peptide to promote angiogenesis. Targeting in vivo to the patient's heart. Increased angiogenesis and hematogenesis made using the method of the present invention tends to reduce ischemia, thus mitigating progression to detrimental ventricular remodeling. In order to adjust these disease states, patients are preferably treated immediately after infarction, preferably within one month after infarction, more preferably within one to three weeks after infarction. The present invention can also be used in patients that are prone to such infarction as a prophylactic. Unless stated otherwise, the techniques and vector compositions for achieving targeted gene delivery in the patient's heart to prevent or alleviate ventricular remodeling are essentially the same as those for the treatment of DCM.

Animal model

Important prerequisites for successful research on gene therapy include: (a) the construction of animal models to which clinical congestive heart disease can be applied, which can provide useful data regarding the mechanism for angiogenesis in the setting of CHF, And (b) an accurate assessment of the effect of gene delivery. It is a particularly suitable model for studying heart disease because pigs are associated with human physiology. The pig heart is very similar to the human heart as follows. Pigs have a natural coronary circulatory system very similar to that of humans, including the absence of natural coronary vessels. Second, the size of the pig heart is similar to that of the human heart, in terms of percentage of total weight. In addition, pigs are large animal models and thus more accurate extrapolation is possible for various parameters such as effective vector dose, toxicity and the like. In contrast, the heart of animals such as dogs and members of murine animals have many endogenous parallel blood vessels. In relation to total weight, the dog's heart is twice the size of the human heart.

Two pig models were used in the present invention. The first model described in Example 1 below resembles clinical congestive heart disease. In this model, continuous rapid pacemakers over a period of 3 to 4 weeks lead to heart disease showing similarities to many features of heart disease (including DCM as well as heart disease associated with severe coronary artery disease). Such cardiac pacing has resulted in left ventricular dilatation showing impaired systolic function similar to the local dysfunction seen in heart disease (including those associated with severe coronary artery disease (CAD), or (DCM)). Therefore, this model can be used to determine whether delivery of vector constructs encoding angiogenic peptides or proteins is effective in alleviating cardiac dysfunction associated with these diseases. This model is particularly useful for providing several parameters thereby assessing the efficacy of in vivo gene therapy for the treatment of congestive heart disease and ventricular remodeling.

A second model, which is a model of myocardial ischemia, is described in Example 5 below. Using this second model, it has been demonstrated that adenovirus-mediated delivery of genes encoding angiogenic proteins reduces myocardial ischemia by stimulating concurrent angiogenesis and enhancing blood circulation in the ischemic region. For example, we have successfully demonstrated these gene transfer techniques using three different angiogenic proteins, including two natural forms and muteins (described in detail in the Examples below).

In the second model, the replacement of the americoid contractile muscles around the left circumflex (LCx) coronary artery with minimal infarction gradually leads to complete closure (within 7 days after replacement) (1% of the left ventricle, 4 ± 1 % Of LCx) (Roth, et al., Circulation, 82: 1778, 1990; Roth, et al., Am. J. Physiol., 235: 1-11279, 1987; White, et al., Circ.Res , 71: 1490, 1992; Hammond, et al., Cardiol., 23: 475, 1994; and Hammond, et al., J. Clin. Invest., 92: 2644, 1993). Myocardial function and hematogenesis are normal at rest in regions previously referred to by occluded arteries (referred to as ischemic arteries), but due to limited endogenous concomitant angiogenesis, hemostasis ischemia when myocardial oxygen demand increases Insufficient to prevent this. Therefore, LCx phase is susceptible to transient ischemia similar to clinical angina. Parallel angiogenesis and flow-function relationships are stable within 21 days after ameroid replacement and remain unchanged for 4 months (Roth, et al., Circulation, 82: 1778, 1990; Roth, et al., Am J. Physiol., 235: H1279, 1987; White, et al., Circ.Res., 71: 1490, 1992). Telemetry has demonstrated that animals carrying periodic ischemic dysfunction in dangerous beds are associated with a sudden increase in heart rate during feeding, whole animals, etc. throughout the day. Therefore, the model has a stable but inadequate parallel vein, and therefore is prone to periodic ischemia. Another distinct advantage of this model is that there is a normally perfused and functioning region (on the LAD phase) adjacent to an abnormally perfused and functioning region (on the LCx phase), thereby providing a contrast in each animal.

Myocardial echocardiography was used to assess local myocardial perfusion. The contrast material consists of microaggregates of galactose and increases the echogenicity (white) of the image. Microaggregates are distributed in a manner proportional to blood circulation in the coronary and myocardial walls (Skyba, et al., Circulation, 90: 1513-1521, 1994). The peak intensity of the contrast was found to be closely correlated with the blood flow of the myocardium as measured by microscopy (Skyba, et al., Circulation, 90: 1513-1521, 1994). Hydraulic cuff to verify that the image of the echocardiography used in the present invention correctly confirms the LCx image, and to demonstrate whether the contrast myocardial echocardiography of the myocardium can be used to evaluate the blood circulation of the myocardium. (cuff) The occluder was placed around the LCx of the base adjacent to the americoid.

In this study, when animals were sacrificed, the heart was perfused-fixed to quantify capillary growth by microscopy (glutaraldehyde, physiological pressure, in situ). PCR was used to detect angiogenic protein DNA and mRNA in the myocardium from the transgenic animals. As described below, two weeks after gene transfer, myocardial samples taken from all five lacZ-transduced animals showed substantial β-galactosidase activity upon histological examination. Finally, expression of angiogenic proteins in cells and myocardium obtained from gene-transmitted animals has been demonstrated using polyclonal antibodies against the angiogenic proteins.

Strategies for therapeutic studies included the appropriate timing of transgene delivery, the route of transgene administration, and the selection of angiogenic genes. In the americoid model of myocardial ischemia, gene transfer was performed after stable but insufficient parallel vessels developed. Previous studies using the ameroid model included delivery of angiogenic peptides during the closure of the ameoid followed by the development of ischemia and lateral vessels. However, this strategy was not used for various reasons. First, prior studies are not suitable for closely copying the conditions that will be present in the treatment of clinical myocardial ischemia that is provided when gene delivery is established in ongoing myocardial ischemia; Previous studies are similar and therefore less relevant for providing peptides that participate in ischemia. Second, based on previous studies in cell culture, it was estimated that ischemic stimulation combined with angiogenic peptides would be the optimal environment for stimulation of angiogenesis. Angiogenesis may be most appropriate by delivery of the transgene when there is already an onset of heart disease (associated with DCM or severe coronary artery disease) or ventricular remodeling. Coupled with these conclusions, a method for achieving transgene delivery is selected.

Swine models provided an excellent means to track local blood flow and function before and after gene transfer. Controls were provided for these studies by using control animals that received the same but recombinant adenovirus construct containing the reporter gene. Based on the foregoing and published prior studies, one skilled in the art will recognize that the results described below obtained in pigs are expected to be the expected results in humans.

Transgenes Encoding Angiogenic Proteins and Peptides

In the present invention, one or more transgenes encoding an angiogenic protein or peptide factor that can promote angiogenic activity in the heart can be used. Any protein or peptide exhibiting "angiogenic activity" (as defined above), which can be measured in the present invention and by methods disclosed in the art, can potentially be used in connection with the present invention. Examples of suitable angiogenic proteins or peptides include family of fibroblast growth factor (FGF), family of vascular endothelial growth factor (VEGF), family of platelet-induced growth factor (PDGF), insulin-type growth factor (IGF) Members of the family. Members of the FGF family include, but are not limited to, aFGF (FGF-1), bFGF (FGF-2), FGF-4 (also referred to as "hst / KS3"), FGF-5, FGF-6 have. VEGF has been shown to be expressed by cardiomyocytes in vitro and in vivo in response to ischemia; It is a regulator of angiogenesis not only during adaptive responses to pathological conditions but also under physiological conditions (Banai et al., Circulation 89: 2183-2189, 1994). Members of the VEGF-A sub-family (such as VEGF-121, VEGF-145, VEGF-165, VEGF-189 and VEGF-206) and the VEGF-B sub-family are not limited to them in the VEGF family. Members (such as VEGF-167 and VEGF-186) and members of the VEGF-C sub-family.PDGF includes PDGF A and PDGF B. Nucleotide sequences of genes encoding these proteins, and corresponding amino acid sequences. Are known in the art (such as the GENBANK sequence database for these and other sequences), see the following document for the FGF family: Burgess, Ann. NY Acad. Sci. 638: 89-97, 1991; Burgess et. al., Annu. Rev. Biochem. 58: 575-606, 1989; Muhlhauser et al., Hum. Gene Therapy 6: 1457-1465, 1995; Zhan et al., Mol. Cell. Biol., 8: 3487, 1988; Seddon et al., Ann. NY Acad. Sci. 638: 98-108, 1991. For human hst / KS3 (ie FGF-4), Taira et al., Proc. Natl. Acad. Sci. US A 84: 2980-2984, 1987. For human VEGF, see Tischer et al., J. Biol. Chem. 206: 11947-11954, 1991 and references cited therein; Muhlhauser et al., Cir.Res. 77: 1077-1086, 1995. Sequence information for such genes and encoded polypeptides can be readily obtained from sequence databases such as GenBank or EMBL Polynucleotides encoding these proteins can also be obtained from gene libraries, such as Obtained by using basic PCR or hybridization techniques in the art.

The success of the gene delivery approach requires two things: synthesis of gene products and secretion from transformed cells. In this respect, genes encoding FGF-4, FGF-5, or FGF-6 are preferred because these proteins contain functional secretory signal sequences and are readily secreted from cells. Many, if not most, human VEGF proteins (including but not limited to VEGF-121 and VEGF-165) are also readily secreted and diffuse after secretion. Therefore, when expressed, these angiogenic proteins can easily induce cardiac interstitium and induce access angiogenesis.

Using other angiogenic proteins such as aFGF (FGF-1) and bFGF (FGF-2) without a naturally secreted signal sequence, fusion proteins with secretory signal sequences are recombinant using standard recombinant DNA methodology familiar to those skilled in the art. It can be prepared as. It is believed that both aFGF and bFGF can be naturally secreted to some extent; However, including additional secretion signal sequences can be used to enhance secretion of the protein. Secretory signal sequences may typically be located at the N-terminus of the desired protein, but may be placed at any position as appropriate to allow for secretion of angiogenic factors. For example, a polynucleotide containing an appropriate signal sequence can be fused to the 5 'of the codon to the first codon of the selected angiogenic protein gene. Suitable secretory signal sequences include the signal sequences of FGF-4, FGF-5, FGF-6 or signal sequences of different secretory proteins such as IL-1β. Example 7 below illustrates one type of modification of angiogenic proteins to contain signal sequences from other proteins, wherein the modification is an angiogenic protein with residues specifying the secretion of the second secreted protein. By replacement of residues in. Signal sequences derived from proteins normally secreted from cardiomyocytes may be used.

For treating humans, genes encoding angiogenic proteins of human origin are preferred, although angiogenic proteins of other mammalian origin that exhibit species-crossing activity, ie, have angiogenic activity in humans, can also be used.

Vectors for Gene Delivery in Vivo

Generally, the gene of interest is delivered in vivo to the heart, including cardiomyocytes, and specifies the production of encoded proteins. Such proteins are preferably constitutive (although inducible expression systems can also be used).

Vectors useful in the present invention include viral vectors, lipid-based vectors (such as liposomes), and other vectors capable of delivering DNA in vivo to non-dividing cells. Presently preferred are viral vectors, particularly replication-deficient viral vectors, including, for example, replication-deficient adenovirus vectors and adeno-associated virus (AAV) vectors. Replication-deficient adenovirus vectors are currently most preferred in terms of ease of preparation and use in the present invention. In contrast to retroviruses, adenoviruses generally do not require replication of host cells for gene expression because integration is not a component of the adenovirus life cycle. Adenoviruses effectively infect cells that do not divide and are therefore useful for the expression of recombinant genes in the myocardium because of the nonreplicative nature of cardiomyocytes.

Various other vectors suitable for in vivo gene therapy can be readily used to deliver angiogenic protein transgenes for use in the present invention. Such other vectors include other viral vectors (such as AAV), non-viral protein-based delivery platforms, and lipid-based vectors. Reference to these and other gene transfer vectors is known in the art.

As described above, the vector may also include other components or functions that further regulate gene delivery and / or gene expression, or otherwise provide beneficial properties to the targeted cell. Such other components include, for example, components that affect binding or targeting to a cell (including components that mediate cell-type or tissue-specific binding); Components that influence uptake of the vector nucleic acid by the cell; Components that influence the positioning of the polynucleotide in the cell after uptake (eg, agents that mediate the positioning of the nucleus); And components that influence the expression of polynucleotides. Such components will also include detectable and / or selectable markers that can be used to detect and select markers, such as cells that absorb and express nucleic acids delivered by a vector. Such components can be provided as a natural feature of the vector (eg, the use of a particular viral vector having components or functions that mediate binding and absorption), or the vector can be modified to provide such a function. Selectable marker markers may be positive, negative or dual. Positive selectable markers allow selection of the cell containing the marker, while negative selectable marker genes allow the cell containing the marker to be selectively removed. Various such markers have been described including dual markers (ie positive / negative) (Lupton, S., WO 92/08796, published May 29, 1992; and Lupton, S., WO 94/28143 , Released December 8, 1994). Such marker markers may provide an additional measure of control that may be advantageous with respect to gene therapy. Many various such vectors are known in the art and are generally available.

