KR20000015984A - Recombination of polynucleotide sequences using random or defined primers - Google Patents

Abstract

PURPOSE: A recombining method is provided to form a pool of short DNA fragments by priming template poly nucleotide with random-sequences or defined-sequence primers. CONSTITUTION: A method for in vitro mutagenesis and recombination of poly nucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template poly nucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturalization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template poly nucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Description

Recombination of Polynucleotide Sequences Using Random or Constant Primers

The publications and other references set forth herein in order to explain the background of the invention and to provide a more detailed description in practicing the invention are those that are incorporated by reference of the invention. For convenience, the references are numbered in the accompanying literature list.

Proteins are further engineered for the purpose of enhancing their function in practical use. The properties required depend on the intended use, for example stronger binding to the receptor, higher catalytic activity, higher stability, availability for a broader (or narrower range) of substrates or action under non-natural environments such as organic solvents. Include the last name. Various methods have been successfully used to optimize protein function, including "reasonable" design and random mutagenesis (1). The choice of approach to solve a given optimization problem will depend on the extent to which the relationship between sequence, structure and function is understood. For example, rational redesign methods of enzyme catalytic sites often require sufficient knowledge of the enzyme structure, the complex structure formed with the various ligands and analogs of the reaction intermediates, and the details of the catalyst mechanism. This information is only available for a few reaction systems where research is sufficient, and little is known about most of the enzymes that are useful. In addition, identifying the amino acids essential for the presence of protein functions and amino acids that can provide new functions often requires excessive experimentation. With this problem, there is a growing awareness that many protein functions are not determined by a few amino acids, but by residues away from the active site, and thus random mutagenesis or "inducible" to develop new proteins. More and more groups are returning to evolutionary methods (1).

Many optimization methods, such as genetic algorithms (2,3) and evolutionary techniques (4,5), are obtained through natural evolutionary processes. These methods use mutations that make arbitrary small changes to some components of an individual, as well as crossovers that combine the properties of several individuals to achieve specific optimization goals. However, again, there are strong interactions between mutations and crossovers, as shown by computer simulations of several optimization problems (6-9). It is a task in the art to imitate these key methods to develop an efficient and practical experimental technique. The development of such a technique allows for the exploration and optimization of the functions of biological molecules such as proteins and nucleic acids in vivo, or even completely solve the problems of the biological system (10, 11).

Inductive evolution based on natural evolution involves the creation and selection or selection of pools of mutated molecules of sufficient diversity that may exist in molecules encoding proteins with altered or improved function. This method generally begins with the fabrication of a library of variant genes. Next, the selected or selected gene product is identified for improvement in the desired properties or group of properties. Repeated treatment of the gene encoding the product thus obtained with the above procedure may accumulate desirable mutants. These evolutionary methods can be advanced for generations or generations, depending on the extent to which they want to advance and the effects of mutations commonly observed in each generation. Such methods have been used to make new functional nucleic acids 12, peptides and other small molecules 12, antibodies 12, as well as enzymes and other proteins 13,14,16. Inductive evolution methods do not require much specific knowledge of the product itself and only require a means of evaluating the function to be optimized. Even this method is not greatly affected by inaccuracies and controversies in terms of functional evaluation.

Genetic diversity in inducible evolution can be achieved by creating new point mutations using a variety of methods including mutagenic PCR (15) or combination cassette mutagenesis (16). However, the method of recombining genes provides an important dimension to the evolutionary method, as shown by its major role in natural evolution. Homologous recombination is an important natural process by which organisms exchange genetic information between related genes to increase the diversity of genes allowed between species. This pathway works at very low efficiencies while providing potentially potent adaptation and diversification to the host, resulting in no significant changes in the structure or function of the pathway, even after decades. Thus, while this mechanism has been found to be beneficial for host organisms / species with geological time distances, in vivo recombination may be used to alter the performance of enzymes or other proteins that are not strongly related to the intermediate metabolism and survival of the organism. It is a complex and not specific but combinatorial method.

Several researchers have examined the usefulness of genetic recombination in inducible evolution. In vivo recombination methods of genes have been disclosed, for example, in PCT WO 97/07205 and US Pat. No. 5,093,257. As mentioned above, in vivo methods are complex and not suitable for rapid evolution of functions. Stemmer has generally disclosed an in vitro recombination method of related DNA sequences that uses an enzyme such as DNase I to cut and reassemble the parental sequence into fragments (17, 18, 19). However, constant DNA fragmentation by DNaseI and other endonucleases exhibits a propensity to recombine to limit recombinant diversity. In addition, this method can be used only for the recombination of double-stranded polynucleotides and not for single-stranded templates. This method is also less workable for specific combinations of genes and primers. For example, recombination of short sequences (less than 200 nucleotides (nt)) is not effective. Finally, this is a somewhat labor intensive method that requires several steps. Thus, there is a need for an alternative convenient method for generating new genes through point mutagenesis and in vitro recombination.

The present invention is based on DE-FG02-93-CH10578 of the Ministry of Resources and N00014-96-1-0340 of the Navy Research Institute, and the US Government has some rights in the present invention.

The present invention relates generally to in vitro mutagenesis and recombination methods of polynucleotide sequences. In particular, the present invention relates to a simple and effective method for in vitro mutagenesis and recombination of polynucleotide sequences based on the process of elongating primer oligonucleotides catalyzed by polymerase, reassembling and selectively amplifying the genes. will be.

1 shows a recombinant method according to the present invention using random sequence primers and gene reassembly. The steps shown are as follows.

a) synthesizing single-stranded DNA fragments using mesophilic or pyrogenic polymerases with oligonucleotides of irregular sequence as primers (primers not shown), b) removing the template, c) pyrogenic DNA Reassembling with polymerase, d) amplifying with thermostable polymerase, e) cloning and screening (optional), and f) repeating the process with the selected gene (optional).

Figure 2 shows a recombinant method according to the invention using a certain primer. This method is illustrated for the recombination of two genes, where x represents a mutation. The method is outlined as follows. a) Prime the gene using a specific primer in a separate PCR reaction (2 primers per reaction solution) or a combination of PCR reactions (multiple primers per reaction solution). b) The primary product is formed until certain primers are completely consumed. The template is removed (optional) and c) the primary obtained fragment is stretched by self priming with additional PCR reactions without other external primers. Assembly continues until full length genes are formed. d) Amplify the full length gene by PCR reaction with another external primer (optional). f) Repeat the process with the gene of your choice (optional).

Figure 3 shows a recombinant method according to the invention using two contiguous constant primers and StEP. To illustrate this recombination method in detail, this figure shows only two single strands from one primer and two templates. This method is outlined as follows. a) Denature the template gene and prime with one constant primer. b) short fragments are obtained for a short time by extension reaction of the primer. c) Randomly prime and stretch fragments to the template in the next cycle of StEP. d) Degeneration and annealing / extension are repeated until full length genes are made (identified using agarose gel). e) Purification of full length genes or amplification in a PCR reaction containing other external primers (optional). f) Repeat the process with the selected gene.

Figure 4 shows the result of recombination of two genes using two adjacent primers and staggered kidney according to the present invention. The DNA sequence of five genes selected from the recombinant library is shown, where x represents a mutation present in the parent gene, and ▽ represents a new point mutation.

5 is a schematic diagram showing the gene sequence of the pNB esterase described in Example 3. FIG. Template genes 2-13 and 5-B12 were recombined using certain primer methods. The positions of the primers are indicated by arrows, and the positions of the different parent sequences are indicated by x. The new point mutation is indicated by ▽. Mutations identified in such a recombinant gene are described (only positions different from the parent sequence are described). Both 6E6 and 6H1 are recombinant products of the template gene.

FIG. 6 shows the positions and sequences of four constant internal primers used to generate recombinant genes from template genes R1 and R2 by recombination based on scattered primers. Primer P50F contains a mutation (A → T at base position 598) resulting in the disappearance of the HindIII restriction site resulting in a new unique NheI site. The gene R2 also contains the mutation A → G at the same base position, so that the HindIII site is missing.

FIG. 7 shows an electrophoretic gel showing the results of restriction digest analysis of plasmids from 40 clones.

Figure 8 shows the results of sequencing the 10 genes obtained from the recombinant library based on a certain primer. The line represents the 986 bp subtilisin E gene containing 45 nt of the prosequence and 113 nts following the full mature sequence and the stop codon. x denotes a mutation position different from the parent genes R1 and R2 and ▽ denotes the position of a new point mutation introduced during the recombination procedure. Indicates a mutation introduced by mutagenic primer P50F.

Figure 9 shows the results of a random sequence primer recombination method to the gene of actinoplanes utahensis ECB deacylating agent. (a) 2.4 kb ECB deacylating agent gene was purified from agarose gel. (b) Random priming products ranged in size from 100 to 500 bases. (c) Fragments shorter than 300 bases were isolated. (d) The fragments thus purified were reassembled into full length genes in the presence of some smear reference. (e) One-time PCR products of the same size as the ECB deacylating agent gene were obtained by conventional PCR using two primers located in the start and end regions of the gene. (f) This PCR product was digested with Xho I and Psh AI and cloned into pIJ702 modified vector to make a library of mutants. (g) This library was introduced into Streptomyces lividans TK23 to obtain about 71% of the clones producing an active ECB deacylating agent.

Figure 10 shows the activity of the mutant M16 and wild type ECB deacylating agent obtained according to the present invention.

11 shows the pH profile of mutant M16 and wild type ECB deacylating agent activity obtained according to the present invention.

FIG. 12 is a DNA sequence analysis of ten randomly selected clones from the library / klinow. The line represents the 986 bp subtilisin E gene containing 45 nt of the prosequence, the total mature sequence and 113 nt following the stop codon. x represents the mutation position different from R1 and R2, and ▽ represents the position of the new point mutation introduced during the random priming recombination method.

FIG. 13 is selected from five polymerases created using several polymerases: a) Library / Klinow, b) Library / T4, c) Library / Sequenase, d) Library / Stopel and e) Library / Pfu . The clone's thermal stability index profile is shown. Normalized residual activity (Ar / Ai) was used after incubation at 65 ° C. as an index of enzyme thermal stability. Data was sorted and plotted in descending order.

Description of Detailed Embodiments

As a first preferred embodiment of the invention, a group of primers is used which consists of a combination of all possible nucleotide sequences (dp (N) _L , where L is primer length) in a primer based recombinant method. It was known several years ago that the Klenau fragment of E. coli polymerase I could use oligodeoxynucleotides of different lengths as primers for initiating DNA synthesis on single-stranded templates (21). Although the size of this primer was smaller than the normal PCR primer size (ie, less than 13 bases), short oligomers on the order of hexanucleotides were often used for labeling reactions as the primers could be properly primed (22). A method of using random primers in making a collection of gene fragments and then reassembling the genes according to the invention is shown in FIG. 1. This method involves random priming to create various “breeding blocks” from single-stranded polynucleotide templates, and the short initial DNA fragments thus obtained are thermocycled in the presence of DNA polymerase and nucleotides to lengthen them. Reassembling into DNA, and amplifying the gene of interest from the reassembled product by conventional PCR method for further cloning and selection. This method results in the formation of new mutations mainly in the priming stage, as well as in other stages. Recombination of these new mutations and mutations already present in the template sequence creates a library of new DNA sequences. If necessary, this method can be repeated for the selected sequence.

In practicing the random priming method, the template can be a linear or cyclic mono- or modified bi-chain polynucleotide. The molds may be mixed in equal molar amounts or, for example, in amounts measured according to the functional properties of the molds. In at least some cases, the template gene may be cloned into a vector where no additional mutations should be formed, and therefore the template gene should first be purified from the vector by cleavage with a restriction enzyme. The linear DNA molecules thus obtained are heated to be denatured, annealed to oligodeoxynucleotides of random sequence and then incubated with DNA polymerase in the presence of an appropriate amount of dNTP. Hexnucleotide primers are preferred, but longer random primers (up to 24 bases) may be used depending on the conditions used during random priming synthesis and DNA polymerase. As a result, oligonucleotides prime and stretch the DNA at various locations along the entire target region to produce short DNA fragments complementary to each strand of template DNA. Such short DNA fragments may also contain point mutations due to mis-incorporation and mispriming. Under conventional reaction conditions, short DNA fragments can prime each other according to homology and can be reassembled into full-length genes by repeated high temperature cycling treatment in the presence of thermostable DNA polymerase. The full-length gene thus obtained has various sequences, but most of them will be similar to the sequence of the original template DNA. These sequences can be further amplified by conventional PCR and cloned into expression vectors. Subsequently, the selection or selection of expressed mutants can result in variants with improved or even new specific functions. Such variants may be used immediately as a partial solution to a substantial problem, or as a new starting point for additional inductive evolution cycles.