References to adenovirus vectors and other viral vectors that may be used in the methods of the present invention include the following:

Various adenovirus plasmids are also available from commercial sources, including, for example, Microbix Biosystems, Toronto, Ontario, Canada (see Microbix Product Information Sheet: Plasmids for Adenovirus Vector Construction, 1996).

References describing AAV vectors that can be used in the method of the present invention include the following:

References describing non-viral vectors that can be used in the methods of the present invention include the following:

Exemplary Adenovirus Vectors That Are Helper-Independent and Replication-Deficient in Humans

In general, genes of interest are delivered in vivo to the heart, including cardiomyocytes, and specify the production of encoded proteins. Several different gene transfer approaches are available. Currently preferred is a helper-independent replication-deficient system based on human adenovirus 5. Using this system, we demonstrated more than 60% transformation of cardiomyocytes in vivo by a single intra-arterial infusion (Giordano and Hammond, Clin. Res. 42: 123A, 1994). Non-replicating recombinant adenovirus vectors are particularly useful for the transformation of coronary endothelial and cardiomyocytes resulting in highly effective transformation after intracoronary injection.

As demonstrated herein, a helper-independent replication-deficient human adenovirus 5 system can be used to efficiently transform large percentages of cardiomyocytes by single coronary infusion in vivo. We also demonstrated that such delivery techniques can be used to effectively target vectors to the myocardium of large mammalian hearts. Additional means of targeting the vector to a particular cell or tissue type are described below and in the art.

In the various examples described below, the recombinant adenovirus vectors used are allowed cell lines in which transgenic gene products are provided in trans by missing essential genes (typically E1A / E1B) from the adenovirus genome. It is based on human adenovirus 5 (McGrory WJ et al., Virology 163: 614-617, 1988), which cannot replicate unless grown in. Instead of missing adenovirus genomic sequences, the transgene of interest can be cloned and expressed in tissues / cells infected with a replication-deficient adenovirus. Although adenovirus-based gene transfer generally does not result in stable integration of the transgene into the host genome (less than 0.1% adenovirus-mediated transformation results in transgene integration into the host DNA). Adenovirus vectors can be propagated to high titers; And even if the transgene is not passaged to daughter cells, it is suitable for delivering genes to mature cardiomyocytes that do not actively divide. Retroviral vectors provide stable gene delivery, and high titers are now available through retrovirus pseudotyping (Burns, et al., Proc. Natl. Acad. Sci. (USA) 90: 8033-). 8037, 1993), current retroviral vectors generally cannot effectively transduce nonreplicated cells (such as cardiomyocytes). In addition, the potential risk of transgene integration into the host DNA is not warned if short-term gene delivery is sufficient.

Indeed, we demonstrated that a limited period of time in the expression of angiogenic proteins is sufficient for substantial angiogenesis (see Example 5). Therefore, transgene delivery is therapeutically appropriate for treating such cardiovascular disease. Within 14 days after gene delivery to the myocardium of FGF-5, hematopoiesis was increased 2-fold, and the effect continued for at least 12 weeks (Example 5 and FIG. 8). Increased blood circulation correlated with an increase in the number of capillaries in the heart (see Example 5). Wall thickening also increased within 2 weeks after gene transfer and lasted for at least 12 weeks. Therefore, angiogenic factor genes need not be present in infected cells for more than a few weeks to produce a therapeutic effect. Once blood vessels develop, continued expression of exogenous angiogenic proteins is not required to maintain new blood vessel structure and increased blood flow.

An advantage associated with cells that do not divide, such as myocytes, is that viral vectors are not easily "diluted" by host cell division. However, if the duration of transgene expression in the heart needs to be further enhanced or desired, it is also possible to use a variety of second producing adenovirus vectors that have both E1 and E4 deletions, which is cyclophosphamide May be used with administration (Dai et al., Proc. Nat'l Acad. Sci. (USA) 92: 1401-1405, 1995). In order to further increase the scope of early gene transfer, injection may also be used during further injection or isolated coronary artery circulation.

Human 293 cells (approval number ATCC CRL1573; Rockville, MD), which are renal cells of human embryos transformed with adenovirus E1A / E1B genes, are typical examples of useful accepted cell lines for the production of such replication-deficient vectors. However, other cell lines may also be used, such as HeLa cells, which allow the proliferation of replication-deficient adenovirus vectors therein.

Preparation of Recombinant Adenovirus Vectors

Adenovirus vectors used in the present invention can be constructed by structural recombination techniques described in the literature (McGrory W.J., et al., Virology, 163: 614-617, 1988). In brief, the transgene of interest is cloned in a shuttle vector containing an adenoviral sequence that lacks the promoter, polylinker and E1A / E1B genes essential for viral replication. The transgene may be cloned in a convenient restriction site in the polylinker. Suitable shuttle vectors include plasmid pAC1 (McGrory et al., Virology, 163) encoding the left end portion of the human adenovirus 5 genome (Virology, 163: 614-617, 1988) without the E1A and E1B sequences encoding the initial protein. : 614-617, 1988) (or analog), and plasmid ACCMVpLpA (Gomez-Foix et al., J. Biol. Chem., 267: 25129-25134, 1992). pACCMVpLpA is a human cytomegalovirus enhancer-promoter (CMV promoter) whose E1 region is obtained from pUC 19 (plasmids well known in the art), followed by multiple cloning sites (polylinkers), followed by substitution with an SV40 polyadenylation site. The 5 'end of the adenovirus serotype 5 genome (map units 0-17). The use of plasmid pAC1 or ACCMVPLA facilitates the cloning process.

The shuttle vector is then co-transformed into 293 cells with a plasmid containing the entire adenovirus 5 genome that is too long to be encapsidated. Co-transformation can be performed by any means commonly used in the art, such as calcium phosphate precipitation or lipofection (see Biotechniques, 15: 868-872, 1993).

Examples of plasmids for co-transformation include plasmid “JM17”, which encodes a portion of vector pBR322 that contains genes for ampicillin resistance (4.3 kb) in addition to the entire human adenovirus 5 genome. Although JM17 encodes all the adenovirus proteins needed to make mature virus particles, it is too large to be encapsidated into mature virions (36 kb vs. 40 kb for wild type).

In a small subset of co-transformed cells, a "structural recombination" occurs between the transgene-containing shuttle vector (such as plasmid pAC1) and the plasmid (such as plasmid pJM17) having the entire adenovirus 5 genome, resulting in deletion of E1A. Recombinant genomes are generated that contain the transgene of interest instead of the / E1B sequence, and that additional sequences (such as the pBR322 sequence) are secondarily lost during recombination (see FIGS. 4 and 5). Giordano et al., Nature Medicine 2 (5): 534-538, 1996; Giordano et al., Circulation, 88: I-139, 1993; and Giordano and Hammond, Clin.Res., 42: 123A, 1994) . The efficiency of gene delivery could be assessed by using X-gal treatment with a CMV promoter (Clin. Res., 42: 123A, 1994) that drives the β-galactosidase gene in adenovirus HCMVSP1lacZ.

Exemplary examples demonstrating the manufacture and use of such vectors are provided below. The advantages of these vectors include the ability to achieve high efficiency (more than 60% of the target organ cells transformed in vivo) gene delivery, the ease of obtaining high titer virus stocks, and the division of these vectors into cardiomyocytes. It has the ability to achieve gene transfer in cells that do not produce it.

Targeted Angiogenic Protein Vector Constructs

By limiting the expression of angiogenic transgenes to the heart or to certain types of cells (such as cardiomyocytes) in the heart, certain advantages can be obtained as discussed below.

The present invention is directed to targeted vectors not only by delivery of the transgene into the coronary arteries, but also by, for example, directing target gene delivery and / or gene expression to a particular host cell or host cell type (eg cardiomyocytes). Use of cell targeting by use of the construct. Such targeted vector constructs will therefore include targeted delivery vectors and / or targeted vectors, as described in detail below and in the art as disclosed. Restricting delivery and / or expression may be beneficial as a means of further focusing on the potential effects of gene therapy. Further the potential usefulness of limiting delivery / expression largely depends on the type of vector used and the place of introduction of such vector. As described herein, delivery of the viral vector to the myocardium via coronary artery injection provides for itself highly targeted gene delivery (see Examples below). In addition, by using vectors (such as adenoviruses and many other vectors) that do not cause the integration of the transgene into the replicon of the host cell, the cardiomyocytes will exhibit relatively long transgene expression because it generally does not replicate. It is expected. In contrast, expression in rapidly dividing cells, such as endothelial cells, will tend to be reduced by cell division and replacement. However, other means of limiting delivery and / or expression may also be used in addition to or instead of the illustrated delivery method as described herein.

Targeted delivery vectors include, for example, preferential binding and / or gene delivery to surface components (such as members of ligand-receptor pairs, the other half found on the host cell to be targeted) or to a particular host cell or host cell type. There are vectors with other features that mediate (eg viral, non-viral protein-based vectors and lipid-based vectors). As is known in the art, many vectors with both viral and non-viral origins have inherent properties that facilitate such preferential binding and / or have been modified to achieve preferential targeting (Douglas). et al., Nature Biotechnology 14: 1574-1578, 1996; Kasahara, N. et al., Science 266: 1373-1376, 1994; Miller, N., et al., FASEB Journal 9: 190-199, 1995; Chonn, A., et al., Curr. Opin. In Biotech. 6: 698-708, 1995; Schofield, JP, et al., British Med. Bull. 51: 56-71, 1995; Schreier, H, Pharmaceutica Acta Helvetiae 68: 145-159, 1994; Ledley, FD, Human Gene Therapy 6: 1129-1144, 1995; Conary, JT, et al., WO 95/34647 (Dec. 21, 1995); Overell, RW, et al., WO 95/28494 (October 26, 1995); and Truong, VL et al., WO 96/00295 (1996. 1. 4.).

Targeted vectors are vectors (eg, viral, non-viral protein-based vectors and lipid-based vectors) in which transgene expression is relatively limited to a particular host cell or host cell type. For example, an angiogenic transgene to be delivered in accordance with the present invention may be operably linked to a heterologous tissue-specific promoter, whereby expression is limited to cells of a particular tissue.

For example, tissue-specific transcriptional regulatory sequences derived from genes encoding left ventricular myosin light chain-2 (MLC2V) or myosin heavy chain (MHC) are fused to transgenes such as the FGF gene in vectors such as the adenovirus constructs described above. Can be. Therefore, the expression of the transgene can be relatively limited to cardiomyocytes of the ventricles. The potency of gene expression and the degree of specificity provided by the MLC2V and MHC promoters, including lacZ, were measured (using recombinant adenovirus systems as exemplified herein); Heart-specific expression was also reported (Lee et al., J. Biol. Chem. 267: 15875-15885, 1992).

Since the MLC2V promoter contains only about 250 bp, it will fit well into size-limited delivery vectors such as the adenovirus-5 packaging system exemplified herein. The myosin heavy chain promoter, known to be a violent promoter of transcription, provides another surrogate cardiac-specific promoter and is less than 300 bp. On the one hand other promoters, such as the highly efficient and sufficiently small troponin-C promoter, do not provide such tissue specificity.

In the method of the present invention for treating heart disease, it is presently desirable to target gene delivery to the heart by intracoronary injection using high titers of the vector.

Proliferation and Purification of Adenovirus Vectors

Recombinant viral vectors, such as adenovirus vectors, can be plaque purified according to standard methods. For example, the resulting recombinant adenovirus vector can be propagated to a desired range of titers of about 10 ¹⁰ to 10 ¹² virus particles / ml in human 293 cells (providing E1A and E1B functions as trans). Proliferation and purification techniques have been described for various viral vectors that can be used in conjunction with the present invention. Although adenovirus vectors are exemplified herein, other viral vectors such as AAV can also be used. For adenoviruses, cells are infected at a density of 80% and can be obtained 48 hours after infection. Infected cells repeat three freeze-thaw cycles, cell debris is pelleted by centrifugation, and viruses are purified by CsCl gradient ultracentrifugation (preferably dual CsCl gradient ultracentrifugation). Prior to injection in vivo, the viral stock can be desalted (eg by gel filtration through a Sepharose column such as Sephadex G25). We typically concentrated and purified the virus stock by double CsCl ultracentrifugation followed by chromatography on Sephadex G25 equilibrated with phosphate buffered saline (PBS). The resulting virus stock typically has a final viral titer of at least about 10 ¹⁰ to 10 ¹² virus particles / ml.

Preferably, the recombinant adenovirus is highly purified and substantially free of wild-type (potentially replicating) viruses. For this reason, proliferation and purification can be carried out to exclude contaminants and wild-type viruses, for example, by identifying successful recombinant viruses using PCR using appropriate primers, performing plaque purification twice, and performing double CsCl gradient ultracentrifugation. have.

Delivery of a Vector Containing Angiogenic Transgenes

The means and compositions used to deliver the vector containing the angiogenic protein transgene depend on the particular vector used, as is well known in the art. Typically, however, the vector may be in the form of an injectable preparation containing a pharmaceutically acceptable carrier / excipient, for example phosphate buffered saline. Other pharmaceutical carriers, formulations and doses are described below.

Currently preferred means of in vivo delivery (especially for vectors that would otherwise not be targeted for delivery and / or expression limited to the myocardium) would be to inject the vector directly into the blood vessel that supplies the myocardium, preferably one or two tubular By injection into an artery. Such injection is preferably substantially (typically at least about 1 cm) in the lumen of one or two coronary arteries or in the lumen of one or more saphenous veins or in an internal mammary graft or other blood vessel that delivers blood to the myocardium. ) By the catheter introduced. Preferably the injection is made in two coronary arteries so as to be universally distributed in all areas of the heart.

The vector is delivered in an amount sufficient for the transgene to be expressed and provide therapeutic benefit. In the case of viral vectors (such as adenoviruses), the final titer of the virus in the injectable preparation is preferably in the range of about 10 ⁶ to 10 ¹⁴ virus particles capable of effective gene delivery. Preferably, adenovirus vector stocks devoid of wild-type virus are measured in the lumen of one or two coronary arteries (or grafts), preferably in the right and left coronary arteries (or grafts), preferably by an optical density meter. in an amount of virus-like particles of the bar 10 ⁸ to 10 ¹² can deeply be injected. Preferably the vector is delivered to each blood vessel (eg in each coronary artery) in a single injection.

By injecting the vector composition directly into the lumen of the coronary artery by a coronary catheter, it is possible to more efficiently target the gene and minimize the loss of the recombinant vector to the proximal aorta during injection. This type of injection makes it possible for local transformation of the desired number of cells, especially cardiomyocytes, to occur in the myocardium affected by angiogenic protein- or peptide-coding genes, thereby maximizing the therapeutic effect of gene transfer and In addition, unwanted angiogenesis in the extracardiac region is minimized.

Angiogenic protein trans incorporation of vector constructs specifically targeted to the myocardium, such as myocardial-specific binding or uptake components, and / or under the control of myocardial-specific transcriptional regulatory sequences (such as ventricular myocyte-specific promoters) Vectors incorporating genes may be used in place of, or preferably in conjunction with, such techniques as a means of further limiting expression to myocardium, particularly ventricular myocytes. For vectors capable of eliciting an immune response, additional techniques for limiting the possibility of extracardiac expression may also be used, but it is preferred to inject the vectors directly into the blood vessels supplying the myocardium as described above.

As described in detail below, by using such a technique to deliver viral vectors containing angiogenic transgenes in vivo, no transgene expression occurred in hepatocytes, and in urine at any point after coronary infusion. It was proved that no viral RNA was found. In addition, as confirmed by PCR two weeks after transcolonial delivery of the transgene in this manner, no evidence of extracardiac gene expression in the eye, liver, or skeletal muscle was detected.

Various catheters and delivery routes can be used to effect intra-arterial delivery, as is known in the art. Direct coronary (or grafting vascular) infusion can be performed using standard transdermal catheter-based methods under fluoroscopic guidance. Any of a variety of coronary catheter, or for example stack perfusion catheter, can be used in the present invention. For example, modified catheters, as well as a variety of general purpose catheters suitable for use in the present invention, are available from commercial suppliers such as Advanced Cardiovascular System (ACS), Target Therapeutics. , Boston Scientific and Cordis. In addition, where delivery to the myocardium is by direct injection into the coronary artery (which is the most preferred case), many approaches can be used to introduce the catheter into the coronary artery, as is known in the art. For example, the catheter can be conveniently introduced into the femoral artery and then retrograde through the iliac and abdominal aorta and extend into the coronary artery. Alternatively, the catheter is first introduced into the bronchus or carotid artery and then extends back into the coronary artery. A detailed description of these and other techniques can be found in the literature (Topol, EJ (ed.), The Textbook of Interventional Cardiology, 2nd Ed. (WB Saunders Co. 1994); Rutherford, RB, Vascular Surgery, 3rd (WB Saunders Co. 1989); Wyngaarden JB et al. (Eds.), The Cecil Textbook of Medicine, 19th Ed. (WB Saunders, 19920; and Sabiston, D, The Textbook of Surgery, 14th Ed. (WB Saunders Co. 1991).

Targeted Gene Expression

An unexpected finding of the present invention is that the recombinant adenovirus is very effectively absorbed on the first blood vessel it encounters. Indeed, in the animal model of Example 4 below, the efficiency of viral uptake in the heart after intracoronary injection was 98%. That is, 98% of the virus was removed during the first passage of the virus through the myocardial vessels. Furthermore, serum taken from animals during infusion did not grow virus plaques until it was diluted 200-fold (Graham, Virology, 163: 614-617, 1988), which was a serum factor (or binding protein) that inhibited virus growth. Implies the existence of. These two factors (the effective first pass adhesion of the virus and the possibility of serum binding proteins) will work together to limit gene expression on the first blood vessel on which the virus will encounter.

To further assess the extent to which gene delivery was limited to the heart after intracoronary gene delivery, viral DNA was used two weeks after gene delivery in two treated animals using polymerase chain reaction (PCR). It was examined whether there is any evidence that is present outside the heart (Example 4 below). Animals showed the presence of viral DNA in the heart, not in their retina, skeletal muscle, or liver. The sensitivity of PCR was enough to detect a single DNA sequence per 5,000,000 cells. Therefore, these data demonstrated that viral DNA was absent in extracardiac tissue two weeks after gene transfer. These results were further confirmed using other angiogenic proteins and derivatives as described below. These findings are extremely important because they confirm the concept of transgene targeting of the heart (ie provide expression of the transgene in the heart and not elsewhere). Localized transgene delivery and expression offers the advantage of safety and further increases the frequency of using the methods of the invention in the treatment of patients.

Therapeutic application

The methods of the invention for delivering transgenes encoding angiogenic proteins in vivo are intended for the treatment of congestive heart disease (including diseases associated with expanded cardiomyopathy (DCM) and severe coronary artery disease (CAD)), and ventricular remodeling. It can be applied to prevent or alleviate the problem. As the data below shows, the expression of angiogenic transgenes exogenously presented in the myocardium promotes angiogenesis, resulting in increased blood circulation and function in the ischemic and non-ischemic regions of the heart. This increased vascular quality will relieve congestive heart disease and offset ventricular dysfunction associated with ventricular remodeling.

As described herein, many different vectors can be used to deliver angiogenic protein transgenes according to the methods of the present invention. For example, the replication-deficient recombinant adenovirus vectors exemplified herein achieved very effective in vivo gene delivery without causing cytotoxic effects or inflammation in the gene expression region.

In treating congestive heart disease, gene delivery of angiogenic proteins encoding transgenes can be performed, for example, after diagnosis of heart disease or after an occurrence similar to heart disease is diagnosed. To treat ventricular remodeling, gene transfer can be performed at any point after the patient suffers from infarction, preferably within 30 days after infarction, more preferably within 7 to 20 days after infarction.

The compositions or products of the present invention may conveniently be presented in the form of a formulation suitable for administration into the blood stream (eg, by coronary infusion). Appropriate mode of administration can be best determined individually by the person who is practicing medical care for each patient. Suitable pharmaceutically acceptable carriers and their formulations are described in standard formulation literature (EW Martin, Remington's Pharmaceuticals Sciences; Wang, YJ and Hanson, MA, "Parental Formulations of Proteins and Peptides: Stability and Stabilizers", Journals of Parental Sciences and Technology, Technical Report No. 10, Supp. 42: 2S (1988). The vectors of the present invention are preferably buffer solutions that are generally considered safe in the art, at solutions of neutral pH, for example from about pH 6.5 to about pH 8.5, more preferably from about pH 7 to 8. For example, excipients which make the solution almost isotonic, such as pH buffered with sodium phosphate, for example 4.5% mannitol or 0.9% sodium chloride, from 0.1% to 0.75%, more preferably from 0.15% to methacresol It should be formulated with an acceptable preservative such as 0.4% methacresol. Desired isotonicity can be achieved using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium nitrate, propylene glycol, polyols (such as mannitol and sorbitol), or other inorganic or organic solutes. Sodium chloride is particularly preferred for buffers containing sodium ions. If desired, solutions of such compositions can also be prepared to enhance shelf life and stability. Therapeutic useful compositions of the present invention are prepared by mixing the components according to universally acceptable procedures. For example, the selected ingredients may be mixed to produce a concentrated mixture and then adjusted to final concentration and viscosity by adding water and / or additional solutes to adjust buffer or tonicity to adjust pH. .

For use by a physician, the composition will be provided in unit dosage form containing an amount of a vector of the invention that is effective to induce angiogenesis sufficient to provide a therapeutic effect in one or several administrations. As will be appreciated by those skilled in the art, the effective amount of therapeutic agent will depend on many factors, including the age and weight of the patient, the condition of the patient, the degree of angiogenesis to be obtained, and other factors.

An effective amount of a compound of the present invention will typically be in the range of about 10 ⁶ to 10 ¹⁴ virus particles, preferably about 10 ⁸ to 10 ¹² virus particles. The number of viral particles however should preferably not exceed 10 ¹⁴ . As will be appreciated, the exact dose to be administered will be determined by the clinician taking care of the patient, but preferably an amount of up to 5 ml, more preferably 1 to 3 ml, in physiological buffers (such as phosphate buffered saline) good.

In the case of heart disease, the presently preferred mode of administration is by intracoronary infusion into one or two coronary arteries (or into one or more saphenous veins or internal mammary artery grafts) using an appropriate coronary catheter.

The following examples are provided to further assist those skilled in the art. Such embodiments are provided for purposes of illustration and therefore should not be considered as limiting of the invention. Many exemplary variations and modifications are described herein and others will be apparent to those skilled in the art. Such changes are considered to be included within the scope of the invention as described and claimed herein.

The present invention provides for the treatment of congestive heart disease (including congestive heart disease as well as dilated cardiomyopathy associated with severe coronary artery disease) by introducing into the patient's myocardium a transgene encoding an angiogenic protein, and A method and composition for preventing or alleviating deleterious ventricular remodeling. Various aspects of the invention are as follows:

Congestive heart disease, comprising delivering a vector comprising a transgene encoding an angiogenic protein or peptide operably linked to a promoter for expression of the transgene in the heart of a patient with congestive heart disease How to treat a patient who is sick. Some patients with congestive heart disease show dilatable cardiomyopathy. Other patients with congestive heart disease typically have severe myocardial infarction associated with severe or obstructive coronary artery disease. Synthesis of angiogenic proteins in the myocardium promotes angiogenesis and increases blood circulation. The vector is preferably introduced into blood vessels that supply blood to the heart myocardium to deliver the vector to the cardiomyocytes. Preferably, the vector is introduced into the lumen of the coronary artery, the saphenous vein graft, or the internal mammary artery graft; Most preferably, the vector is introduced into the lumen of the right and left coronary arteries. Intra-arterial infusion is preferably made relatively deep within the artery, preferably at least about 1 cm into the lumen of the left and right coronary arteries. Intra-arterial injection may also be made at about 1 cm of the lumen of the saphenous vein graft and / or the internal mammary artery graft, which may be in addition to the intra-coronary injection. The vector can be delivered to each such vessel in a single injection.

Consisting of delivering a vector containing a gene encoding an angiogenic protein or peptide operably linked to a promoter for expression of the gene in the heart of a patient suffering from (or suffering from) myocardial infarction And to prevent or alleviate harmful ventricular remodeling in a patient suffering from (or potentially suffering from) myocardial infarction. Induction of angiogenesis by the synthesis of angiogenic proteins in the myocardium increases blood circulation and mitigates harmful ventricular remodeling.

In a preferred method of promoting angiogenesis in the treatment of heart disease according to one of the preceding embodiments, the vector may comprise FGF (fibroblast growth factor), VEGF (vascular endothelial growth factor), PDGF (platelet-derived growth factor) or IGF. At least one gene encoding an angiogenic protein or peptide from a family of (insulin-type growth factors). In certain preferred embodiments, vectors include, but are not limited to, FGF-4, FGF-5, FGF-6, aFGF (also known as FGF-1) and bFGF (also known as FGF-2) Genes encoding FGFs. Preferred angiogenic proteins are those that are naturally secreted, or those that are modified to increase secretion. Currently preferred of such angiogenic proteins are forms of FGF-4, FGF-5, FGF-6, FGF-1 and FGF-2 which are naturally secreted or modified to increase secretion. In other embodiments, genes are not limited to, but are members of the VEGF-A family (such as VEGF-121, VEGF-145, VEGF-165, VEGF-189 and VEGF-206), the VEGF-B family (such as VEGF -167 and VEGF-186), and members of the VEGF-C family (such as PDGF or IGF), encode VEGF.

The angiogenic protein-encoding gene is operably linked to a promoter that specifies the transcription and expression of the gene in mammalian cells, preferably cardiomyocytes. One presently preferred promoter is the CMV promoter. In another preferred embodiment, the promoter is a tissue specific promoter, preferably a heart-specific promoter, more preferably a ventricular myocyte-specific promoter. Preferred examples of ventricular myocyte-specific promoters are the ventricular myosin light chain-2 promoter and the myosin heavy chain promoter. Preferably, the gene encoding the angiogenic factor is also operably linked to a polyadenylation signal.