Some advantages of the method based on random primers used for in vitro protein evolution compared to other methods used for protein optimization, such as combinatorial cassettes and oligonucleotide-induced mutagenesis (24, 25, 26) The summary is as follows.

1. The template used for random priming synthesis may be single-stranded or double-stranded polynucleotides. In contrast, PCR and DNA shuffling recombination methods (17, 18, 19), which are prone to error, must use only two-stranded polynucleotides. Using the methods described herein, mutations and / or crosses can be formed directly from mRNA at the DNA level using several types of DNA dependent DNA polymerase or even using several types of RNA dependent DNA polymerase. Recombination can be carried out using a single-stranded DNA template.

2. In contrast to the DNA shuffling method, which requires fragmentation of a double stranded DNA template (generally with DNAse I) to make a random fragment, the method disclosed herein can be used for further reassembly using random priming synthesis. DNA fragments of adjustable size are made as "crossing blocks" (Figure 1). A direct advantage of this method is that it does not require two sources of nuclease activity (DNaseI and 5'-3 'exonuclease), which facilitates control of the size of the final reassembly and amplified gene fragments.

3. Since random primers are a group of synthetic oligonucleotides containing all four bases at each position, they are uniform in length and do not tend to be constant in sequence. This heterogeneity of the sequence allows hybridization with the template DNA strand at many locations, so that all the nucleotides of the template (except for the 5 ′ extreme) must be copied into the product at a similar frequency. In this way mutations and crossovers occur more randomly than, for example, error-prone PCR or DNA shuffling.

4. Random primed DNA synthesis is based on hybridization of hexanucleotide mixtures to DNA templates, the complementary strand of which is the 3'-OH terminus of random hexanucleotide primers using polymerase and four deoxynucleotide triphosphates. Synthesize from Thus, this reaction is independent of the length of the DNA template. DNA fragments 200 bases in length can be primed as well as linearized plasmids or [lambda] DNA (29). This method is particularly useful for engineering peptides, for example.

5. DNaseI is an endonuclease that preferentially hydrolyzes double-stranded DNA at sites adjacent to pyrimidine nucleotides and therefore, when used for DNA shuffling, will show a certain trend in template gene digestion steps (especially G + C or A + For genes with high T content). The effect of this potential trend on total mutation rate and recombination frequency can be avoided using random priming. The tendency to preferentially hybridize to the GC-rich region of the template DNA appearing in random priming can be overcome by increasing the content of A and T in the random oligonucleotide library.

An important part of the practice of the present invention is to control the average size of the primary stranded DNA synthesized during the random priming method. This step is studied in detail through known literature. Hodgson and Fisk 30 show that the average size of single-stranded DNA synthesized is the inverse of the primer concentration, and length = k / (Where Pc is the primer concentration). The inverse relationship between primer concentration and resulting DNA fragment size may be due to steric hindrance. Based on this fact, random priming synthesis conditions suitable for each gene of various lengths can be easily set.

There are dozens of polymerases available today, so there are many ways to synthesize short initial DNA fragments. For example, bacteriophage T4 DNA polymerase 23 or T7 sequinase version 2.0 DNA polymerase 31,32 can be used for random priming synthesis.

Reverse transcriptase is preferred when the template is a single-stranded polynucleotide (particularly an RNA template) in random priming synthesis. This enzyme is somewhat error prone because it lacks 3 '→ 5' exonuclease activity. In the presence of high concentrations of dNTP and Mn ^2+, about 1 base per 500 bases is misloaded (29).

By changing the reaction conditions, PCR can be performed for short priming DNA fragments using a thermostable polymerase for random priming synthesis. What is important at this point is that routine experiments should identify the conditions under which short random primers anneal the template and allow sufficient DNA amplification even at high temperatures. Applicants have discovered that random primers as short as dp (N) ₁₂ can be made into elongated primers by PCR. Tailoring PCR for random priming synthesis yields a convenient way to create short initial DNA fragments. Such random priming recombination techniques are very powerful.

In many evolutionary scenarios, recombination has occurred between oligonucleotide sequences if there is sequence information of at least some of the template sequences. In such a scenario, a series of primers interspersed among various mutations can be specified and synthesized. In the case of using a constant primer, the length of the primer may be 6 to 100 bases. According to the present invention, when a series of overlapping primer extension reactions (which can be carried out by high temperature circulation treatment) using such constant primers, one or more mutations, allelic differences or isotype differences accumulated between the templates are obtained. It was found that each recombinant cassette containing could be obtained. The use of constant primers to produce overlapping extension products in a DNA polymerization reaction results in a gradual increase in cross hybridization of the primer extension products until the complete gene product is formed while the useful primer is consumed. Repeated annealing, stretching and denaturation steps result in each overlapping cassette recombining with each other.

Preferred embodiments of the invention include methods of using a group of certain oligonucleotide primers to initiate DNA synthesis. 2 illustrates an exemplary form of the invention using certain primers. Properly designed and placed oligonucleotide primers yield constant stretched recombinant primers and measure the major recombination (simultaneous separation) form along the length of the homologous template.

In another embodiment, the present invention provides an alternative to the primer based gene assembly and recombination methods in the presence of a template. Thus, as shown in FIG. 3, the present invention provides a recombination method that allows the enzyme catalyzed DNA polymerization reaction to proceed simply simply (by limiting time and lowering the temperature of the elongation step) prior to denaturation. After denaturation the stretched fragments are randomly annealed to the template sequence and continue to partially stretch. This method is repeated several times until a full length sequence is obtained, depending on the concentration of the primer and template. This method is called staggered extension or StEP. Random primers can also be used in StEP, but gene synthesis is not as effective as certain primers. Thus, certain primers are preferred.

This method uses a simple annealing / extension step to make partially stretched primers. That is, the general annealing / extension step is carried out under conditions that allow for high fidelity primer annealing (where T _annealing is greater than T _m ^-25 ), but the polymerization / extension reaction is within seconds (or less than 300 nt average elongation). Shorten). It is preferred that the minimum elongate is on the order of 20-50 nt. Thermostable DNA polymerases generally appear to have a maximum polymerization rate of 100 to 150 nucleotides / second / enzyme molecule at the optimum temperature, but at temperatures near the optimum temperature (T _opt ) it has been demonstrated to follow approximately Arrhenius kinetics. have. Thus, the thermostable polymerase at a temperature of 55 ° C. shows only 20-25%, or 24 nt / sec, of the steady state polymerization rate at 72 ° C. (T _opt ) (40). Taq polymerase has been reported to exhibit kidney activity of 1.5 nt / sec and 0.25 nt / sec at 37 ° C. and 22 ° C., respectively (24). Time and temperature can be varied in a conventional manner depending on the knowledge of the rate and biochemistry of the base polymerase and the desired recombination process.

The progress of the staggered stretch method is monitored by isolating DNA fragments via agarose gel electrophoresis by separating a certain amount from the reaction tube every several hours during primer stretch reaction. Effective primer extension can be identified from the low molecular weight “smear” phenomenon observed earlier in this method of increasing molecular weight with increasing number of cycles.

Unlike the gene amplification method (exponentially generating new DNA), StEP creates a new DNA fragment containing DNA fragments corresponding to several template genes in an additional manner in its initial cycle. 20 cycles of StEP under non-amplified conditions yielded the maximum molar amount of DNA, approximately 40 times the initial template concentration. In contrast, the ideal polymerase chain reaction for gene amplification is absolute fold, providing up to about 1 × 10 ⁶ fold molar amount through the same number of steps. Indeed, the difference between the two methods can be observed by PCR, which uses a 10 to 500-fold excess primer (typically 10 ^6- fold excess for gene amplification) and less than 1 ng / μl template. Only a few cycles (less than 10 cycles) provide a clear “band”. Under similar reaction conditions, StEP is expected to exhibit a "smear" with low visibility of increasing molecular weight with increasing number of cycles. When a significant number of primer stretched DNA molecules began to reach a size greater than 1/2 the length of the full-length gene, the forward and reverse half-stranded strands cross-hybrid, resulting in fragment size present at this point in the method. There is a sharp increase in molecular weight, such as producing fragments that are nearly two times closer. At this time, if the DNA is continuously StEP treated or the high temperature circulating treatment is changed so that the complete extension of the priming DNA is introduced into the logarithmic stage of gene amplification, the smear portion rapidly integrates into a distinct band of appropriate molecular weight.

Gene assembly (and, if necessary, conversion into a double stranded form), followed by amplification of the recombinant gene (optionally), digested with a suitable restriction enzyme and ligated into an expression vector to select the expression gene product. This process can be repeated if necessary to accumulate sequence changes that induce evolution into the desired function.

Thus, staggered kidney and homologous gene assembly (StEP) is a powerful and flexible way to recombine similar genes in a random manner or in a trend-like manner. This method can be used to bias recombination within or outside a particular region of a series of known sequences by adjusting the time and placement of primers used in the annealing / extension step. Moreover, it can also be used when recombining the specific cassette with homogeneous genetic information obtained separately or from one reaction solution. This method can also be used when recombining genes that have no sequence information but can produce functional 5 'and 3' amplification primers. Unlike other recombination methods, the staggered extension method can be carried out in one tube using conventional methods without complicated separation or purification steps.

Some advantages of certain primer embodiments according to the present invention are as follows.

1. The StEP method does not require separation of the parent molecule from the assembled product.

2. Certain primers can be used so that the recombination site exhibits a certain propensity.

3. StEP can adjust recombination frequency by varying elongation time.

4. The recombination method can be carried out in one tube.

5. This method can be carried out using single- or double-stranded polynucleotides.

6. This method shows no propensity to be introduced by DNaseI or other endonucleases.

7. Universal primers can be used.

8. Certain primers with limited randomness can be used to increase the frequency of mutations in selected regions of the gene.

Those skilled in the art can implement the present invention in various embodiments. For example:

1. Recombination and point mutation of related genes using only adjacent constant primers and staggered kidneys.

2. A method for recombination and mutation of related genes using a series of internal and adjacent primers at sufficiently low concentrations to cross-hybrid and stretch overlapping gene fragments until the primer is consumed during the high temperature cycle to form a recombinant synthetic gene. .

3. A method for recombination and mutation of genes using high concentrations of random sequence primers to make a collection of short DNA fragments and reassemble them to create a new gene.

4. A method for recombination and mutation of a gene using a group of constant primers to make a collection of DNA fragments and reassemble them to create a new gene.

5. A method of recombination and mutation of single-stranded polynucleotides to create new genes using one or more constant primers and staggered kidneys.

6. A method of recombination using certain primers with defined randomness at least 30% or at least 60% of the nucleotide positions present in the primers.

Specific examples of the recombinant method based on the primers are as follows.

The present invention provides a significantly improved novel method of producing a novel polynucleotide sequence by point mutation and in vitro recombination of a group of parent sequences (templates). The novel polynucleotide sequences can be expressed in recombinant organisms using themselves (eg, computer-based computational work), or for inductively evolving a gene product. A first aspect of the invention involves priming a template gene with oligonucleotides of random sequence to make a collection of short DNA fragments. These short DNA fragments can be primed with each other based on complementarity under appropriate reaction conditions, and thus can be reassembled and made into full-length genes by repeating the high temperature cycling process in the presence of thermostable DNA polymerase. Reassembled genes containing point mutations as well as sequences of new combinations derived from other parent genes thus prepared can be amplified by conventional PCR and cloned into appropriate vectors to express the encoded protein. Selection or selection of such gene products may result in new variants with improved or even novel functions. This variant may use itself or serve as a new starting point for further progression of mutagenesis and recombination.