In a preferred method of treating heart disease (including DCM) according to the invention or in a preferred method of alleviating harmful ventricular remodeling (eg after myocardial infarction), the vector is a viral vector or a lipid-based vector, preferably a virus. Castle vector. The vector may be a targeted vector, particularly a vector that preferentially targets ventricular myocytes. Currently preferred viral vectors are those derived from adenoviruses (Ad) or those derived from adeno-associated viruses (AAV). Although two human and non-human viral vectors can be used, the preferred recombinant viral vector is one that cannot replicate in humans (replica-deficient). If the vector is adenovirus, it is preferably a poly with a promoter operably linked to the gene encoding FGF (eg FGF-1, FGF-2, FGF-4, FGF-5 or FGF-6). Contains nucleotides and cannot be reproduced in humans. Presently preferred replication-deficient adenovirus vectors have a deletion to remove the E1A and E1B genes, or have a deletion to remove the E1A, E1B and E4 genes. Preferably about 10 ⁶ to 10 ¹⁴ adenovirus vector particles, more preferably about 10 ⁸ to 10 ¹² vector particles are introduced into the blood vessel, preferably the blood vessel that supplies the myocardium. Most preferably, adenovirus vectors containing angiogenic protein-encoding genes are introduced by direct coronary injection into the lumen of two coronary arteries in the patient's heart.

In the case of an AAV vector, the vector preferably comprises a polynucleotide having a promoter with AAV converted terminal repeats (ITRs) operably linked to a gene encoding the angiogenic protein on either side. Preferably, AAV vectors cannot be replicated in humans. Presently preferred replication-deficient AAV vectors have deletions that affect one or more AAV replication or encapsulation sequences. More preferably, both AAV rep and cap genes are removed (as a result, as is known in the AAV art, typically must be supplied in trans so that AAV vectors are replicated and packaged in packaging cell lines). .

The vector may also be a lipid-based vector containing genes encoding angiogenic proteins. Various such lipid-based vectors are well described in the art, including liposomes, micelles and lipid-containing emulsions.

Preferred methods of the invention include treatment of patients suffering from heart disease and / or ventricular remodeling.

Example 1 describes a model of heart disease induced by prolonged ventricular tachycardia (extended 3-4 week period or longer). This example shows that in animal models of heart disease, left ventricular myocardial hematoma is abnormally low when the left ventricle is swollen and a signal of heart disease is present. In this model, myocardial demands sometimes induce myocardial ischemia in place of myocardial blood circulation (oxygen supply).

Example 2 demonstrates the construction of the adenovirus vector used in the present invention.

Example 3 describes preliminary in vitro experiments to ensure the potency of the adenovirus vectors of the invention. Control (β-galactosidase-encoded) adenovirus vectors (AdlacZ) were also tested. The results showed that the recombinant adenovirus vector of the present invention can actually infect mature cardiomyocytes and provide high efficiency for expression of the transgene. In vivo studies were then performed.

Example 4 shows in vivo infection of pig myocardium with an adenovirus vector (AdLacZ) encoding β-galactosidase and expression of β-gal in the myocardium.

Example 5 shows that virus-mediated in vivo delivery of the FGF-5 angiogenic transgene to the myocardium can improve local hematogenesis and can improve local myocardial contractile dysfunction.

Example 6 shows that virus-mediated in vivo delivery of the FGF-4 angiogenic transgene to the myocardium can improve local hematogenesis and can improve local myocardial contractile dysfunction.

Example 7 shows that virus-mediated in vivo delivery of the FGF-2 angiogenic transgene to the myocardium can improve local blood circulation and improve local myocardial contractile dysfunction.

Example 1

Porcine Model of Congestive Heart Disease and Associated Myocardial Ischemia

1-A. Animal and Surgery Courses

Nine yorkshire pigs (Sus scrofa) weighing 40 ± 6 kg were subjected to ketamine (50 mg / kg IM) and atropine sulfate (0.1 mg / kg IM) followed by sodium amital (100 mg / kg IV). Anesthesia was used. After intubation, halotan (0.5% to 1.5%) was delivered by pressure-circulating ventilator throughout. When the left chest was opened, the catheter was placed in the aorta, the pulmonary artery, and the left atrium. A Königsberg micromanometer was placed in the left ventricular apex and the unipolar lead of the epicardium was placed 1.0 cm below the ventricular groove in the side wall of the left ventricle. A force generator (Spectrax 5985; Medtronic, Inc.) was inserted into the subcutaneous pocket of the abdomen. Four animals were equipped with a flow probe (Transonic, Inc.) around the main pulmonary artery. Loosely close the pericardium and close the chest. Seven to ten days after thoracotomy, background measurements of hemodynamics, left ventricular function, and myocardial blood circulation were made. The heart rate of the ventricles was then started (220 ± 9 bpm (beats per minute) for 26 ± 4 days). The magnitude of the stimulus was 2.5 V and the pulse duration was 0.5 ms. In addition 9 pigs (40 ± 7 kg) were used as control; Thoracotomy was performed on five rats as described above, and was sacrificed 30 ± 7 days after the initial thoracotomy with a machine without pacing. The data for right and left ventricular masses were similar in control animals regardless of whether they had thoracotomy, and therefore their data were collected in a single control group.

1-B. Hemodynamic Study

Hemodynamic data was obtained from a conscious, excited animal after deactivating the pacemaker for at least 1 hour and then returning the animals to their basal state. All data were obtained at 7 day intervals in each animal. Pressure was obtained from the left atrium, the pulmonary artery, and the aorta. Left ventricular dP / dt was obtained from a reliable left ventricular pressure. The flow of the pulmonary artery was recorded. Blood samples of the aorta and lung were obtained to calculate the difference in arteriovenous oxygen content.

1-C. Ultrasound Cardiac Echo Scan Study

Ultrasound echocardiography is a method of measuring local myocardial blood circulation, which involves injecting a contrast agent into an individual or animal. Contrast material (microaggregates of galactose) increases echogenicity ("white") of the image after left atrial injection. Microaggregates are distributed in a manner proportional to blood flow into the coronary and myocardial walls (Skyba, et al., Circulation, 90: 1513-1521, 1994). Peak intensity of contrast enhancement correlates with myocardial blood flow as measured by microspheres (Skyba, et al., Circulation, 90: 1513-1521, 1994).

Two-dimensional and M-method imaging was obtained using the Hewlett Packard Sonos 1500 imaging system. Images were obtained at the mid-projectile muscle level from the right para sternum approach and recorded on VHS tape. Measurements were made according to the criteria of the American Association of Ultrasound Cardiology (Sahn, DJ, et al., Circulation 58: 1072-1083 (1978)). Due to the centerline orientation of the interventricular septum (IVS) of pigs and the use of the right parasternal diagram, IVS and Short axis M-method measurements were made through the anatomical sidewalls. All parameters, including end-dilator dimensions (EDD), end-deflator dimensions (ESD), and wall thickness, were measured for at least five random end-breath beats and averaged. End-dilator dimensions were obtained when the QRS composite was started. End-shrinkage dimensions were obtained for the maximum side position of IVS or at the end of the T wavelength. Left ventricular systolic function was assessed by using partial shortening, FS = [(EDD-ESD) / EDD] × 100. % Wall thickness (% WTh) was calculated as% WTh = [(ESWTh-EDWTh) / EDWTh] x 100. To demonstrate the reproducibility of the ultrasound cardiac echo test measurements, animals were imaged over two days before beginning the heart rate tuning protocol. Data obtained from separate measurements showed very high reproducibility (partially shortened, R ² = .94, P = .006; sidewall thickness, R ² = .90, P = .005). All these measurements were obtained using an inactive pacemaker.

1-D. Myocardial blood circulation

Myocardial hematogenesis is described in detail in the prior art (Roth, DM, et al., Am. J. Physiol. 253: H1279-H1288, 1987; Roth, dm, et al., Circulation 82: 1778-1789, 1990) by radioactive microsphere technique. The transmural samples from the left ventricular side wall and the IVS were divided into three intracardiac, middle wall, and epicardium, and blood circulation and flow across the wall for each third were measured. The portion across the wall was obtained from the area where the intracardiac measurements were made such that blood flow and functional measurements could correspond within each phase. Microspheres were injected at 7 days intervals during ventricular pacing at the control state (not pacemaker), at the onset of ventricular pacing (225 bpm), and at 225 bpm; Microspheres were also injected at 14 days (n = 4) and 21 to 28 days (n = 3) with an inactive pacemaker. Myocardial blood circulation per beat was calculated by dividing myocardial blood circulation by heart rate (recorded during microsphere infusion) (Indolfi, C., et al., Circulation 80: 933-993 (1989)). The average left atrium and average arterial pressure were recorded during the infusion of microspheres to calculate the assessment of coronary vascular resistance; The coronary resistance index is equal to (average arterial pressure-average left atrial pressure) ÷ coronary blood circulation across the wall.

1-E. Systolic wall pressure

Peripheral systolic wall pressure could not be measured because we could not obtain a suitable view for evaluating the long axis of the left ventricle. Therefore, the inventors have formulated Meridion end-deflator wall pressure (Riechek, N., et al., Circulation 65: 99-108 (1982)), formulating Meridion end-deflator wall pressure (dyne) = (0.334xPxD) ÷ [h (Ih / D)] (P is left ventricular end-contractor pressure, dyne; D is left ventricular end-contractor diameter, cm; h is end-contractor wall thickness). Meridion end-deflator wall pressures were calculated for the side wall and IVS prior to initiating pacemaker and subsequently at weekly intervals (no pacemaker).

1-F. Terminal surgery

After 26 ± 2 days of continuous pacemakers, animals were anesthetized, cannulated, and a sternal anatomical centerline created. Place the still beating heart in saline (4 ° C.), quickly coronate the coronary artery with saline (4 ° C.), weigh the right ventricle and left ventricle (including IVS), and sample across the wall from each region. Was quickly frozen in liquid nitrogen and stored at -70 ° C.

1-G. Adenine nucleotide

ATP and ADP were measured from samples across the walls of the side wall and IVS obtained from four animals suffering from heart disease (tracing for 28 days) and four control animals. Samples from animals with heart disease were obtained without pacemaker (60 minutes) on the day of animal sacrifice. Samples were obtained identically from all animals. ATP and ADP were measured by Waters high performance liquid chromatography (Pilz, R.B., et al., J. Biol. Chem. 259: 2927-2935 (1984)).

1-H. Statistical analysis

Data are expressed as mean ± standard deviation (SD). Specific measurements obtained at control intervals from the control (primary pacemaker) state and at weekly intervals were compared by repeated measures ANOVA (Crunch4, Crunch Software Corp.). In some comparisons (eg sidewall vs. IVS) a two way ANOVA was used. Post hoc comparisons were performed using the “tucky method” as described in the art. Nine animals survived at 21 days of pacing; Six of these animals survived at 28 days of pacing. Data from animals surviving on day 28 was distinguished from data from animals surviving only on day 21. Therefore, ANOVA was performed on 9 animals at 4 time points: control (primary pacing), 7th, 14th, and 21st-28th days. When P RK .05 is smaller (2-tailed), the meaningless hypothesis was discarded.

result

1-I. Hemodynamics Research

Fast ventricular pacemakers resulted in changes in hemodynamics, which were significant after 7-14 days. On day 7, the animals had increased mean left arterial pressure and pulmonary artery pressure. These pressures became more and more abnormal as the pacemaker continued (Table 1 below). Signals of circulating congestion (rapid breathing, ascites, tachycardia) were apparent at days 14-21. Pulmonary artery flow (cardiac output) decreased at 21 days of pacemaker (control, 3.3 ± 0.1 L / min; 21 days, 1.9 ± 0.4 L / min; P <.05).

1-J. Holistic left ventricular function

Left ventricular function was assessed by echocardiography and hemodynamic parameters after deactivation of pacemakers. Partial shortening gradually decreased with the pacemaker period (P = .0001; Table 1), reaching the lowest value at 21-28 days (control, 39 ± 3%; 21-28 days, 13 ±). 4%; P <.0002). Left ventricular end-dilator dimensions gradually increased during cardiac pacing (P <.0001; Table 1), reaching the highest values between 21 and 28 days (control, 3.9 ± 0.4 cm; 21 to 28 days, 5.8 ± 0.6 %; P = .0002). Left ventricular peak positive dP / dy was also reduced throughout the study (P = .0001; Table 1). The gradual drop in dP / dt was accompanied by an increase in left ventricular end-dilator pressure, indicating that increased preload normally increased the left ventricular peak dP / dt (Mahler, F., et al., Am. J. Cardiol. 35: 626-634 (1975).

1-K. Local function of the left ventricle

As the pacemaker was deactivated, local left ventricular function was assessed by measuring the left ventricular sidewall and% wall thickness of the IVS. Ventricular tachycardia from the sidewalls caused a significant weakening of the function of the sidewalls as compared to IVS (P = .0001; FIG. 1 and Table 2). This difference was equivalent to day 7 and further increased from 21 to 28 days as the sidewall function deteriorated. IVS showed an insignificant decrease in wall thickness over the course of the study. The end-dilator wall thickness was found to gradually become thinner during the study, which was more severe at the sidewalls (Table 2).

1-L. Local blood circulation of the left ventricle

Subcardiac hematogenesis per minute increased more in IVS than in the side wall when pacing was started (FIG. 2 and Table 3 below). This difference in local blood circulation during cardiac pacing persisted during the study and the pattern of blood circulation change was different between the two regions (P = .006). The pattern of change in blood circulation per minute between the two regions of cardiac pacing is intracardiac (P = .006), medial wall (P = .002), extracardiac (P = .016), or septum (P = .003). Consistent depending on whether measured in parts (Table 3). In contrast, when the pacemaker was inactivated, the subcardiac hemostasis showed no local differences, even when measured at control, 14 days, or 21 to 28 days (Figure 2 and Table 3).

Intracardiac-to-cardiac hemostasis did not change significantly as heart disease progressed (P = .058). However, when initiating cardiac pacing, the intracardiac-to-cardiac ratio was substantially lower in the sidewall than in IVS (IVS, 1.32 ± 0.23; sidewall, 0.77 ± 0.10; P = .0002; Table 3). The ratio in both areas was greater than 1.0 over the remainder of the study. Intracardiac blood flow per beat (FIG. 2 and Table 4) was similar in both regions prior to onset of pacemaker (IVS, 0.013 ± 0.003 mL · min −1 −g −1 beat-1; sidewall, 0.012 ± 0.004 mL · min -1 g-1 beats-1; P = NS). At the onset of ventricular pacing (225 bpm), there was a local loss of intracardiac blood per beat on the sidewalls but not on IVS (IVS, 0.009 ± 0.002 mL min-1 g-1 beats-1). Sidewall, 0.005 ± 0.001 mL · min −1 − g − beat −1; P = .001). On days 14 and 21-28, intracardiac hematogenesis was less on the sidewalls than in IVS during the pacemaker period (Figure 2 and Table 4). These data indicate that myocardial low perfusion at the sidewall begins with the onset of pacemaker and this relative ischemic state persists. However, intracardiac blood circulation remained normal in both regions even without a pacemaker (Figure 2 and Table 4).

Blood circulation in both regions tends to increase during the final week of pacemaker (Figure 2 and Table 3). This pattern is associated with a gradual drop in the coronary vascular resistance index (FIG. 3), suggesting that alterations in coronary vascular structure and function may involve remodeling of the left ventricle as heart disease progresses. Coronary vascular resistance index was significantly greater in the sidewall than in IVS when heart rate was initiated, and the pattern of change in coronary vascular resistance was different between the two regions (P = .0012) (FIG. 3). These findings would indicate the effect of altered electrical activation on myocardial perfusion.

1-M. Left Ventricular End-Shrink Wall Pressure

There was a significant increase in the estimated Meridion end-deflator wall pressure with respect to the duration of pacemaker (P <.0001), but the pattern of change in wall pressure was similar to that for the sidewall and IVS (P = 33), but after hoc The test showed no local difference in systolic wall pressure at any particular time point (FIG. 3). The increase in end-shrink wall pressure was approximately three times that of the sidewall (control, 168 ± 40 × 10 ³ dynes; 28 days, 412 ± 143 × 10 ³ dynes; P = .0001) approximately 3 than that of IVS (Control, 159 ± 35 × 10 ³ dynes; 28 days, 480 ± 225 × 10 ³ dynes; P = .0001).

1-N. autopsy

At necropsy, animals with heart disease had ascites (average, 1809 mL; range, 300 to 3500 mL), had an expanded, thin-walled heart, and all four rooms and threads were coarsely enlarged. Appeared. The weight ratio of the ventricles to body weight indicated the hypertrophy of the right ventricle alone, which confirms the data obtained earlier using this model [Roth, D.A., et al., J. Clin. Invest. 91: 939-949 (1993). There was no change in the left ventricle associated with heart disease when compared to control animals that matched weight (control, 112 ± 10 g; heart disease, 114 ± 17 g); Left ventricular weight ratio to body weight was also similar in the two groups (control, 2.8 ± 0.3 g / kg; heart disease, 2.9 ± 0.3 g / kg). In contrast, heart disease was associated with increased right ventricular weight (control, 38 ± 3 g; heart disease, 52 ± 11 g; P = .003) and weight ratio of right ventricle to weight (control, 0.09 ± 0.1 g / kg; heart disease, 1.3 ± 0.3 g / kg; P <.003). The phased animals increased 4 kg during the study period and this amount partially shows ascites accumulation. If the initial body weight is used to calculate the left ventricular weight to weight ratio, the ratio is still not significantly higher than that obtained from the matched control animals. These data confirm that there was no substantial increase in left ventricular weight during the study.

1-O. Adenine nucleotide

Reported in pig heart collected by drill biopsy followed by immediate subprecipitation into liquid nitrogen [White, F.C., and Boss, G., J. Cardiovasc. Pathol. 3: 225-2236 (1990), control animals showing normal ATP / ADP ratios demonstrate that the sampling technique used was adequate. Animals suffering from heart disease were from IVS (control, 14.8 ± 1.1; heart disease, 2.4 ± 0.3; P <.0001, n = 4 both groups) and from the sidewalls (control, 14.3 ± 4.0; heart disease, 2.4 ± 0.9; P = .0012, n = 4 Both groups) showed a significant decrease in the ATP / ADP ratio in the samples taken. This proves that there is a balance between oxygen supply and demand of the myocardium.

1-P. Myocardial blood circulation

Local changes in myocardial blood circulation, which are immediate consequences of rapid ventricular pacemakers, will play a role in the pathogenesis of local and global dysfunction in pacemaker-induced heart disease. During cardiac pacing, a difference in myocardial blood circulation per minute was found between the left ventricular sidewall (adjacent to the stimulus site) and the IVS. Reduced blood circulation appeared on the sidewalls immediately after the pacemaker started and remained for 21 to 28 days. Left ventricular sidewalls receiving less blood than IVS during cardiac pacing showed a gradual decrease in wall thickness (pace pacing) during pacing between 21 and 28 days. In contrast, IVS, which received a greater amount of blood during pacing, maintained a relatively normal wall thickness during pacing between 21 and 28 days.

Because myocardial blood circulation per minute does not readily allow for access of relative myocardial ischemia, we also indicated coronary flow as intracardiac blood circulation per beat. The physiological basis for such an analysis is that local intracardiac subcardiac hemorrhage (rather than the outer wall of septum flow) is the primary determinant of local myocardial contraction under progressive coronary stenosis [Gallagher, KP, et al., Am . J. Physiol. 16: H727-H738 (1984)] and increased heart rate move this flow-function relationship downward, with local function lower at any level of subcardiac blood circulation [Delbaas, T., et. al., J. Physiol. 477: 481-496 (1990). However, if the flow-function relationship is plotted as local function versus intracardiac blood flow to compensate for the heart rate effect, there is a single relationship at different heart rates, which is when the coronary blood circulation decreases and the intracardiac blood flow per heart rate decreases. This mainly refers to determining the level of wall function [Indolfi, C., et al., Circulation 80: 933-993 (1989); Ross, J., Circulation 83: 1076-1083 (1991)]. Initiating cardiac pacing resulted in a 50% or more decrease in intracardiac blood circulation per beat in the side wall compared to IVS (P <.001; Table 4).

In a previous study in conscious pigs, we found that a 50% reduction in intracardiac blood circulation resulted in a 50% reduction in local function, and the per-beat subtype similar to that observed in the sidewall in this study (Table 4). Proved to be associated with intracardiac blood circulation. The decrease in blood circulation in the sidewalls during cardiac pacing persisted throughout the study. These data provide evidence for myocardial ischemia at the sidewalls when the ventricular pacing is initiated. In contrast, IVS function and intracardiac blood circulation per beat remained relatively normal. After the pacemaker disappeared, the percardiac subcardiac hemorrhage remained normal in both areas throughout the course of the study, while local dysfunction persisted in the sidewalls coincided with the occurrence of myocardial stunning in that area. . Therefore, the inventors considered that sustained ischemia of the side wall would have a significant effect on the overall function during and after cardiac pacing.

Example 2

Preparation of Adenovirus Constructs

A helper independent replication deficient human adenovirus-5 system was used. As an early example for vector constructs, we used genes encoding β-galactosidase and FGF-5. Recombinant adenoviruses encoding β-galactosidase or FGF-5 were constructed using full length cDNA. The system used to make the recombinant adenovirus contained a packing limit of about 5 kb for the transgene insert. Each of the β-gal and FGF-5 genes operably linked to the CMV promoter and having the SV40 polyadenylation sequence was less than 4 kb and therefore included within the packaging limits.

The full-length cDNA for human FGF-5 was plasmid pLTR122E [Zhan et al., Mol.] As a 1.1 kb ECOR1 fragment containing 981 bp of the open reading frame of the gene. Cell. Biol., 8: 3487, 1988] and cloned into the polylinker of the shuttle vector plasmid ACCMVpLpA. Nucleotide and amino acid sequences of FGF-5 are shown in the literature [Figure 1 in Zhan et al., Mol. Cell. Biol., 8: 3487, 1988]. pACCMVpLpA has also been described in the literature [Gomez-Foix et al., J. Biol. Chem., 267: 25 129-25134, 1992]. pACCMVpLpA is a region wherein the E1 region is substituted with human cytomegalovirus enhancer-promoter (CMV promoter) and multiple cloning sites (polylinkers) from pUC 19 (vectors well known in the art), and then with SV40 polyadenylation signal. Contains the 5 'end of the adenovirus serotype 5 genome (map units 0-17). The lacZ-encoded control adenovirus is based on E1A / E1B deletions from map units 1 to 9.8. FGF-5-encoded adenovirus (Ad.FGF-5) is based on E1A / E1B deletions from map units 1.3 to 9.3. Both of these vectors eliminate the entire E1A coding sequence and most of the E1B coding sequence. Both vectors have transgene inserts cloned in anti-sense orientation compared to adenovirus sequences. Therefore, in the unlikely event of read-through transcription, the adenovirus transcript will be antisense and will not express viral protein.

FGF-5 gene-containing plasmid was co-transformed into plasmid JM17 (pJM17) containing the whole human adenovirus 5 genome with an additional 4.3 kb insert into 293 cells (calcium phosphate precipitation) ), Too large pJM17 to be encapsidated into mature adenovirus virions. The cells were then covered with nutrient agarose. Infectious virus particles containing angiogenic genes were prepared by homologous recombination in 293 cells and isolated as single plaques after 10-12 days. (Identification of successful recombinant viruses was also performed by co-transformation by lipofection and by direct microscopic observation of cytopathological effects as described in literature [Zhang et al., Biotechniques 15 (5): 868-872, 1993). The resulting adenovirus vector contains the transgene but lacks the E1A / E1B sequence and is therefore replication-deficient. Adenovirus vectors containing the FGF-5 gene are also referred to herein as Ad.FGF-5.

Although these recombinant adenoviruses are incapable of replicating in mammalian cells, they can also be propagated in 293 cells transformed with E1A / E1B and provide these essential gene products as trans. Recombinant virus from individual plaques was propagated in 293 cells and viral DNA was characterized by restriction analysis.

Plaque purification was then performed twice using standard procedures for successful recombinant viruses. Virus stocks were grown in 293 cells with titers ranging from 10 ¹⁰ to 10 ¹² virus particles per milliliter (ml) as measured by an optical density meter. Human 293 cells were infected at a density of 80% and culture supernatants were obtained after 36 to 48 hours. After performing a freeze-thaw cycle on the virus-containing supernatant, the cell debris was pelleted by standard centrifugation, and then the virus was subjected to two cesium chloride (CsCl) gradient ultracentrifuges (discontinuous 1.33 / 1 / 45 CsCl gradient; CsCl prepared in 5 mM Tris, 1 mM EDTA, pH 7.8; further purified by 90,000 × g (2 hours), 105,000 × g (18 hours). Prior to in vivo injection, virus stocks were desalted by gel filtration through Sepharose columns (eg G25 Sephadex equilibrated with PBS). The final virus concentration was about 10 ¹¹ virus particles per ml as measured by an optical density meter. Virus stocks are conveniently stored in cells in medium at -70 ° C. For injection, the purified virus is preferably resuspended in saline. Adenovirus vector preparations were highly purified, resulting in no wild type (potentially replicating) viruses. Therefore, adenovirus infection and inflammatory invasion in the heart were minimized.

Example 3

Gene Transfer in Mature Rat Cardiomyocytes

Mature rat cardiomyocytes were prepared by Langendorff perfusion using collagenase containing perfusion following standard methods. The rod-shaped cells were cultured on laminin coated plates and infected at a multiplicity of 1: 1 using the β-galactosidase-encoded adenovirus obtained in Example 2 above at 24 hours. After another 36 hours, cells were fixed with glutaraldehyde and incubated with X-gal. Consistently, 70-90% of mature myocytes expressed β-galactosidase transgene after infection with recombinant adenovirus. Cytotoxicity was not observed when the multiplicity of infection was 1 to 2: 1.