A second aspect of the present invention is directed to priming a template gene with a group of primer oligonucleotides of a given sequence or a sequence that exhibits limited irregularity to produce a collection of short DNA fragments and then re-whole to the full-length gene as described above. Assembling.

A third aspect of the invention includes a 'staggered extension' method, a novel method called StEP. Instead of reassembling the fragment collection made by extension of the primer, directly assemble the full-length gene in the presence of the template. StEP consists of a repeat cycle of denaturation followed by a abbreviated annealing / extension step. Fragments elongated in each cycle can anneal to other templates based on complementarity and can be elongated slightly to create "recombinant cassettes". This template conversion results in most polynucleotides containing sequences from different parent genes (ie, new recombinants are made). This method is repeated until full-length genes are formed. An optional gene amplification step can then be performed.

In another aspect, the present invention provides features and advantages for various uses. The most preferred embodiment uses a constant primer exhibiting defined irregularities corresponding to or adjacent to the 5 'and 3' ends of one or more constant primers or template polynucleotides with StEP to obtain gene fragments that grow to novel full-length sequences. It is. This simple method does not need to know the template sequence.

In another preferred embodiment, multiple constant primers or constant primers with defined irregularities are used to obtain short gene fragments that are reassembled into full-length genes. The use of multiple constant primers tends to result in a constant in vitro recombination frequency. Once sequence information is obtained, primers can be designed to create overlapping recombinant cassettes that increase the frequency of recombination at specific locations. As another feature, the method provides adaptability using useful structural and functional information as well as information accumulated through previous steps of mutagenesis and selection (or screening).

In addition to recombination, several aspects of primer-based recombination methods produce point mutations. It is desirable to be able to know and control this point mutation rate, which can be provided by manipulating DNA synthesis and genetic reassembly conditions. Using certain primer methods, mutagenic primers can induce specific point mutations at specific positions in the sequence.

Recombinant methods based on various primers according to the present invention enhance the activity of Actinoplanes utahensis ECB deacylating agents in the presence of organic solvents at various pH ranges and Bacillus subtilis It has been found to increase the thermal stability of subtilisin E. The role of point mutation and recombination in the generation of new sequences is confirmed by DNA sequencing. This method was observed in a simple and accurate way.

Many other features and additional advantages described above will be understood in greater detail through the following detailed description in conjunction with the accompanying drawings.

Example 1

Use of Contiguous Primers and Staggered Kidneys to Recombine and Improve the Thermal Stability of Subtilisin E

This example shows a constant primer recombination method used to enhance the thermostability of subtilisin E by recombining two genes known to encode subtilisin E variants with better thermal stability than wild type subtilisin E. . This example illustrates the general method outlined in FIG. 3 using only two primers corresponding to the 5 'and 3' ends of the template.

As outlined in FIG. 3, first, an extended recombinant primer is produced by the Staggered Stretch Method (StEP), which consists of a repeat cycle of denaturation and maximally abbreviated annealing / extension steps. The elongated fragments are reassembled into full-length genes through a homogeneous gene assembly step through high temperature circulation in the presence of DNA polymerase followed by a selective gene amplification step.

Two thermostable subtilisin E variants R1 and R2 were used to test recombinant methods based on constant primers with staggered kidneys. The positions with different bases between these two genes are shown in Table 1a and Table 1b. Only mutations leading to the amino acid substitutions Asn 181-Asp (N181D) and Asn 218-Ser (N218S) of the 10 different nucleotide positions in R1 and R2 provide thermostability. The remaining mutations remain unchanged in terms of thermostable effect (33). The single variants, N181D and N218S, have half-lives at 65 ° C. about 3 and 2 times greater than wild type subtilisin E, respectively, and their melting points (T _m ) are 3.7 ° C. and 3.2 ° C. higher than wild type enzymes, respectively. Random recombination methods that provide sequences containing such functional mutations have enzymes whose half-life at 65 ° C. is about eight times greater than wild-type subtilisin E, unless any other harmful mutations are formed in these genes during this recombination process. Will generate In addition, the total point mutagenesis associated with the recombination process can be estimated by the catalytic activity profile obtained from a small sample of the recombinant variant library. That is, if the point mutagenesis rate is 0, 25% of the population shows activity similar to wild type, 25% of the population shows activity similar to double mutant (N181D + N218S), and the remaining 50% is single mutant (N181D or N218S). Similar activity). Limited point mutagenesis increases the fraction of the library encoding enzymes with similar (or lower) activity to wild type. This fraction can be used to estimate point mutagenesis.

Substitution of DNA and Amino Acids in Thermostable Subtilisin E Mutants R1 and R2 gene base Base substitution Codon location amino acid Amino acid substitutions R1 780110711411153 A → GA → GA → TA → G 2233 109218229233 Substitution of Asn → SerAsn → Ser Copper

gene base Base substitution Codon location amino acid Amino acid substitutions R2 4845205987317457809951189 A → GA → TA → GG → AT → CA → GA → GA → G 33313213 1022489397109181245 Substitution of Copper Substitution Substitution of Copper Substitution Val → Ile Substitution Substitution Asn → SerAsn → Substitution of Copper The mutation is relative to wild-type subtilisin E with base substitution in common at position 780.

Materials and methods

Recombinant method based on constant primer using two contiguous primers

2 constant primers P5N (5'-CCGAG CGTTG CATAT G TGGA AG-3 '(SEQ ID NO: 1), underlined sequences are NdeI restriction sites) and P3B (5'- corresponding to 5' and 3 'adjacent primers, respectively) CGACT CTAGA GGATC C GATT C-3 ′ (SEQ ID NO: 2), the underlined sequence is a BamHI restriction site, was used for recombination. Reaction conditions (final volume 100 μl): 0.15 pmol plasmid DNA containing genes R1 and R2 (1: 1 mixture) used as template, 15 pmol of each adjacent primer, 1x Taq buffer, 0.2 mM each dNTP, 1.5 mM MgCl ₂ And 0.25 U of Taq polymerase. Program: Circulation 80 times for 5 minutes at 95 ° C and 30 seconds at 94 ° C, 5 seconds at 55 ° C. QIAEX II gel extraction kit by electrophoresis to cut from 0.8% agarose gel after electrophoresis Purification using The thus purified product was digested with NdeI and BamHI and subcloned into pBE3 shuttle vector. Libraries of this gene were expressed and selected by amplification in E. coli HB101 and transfer to B. subtilis DB428 competent cells as described in Document (35).

DNA sequencing

Genes were purified using the QIAprep spin plasmid miniprep kit to obtain sequencing grade DNA. Sequencing was performed with an ABI 373 DNA Sequencing System using the Dye Terminator Cycle Sequencing Kit (Perkin Elmer, Branchburg, NJ).

result

Progression of staggered elongation was monitored by isolating DNA fragments by agarose gel electrophoresis by aliquoting an amount (10 μl) from reaction tubes at various time points in the primer elongation method. Gel electrophoresis of primer extension reaction resulted in an annealing / extension reaction at 55 ° C. for 5 seconds, the smear was removed at around 100 bp (after 20 cycles), near 400 bp (after 40 cycles) and near 800 bp (after 60 cycles). Finally, strong bands in the smear were shown at about 1 kb. This band (mixture of the reassembled product) was gel purified, digested with restriction enzymes BamHI and NdeI and ligated to the vector generated by BamHI-NdeI digestion of the E. coli / B. Subtilis pBE3 shuttle vector. This gene library was amplified in E. coli HB101 and transferred to B. subtilis DB428 competent cells for expression and selection (35).

The thermal stability of the enzyme variants was determined by the 96 well plate mode 33 as described above. About 200 clones were selected, about 25% of which showed subtilisin activity. Among these active clones, the frequency of double mutant like phenotype (high thermostability) was about 23%, single mutant like phenotype was about 42%, and wild type like phenotype was about 34%. This distribution was very similar to the value expected when the two thermostable mutants N218S and N181D were able to recombine completely independently of each other.

Twenty clones were randomly taken from the E. coli HB101 gene library. Their plasmid DNA was isolated and digested with NdeI and BamHI. Nine (45%) of the 20 clones had the correct size insert (approximately 1 kb). Thus, about 55% of the libraries did not show activity due to the deletion of the correct subtilisin E gene. These clones were not counted because they could not be members of the subtilisin library. In view of this factor, it was found that 55% of the library (25% active clone in 45% clone with the correct size insert) had subtilisin activity. This activity profile indicates that point mutagenesis is less than 2 mutations per gene (36). Five clones with the correct size insert were sequenced. The results are summarized in FIG. All five genes are recombinant products with varying minimum crossings from one to four. Of these five genes, only one new point mutation was observed.

Example 2

Use of Certain Contiguous Primers and Staggered Kidneys to Recombine pNB Esterase Variants

The two primer recombination methods used in this example for the pNB esterase are similar to those described in Example 1 for subtilisin E. As two templates, 14 bases different pNB esterase mutant genes were used. These templates 61C7 and 4G4 were used in the form of plasmids. Two target genes were used at a concentration of 1 ng / μl in the renal response. Adjacent primers (RM1A and RM2A, Table 2) were added at a final concentration of 2 ng / μl (about 200-fold molar excess per template).

Primers used for recombination of the pNB esterase gene primer order RM1A GAG CAC ATC AGA TCT ATT AAC (SEQ ID NO: 3) RM2A GGA GTG GCT CAC AGT CGG TGG (SEQ ID NO: 4)

Clone 61C7 was isolated based on the activity exhibited in the organic solvent and contained 13 DNA mutations compared to the wild type sequence. Clone 4G4 was isolated on the basis of thermal stability and contained 17 DNA mutations compared to wild type. These clones shared eight mutations due to the use of co-parents. The gene product from 4G4 was much more thermostable than the gene product from 61C7. Thus, the measure of recombination between genes is the simultaneous separation of high solvent activity and high thermal stability or the loss of both properties in the recombinant gene. In addition, recombination frequency and mutation rate can be confirmed by sequencing random clones.

In the case of the pNB esterase gene, the extension of the primer proceeds by conducting the extension reaction 90 times by a high temperature circulation treatment consisting of 30 seconds at 94 ° C and 15 seconds at 55 ° C. After 20, 40, 60, 70, 80 and 90 cycles an amount (10 μl) was isolated. Agarose gel electrophoresis showed a low molecular weight 'smear' phenomenon after 20 cycles, and the average size and total intensity of subsequent consecutive samples increased. After 90 cycles a clear smear evolving from 0.5 kb to 4 kb was apparent, with a maximum signal intensity of about 2 kb (length of full length gene). Soaring from half length to full length genes has been shown to occur in 60 to 70 cycles.

The thick smear was amplified through six polymerase chain reactions to more clearly represent the full length recombinant gene population. In addition, controls other than the primers were also amplified using adjacent primers to determine baseline values due to residual templates present in the reaction mixture. Band intensities from primer-extended gene populations were more than 10 times stronger than controls, indicating that the amplified nonrecombinant template contained only a small amount of the amplification group of the gene population.

The amplified recombinant gene collection was digested with restriction enzymes XbaI and BamHI and then ligated to the pNB106R expression vector as disclosed by Zock et al, 35. Transformation of the E. coli strain TG1 using the ligated DNA was carried out using a known calcium chloride transformation method. Transformed colonies were selected on LB / agar plates containing 20 μg / ml tetracycline.

The mutation rate of this method was calculated by measuring the percentage of clones expressing active esterases (20). In addition, randomly collected colonies were sequenced to determine the mutation frequency and recombination efficiency of this method.

Example 3

Recombination of pNB Esterase Gene Using Scattered Internal Constant Primer and Staggered Kidney

This example demonstrates that scattered constant primer recombination techniques can generate new sequences through recombination and point mutagenesis of mutations present in the parent sequence.

Experiment method and basic information

Two pNB esterase genes (2-13 and 5-B12) were prepared using constant primer recombination techniques. Gene products derived from 2-13 and 5-B12 were somewhat thermostable than the wild type. Gene 2-13 contained 9 mutations that were not originally present in the wild-type sequence, while Gene 5-B12 contained 14 mutations. The positions of these two genes are shown in FIG. 5.