Example 4

In vivo gene transfer into porcine myocardium

The β-galactosidase-encoded adenovirus vector obtained in Example 2 was propagated in an acceptable 293 cell, and the final of 1.5 × 10 ¹⁰ virus particles based on the procedure of Example 2 by CsCl gradient ultracentrifugation. Purified by virus titer. Thoracotomy was performed on anesthetized, ventilated 40 kg pigs. A 26 gauge butterfly needle was inserted into the middle left anterior downward (LAD) coronary artery and the vector (1.5 × 10 ¹⁰ virus particles) was injected at a volume of 2 ml in phosphate buffered saline. The chest was closed and the animals were allowed to recover. The animals died 4 days after injection. The heart was fixed with glutaraldehyde, incised and incubated for 16.5 hours with X-gal. After immersion and incision, the tissues were counterstained with eosin.

Tissue sections (sections across the walls of the LAD 96 hours after intracoronary injection of adenovirus containing lacZ) were analyzed under a microscope and found to be of considerable size on the LAD coronary artery containing many tissue sections. Gene transfer was observed, indicating that a substantial proportion of cells stained positive for β-galactosidase. Myocardial regions distant from the LAD circulation phase did not show X-gal staining, thus acting as a negative control, while diffusion expression of the gene was observed in myocytes and endothelial cells. Substantial proportions of myocytes showed β-galactosidase activity (blue staining), and in subsequent studies using coronary infusion of the closed chest, similar activity appeared 14 days after gene delivery (n = 8). There was no evidence of inflammation or necrosis in the gene expression region.

Example 5

Porcine model of angiogenesis-mediated gene therapy (using FGF-5 transgene)

In this porcine model of myocardial ischemia and heart disease, animals were stressed by electrical stimulation of the atria. After quantifying the degree of stress-induced myocardial dysfunction and inadequate local blood circulation, gene delivery was performed by injecting an exemplary recombinant adenovirus expressing FGF-5 into the coronary artery. Gene transfer was stable but was performed after limited endogenous angiogenesis occurred, and the patient showed an induced ischemia similar to angina. The animals did not show ischemia at rest, but exhibited ischemia during activity or attrition. Control animals received a recombinant adenovirus expressing lacZ (β-gal) to exclude the possibility that the adenovirus, which is independent of FGF-5, would itself stimulate new blood vessel formation. It also regulated for possible sustained concurrent angiogenesis not related to gene delivery. Two weeks after gene transfer, the stress-induced dysfunction of the heart and local blood flow were measured again.

Pigs receiving lacZ showed similar pacemaker-induced dysfunction in the ischemic zone before and two weeks after gene transfer. In contrast, two weeks after receiving the FGF-5 gene, the animals showed improved blood circulation and increased wall thickness in the ischemic region during pacemakers. The results demonstrated that gene delivery of the angiogenic transgene (FGF-5) was effective in attenuating local myocardial contractile dysfunction by opening local blood circulation through newly formed blood vessels.

Way

Animals and Models

A Yorkshire cattle pig (Sus scrofa, n = 27) weighing 47 ± 9 kg was used. Two animals were injected 3 or 5 days after injection into the coronary artery with a recombinant adenovirus expressing lacZ (10 ¹¹ virus particles in 2.0 ml saline). The remaining 25 animals received a catheter in the left atrium, pulmonary artery and aorta as a means to measure local blood circulation and the pressure was monitored. The wire was sealed to the left atrium to allow ECG recording and cardiac pacing. The americoid systolic was placed around the coronary artery near the left side of the base. The americoid material is hygroscopic and expands slowly, gradually leading to complete arterial occlusion 10 days after installation, with minimal infarction (<1% of the left ventricle) due to the development of parallel vessels. Myocardial function and blood circulation are normal at rest in areas previously perfused by the occluded arteries (ischemic areas), but when the myocardial oxygen demand increases, the blood circulation is insufficient to prevent ischemia. The development of concurrent blood vessels occurs completely within 21 days after the ameroid installation and remains unchanged for at least 4 months [Roth et al., Am. J. Physiol. 253: H1279-H1288, 1987]. Hydraulic cuffs were also installed around the atrium, adjacent the ameroid but on the base side. These procedures are described in detail in Hammond et al., J. Am. Coll. Cardiol. 23: 475-482, 1994 and Hammond et al., J. Clin. Invest. 92: 2644-2652, 1993. Two animals died 5 and 7 days after ameroid installation. After 38 (± 2) days after ameroid installation, studies were performed to define pacemaker-induced local function and blood circulation in animals when limited parallel circulation occurred and stabilized, and then lacZ (n = 7, control animals) or recombinant adenovirus expressing FGF-5 (n = 16, treatment group) was administered by intracoronary injection. Then, after 14 ± 1 days, the study was repeated to define pacemaker-induced local function and blood circulation. The next day, tissue was collected at the expense of AdlacZ (n = 7) and AdFGF-5 (n = 11) animals. Five AdFGF-5 animals were studied and killed 12 weeks after gene transfer.

Recombinant Adenovirus and Transgene Delivery.

A helper-independent replication-deficient human adenovirus-5 system was prepared as described in Example 2 above.

For intracoronary delivery of the transgene, animals were anesthetized and a 5F artery cover was placed in the carotid artery. A 5F multipurpose (A2) coronary catheter was inserted through the sheath into the coronary artery. The closure of the ameroid was confirmed by contrast injection in the left main coronary artery in all animals. The tip of the catheter was then inserted deep into the lumen of the artery to minimize the amount of material lost in the basal aorta during injection. 4 ml containing 2 × 10 ¹¹ viral particles of recombinant adenovirus were delivered by slowly injecting 2.0 ml each into the left and right coronary arteries.

black

(i) local contractile function and perfusion

Two-dimensional and M-mode images were obtained from an accurate parasternal approach at the dendritic muscle level using the Hewlett-Packard Sonos 1000 system. Conscious animals were studied by hanging them in a comfortable sling to minimize physical exertion. Images of the animals at basal state and again during left atrial tuning (heart rate = 200 bits per minute) were recorded on VHS tape. These studies were performed one day before gene transfer and 14 ± 1 day after gene transfer. Five animals were delivered with FGF-5 again and examined 12 weeks later to determine whether the effects on improved function persisted. The rate-pressure product and left atrial pressure were similar in both groups before and after gene transfer, indicating that myocardial oxygen demand and loading conditions were similar. Standardized criteria were used to create an echocardiographic echocardiography (Sahn et al., Circulation 58: 1072-1083, 1978). Five animals were imaged for two consecutive days to demonstrate the regeneration of the echocardiographic echocardiogram. The data obtained from the separate measurements were very reproducible (side wall thickness: r ² = 0.90; P = 0.005). In this model, the percent increase in function measured by ultrasound cardiac echocardiography and sonic microscopy through the thoracic cavity was comparable [Hammond et al., J. Am. Coll. Cardiol. 23: 475-482, 1994 and Hammond et al., J. Clin. Invest. 92: 2644-2652, 1993], which demonstrates the accuracy of ultrasound echocardiography for the evaluation of ischemic dysfunction. Analysis was performed without knowledge of treatment groups.

Contrast material (Levovist, microaggregate of galactose) increases the ultrasound echo generation (white) of the image after left atrial injection. Microaggregates are distributed in proportion to blood circulation in the coronary arteries and in the myocardial wall. Peak intensity of contrast enhancement correlates with blood flow in the myocardium as measured by microscopy [Skyba et al., Circulation 58: 1072-1083, 1978]. A contrast echocardiographic echocardiogram study was performed during attrition of the atrium (200 bpm) after ameroid closure, but before gene transfer, 38 (± 2) days after ameroid installation. The study was repeated 14 ± 1 days after gene delivery and in five animals 12 weeks after gene delivery using FGF-5. If an objective measure of video intensity was provided, the peak contrast intensity was measured from the video image using a computer-based video program (Color Vue II, Nova Microsonics, Indianapolis, Indiana). Data is expressed as the ratio of peak video intensity in the ischemic region (on LCx phase) divided by peak video intensity in the interventricular septum (IVS, the region that receives normal blood circulation through the left unobstructed anterior downward coronary artery). Differences in regional blood flow during atrial tuning measured by contrast echocardiographic echocardiography were similar to those measured by microspheres in the same model in our laboratory, which is an ultrasound cardiac for assessing local myocardial blood circulation. It is to prove the accuracy of the echo test. Contrast studies were divided without knowledge of which gene the animal received.

(ii) assessment of angiogenesis

A cannula was inserted into the pedicle artery and the other large vessels were ligated. Heparin (10,000 IU), papaverine (60 mg) and potassium chloride (to induce diastolic cardiac arrest) were injected intravenously, followed by cross-clamping of the aorta and perfusion of coronary vessels. Glutaraldehyde solution (6.25%, 0.1 M cacodylate buffer) was perfused at a pressure of 120 mmHg; Remove the heart; Phases were identified using color-encoded dye injected in an anterior direction through the left anterior downward coronary artery, the left coronary artery, and the right coronary artery; And the ameroid was examined to determine whether it was closed. Samples from normally perfused and ischemic regions (external and intracardiac 1/3) were plastic-inserted to prepare for microscopic analysis of capillary number. As previously described, Mathieu-Costello, Microvasc. Res. 33: 98-117, 1987 and Poole & Mathieu-Costello, Am. J. Physiol. 259: H204-H210, 1990] Four 1-μm-thick, transverse fragments were taken from each subsample (intracardiac and extracardiac of each region). The number of capillaries around each fiber and the fiber cross-sectional area of each of the eight fields in each subsample (randomly selected by global sampling) were measured at X1400 using an image analyzer (Videometric 150, American Innovision). The number of capillaries around the total 325 ± 18 fibers was measured. Capillary density (number per fiber cross-sectional area) was assessed by dot counting 15 ± 1 fields per subsample. The relative standard error, fiber cross-sectional area and capillary density of the capillary number around the fiber were 1.4, 4.1 and 4.2%, respectively. Capillary-to-fiber ratio was calculated as the product of capillary density and fiber cross-sectional area. There was no significant difference in fiber cross-sectional area in myocardial samples from each group. Bromodeoxyuridine (50 mg / kg) was injected into the abdominal cavity of five animals: control animals (no ameroid); Two animals had an ameroid occlusion that had received lacZ gene transfer two weeks ago; Two animals have an ameroid occlusion that received FGF-5 gene transfer two weeks ago. Animals were sacrificed 36 hours after injecting BRDU, using the method described above [Kajstyra et al., Circ. Res. 74: 383-400, 1994]. Fragments of duodenum were used as positive controls.

(iii) DNA, mRNA and protein expression

Following gene transfer, studies were conducted to demonstrate the presence and expression of transgenes for left ventricular equivalents. 500-bp expected with polymerase chain reaction (PCR) using sense primers for CMV promoter (GCAGAGCTCGTTTAGTGAAC; SEQ ID NO. 1) and antisense for internal FGF-5 sequence (GAAAATGGGTAGAGATATGCT; SEQ ID NO. 2) Fragments were amplified. 400 predicted RT-PCR, using sense primers for the beginning of the FGF-5 sequence (ATGAGCTTGTCCTTCCTCCTC; SEQ ID NO. 3) and antisense primers for the internal FGF-5 sequence (ie SEQ ID NO. 2) -bp fragment was amplified. Wild type or presynthetic virus DNA (TCGTTTCTCAGCAGCTGTTG; SEQ ID NO. 4) and (CATCTGAACTCAAAGCGTGG; SEQ ID NO. 5) in tissues were detected using primers specific for the adenovirus DNA E2 region. The expected 900-bp fragment was amplified from the recombinant virus. These studies were performed on 200-mg tissue samples from myocardium and other tissues. PCR detection sensitivity was 1 virus sequence per 5 million cells. Polyclonal antibodies directed against FGF-5 [Kitaoka et al., Invest. Ophthalmol. Vis.Sci. 35: 3189-3198, 1994] was used for immunoblot of proteins obtained from the culture of mouse cardiac fibroblasts cultured 48 hours after FGF-5 or lacZ gene delivery. FGF-5 protein was found in regulated medium after gene transfer of FGF-5, but not after lacZ gene transfer. Methods for PCR and western blotting are also described in detail in other literature [Hammond et al., J. clin. Invest. 92: 2644-2652, 1993; Roth et al., J. Clin. Invest. 91: 939-949, 1993; And Tsai et al., Am. J. Physiol. 267: H2079-H2085, 1994]. To examine transgenes for cell division promoting activity in vitro, mature rat cardiac fibroblasts were infected or not infected with adenoviruses encoding FGF-5 or adenoviruses encoding lacZ. Media from these cell cultures were incubated with NIH 3T3 mouse fibroblasts and thymidine integration treated with tritium was measured (Tsi et al., Endocrinology 136: 3831-3838, 1995).

(iv) adenovirus release during coronary artery delivery

Three animals continued to withdraw pulmonary blood during intracoronary infusion of recombinant adenovirus. Serum from each sample was used for a standard plaque assay. Undiluted serum (0.5 ml) was added to subconfluent H293 cells; After 10 days, plaques did not form. However, virus plaques formed on day 9 when 0.5 ml of serum was diluted 200- to 8000-fold with DMEM (2% FBS). A single bed (myocardium) separates the coronary and pulmonary arteries. If there is no virus death after injection into the coronary artery, then the viral pulmonary artery concentration should reflect the dilution of coronary sinus blood by systemic venous blood over the injection time. Measurements obtained from our experiments indicate that coronary flow represents 5% of pulmonary flow. Using this dilution factor (20-fold), the duration of coronary artery infusion, and the amount of adenovirus injected, we calculated the amount of adenovirus delivered to the pulmonary artery, resulting in the adenovirus disappearing or not attached. It is not believed. This assessment was compared with the measured amount and the difference used as an assessment of the amount of virus removed by the myocardial vascular phase.

(v) evaluation of inflammation

Hematoxylin / eosin and Mason's trichrome were used to detect infiltrates, cell necrosis and fibrosis of inflammatory cells. Frozen spleen (positive control) and fragments of the heart using ascites in mice, anti-CD4 and anti-C8 monoclonal antibodies in pigs (1.0 mg / ml; VMRD, Inc., Pullman, Washington) (6 CD4 and CD8 markers for T lymphocytes were detected. These studies were performed on samples across the heart wall of six animals that received an ameroid occlusion 50 days before death: no genes were delivered to two animals and two animals were FGF-5 genes. Two weeks ago, two animals received the lacZ gene two weeks ago. Analysis was performed without knowledge of treatment groups.

(vi) statistical analysis

Data were averaged ± 1 s.e.m. Display as. Measurements made before and after gene delivery with FGF-5 and lacZ were compared using a two-way assay of change (Crunch4, Crunch Softare Corporation, Oakland, California). Data from the angiogenesis study was also performed in a two-way analysis of changes. When P was less than 0.05, it was discarded as a meaningless hypothesis.

Results Using FGF-5 Transgene

Three measurements were used to evaluate whether gene delivery of FGF-5 is effective in treating ischemia of myocardium: local contractile function and perfusion (evaluated before and after gene delivery) and capillary number. All measurements were performed without knowledge of which gene the animal received (FGF-5 vs lacZ).

Local contractile function and blood circulation

After 38 days of installing the ameroid, the animals exhibited a damaged wall thickness during the electrical stimulation of the atria (heart pacing). Pigs receiving lacZ showed similar pacemaker-induced dysfunction in the ischemic zone before and two weeks after gene transfer. In contrast, two weeks after receiving the FGF-5 gene, the wall thickness in the ischemic region increased 2.7-fold during cardiac pacing (P <.0001; FIG. 6). Wall thickness in the normal perfused area (interventricular septum) was normal during cardiac pacing and was not affected by gene delivery (% wall thickness: lacZ: 53 ± 8% before gene transfer, 51 ± 6% after gene transfer) FGF-5: 59 ± 4% before gene transfer, 59 ± 6% after gene transfer).

Local blood circulation was also improved with regard to improved function in the ischemic zone. Two weeks after receiving the lacZ gene, there was a continuous flow defect in the ischemic region during cardiac pacing (Figure 8). However, animals receiving FGF-5 showed homogeneous contrast enhancement in 2 regions after 2 weeks, indicating an improvement in blood circulation in the ischemic region (P = 0.0001). In order to determine whether improved function in the ischemic phase and perfusion will last long, five animals were examined again 12 weeks after delivering the FGF-5 gene. Each animal showed continuous improvement in function (P = .005; FIG. 6) and perfusion (P = 0.001; FIG. 8).

Angiogenesis

Uninfected ameroid-limited animals (no gene transfer performed) had the same physiological response as animals receiving lacZ-encoded adenovirus, meaning that the lacZ vector did not adversely affect natural angiogenesis. do. To assess angiogenesis, capillary number of myocardium was quantified by microscopic analysis of perfusion-fixed heart (FIG. 9). The number of capillaries surrounding each myocardial fiber was compared to the ischemic and non-ischemic regions of the heart of animals transgenic with lacZ (P = 0.038) of the ischemic and non-ischemic regions of animals transgenic with FGF-5. Larger in the heart. Therefore, improved local function and perfusion were associated with capillary angiogenesis 2 weeks after FGF-5 gene delivery. Increased capillary number around each fiber tends to increase in the extracardiac part of the wall after gene transfer to FGF-5 (P = 0.13). Other measures of capillaries, such as the number of capillaries per fiber cross section and the number of capillaries per fiber number, did not change intracardiac or extracardiac.

DNA, mRNA and Protein Expression

By establishing the desired effect of FGF-5 on function, perfusion and capillary number around each fiber, the presence and expression of transgenes in the heart can be demonstrated. Transgene FGF-5 DNA and mRNA were detected in myocardium obtained from animals receiving the FGF-5 gene using polymerase chain reaction (PCR) and reverse transcriptase (RT-PCR) coupled with PCR.

Following gene transfer, left ventricular samples were examined to demonstrate transgene integration and expression. Briefly, after 3 days of gene transfer into the coronary artery, myocardium was treated with X-gal and counterstained with Eosin X120. Investigations using standard histological techniques revealed that most myocytes exhibited β-galactosidase activity (blue staining). Activity was also seen 14 ± 1 days after gene transfer in all animals receiving lacZ gene. At larger magnifications, there is evidence of thin grooves across cells containing β-galactosidase activity, confirming the presence of gene expression in myocytes. PCR analysis using the sense primers specified for the CMV promoter and the antisense primers specified for the internal FGF-5 sequence was performed in the ischemic (LCx) and non-ischemic (LAD) regions of three animals receiving the FGF-5 gene. This was performed to confirm the presence of recombinant adenovirus DNA encoding FGF-5. The results shown in FIG. 10A confirmed the presence of the expected 500-bp fragment. Then, 14 days after gene transfer, FGF-5 mRNA expression was examined. As shown in FIG. 10B, RT-PCR-amplified 400-bp fragments were present in both regions from two animals, while control animals showed no signal. Polyclonal antibodies directed against FGF-5 were used in immunoblots of proteins obtained from the media of mouse cardiac fibroblasts cultured 48 hours after gene delivery of FGF-5 or lacZ. As shown in FIG. 10C, FGF-5 protein was found after gene transfer of FGF-5 (F) but not after gene transfer of lacZ (β), which revealed protein expression and extracellular secretion after FGF-5 gene transfer. Prove it. Finally, PCR using a primer set specified for adenovirus DNA (E2 region) was performed in the retina, liver, or skeletal muscle of two animals in which adenovirus DNA was injected into the coronary artery 14 days ago. It was carried out to measure whether or not. As shown in FIG. 10D, a control lane containing recombinant adenovirus (as a positive control), not in lanes derived from retina (r), liver (l) or skeletal muscle (m) of treated animals. 900-bp amplified fragments found only in positive phase were found.

Successful gene delivery has been demonstrated in both ischemic and non-ischemic regions. Immunoblotting indicated the presence of FGF-5 protein in the myocardium from animals receiving the FGF-5 gene. In further experiments with cultured fibroblasts, we demonstrated that gene delivery of FGF-5 provided these cells with the ability to synthesize and secrete FGF-5 extracellularly. Media from cultured cells infected with recombinant adenovirus expressing FGF-5 showed a cell division promoting response (14-fold increase over control; P = 0.005). Finally, myocardial samples (not liver samples) obtained from lacZ-infected animals two weeks after gene transfer showed β-galactosidase activity upon histological examination. These studies confirm successful in vivo gene transfer and expression and demonstrate the biological activity of the transgene product.

Two weeks after injection of the recombinant adenovirus into the coronary artery, we were unable to detect viral DNA in liver, retinal or skeletal muscle using PCR despite the presence of viral DNA in the myocardium. Furthermore, viral DNA could not be detected in urine within 2 to 24 hours after intracoronary injection. These experiments show that coronary delivery of adenovirus vectors minimizes the distribution of the virus systemically in the arteries to levels below the detection limits of the PCR method. This technique will be difficult to achieve in animals with smaller coronary arteries, such as rabbits.

To evaluate the efficiency of myocardial uptake of adenoviruses, we measured the amount of adenovirus released from the heart by sampling pulmonary arterial blood during intracoronary infusion. Undiluted serum obtained from the pulmonary artery during intrapercutaneous injection of the virus was unable to form viral plaques under appropriate conditions. Therefore, the present invention effectively provides a cardiac-specific gene delivery system.

Evaluation of Inflammation

Microscopic examination of the fragments across the wall of the heart of animals receiving recombinant adenovirus did not show inflammatory cell infiltrates, cell necrosis or fibrosis. As a further assessment of the adenovirus-induced cytopathological effects, we conducted immuno-histologic studies to detect CD4 and CD8 antigens that would indicate the presence of cytotoxic T cells. These studies showed little positive cells for fragments across the wall of the heart from uninfected animals (n = 2) or animals that received recombinant adenovirus (n = 4). The liver was also inflamed.

Example 6

Gene-mediated Angiogenesis Using FGF-4 Transgene

This experimental example demonstrates a successful gene therapy using FGF-4, a gene encoding different angiogenic proteins. The protocol for FGF-4 gene therapy was essentially the same as described in Example 5 above for FGF-5.

Human FGF-4 gene was isolated from a cDNA library constructed from the mRNA of Kaposi's sarcoma DNA transformed-NIH3T3 cells. FGF-4 cDNA encodes a polypeptide of 206 amino acids that is about 1.2 kb in length and contains 30 amino acid signal sequences at the N-terminus [Dell Bovi et al., Cell 50: 729-737, 1987; Bellosta et al., J. Cell Biol. 121: 705-713, 1993. We subcloned FGF-4 cDNA essentially 1.2-kb EcoRI fragments in full length into the EcoRI site of the adenovirus vector pACCMVpLpASR (abbreviated as pACSR for simplicity). The 5 'starting site is at 243 base pairs and the 3' end is at 863 base pairs. Recombinant adenovirus encoding FGF-4 (hereinafter referred to as Ad.FGF-4) was made as described in Example 2 above to make FGF-5 adenovirus.

Expression of FGF-4 in cardiac tissue (and absence of expression in other tissues including liver, skeletal muscle and eye) was confirmed by Western-blot analysis using an anti-FGF-4 antibody for detection. The effects of FGF-4's cell division accumulation on the proliferation of endothelial cells in vitro were also tested.

45 days after installing the ameroid, animals were studied to define stress-induced local function and hematogenesis, and then administered recombinant adenovirus expressing FGF-4 delivered by intracoronary infusion. (N = 6). After 13 days, the study was repeated to define stress-induced local function and blood circulation, and tissues were collected the next day at the expense of animals.

Transgene delivery

As was the case with FGF-5, gene delivery was performed after endogenous angiogenesis was stopped and there was an induced myocardial ischemia similar to angina in the patient. For intracoronary delivery of the transgene, animals were anesthetized and a 5F artery cover was placed in the carotid artery. A 5F multipurpose coronary catheter was inserted through the sheath into the coronary artery. The closure of ameroids in all animals was confirmed by contrast injection into the left main coronary artery. The tip of the catheter was then inserted deep into the lumen of the artery to minimize the amount of material lost in the basal aorta during injection. 5 ml containing a recombinant adenovirus expressing FGF-4 of 1.5 × 10 ¹² virus particles were delivered by slowly injecting 3.0 ml into the left coronary artery and 2.0 ml into the right coronary artery.

Results Using FGF-4 Transgene

Local function and perfusion

45 days after the installation of the ameroid, the animals showed a damaged wall thickness during cardiac pacing. In contrast, two weeks after receiving the FGF-4 gene, the wall thickness increased 2.7-fold in the ischemic region during cardiac pacing (p <0.0001; FIGS. 11 and 12). Wall thickness in the normally perfused area (interventricular septum) was normal during pacing and was not affected by gene transfer. The improvement in function after FGF-4 gene delivery was not statistically different from the improvement obtained after gene delivery with FGF-5 or FGF-2LI + signal peptide (“sp”) (FIG. 11). Improved function in the ischemic region was associated with improved local perfusion (FIG. 12). As can be seen in FIG. 12, there was a flow defect in the ischemic region during pacemaker prior to FGF-4 gene delivery. Homogeneous contrast enhancement was seen in both regions two weeks after gene transfer with FGF-4, indicating an improved flow in the ischemic region (p = 0.0001). The results obtained using FGF-4 were not statistically different from the results obtained with FGF-5 and FGF-2LI + sp (FIG. 13). FGF-2LI + sp is described in Example 7 below and referred to as FGF-2 containing a signal sequence.

Transgene expression

Intensive expression of FGF-4 in the heart was confirmed by performing PCR and RT-PCR using primers specific for the sequence encoding the transgene. FGF-4 DNA and mRNA were found in the heart but not in the eye, liver and skeletal muscles. These data confirm the data derived using Ad.FGF-5 (n = 2) and Ad.FGF-2LI + sp (n = 1). Therefore, exclusive expression of transgenes in the heart was confirmed in all four animals receiving adenovirus vectors containing genes encoding different angiogenic proteins.

Absence of myocardial inflammation

Myocardial biopsies across the wall taken from three conscious animals receiving Ad.FGF-4 were examined. Animals were sacrificed 2 weeks after gene transfer. There was no evidence of inflammatory cell infiltrates, cell necrosis, or increased fibrosis in these fragments compared to control ameoid animals that did not receive adenovirus. This was true on LAD and LCx. These slides were reviewed by a pathologist doing a blind-sample evaluation, and no fragments were evaluated for evidence of myocarditis.