Tables 3a and 3b describe the sequences of the eight primers used in this example. Along with the position of the oligos annealed to the template gene (5 'end of the template gene), primer orientation (F is forward and R is reverse) is also shown. These primers are indicated by arrows along gene 2-13 in FIG. 5.

Primer sequences used in this example designation Orientation location order RM1A F -76 GAGCACATCAGATCTATTAAC (SEQ ID NO: 3) RM2A R +454 GGAGTGGCTCACAGTCGGTGG (SEQ ID NO: 4) S2 F 400 TTGAACTATCGGCTGGGGCGG (SEQ ID NO: 5) S5 F 1000 TTACTAGGGAAGCCGCTGGCA (SEQ ID NO: 6) S7 F 1400 TCAGAGATTACGATCGAAAAC (SEQ ID NO: 7)

designation Orientation location order S8 R 1280 GGATTGTATCGTGTGAGAAAG (SEQ ID NO: 8) S10 R 880 AATGCCGGAAGCAGCCCCTTC (SEQ ID NO: 9) S13 R 280 CACGACAGGAAGATTTTGACT (SEQ ID NO: 10)

Materials and methods

Recombination based on constant primers

1. Preparation of the gene to be recombined.

Plasmids containing the gene to be recombined were purified from transformed TG1 cells using the Qiaprep kit (Qiagen, Chassworth, CA). Purified plasmids were quantified by UV absorbance and mixed 1: 1 at a final concentration of 50 ng / μl.

2. Staggered Kidney PCR and Reassembly.

100 μl of standard reaction solution containing 12.5 ng of 8 primers each (MgCl ₂ 1.5 mM, KCl 50 mM, Tris-HCl (pH 9.0) 10 mM, Triton X-10 0.1%, dNTP 0.2 mM, Taq polymerase 0.25U (US) 4 μl of the plasmid mixture was used as a template in Promega, Madison, Wisconsin). Control reactions containing no primer were also assembled. The reaction was subjected to 100 high temperature cycles in cycles of 94 seconds for 30 seconds and 55 seconds for 15 seconds. At this time, the reaction was detected through an agarose gel, and the product appeared as a large smear (the product without the primer control had no product visible to the naked eye).

3. DpnI decomposition of the template.

1 μl of the assembly reaction was then digested with DpnI to remove the template plasmid. 10 μl of DpnI lysate contains 1 × NE buffer 4 and DpnI 5U (New England Biolabs, both of Beverly, Mass., USA), incubated for 45 minutes at 37 ° C., followed by 10 at 70 ° C. The enzyme was heat inactivated by incubation for a minute.

4. PCR amplification of the reassembled product.

10 μl of the digest was added to 90 μl of the standard PCR reaction solution (described in Step 2) containing 0.4 μM of primers 5b (ACTTAATCTAGAGGGTATTA, SEQ ID NO: 11) and 3b (AGCCTCGCGGGATCCCCGGG, SEQ ID NO: 12) specific to the ends of the gene. After 20 times of standard PCR (30 sec at 94 ° C., 30 sec at 48 ° C., 1 min at 72 ° C.), the reaction was detected with agarose gel to show a strong band of correct size (2 kb), Only very faint bands were observed in the lanes of no control group. The product band was purified and cloned back into the expression plasmid pNB106R and transformed TG1 cells by electropenetration.

result

Colonies obtained by this transformation were analyzed for pNB esterase initial activity and thermostability in four 96 well plates. About 60% of the clones exhibited initial activity and thermal stability within 20% of the parent gene value. Very few (10%) of the clones were inactive (less than 10% of the parental gene's initial activity). This result suggests a low mutagenesis rate. Four mutants with the highest thermostability values were sequenced. Two clones (6E6 and 6H1) were obtained as a result of recombination between parent genes (FIG. 5). One of the remaining two clones had a new point mutation and the other did not show any difference from the parent 5B12. The combination of mutations T99C and C204T present in mutant 6E6 suggests that recombination has occurred between these two sites. In addition, mutant 6H1 was missing mutation A1072G (with mutations C1038T and T1310C), which is the result of two recombinations (one recombination between 1028 and 1072 sites, and the other recombination between 1072 and 1310). A total of five new point mutations were observed among four sequenced genes.

Example 4

Recombination of Two Thermostable Subtilisin E Variants Using Internal Constant Primer and Staggered Kidney

This example demonstrates that certain primer recombination techniques can produce new sequences of newly combined mutations present in the parent sequence. It also demonstrates the utility of certain primer recombination techniques in further improving enzyme performance (here thermostability). This example suggests that certain primers provide some propensity for recombination so that recombination occurs best at the sequence site designated by the primers (inside the primer). This example also demonstrates that certain mutations can be made to the recombinant sequence using the appropriate constant primer sequence containing the desired mutation.

The genes (R1 and R2) encoding the two thermostable subtilisin E variants described in Example 1 were recombined by constant primer recombination using internal primers. FIG. 6 shows four constant internal primers used to make progeny genes recombinant from template genes R1 and R2 in this example. Primer P50F contains a mutation (A → T at base position 598) that eliminates HindIII restriction sites while at the same time creates a new unique NheI site. These primers are used to demonstrate that designing certain primers in specific ways can result in specific mutations in a group of recombinant sequences. Gene R2 also contains mutation A → G, which lacks the HindIII site at the same base position. Thus, restriction analysis (cutting with NheI and HindIII) of random clones taken from the recombinant library can yield the efficiency of introduction and recombination of specific mutations through mutagenic primers. In addition, sequencing randomly taken (unselected) clones can provide more information about recombination and mutagenesis results during certain primer-based recombinations.

Materials and methods

Recombination based on constant primers

Recombination method based on a constant primer shown in Figure 2 was performed as follows with StEP.

1. Preparation of the gene to be recombined.

Approximately 10 μg of the plasmid containing the R1 and R2 genes was mixed with NdeI and BamHI (30U each) in 50 μl of 1 × Buffer B (Morlinger Mannheim, Indianapolis, Indiana, USA) for 1 hour at 37 ° C. Digested. About 1 kb of insert was purified from 0.8% preparative agarose gel using the QIAEX II gel extraction kit. This DNA insert was dissolved in 10 mM Tris-HCl, pH 7.4. DNA concentration was measured and the inserts were mixed 1: 1 at a concentration of 50 ng / μl.

2. Staggered Kidney PCR and Reassembly.

Reaction conditions (final volume 100 μl): about 100 ng of insert used as template, 4 internal primers 50 ng each, 1 × Taq buffer, 0.2 mM each dNTP, 1.5 mM MgCl ₂ , 0.25U Taq polymerase.

Program: 7 times for 30 seconds at 94 ° C, 15 seconds at 55 ° C, then 10 seconds for 30 seconds at 94 ° C, 15 seconds at 55 ° C, 5 seconds at 72 ° C (staggered kidney), then 94 ° C At 53 seconds for 30 seconds, 15 seconds at 55 ° C and 1 minute at 72 ° C (genetic assembly).

3. DpnI decomposition of the template. 1 μl of the reaction solution was diluted with up to 9.5 μl of dH ₂ O, 0.5 μl of DpnI restriction enzyme was added to digest the DNA template for 45 minutes, then incubated at 70 ° C. for 10 minutes, and then 10 μl of the reaction was added. It was used as a template for 10 PCR reactions.

4. PCR amplification of the reassembled product.

PCR conditions (100 μl final volume): 30 pmol of external primers P5N and P3B, 1 × Taq buffer, 0.2 mM each dNTP and 2.5 U of Taq polymerase.

PCR program: 10 cycles of 30 seconds at 94 ° C, 30 seconds at 55 ° C and 1 minute at 72 ° C.

The program provided a single band of the correct size. The product was purified and subcloned into the pBE3 shuttle vector. This gene library was amplified in E. coli HB101 and transferred to B. subtilis DB428 competent cells for expression and selection as described in document (35). The thermal stability of the enzyme variants was measured in a 96 well plate manner as described above (33).

DNA sequencing

Ten E. coli HB101 transformants were selected and sequenced. Genes were purified using the QIAprep spin plasmid miniprep kit to obtain sequencing grade DNA. Sequencing was performed with an ABI 373 DNA sequencing system using the Dye Terminator Cycle Sequencing Kit (Perkin Elmer, Branchburg, NJ).

result

1) restriction analysis

Forty clones randomly taken from the recombinant library were digested with the restriction enzymes NheI and BamHI. In separate experiments the same 40 plasmids were digested with HindIII and BamHI. Their reaction products were analyzed by gel electrophoresis. As shown in FIG. 7, eight of the 40 clones (about 20%) contained the newly introduced NheI restriction site, demonstrating that specific mutations can be introduced into the individual through mutagenic primers.

2) DNA sequence analysis

The first 10 randomly picked clones were sequenced and the results are shown in FIG. 8. At least six of the ten genes were recombined. The minimum cross-reaction (recombination) between genes R1 and R2 among these six genes varied from 1 to 4. All observed crossovers occurred among the regions designated by the four primers. Mutations outside this region are rarely recombined, if any, and can be seen by the fact that no recombination occurs at all between the two mutations at the 484 and 520 base positions. These results indicate that certain primers impart a certain propensity to recombination so that recombination occurs most often at the sequence site (inside the primer) designated by the primer. Also, very close mutations tend to remain together (eg, base substitutions 731 and 745 and base substitutions 1141 and 1153 always remain in pairs). However, the sequence of clone 7 shows that two mutations located as close as 33 bases can also be recombined (base positions 1107 and 1141).

In the process, 23 new point mutations were formed out of 10 genes. This error rate of 0.23% corresponds to two to three new point mutations per gene, which is the rate determined to be optimal for making mutation libraries in induced enzyme evolution (15). Such mutant forms are listed in Table 4. Mutations are mainly base transitions and are uniformly distributed along genes.

New point mutations identified in 10 recombinant genes Base transition Frequency Base conversion Frequency G → AA → GC → TT → C 4435 A → TA → CC → AC → GG → CG → TT → AT → G 11101030 A total of 9860 bases were sequenced. The mutation rate was 0.23%.

4) Phenotypic Analysis

Approximately 450 B. subtilis DB428 clones were harvested and grown in SG medium supplemented with 20 μg / ml of kanamycin injected into 96 well plates. About 56% of the clones expressed active enzymes. Previous experiments have shown that the inactivation rate of this experiment is a mutation rate representing 2-3 mutations per gene (35). About 5% of the clones showed a double mutant (N181D + N218S) like phenotype, lower than 25%, which is expected when random recombination occurred solely by point mutations. (DNA sequencing revealed that out of 10 randomly picked clones, two clones 7 and 8 contained N218S and N181D mutations.)

Example 6

Optimization of Actinoplanes Utahensis ECB Deacylating Agent by Random Priming Recombination Method

This example illustrates a method for obtaining short DNA fragments from denatured linear double stranded DNA (eg, restriction fragments purified by gel electrophoresis; 22). Purified DNA was mixed with a molar excess of primer, heated to denature, and synthesized using a Klenow fragment of E. coli DNA polymerase I. Since this enzyme lacks 5 '→ 3' exonuclease activity, random priming products are synthesized only by primer extension and are not degraded by exonuclease. The reaction is carried out at pH 6.6 where the 3 '→ 5' exonuclease activity of the enzyme is much reduced (36). This condition is preferred for random synthesis initiation.

The method includes the following steps.

1. Cut the target DNA with a suitable restriction enzyme and purify the target DNA fragment by gel electrophoresis using the Wizard PCR Prep Kit (Promega, Madison, Wisconsin). As an example, the actinoplanes utahensis ECB deacylating agent gene was cleaved from the recombinant plasmid pSHP100 as a 2.4 kb long XhoI-PshAI fragment. This step is essential for linearizing DNA in subsequent denaturation steps. This fragment was purified by agarose gel electrophoresis using the Wizard PCR Prep Kit (Promega, Madison, WI) (FIG. 9, step (a)). The gel purification step is also essential for removing restriction enzyme buffer from the DNA because Mg ²⁺ ions make it difficult to denature the DNA in the next step.

2. 400 ng (about 0.51 pmol) of double stranded DNA dissolved in H ₂ O was mixed with 2.75 μg (about 1.39 nmol) of dp (N) ₆ random primers. After soaking in boiling water for 3 minutes, the mixture was immediately placed in an ethanol / ice water bath.