Example 7

Gene-mediated angiogenesis using FGF-2 muteins

This experimental example demonstrates a successful gene therapy using the gene encoding the third angiogenic protein, FGF-2. This experiment also demonstrates how angiogenic proteins can be modified to potentially improve the efficacy and increase secretion of angiogenic gene therapy in enhancing blood circulation and cardiac function in the heart. The protocol used for FGF-2 gene therapy was actually identical to that for FGF-5 and FGF-4 above.

Acidic FGFs (aFGF, FGF-1) and Basic FGFs (FGF-2) lack a natural secretion signal sequence; Although some proteins may be secreted. Alternative secretory pathways that do not include the Golgi apparatus are described for acidic FGFs. Two FGF-2 constructs (FGF-2LI + sp and FGF-2LI-sp) were made. One contains the sequence encoding the signal peptide (FGF-2LI + sp) for the classical protein secretion pathway, and the other is the absence of the sequence encoding the signal peptide (FGF-2LI-sp), so that the added signal peptide The improved potency of FGF-2 with added signal peptide, which surpassed the same protein without was tested.

As can be seen below, FGF-2 has a loop structure of five residues extending from amino acid residue 118 to residue 122. This loop structure was replaced by cassette-specific mutagenesis with a loop of the corresponding five residues from interleukin-1β to generate a FGF-2LI loop replacement mutant. Briefly, genes encoding human Glu ^3,5 FGF-2 [Seddon et al., Ann. NY Acad. Sci. 638: 98-108, 1991] were cloned between the restriction sites Ndel and BamHI in the T7 expression vector pET-3a (M13), a derivative of pET-3a [Rosenberg et al., Gene 56: 125-135, 1987]. . A single restriction endonuclease site, BstB1 and Spl1, is present in the gene in such a way that there is no change in the encoded amino acids at either side of the codon encoding Trp123 at the segment Ser117 of FGF-2 (ie, silent mutation). Introduced.

Structural Arrangement of β9-β10 Loops in FGF-1, FGF-2, and IL-1β ¹

^The numbering for ¹ FGF-1 and FGF-2 is from amino acid residue 1 deduced from the cDNA sequence encoding the 155-residue morphology (Seddon et al., Ann. NY Acad. Sci. 638: 98-108, 1991). , For IL-1β is from residue 1 of mature 153-residue polypeptide (id).

Replacing residues Arg118-Lys119-Tyr120-Thr121-Ser122 of FGF-2 with the human sequence Ala-Gln-Phe-Pro-Asn from the corresponding loop of the structural analog IL-1β (115-119) is essentially Was performed as follows:

BstB1 and Spl1 digestion was performed on plasmid DNA, pET-3a (M13), and the resulting larger DNA fragments were isolated using agarose gel electrophoresis. DNA fragments were ligated to double-stranded DNA containing ends corresponding to those produced by BstB1 and Spl1 digestion, obtained by annealing the following two synthetic oligonucleotides using T4 DNA ligase: 5 '-CGAACGATTG GAATCTAATA ACTACAATAC GTACCGGTCT GCGCAGTTTC CTAACTGGTA TGTGGCACTT AAGC-3' and (SEQ ID NO. The ligation products were used to deliver E. coli (strain DH5α) cells. The desired mutant plasmid (FGF-2LI) was selected based on sensitivity to cleavage at the newly introduced Af12 restriction site (underlined above).

FGF-2LI with and without signal peptide was constructed using the polymerase chain reaction (PCR) -based method. To add the FGF-4 signal peptide sequence to 5 'of FGF-2LI and ensure that the signal peptide is cleaved from the FGF-2LI protein, Forlow R. et al. The gene cassette used by.) Was used. 5 'portion of the FGF-4 signal peptide and the second primer (pF2R: 5'-CGGAATTCTG TGAAGGTGGT GATTTCCC-3') using primers (pF1B: 5'-CGGGATCCGC CCATGGCGGG GCCCGGGACG GC-3 '(SEQ ID NO. 11)) , (SEQ ID NO. 12)) to the 5 'portion of FGF-1, the inventors identified by PCR the BamHI site at the 5' end of the FGF-4 signal peptide sequence, followed by the first 10 of FGF-1. DNA fragments comprising amino acids and EcoRI sites at the 3 'end were synthesized. Using another pair of primers (pF3R: 5'-CGGAATTCAT GGCTGAAGGG GAAATCACC-3 '(SEQ ID NO. 13) and pF4HA: 5'-GCTCTAGATT AGGCGTAGTC TGGGACGTCG TATGGGTAGC TCTTAGCAGA CATTGGAAGA AAAAG-3' (SEQ ID NO. 14)) By matching the 5'- and 3'-ends of FGF-2LI, respectively, we have an EcoRI site at the 5 'end of FGF-2LI and an influenza hemoglutinin (HA) tag and XbaI at the 3'-end. A second DNA fragment with a site was obtained. These two fragments were then subcloned to the BamHI and XbaI sites by trimolecular ligation to the pcDNA3 vector. Plasmid pFGF-2LI / cDNA3, similar to pSPFGF-2LI / cDNA3, was subcloned in a similar manner except for the absence of signal peptide. Two plasmids were then sequenced to confirm correct insertion. Next, two FGF-2LI fragments were released from pcDNA3 by BamHI and XbaI digestion and subcloned into pACCMVpLpASR (+) (simply pACSR), a shuttle vector for preparing recombinant viruses. Recombinant virus and injectable vectors were prepared essentially as described in Example 2. Gene transfer was performed as described in Example 5 (8 animals for FGF-2LIsp + and 6 animals for FGF-2LIsp-, lacZ vector was used as a control, all 10 ¹¹ to 10 ¹² virus particles).

Results Using FGF-2 Muteins

At 200 bpm after 2 weeks of gene transfer to FGF-2LI + sp, the ratio to peak during pacemaker stress (LCx / LV) was significantly improved compared to before gene transfer. FIG. 13 depicts the results using intracoronary gene delivery of recombinant adenovirus expressing lacZ, FGF-5, FGF-2LI + sp, FGF-2LI-sp, and FGF-4 for comparison. The black bars on the right in FIG. 13 represent normal flow rates using this method. In these animals, FGF-2LI + sp normalized the flow to peak ratio.

% Wall thickness was also improved 2 weeks after intracoronary delivery of recombinant adenovirus expressing FGF-2LI + sp. FIG. 11 depicts the results using intracoronary gene delivery of recombinant adenoviruses expressing lacZ, FGF-5, FGF-2LI + sp, FGF-2LI-sp, and FGF-4 for comparison. The black bars on the right side of FIG. 11 represent normal% wall thickness before pacemaker-induced stress. FGF-2LI + sp improved local function to a level that was statistically indistinguishable from FGF-5. Although some improvement was noted after gene transfer with FGF-2LI-sp, the improvement with signal peptides including transgenes was superior (FIG. 13).

Claims (58)

Treatment of the patient, comprising delivering to the heart of a patient suffering from congestive heart disease a vector comprising a gene encoding an angiogenic protein or peptide in a form operably linked to a promoter for expression of the gene. Way. The method of claim 1, wherein the congestive heart disease is associated with severe coronary artery disease and myocardial ischemia. The method of claim 1, wherein the congestive heart disease is associated with dilated cardiomyopathy. The method of claim 1, wherein the vector is delivered to a blood vessel that supplies blood to the heart muscle of the heart. 5. The method of claim 4, wherein the blood vessel that supplies blood to the myocardium is a coronary artery, a saphenous vein graft, or an internal mammary artery graft. 5. The method of claim 4, wherein the vector is delivered directly to the left and / or right coronary arteries by intracoronary injection. 7. The method of claim 6, wherein the intracoronary infusion is performed about 1 cm into the lumen of the left and / or right coronary arteries. The method of claim 1, wherein the angiogenic protein or peptide is a member of the fibroblast growth factor (FGF) family. 9. The method of claim 8, wherein the angiogenic protein or peptide is FGF-4, FGF-5, FGF-6, FGF-1 or FGF-2. 10. The method of claim 9, wherein the angiogenic protein is FGF-4. 10. The method of claim 9, wherein the angiogenic protein is FGF-5. The method of claim 10, wherein the angiogenic protein is FGF-1. The method of claim 10, wherein the angiogenic protein is FGF-2. The method of claim 1, wherein the angiogenic protein comprises a secretory signal sequence. The method of claim 14, wherein the angiogenic protein is FGF-2 modified by inclusion of a heterologous secretion signal sequence. The method of claim 1, wherein the angiogenic protein or peptide is a member of the vascular endothelial growth factor (VEGF) family. The method of claim 16, wherein the angiogenic protein or peptide is VEGF-121, VEGF-145, VEGF-165, VEGF-189, VEGF-206, VEGF-167, VEGF-186 or VEGF-C. The method of claim 1, wherein the angiogenic protein or peptide is a member of the platelet-induced growth factor (PDGF) family. The method of claim 18, wherein the angiogenic protein or peptide is PDGF-A or PDGF-B. The method of claim 1, wherein the angiogenic protein or peptide is a member of the insulin-type growth factor (IGF) family. The method of claim 1, wherein said promoter is a CMV promoter. The method of claim 1, wherein said promoter is tissue-specific for cardiomyocytes. 23. The method of claim 22, wherein said tissue-specific promoter is a ventricular myocyte-specific promoter. 24. The method of claim 23, wherein said ventricular myocyte-specific promoter is a ventricular myosin light chain-2 promoter or a ventricular myosin heavy chain promoter. The method of claim 1 wherein the vector is a viral vector or a lipid-based vector. The method of claim 25, wherein the vector is a viral particle, 27. The method of claim 26, wherein the viral particle is a replication-deficient adenovirus (Ad). 27. The method of claim 26, wherein the viral particle is a replication-deficient adeno-associated virus (AAV). 27. The method of claim 26, wherein about 10 ⁶ to 10 ¹⁴ viral vector particles are delivered upon injection. The method of claim 27, wherein about 10 ⁸ to 10 ¹² viral vector particles are delivered upon injection. In the heart of a patient suffering from myocardial infarction, a vector containing a gene encoding an angiogenic protein or peptide is operably linked to a promoter for expression of the gene, thereby increasing myocardial blood circulation and detrimental A method for preventing or alleviating ventricular remodeling, comprising reducing ventricular remodeling. 32. The method of claim 31, wherein the vector is delivered to a blood vessel that supplies blood to the myocardium of the heart. 33. The method of claim 32, wherein the blood vessel that supplies blood to the myocardium is a coronary artery, saphenous vein graft, or an internal mammary artery graft. 33. The method of claim 32, wherein the vector is delivered directly to the left and / or right coronary arteries by intracoronary injection. 35. The method of claim 34, wherein said intracoronary infusion is performed about 1 cm into the lumen of the left and / or right coronary artery. 32. The method of claim 31, wherein the angiogenic protein or peptide is a member of the fibroblast growth factor (FGF) family. The method of claim 36, wherein the angiogenic protein or peptide is FGF-4, FGF-5, FGF-6, FGF-1 or FGF-2. 38. The method of claim 37, wherein the angiogenic protein is FGF-4. 38. The method of claim 37, wherein the angiogenic protein is FGF-5. 40. The method of claim 39, wherein the angiogenic protein is FGF-1. 40. The method of claim 39, wherein the angiogenic protein is FGF-2. 32. The method of claim 31, wherein the angiogenic protein comprises a secretory signal sequence. 43. The method of claim 42, wherein the angiogenic protein is FGF-2 modified by inclusion of a heterologous secretion signal sequence. 32. The method of claim 31, wherein the angiogenic protein or peptide is a member of the vascular endothelial growth factor (VEGF) family. 45. The method of claim 44, wherein the angiogenic protein or peptide is VEGF-121, VEGF-145, VEGF-165, VEGF-189, VEGF-206, VEGF-167, VEGF-186 or VEGF-C. 32. The method of claim 31, wherein the angiogenic protein or peptide is a member of the platelet-induced growth factor (PDGF) family. 47. The method of claim 46, wherein the angiogenic protein or peptide is PDGF-A or PDGF-B. 32. The method of claim 31, wherein the angiogenic protein or peptide is a member of the insulin-type growth factor (IGF) family. 32. The method of claim 31, wherein said promoter is a CMV promoter. 32. The method of claim 31, wherein said promoter is tissue-specific for cardiomyocytes. 51. The method of claim 50, wherein said tissue-specific promoter is a ventricular myocyte-specific promoter. 52. The method of claim 51, wherein the ventricular myocyte-specific promoter is a ventricular myosin light chain-2 promoter or a ventricular myosin heavy chain promoter. 32. The method of claim 31, wherein the vector is a viral vector or a lipid-based vector. 54. The method of claim 53, wherein the vector is a viral particle, 55. The method of claim 54, wherein the viral particle is a replication-deficient adenovirus (Ad). 55. The method of claim 54, wherein the viral particle is a replication-deficient adeno-associated virus (AAV). 55. The method of claim 54, wherein about 10 ⁶ to 10 ¹⁴ viral vector particles are delivered upon injection. 56. The method of claim 55, wherein about 10 ⁸ to 10 ¹² viral vector particles are delivered upon injection.