The size of the random priming product is the inverse of the primer concentration (33). The presence of high concentration primers is believed to induce steric hindrance. Under these reaction conditions the random priming product is about 200 to 400 bp as measured by electrophoresis through an alkaline agarose gel (step b in FIG. 9).

3. Add 10 μl of 10 × reaction buffer (10 × buffer: 900 mM HEPES, pH 6.6; 0.1 M magnesium chloride, 10 mM dithiothreitol and 5 mM dATP, dCTP, dGTP and dTTP) to the denatured sample. The total volume of the reaction mixture was made up to 95 μl with H ₂ O.

4. 10 units (approximately 5 μl) of Klenow fragment of E. coli DNA polymerase I were added. All components were mixed by well blocking the outside of the tube and centrifuged at 12,000 g for 1-2 seconds in a microcentrifuge to transfer all liquid to the bottom. This reaction was performed at 22 degreeC for 35 minutes.

The elongation rate depends on the template and the concentration of the four nucleotide precursors. Since the reaction was conducted under conditions that minimize exonuclease degradation, the newly synthesized product did not degrade to the extent that it was detected.

5. After 35 minutes at 22 ° C., the sample was cooled to 0 ° C. on ice to stop the reaction. 100 µl of ice-cold H ₂ O was added to the reaction mixture.

6. The reaction mixtures were all passed serially through a Centricon-100 (template and protein removal) filter and a Centricon-10 filter (priming and removing fragments of less than 50 bases) to purify randomly primed products. Centricon filters are available from Amicon Inc., Beverly, Mass., USA. Residual fraction (volume about 85 μl) was recovered from Centricon-10. This fraction contained the desired random priming product (FIG. 9, step c) and was used for total gene reassembly.

Total gene reassembly was performed as follows.

1. For reassembly by PCR, 5 μl randomly primed DNA fragments from Centricon-10, 2 × PCR premixes [5 times diluted cloned Pfu buffer, 0.5 mM of each dNTP, cloned Pfu polymerase 0.1 U / μl (Stratazine, La Jolla, Calif.), 8 μl of 30% (v / v) glycerol and 7 μl of H ₂ O were mixed on ice. The concentration of randomly primed DNA fragments used for reassembly is the most important variable, so it is advisable to make several separate reactions in different concentrations to find the desired concentration.

2. After incubation at 96 ° C. for 6 minutes, 1.5 minutes at 95 ° C. in a DNA Engine PTC-200 (MJ Research, Inc., Watertown, Mass., USA) without adding mineral oil, 40 cycles of high temperature circulation consisting of 1.0 min at 55 ° C. and 1.5 min + 5 sec / cycle at 72 ° C. were carried out, and the extension step of the last cycle was carried out at 72 ° C. for 10 minutes.

3. After 20, 30 and 40 cycles, 3 μl were aliquoted from the reaction mixture and analyzed by agarose gel electrophoresis. The PCR product reassembled after 40 cycles contained the correct size product in a rather large and small smear (see Figure 9, step d).

The correctly reassembled product obtained in this primary PCR was further amplified by a secondary PCR reaction containing PCR primers complementary to the ends of the template DNA. The amplification procedure is as follows.

Each primer, xhoF28 (5 'GGTAGAGCGAGTCTCGAGGGGGAGATGC3') (SEQ ID NO: 13) and pshR22 (5 'AGCCGGCGTGACGTGGGTCAGC 3') (SEQ ID NO: 14) 0.2 mM, MgCl ₂ 1.5 mM, Tris-HCl (pH 9.0) 10 mM, KCl 50 mM , 200 μM each of 4 dNTPs, 6% (v / v) glycerol, Taq polymerase (Promega, Madison, WI) 2.5 U and Pfu polymerase ( Stratazine, La Jolla, CA, USA) 2.0 μl of the primary PCR reassembly product was used as template in 100 μl of standard PCR reaction containing 2.5 U.

2. After 5 minutes incubation at 96 ° C, 1.5 minutes at 95 ° C in DNA Engine PTC-200 (MJ Research, Inc., Watertown, Mass., USA) without adding mineral oil. 15 cycles of high temperature circulation at 1.0 ° C. and 1.5 minutes at 72 ° C. were performed 15 times, 1.5 minutes at 95 ° C., 1.0 minutes at 55 ° C., 1.5 minutes at 5 ° C., and 15 additional cycles of 5 seconds / cycle. In the last cycle, the stretching step was carried out for 10 minutes at 72 ℃.

3. Amplification Results A large amount of PCR product with the correct size of the entire ECB deacylating agent gene was obtained (see FIG. 9, step e).

Cloning was performed as follows.

1. PCR product of ECB deacylating agent gene was digested with XhoI and PshAI restriction enzymes and cloned into pIJ702 modified vector.

2. Mutant libraries were made by transforming the S.lividans TK23 protoplasts with this ligation mixture.

In situ screening method of ECB deacylating agent mutant

Each transformant with S. lividans TK23 library obtained as described above was selected by detecting deacylating agent activity by in situ plate assay using ECB as substrate. Transformed protoplasts were regenerated by incubation at 30 ° C. for 24 hours in R2YE agar plate medium and further propagated for 48 to 72 hours in the presence of thiostrepton. When colonies were grown to the appropriate size, 6 ml of a 45 ° C. purified agarose (Sigma product) solution containing 0.5 mg / ml ECB in 0.1 M sodium acetate buffer (pH 5.5) was poured onto the top of each R2YE agar plate 37 Further propagation at 18 ° C. for 18 to 24 hours. Colonies enclosed with larger clear sections than control colonies containing wild-type recombinant plasmid pSHP150-2 were selected as potential positive mutants by using them as indicators of more effective ECB hydrolysis activity obtained through improved enzyme properties or increased enzyme expression and secretion rate. It was. These colonies were harvested and used for preservation and subsequent manipulation.

HPLC analysis of ECB deacylating agent mutants

Single positive transformants were inoculated in 20 ml of fermentation medium containing 5 µg / ml thiostrepton and propagated at 30 ° C. for 48 hours. In this step, all cultures were subjected to HPLC analysis using ECB as substrate. 100 μl of total broth was used for an HPLC reaction run at 30 ° C. for 30 minutes in the presence of 200 μg / ml of 0.1 M NaAc (pH 5.5), 10% (v / v) MeOH and ECB substrate. 20 μl of each reaction mixture was loaded onto a PolyLC polyhydroxyethyl aspartamide column (4.6 × 100 mm) and eluted through an acetonitrile gradient at a flow rate of 2.2 mL / min. ECB nuclei were detected at 225 nm.

Purification of ECB Deacylating Agent Mutant

After HPLC analysis, 2.0 ml of all potential positive mutant precultures were seeded in 50 ml of fermentation medium and propagated at 30 ° C. at 280 rpm for 96 hours. This 50 ml culture was centrifuged at 7,000 g for 10 minutes. The supernatant was recentrifuged at 16,000 g for 20 minutes. Supernatants containing ECB deacylating agent mutant enzyme were stored at -20 ° C.

Supernatants of positive mutants were further concentrated to 1/30 of the original volume using an Amicon filtration unit with a molecular weight cutoff of 10 kD. The enzyme sample thus obtained was diluted with an equal volume of 50 mM KH ₂ PO ₄ (pH 6.0) buffer and 1.0 ml was loaded into a HiTrap ion exchange column. 50 mM KH ₂ PO ₄ (pH 6.0) was used as the binding buffer, and 50 mM KH ₂ PO ₄ (pH 6.0) and 1.0 M NaCl were used as the elution buffer. A linear gradient of 0-1.0 M NaCl was injected in an 8-fold column volume under a flow rate of 2.7 ml / min. The ECB deacylating agent mutant fraction was eluted in 0.3 M NaCl and it was concentrated using Amicon Centricon-10 unit and the buffer was exchanged for 50 mM KH ₂ PO ₄ (pH 6.0). Enzyme purity was confirmed by SDS-PAGE and concentration was measured by Bio-Rad protein analysis.

Inactivity Assay for ECB Deacylating Agent Variants

In order to assay the activity of 4.0 μg of each purified ECB deacylating agent variant, reaction was carried out at 30 ° C. for 0 to 60 minutes in the presence of 0.1 M NaAc (pH 5.5), 10% (v / v) MeOH and 200 μg / ml of ECB substrate. I was. 20 μl of each reaction mixture was loaded onto a PolyLC polyhydroxyethyl aspartamide column (4.6 × 100 mm) and the acetonitrile gradient was eluted at a flow rate of 2.2 ml / min. The reaction product was monitored at 225 nm and recorded with IBM PC data capture system. The peaks of the ECB nuclei were numerically integrated and used to calculate the specific activity of each mutant.

As shown in FIG. 10, one mutant (M16) obtained from 2,012 original transformants after wild-type ECB deacylating agent gene was performed only once with a technique based on such random priming was a wild-type enzyme. It was observed to have 2.4 times higher activity than that of. FIG. 11 shows that the activity of M16 was increased compared to that of wild type enzyme in a wide pH range.

Example 7

Method for improving subtilisin E from thermostable Bacillus subtilis using random sequence primer recombination

This example illustrates whether primer-based recombination methods can be used for various DNA polymerases. In addition, the stability of subtilisin E obtained by recombination is also illustrated.

As recombinant templates, genes R1 and R2 encoding the two thermostable subtilisin E variants described in Example 1 were selected.

(1) target gene preparation

Subtilisin E thermostable mutant genes R1 and R2 (FIG. 11) were treated by random priming DNA synthesis. Plasmid pBE3 was double digested with BamHI and NdeI and purified on 0.8% agarose gel using Wizard PCR Prep kit (Promega, Madison, WI) to subtilisin E prosequence 45 nt, total mature sequence and A 986 bp fragment containing 113 nts following the stop codon was obtained. This DNA needs to be linearized for subsequent denaturation steps. In addition, purification of the gel is necessary to remove restriction enzyme buffer from the DNA, since Mg ²⁺ ions adversely affect DNA denaturation in the next step.

(2) Random Priming DNA Synthesis

Random priming DNA synthesis was used to obtain short DNA fragments from denatured linear double stranded DNA. Purified B. subtilis subtilisin E mutant genes are mixed with primers in excess of molar amount and heated to denature, followed by denaturation of various DNA polymerases, ie Clinau fragment of E. coli DNA polymerase I, bacteriophage T4 DNA Synthesis was carried out using either one of the polymerase and T7 sequinase version 2.0 DNA polymerase.

Under each optimal performance condition (29), bacteriophage T4 DNA polymerase provided similar synthesis results to the Clinau fragment. In the case of using the T7 sequinase version 2.0 DNA polymerase (31, 32), the length of the synthesized DNA fragment was usually longer. In order to control the length of the synthetic fragment to 50 to 400 bases, the synthesis must contain a small amount of MnCl ₂ .

Short initial DNA fragments can also be generated by PCR using Stoffel fragments of Taq DNA polymerase or Pfu DNA polymerase. Importantly, routine experiments have identified reaction conditions in which short random primers can anneal the template and provide sufficient DNA amplification at high temperatures. Applicants have discovered that random primers such as dp (N) ₁₂ can be used for fragment generation via PCR.

2.1 Randomized Primed DNA Synthesis Using Klenow Fragments

Since the Klenow fragment of E. coli DNA polymerase I has no 5 '→ 3' exonuclease activity, the random priming product is only synthesized by primer extension and not degraded by exonuclease. This reaction is carried out at pH 6.6 where the 3 '→ 5' exonuclease activity of the enzyme is significantly reduced (36). Such conditions are advantageous for initiating random synthesis.

1. 200 ng (about 0.7 pmol) of R1 DNA dissolved in H ₂ O and the same amount of R2 DNA were mixed with 13.25 µg (about 6.7 nmol) of dp (N) ₆ random primer. This mixture was immersed in boiling water for 5 minutes and immediately placed in an ethanol ice water bath.

The size of the random priming product is the inverse of the primer concentration (30). The presence of high concentrations of primers is believed to induce steric hindrance. Under these reaction conditions, the random priming product shows a size of about 50 to 500 bp as measured by agarose gel electrophoresis.

2. Add 10 μl of 10 × reaction buffer (10 × buffer: 900 mM HEPES, pH 6.6; 0.1 M magnesium chloride, 20 mM dithiothreitol and 5 mM of each dATP, dCTP, dGTP and dTTP) to the denatured sample. The total volume of the reaction mixture was made up to 95 μl with H ₂ O.

3. 10 units (approximately 5 μl) of the Clinau fragment of E. coli DNA polymerase I (Murlinger Mannheim, Indianapolis, Indiana) were added. Carefully tap the outside of the tube to mix all the ingredients and centrifuge at 12,000 g for 1-2 seconds with a microcentrifuge to move all liquid to the bottom. The reaction was carried out at 22 ° C. for 3 hours.

The elongation rate depends on the template and the concentration of the four nucleotide precursors. Since the reaction was conducted under conditions that minimize the exonuclease degradation reaction, the newly synthesized product did not degrade to a detectable degree.

4. After 3 hours at 22 ° C., the sample was cooled to 0 ° C. on ice to terminate the reaction. 100 μl of ice-cold H ₂ O was added to the reaction mixture.

5. Pass all of the reaction mixture continuously through Microcon-100 (Amicon, Beverly, Mass.) (Template and protein removal) and Microcon-10 filter (primer and fragments less than 40 bases) Random priming products were purified. The remaining fractions (about 65 μl) were recovered from Microcon-10. Fractions containing the desired random priming product were buffer exchanged for PCR reaction buffer using fresh Microcon-10 and used for complete gene reassembly.

Randomized Priming DNA Synthesis Using Bacteriophage T4 DNA Polymerase

Clinau fragments of bacteriophage T4 DNA polymerase and E. coli DNA polymerase I are similar in that they have 5 '→ 3' polymerase activity and 3 '→ 5' exonuclease activity, respectively. The exonuclease activity of the bacteriophage T4 DNA polymerase is 200 times higher than that of the Clinau fragment. In addition, mutagenesis efficiency is different from that of the Klenow fragment, since short oligonucleotide primers are not removed from the single-stranded DNA template (23).

1. 200 ng (about 0.7 pmol) of R1 DNA dissolved in H ₂ O and the same amount of R2 DNA were mixed with 13.25 µg (about 6.7 nmol) of dp (N) ₆ random primer. This mixture was immersed in boiling water for 5 minutes and immediately placed in an ethanol ice water bath. The presence of high concentrations of primers is believed to induce steric hindrance.

2. The denatured sample was subjected to 10 × reaction buffer (10 × buffer: 500 mM Tris-HCl, pH 8.8; 150 mM (NH ₄ ) ₂ SO ₄ , 70 mM magnesium chloride, 100 mM 2-mercaptoethanol, 0.2 mg / ml) 10 μl of serum albumin and 2 mM of each dATP, dCTP, dGTP and dTTP) were added and the total volume of the reaction mixture was made up to 90 μl with H ₂ O.

3. 10 units (approximately 10 μl) of T4 DNA polymerase I (Morlinger Mannheim, Indianapolis, Indiana) were added. Carefully tap the outside of the tube to mix all the ingredients and centrifuge at 12,000 g for 1-2 seconds with a microcentrifuge to move all liquid to the bottom. The reaction was carried out at 37 ° C. for 30 minutes. Under these reaction conditions the size of the random priming product was approximately 50 to 500 bp.

4. The reaction was terminated by cooling the reaction to 0 ° C. on ice after 30 min at 37 ° C. 100 μl of ice-cold H ₂ O was added to the reaction mixture.

5. Purify the random priming products by passing all of the reaction mixture continuously through Microcon-100 (template and protein removal) and Microcon-10 filters (priming and fragment removal of less than 40 bases). The remaining fractions (about 65 μl) were recovered from Microcon-10. Fractions containing the desired random priming product were buffer exchanged for PCR reaction buffer using fresh Microcon-10 and used for subsequent complete gene reassembly.

2.3 Random Priming DNA Synthesis Using T7 Sequinase v2.0 DNA Polymerase

Since the T7 sequinase v2.0 DNA polymerase has no exonuclease activity and is highly progressive, the average length of the synthesized DNA is greater than the DNA synthesized by the Klenau fragment or T4 DNA polymerase. When the reaction solution contains an appropriate amount of MnCl ₂ , the size of the synthesized fragment can be controlled to less than 400 bp.

1. 200 ng (about 0.7 pmol) of R1 DNA dissolved in H ₂ O and the same amount of R2 DNA were mixed with 13.25 µg (about 6.7 nmol) of dp (N) ₆ random primer. The mixture was immersed in heated water for 5 minutes and immediately placed in an ethanol ice water bath. The presence of high concentrations of primers is believed to induce steric hindrance.

2. 10x reaction buffer (10x buffer: 400 mM Tris-HCl, pH 7.5, 200 mM magnesium chloride, 500 mM NaCl, 3 mM MnCl ₂ , and 3 mM of each dATP, dCTP, dGTP and dTTP) in the denatured sample 10 Μl was added and the total volume of the reaction mixture was made up to 99.2 μl with H ₂ O.

3. 10 units (approximately 0.8 μl) of T7 Sequinase v2.0 (Amersham Life Sciences, Cleveland, Ohio) were added. Carefully tap the outside of the tube to mix all the ingredients and centrifuge at 12,000 g for 1-2 seconds with a microcentrifuge to move all liquid to the bottom. The reaction was carried out at 22 ° C. for 15 minutes. Under these reaction conditions the size of the random priming product was approximately 50 to 400 bp.

4. After 15 minutes at 22 ° C., the reaction was cooled to 0 ° C. on ice to terminate the reaction. 100 μl of ice-cold H ₂ O was added to the reaction mixture.

5. Purify the random priming products by passing all of the reaction mixture continuously through Microcon-100 (template and protein removal) and Microcon-10 filters (priming and fragment removal of less than 40 bases). The remaining fractions (about 65 μl) were recovered from Microcon-10. Fractions containing the desired random priming product were buffer exchanged for PCR reaction buffer using fresh Microcon-10 and used for complete gene reassembly.

2.4 Random Priming DNA Synthesis by PCR Using Stoppel Fragments of Taq DNA Polymerase

Similar to the Klenow fragment of E. coli DNA polymerase I, the stoppel fragment of Taq DNA polymerase lacks 5 '→ 3' exonuclease activity. In addition, the thermal stability is greater than that of Taq DNA polymerase. However, the stoppel fragment is less progressive, extending on average 5 to 10 nucleotides of primer before dissociation. Fidelity can be improved because of less progress.

1. 50 ng (about 0.175 pmol) of R1 DNA dissolved in H ₂ O and the same amount of R2 DNA were mixed with 6.13 ug (about 1.7 nmol) of dp (N) ₁₂ random primer.

2. To this sample add 10 μl of 10 × reaction premix (10 × reaction premix: 100 mM Tris-HCl, pH 8.3, 30 mM magnesium chloride, 100 mM KCl, and 2 mM of each dATP, dCTP, dGTP and dTTP) The total volume of the reaction mixture was made up to 99.0 μl with H ₂ O.

3. After 5 minutes of incubation at 96 ° C., 2.5 units (ca. 1.0 μl) of Taq DNA polymerase stoppel fragment (Perkin Elmer Corporation, Norwalk, Conn.) Were added. The high-temperature circulation of DNA Engine PTC-200 (MJ Research, Inc., Watertown, Mass., USA) was performed at 95 ° C. for 60 seconds, 55 ° C. for 60 seconds and 72 ° C. for 50 seconds. 35 times were performed without the elongation step. Under these reaction conditions the size of the random priming product was approximately 50 to 500 bp.

4. The sample was cooled to 0 ° C. on ice to terminate the reaction. 100 μl of ice-cold H ₂ O was added to the reaction mixture.

5. Purify the random priming products by passing all of the reaction mixture continuously through Microcon-100 (template and protein removal) and Microcon-10 filters (priming and fragment removal of less than 40 bases). The remaining fractions (about 65 μl) were recovered from Microcon-10. Fractions containing the desired random priming product were buffer exchanged for PCR reaction buffer using fresh Microcon-10 and used for complete gene reassembly.

Random Priming DNA Synthesis by PCR Using 2.5 Pfu DNA Polymerase

Pfu DNA polymerase is very thermally stable and has inherent 3 '→ 5' exonuclease activity but no 5 '→ 3' exonuclease activity. Base substitution fidelity is estimated to be 2 × 10 ⁻⁶ .

1. 50 ng (about 0.175 pmol) of R1 DNA dissolved in H ₂ O and the same amount of R2 DNA were mixed with 6.13 ug (about 1.7 nmol) of dp (N) ₁₂ random primer.

2. To this sample 50 μl of a 2x reaction premix (2x reaction premix: cloned Pfu buffer ( stratazine , Lazola, Calif.), 0.4 mM of each dNTP, diluted 5 times) was added and the reaction The total volume of the mixture was made up to 99.0 μl with H ₂ O.

3. After incubation at 96 ° C. for 5 minutes, 2.5 units (approximately 1.0 μl) of Pfu DNA polymerase ( Stratazine , La Jolla, Calif.) Were added. The high-temperature circulation of DNA Engine PTC-200 (MJ Research, Inc., Watertown, Mass., USA) was performed at 95 ° C. for 60 seconds, 55 ° C. for 60 seconds and 72 ° C. for 50 seconds. 35 times were performed without the elongation step. Under these reaction conditions the size of the main random priming product was approximately 50-500 bp.

4. The sample was cooled to 0 ° C. on ice to terminate the reaction. 100 μl of ice-cold H ₂ O was added to the reaction mixture.

5. Purify the random priming products by passing all of the reaction mixture continuously through Microcon-100 (template and protein removal) and Microcon-10 filters (priming and fragment removal of less than 40 bases). The remaining fractions (about 65 μl) were recovered from Microcon-10. Fractions containing the desired random priming product were buffer exchanged for PCR reaction buffer using fresh Microcon-10 and used for complete gene reassembly.

(3) complete gene reassembly

1. For reassembly by PCR, 10 μl of random priming DNA fragments obtained from Microcon-10, 2 × PCR premixes [5 times diluted cloned Pfu buffer, 0.5 mM of each dNTP, cloned Pfu polymerase (California, USA). 0.1 U / μl) of Stratazine, Main Lazola), and 15 μl of H ₂ O were mixed on ice.

2. Incubate at 96 ° C. for 3 minutes, then 1.0 minutes at 95 ° C. without adding mineral oil in a DNA Engine PTC-200 (MJ Research, Inc., Watertown, Mass., USA) , 40 cycles of high temperature circulation consisting of 1.0 min at 55 ° C. and 1.0 min + 5 sec / cycle at 72 ° C. were carried out, and an extension step of 10 min at 72 ° C. was performed in the last cycle.

3. Take 3 μl from the reaction mixture at 20, 30 and 40 cycles and analyze by agarose gel electrophoresis. The reassembled PCR product obtained in 40 cycles contained the correct size product in large and small smears.

(4) amplification

The precisely reassembled product obtained in the primary PCR was further amplified in the secondary PCR reaction containing the PCR primer complementary to the end of the template DNA.

Primers P1 (5 'CCGAGCGTTGC ATATGTGGAAG 3') (SEQ ID NO: 15) and P2 (5 'CGACTCTAGAGGATCCGATTC 3') (SEQ ID NO: 16), respectively, 0.3 mM, MgCl ₂ 1.5 mM, Tris-HCl (pH 9.0) 10 mM, Standard PCR containing 50 mM KCl, 200 mM each of 4 dNTPs, 2.5 U of Taq Polymerase (Promega, Madison, WI) and 2.5 U of Pfu Polymerase ( Stratagin , La Jolla, CA) To 100 μl of reaction was added 2.0 μl of PCR reassembly aliquot as template.

2. After incubation for 3 minutes at 96 ° C., 60 seconds at 95 ° C. without addition of mineral oil in the DNA Engine PTC-200 (MJ Research, Inc., Watertown, Mass., USA) 15 high temperature cycles consisting of 60 seconds at 55 ° C. and 50 seconds at 72 ° C., followed by 60 seconds at 95 ° C., 60 seconds at 55 ° C., and 50 seconds (+5 seconds / cycle) at 72 ° C. 15 The elongation was carried out and the elongation step of 10 minutes was carried out at 72 ° C in the last cycle.

3. This amplification resulted in a large amount of PCR product containing subtilisin E complete gene of the correct size.

(5) cloning

Short DNA fragments were obtained using five different DNA polymerases, resulting in five collections of the final PCR amplified product. Each DNA collection was used to construct a library of corresponding subtilisin E variants.

1. PCR amplified reassembled product was purified by Wizard DNA-CleanUp kit (Promega, Madison, WI), digested with BamHI and NdeI, and electrophoresed on 0.8% agarose gel. The 986 bp product was cut from this gel and purified using the Wizard PCR Prep kit (Promega, Madison, Wisconsin). The product was ligated with the vector obtained by BamHI-NdeI digestion of the pBE3 shuttle vector.

2. Mutant libraries were prepared by transforming E. coli HB101 competent cells with this ligation mixture. Approximately 4,000 transformants were collected from this library and recombinant plasmid mixtures were isolated from this collection.

3. The plasmid mixture thus isolated was transformed with B. subtilis DB428 competent cells to make a library of another subtilisin E variant.

4. Based on the DNA polymerase used to randomly prime the short initial DNA fragments, the five libraries thus constructed were converted to Library / Klinau, Library / T4, Library / Sequenase, Library / Stopel and Library / Pfu . Named it. About 400 transformants were randomly taken from each library and selected by testing for thermal stability (see step (7)).

(6) Random clone sequence analysis

Ten random clones from the B. subtilis DB428 library / Klinau were used for DNA sequencing. Recombinant plasmids were purified from B. subtilis DB428 using QIAprep Spin Plasmid Miniprep Kit (QIAGEN), modified by adding 2 mg / ml of lysozyme to P1 buffer and incubating the cells for 5 minutes at 37 ° C., respectively. Competent E. coli HB101 was retransformed into this plasmid, which was then purified using QIAprep spin plasmid miniprep kit to obtain sequencing grade DNA. Sequencing was performed with an ABI 373 DNA sequencing system using the Dye Terminator Cycle Sequencing Kit (Perkin Elmer Corporation, Norwalk, Conn.).

(7) Screening for Thermal Stability

The selection was performed with about 400 transformants obtained from each of the five libraries described in step (4), the selection being succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (SEQ ID NO: 25) as substrate. Was carried out based on the above-described assays (33, 35). B. subtilis DB428 containing this plasmid library was grown on LB / kanamycin (20 μg / ml) plates. After 18 hours at 37 ° C., single colonies were seeded into 96 well plates containing 100 μl SG / kanamycin medium / well. The plates were incubated at 37 ° C. for 24 hours while shaking to propagate the cells to saturation. The cells were spun down and the supernatants taken and treated by thermostable assay. Three replicate 96-well assay plates were replicated for each propagation plate and 10 μl of supernatant was added to each well. Subsequently, add 100 µl of the activity assay solution (succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (SEQ ID NO: 25), 100 μl of Tris-HCl, 100 mM CaCl ₂ , pH 8.0, 37 ° C.) Tilisin activity was measured. The reaction rate was measured for 1.0 min at 405 nm in a ThermoMax microplate reader (Morcula Devices, Sunnivale, Calif.). The activity measured at room temperature was used to calculate the proportion of active clones (clones with less than 10% activity than the wild type activity were recorded as inactive). 0.2 mM of assay solution (succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (SEQ ID NO: 25), 100 mM of Tris-HCl (pH 8.0), preheated (37 ° C) to each well of one assay plate 100 μl of CaCl ₂ ) was immediately added and incubated at 65 ° C. for 10 minutes to measure initial activity (Ai). Residual activity (Ar) was measured after incubation for 40 minutes.

(8) sequence analysis

After screening, one clone showing the highest thermostability among the 400 transformants obtained from the library / Klinau was re-streamed onto LB / kanamycin agar plates, and then single colonies from this plate were prepared for glycerol storage and plasmid preparation. Inoculated in test tube culture. Recombinant plasmid was purified using QIAprep spin plasmid miniprep kit (QIAGEN), modified by adding 2 mg / ml of lysozyme to P1 buffer and incubating the cells for 5 minutes at 37 ° C., and the competent E. coli HB101 was retransformed and then purified again using the QIAprep spin plasmid miniprep kit to obtain sequencing grade DNA. Sequencing was performed with an ABI 373 DNA sequencing system using the Dye Terminator Cycle Sequencing Kit (Perkin Elmer Corporation, Norwalk, Conn.).

result

1. Frequency and efficiency of recombination associated with random sequence recombination

The random priming method was performed as described above. This method is illustrated in FIG. Ten clones obtained from the mutant library / Klinau were randomly selected and sequenced. As outlined in FIG. 12 and Tables 5A and 5B, all clones differed from the parent gene. The frequency of occurrence of specific point mutations different from the parent gene R1 or R2 among the recombinant genes ranged from 40% to 70%, fluctuating around the expected 50%. This result suggests that the two parent genes were almost randomly recombined using a random primer technique. 12 shows that all 10 mutations can be recombined or split, even only 12 bp apart.

Then, 400 random clones from each of the five libraries constructed in step (5) were analyzed to determine the subtilisin heat inactivation rate at 65 ° C. Thermal stability obtained on one 96 well plate is shown in descending order in FIG. 13. About 21% of the clones showed thermostability comparable to mutants with N181D and N218S double mutations. This suggests that the N181D mutation from RC2 and the N218S mutation from RC1 were randomly recombined. Sequencing the clones showing the highest thermostability among the 400 transformants selected from the library / Klinau revealed the presence of the N181D and N218S mutations.

2. Frequency of newly introduced mutations during random priming method

About 400 transformants from each of the 5 B. subtilis DB428 libraries (see step (5)) were taken and grown in SG medium supplemented with 20 μg / ml of kanamycin contained in 96 well plates and subtilisin E Screened for activity. About 77-84% of the clones expressed active enzymes, while 16-23% of the transformants were inactive, presumably as a result of the newly introduced mutations. As can be seen from experience, this inactivation rate is the mutation rate representing one to two mutations per gene (35).

As shown in FIG. 12, 18 new point mutations were introduced through this method. This error rate of 0.18% corresponds to one to two new point mutations per gene, as measured on the inactivation curve. That is, it can be seen that the mutations are distributed almost randomly along the gene.

DNA and amino acid residue substitutions in 10 random clones obtained from the library / Klinau Clone # location Base substitution Substitution form Amino acid substitutions Substitution form C # 1 839 A → C Base conversion Gly → Gly Motion substitution C # 2 722 A → G Base potential Ser → Ser Motion substitution C # 2 902 T → C Base potential Val → Val Motion substitution C # 2 1117 C → G Base conversion Ser → Ser Motion substitution C # 4 809 T → C Base potential Asn → Asn Motion substitution C # 4 1098 G → C Base conversion Gly → Ala Non-synonymous substitution C # 4 1102 T → C Base potential Ala → Ala Motion substitution C # 6 653 C → A Base conversion His → Ile Non-synonymous substitution C # 6 654 A → T Base conversion His → Ile Non-synonymous substitution C # 6 657 T → C Base potential Val → Ala Non-synonymous substitution C # 6 658 A → C Base conversion Val → Ala Non-synonymous substitution C # 6 1144 A → G Base potential Ala → Ala Motion substitution C # 6 1147 A → G Base potential Ala → Ala Motion substitution

Clone # location Base substitution Substitution form Amino acid substitutions Substitution form C # 7 478 T → C Base potential Ile → Ile Motion substitution C # 9 731 A → G Base potential Ala → Ala Motion substitution C # 9 994 A → G Base potential Val → Val Motion substitution C # 10 1111 A → G Base potential Gly → Gly Motion substitution C # 10 1112 A → T Base conversion Thr → Ser Non-synonymous substitution

Mutation types are listed in Table 5. The direction of mutation was clearly regular. For example, A often changes to G rather than T or C. In addition, translocations, in particular T-C and A-G, are more common than base conversion. Some nucleotides are more mutable than others. Of the 10 sequenced clones, one G → C, one C → G and one C → A base conversion was found. Such mutations are difficult to observe when subtilisin is subjected to a large error in PCR mutagenesis (37). Random priming can yield a wider range of amino acid substitutions than PCR based point mutagenesis.

In particular, the short stretch 5 'C GGT ACG CAT GTA GCC GGT ACG 3' (SEQ ID NO: 16) at positions 646-667 in the parent genes R1 and R2 was 5 'C GGT ACG ATT GCC GCC GGT in random clone C # 6. Was mutated to ACG 3 ′ (SEQ ID NO: 17). Since this stretch contains two short repeats at both ends, newly introduced mutations can be obtained by using a misaligned, stranded-stranded zygote instead of point mutation alone. This kind of misalignment is useful for domain base conversion because there is no skeletal shift.

3. Comparison of Several DNA Polymerase Fidelity in Randomized Priming Methods

During the random priming recombination method, homologous DNA sequences are almost randomly recombined and new point mutations also occur. While such point mutations may be useful by providing diversity in some in vitro evolutionary processes, this is a problem by recombining beneficial mutations that have already been identified, especially when the mutation rate is high. Therefore, it is particularly important to adjust the error rate that occurs during this method in order to adequately use random priming to solve in vitro evolution problems. By selecting multiple DNA polymerases and changing the reaction conditions, random priming molecular hybridization techniques can be tailored to produce mutant libraries with different error rates.

Clinau fragment of E. coli DNA polymerase I, bacteriophage T4 DNA polymerase, T7 sequinase version 2.0 DNA polymerase, stoppel fragment of Taq polymerase and Pfu polymerase were used for the initial DNA fragment synthesis test. The activity profiles of the five populations obtained (see step (5)) are shown in FIG. 13. To obtain this profile, the activity of each clone measured in 96 well plate screening assay was plotted in descending order. Libraries / Stopfel and Libraries / Klinau contain higher proportions of wild type or inactive subtilisin E clones than Libraries / Pfu . The proportion of wild type and inactive clones in all five populations ranged from 17 to 30%.

Example 8

Use of constant contiguous primers and staggered kidneys to recombine single-stranded DNA

This example relates to the use of certain primer recombination methods with staggered kidneys for the recombination of single-stranded DNA.

How To

Single-stranded DNA can be prepared using various methods, and the easiest method can be prepared from plasmids using helper phage. Many vectors currently in use are derived from filamentous phage such as the M13mp derivative. These vectors are transformed into cells and then formed into a new double-ring ring and a single-chain ring derived from either of the two strands of the vector. Single-chain rings can be packaged into phage particles, secreted from cells and then easily purified from the culture supernatant.

Two constant primers (eg, primers hybridizing to the 5 'and 3' ends of the template) were used to recombine single stranded genes. Only one of the primers is needed before the final PCR amplification step. Elongated recombinant primers were first obtained by the staggered elongation method (StEP), which involves a repeat cycle consisting of denaturation and maximally abbreviated annealing / extension steps. The elongated fragments were then reassembled into full-length genes through a homologous gene reassembly step followed by a high temperature cycle treatment in the presence of DNA polymerase followed by amplification of the gene.

Progress of the staggered extension method is monitored by separating aliquots of DNA fragments via agarose gel electrophoresis by taking aliquots (10 μl) from reaction tubes (volume 100 μl of starting reaction solution) at various time points during primer extension. Evidence of effective primer extension is confirmed by a low molecular weight 'smear' appearing earlier in the method in which the molecular weight increases with increasing number of reaction cycles. Initial reaction conditions include a template denaturation step (eg, 30 seconds denaturation at 94 ° C.) followed by a very simple annealing / extension step (e.g. 1 to 15 seconds at 55 ° C.), repeated 5 to 20 times prior to sampling the reactants. Set to. In general, 20-200 cycles of staggered kidneys are required to obtain single-stranded DNA “smear” that is larger than the length of a complete gene.

The experimental design is as described in Example 1. Two thermostable subtilisin E mutants R1 and R2 genes were subcloned into vector M13mp18 with restriction digestion with EcoRI and BamHI. Single-stranded DNA is prepared as described above (39).

Recombination based on two contiguous primers

Two constant primers corresponding to 5 'and 3' contiguous primers, P5N (5'-CCGAG CGTTG CATAT G TGGA AG-3 '(SEQ ID NO: 18), underlined sequences are NdeI restriction sites) and P3B (5' -CGACT CTAGA GGATC C GATT C-3 '(SEQ ID NO: 19) (underlined sequence is BamHI restriction site) was used for recombination.

Reaction conditions (final volume 100 μl): 0.15 pmol of single stranded DNA containing R1 and R2 genes (1: 1 mixture) used as template, 15 pmol of each adjacent primer (P5N or P3B), 1 × Taq buffer, 0.2 dNTP each mM, MgCl ₂ 1.5 mM and Taq polymerase 0.25 U.

Program: 80 to 200 cycles consisting of 5 minutes at 95 ° C., 30 seconds at 94 ° C., 5 seconds at 55 ° C.

Single-stranded DNA products of the correct size (about 1 kb) were cut from 0.8% agarose gel electrophoresis and purified using a QIAEX II gel extraction kit. The product thus purified was amplified by conventional PCR.

Reaction conditions (final volume 100 μl): template 1 to 10 ng, each adjacent primer 30 pmol, 1 × Taq buffer, 0.2 mM each dNTP, 1.5 mM MgCl ₂ and 0.25 U of Taq polymerase.

Program: 20 cycles consisting of 5 minutes at 95 ° C., 30 seconds at 94 ° C., 30 seconds at 55 ° C., and 1 minute at 72 ° C. The PCR product was purified, digested with NdeI and BamHI, and then subcloned into the pBE3 shuttle vector. This gene library was amplified in E. coli HB101 and transferred to B. subtilis DB428 competent cells for expression and selection as described (35). The thermal stability of the enzyme variants was measured in the manner described above (33) 96-well plate.

As a result of this protocol, new sequences containing new combinations of mutations in the parent sequence as well as new point mutations were obtained. As a result of selection as described in Example 1, enzyme variants with greater thermal stability than the parent enzyme were identified.

As evident from the above examples, primer-based recombination methods search for a wide range of potentially useful catalysts with optimal performance in a variety of applications, as well as the development or evolution of new enzymes for basic structure-function studies. Can be used to

Although a single strand of DNA and a DNA dependent DNA polymerase are used as templates in this specification, alternative methods of using single stranded RNA as templates are also feasible. When using specific protein mRNA as a template and RNA dependent DNA polymerase (reverse transcriptase) as a catalyst, the methods described herein can be modified to cross mutations in cDNA clones and to aim for optimizing protein function. To achieve this, molecular diversity can be made directly from the mRNA level. This method can greatly simplify the ETS (expression tagged strategy) for discovering new catalysts.

In addition to the foregoing, the present invention is also useful for probing proteins from organized intracellular pathogens or other systems that are unable to propagate cells of interest (38).

As mentioned above, although exemplary embodiments of the present invention have been described, those skilled in the art will understand that various other modifications, modifications, etc. are possible within the scope of the present invention for the purpose of illustration only. Accordingly, the invention is not limited by the specific embodiments described herein, but only by the claims set forth below.

references

Sequence list

(1) General Information:

(i) Applicants: Arnold Francis H, Xiao Straight, Apuholter Joseph A, Jiao Huimin, Giber Lori

(ii) Name of the Invention: Recombination of Polynucleotide Sequences Using Constant or Random Primer Sequences

(iii) Number of sequences: 25

(iv) correspondence address

(A) To: Oppenheimer Poms Smid

(B) Street: Sweet 3800 Century Park East 2029

(C) City: Los Angeles

(D) State: California

(E) Country: United States

(F) ZIP code: 90067

(v) computer readable form:

(A) Medium type: floppy disk

(B) Computer: IBM PC compatible model

(C) operating system: Windows

(D) Software: Microsoft Word 6.0

(vi) current application data

(A) Application number:

(B) filing date:

(C) classification:

(vii) conventional application data

(A) Application number: 60 / 041,666

(B) Application date: March 25, 1997.

(C) application number: 60 / 045,211

(D) Application date: April 30, 1997

(E) Application No: 60 / 046,256

(F) Filed Date: May 12, 1997

(viii) agent information

(A) Statement: Olden Camp David J.

(B) registration number: 29,421

(C) Reference Number: 330187-84

(ix) communication information

(A) Telephone: (310) 788-5000

(B) Fax: (310) 277-1297

(2) Information about SEQ ID NO: 1

(i) Sequence Properties:

(A) Length: 22 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO 1:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 2:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 3:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO 4:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 5:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO 6:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO 7:

(2) Information about SEQ ID NO: 8

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 8:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 9:

(2) Information about SEQ ID NO: 10:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 10:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 20 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 11:

(2) Information about SEQ ID NO: 12:

(i) Sequence Properties:

(A) Length: 20 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 12:

(2) Information about SEQ ID NO:

(i) Sequence Properties:

(A) Length: 28 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 13:

(2) Information about SEQ ID NO: 14:

(i) Sequence Properties:

(A) Length: 22 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 14:

(2) Information about SEQ ID NO: 15:

(i) Sequence Properties:

(A) Length: 22 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 15:

(2) Information about SEQ ID NO: 16:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO 16:

(2) Information about SEQ ID NO: 17:

(i) Sequence Properties:

(A) Length: 22 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 17:

(2) Information about SEQ ID NO: 18:

(i) Sequence Properties:

(A) Length: 22 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 18:

(2) Information about SEQ ID NO: 19:

(i) Sequence Properties:

(A) Length: 22 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 19:

(2) Information about SEQ ID NO: 20:

(i) Sequence Properties:

(A) Length: 21 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 20:

(2) Information about SEQ ID NO: 21:

(i) Sequence Properties:

(A) Length: 18 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 21:

(2) Information about SEQ ID NO: 22:

(i) Sequence Properties:

(A) Length: 18 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 22:

(2) Information about SEQ ID NO: 23:

(i) Sequence Properties:

(A) Length: 18 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 23:

(2) Information about SEQ ID NO: 24:

(i) Sequence Properties:

(A) Length: 18 nucleotides

(B) Sequence type: nucleotide

(D) Form: straight chain

(ii) Type of sequence: oligonucleotide

(xi) SEQ ID NO: 24:

(2) Information about SEQ ID NO: 25:

(i) Sequence Properties:

(A) Length: 4 amino acids

(B) Sequence type: peptide

(D) Form: straight chain

(ii) Type of sequence: peptide

(xi) SEQ ID NO: 25:

Claims (34)

a) enzymatically catalyzed DNA polymerization synthesis reactions from random sequences or primers of certain sequences in the presence of one or more template polynucleotides to produce short polynucleotide fragments and DNA collections containing the template polynucleotides; b) denaturing said DNA collection into a collection of single stranded fragments; c) annealing said single stranded fragments under anneal conditions to form a collection of annealed fragments; d) incubating the collection of annealed fragments with a polymerase under conditions that stretch the double stranded fragments to form a fragmented collection containing the stretched single stranded fragments; e) repeating steps b) to d) until a double-stranded nucleotide polynucleotide is formed in the collection of fragments, wherein the other nucleotide is in the same position as the template polynucleotide from one or more template polynucleotides; Method for producing a double-stranded mutant polynucleotide containing one or more. The method of claim 1, wherein the single-stranded fragment has a complementary region, and incubating the collection of the annealed fragments primes each short nucleotide strand or extended short polynucleotide strand of each of the annealed fragments. To produce a double-stranded mutant polynucleotide, characterized in that it is carried out under conditions capable of producing a collection of fragments. 2. The double stranded mutation of claim 1, wherein incubating the collection of annealed fragments is carried out in the presence of a template polynucleotide to randomly reprime the single stranded polynucleotide and the template polynucleotide. Methods of Making Polynucleotides. The method of claim 1, wherein at least one of the primers is a primer of a predetermined sequence. The method of claim 2, wherein at least one of the primers is a primer of a predetermined sequence. The method of claim 3, wherein at least one of the primers is a primer of a predetermined sequence. 5. The method of claim 4, wherein said primer contains 6 to 100 nucleotides. 6. The method of claim 5, wherein said primer contains 6 to 100 nucleotides. 7. The method of claim 6, wherein said primers contain 6 to 100 nucleotides. 5. The method of claim 4, wherein at least one constant primer is a terminal primer. 6. The method of claim 5, wherein at least one constant primer is a terminal primer. 7. The method of claim 6, wherein at least one constant primer is a terminal primer. The method of claim 1, wherein the primer is a primer of a predetermined sequence exhibiting randomness defined at at least one nucleotide position in the primer. The method of claim 13, wherein the primer contains 6 to 100 nucleotides. The method of claim 13, wherein the constant primers are two or more constant primers specific for any region of the template. The method of claim 1, wherein the primer is a primer of a predetermined sequence exhibiting randomness defined at a nucleotide position of at least 30% of the primer. 17. The method of claim 16, wherein said primer contains 6 to 100 nucleotides. The method of claim 16, wherein the primers of a sequence are at least two constant primers specific for any region of the template. The method of claim 1, wherein the primer is a primer of a predetermined sequence exhibiting randomness defined at a nucleotide position of at least 60% of the primer. 20. The method of claim 19, wherein said primers contain 6 to 100 nucleotides. 20. The method of claim 19, wherein the primers of a sequence are at least two constant primers specific for any region of the template. The method of claim 1, wherein said primers are primers of random sequence. 23. The method of claim 22, wherein the primer is 6 to 24 nucleotides in length. 23. The method of claim 22, wherein the template polynucleotide is removed from the DNA collection after generation of the short polynucleotide fragment. The method of claim 1, further comprising separating the mutated double-stranded polynucleotides from the DNA collection and amplifying the mutated double-stranded polynucleotides. The method of claim 25, wherein said mutated double-stranded polynucleotide is amplified by a polymerase chain reaction. a) inserting an enzyme encoding double stranded mutant polynucleotide prepared according to the method of claim 1 into a vector to create an expression vector; b) transforming a host cell with said expression vector; c) expressing an enzyme encoded by said mutant polynucleotide. (a) conducting an enzyme catalyzed DNA polymerization synthesis reaction from random sequences or constant sequence primers in the presence of one or more template polynucleotides to produce a short polynucleotide fragment and a DNA collection containing said template polynucleotide; (b) denaturing the DNA collection with a collection of single stranded fragment polynucleotides and single stranded template polynucleotides; (c) annealing the single-stranded polynucleotides contained in the collection under annealing conditions to obtain a collection of annealed double-stranded polynucleotides; (d) incubating the annealed polynucleotide collection with DNA polymerase under conditions extending the double-stranded polynucleotide to obtain a DNA collection containing the extended double-stranded polynucleotide; (e) repeating steps (b) to (d) until the DNA collection containing the elongated double-stranded polynucleotide contains the mutated polynucleotide, from one or more template polynucleotides A method for producing a double-stranded mutant polynucleotide containing one or more different nucleotides at corresponding positions of the template polynucleotide. 29. The method of claim 28, wherein the collection of single-stranded fragment polynucleotides and single-stranded template polynucleotides contains a single-stranded fragment polynucleotide having a region complementary to that of other single-stranded fragment polynucleotides present in the collection. Wherein said fragment polynucleotides anneal to each other in step (c) and prime each other in step (d). The method of claim 28, wherein the single-stranded template polynucleotide can be annealed to at least a portion of the single-stranded fragment polynucleotide in step (c) to randomly reprime the single-stranded fragment polynucleotide in step (d). From two or more template polynucleotides containing different first template polynucleotides and second template polynucleotides, one or more different nucleotides at corresponding positions in the first template polynucleotide and corresponding ones in the second template polynucleotide A method of making a double stranded mutant polynucleotide containing at least one nucleotide different in position, (a) enzyme catalyzed DNA polymerization of the template polynucleotides from a group of random sequence primers or one or more constant sequence primers under standard DNA polymerization conditions or only partially stretched conditions to yield polynucleotide fragments and Obtaining a DNA collection containing the template polynucleotide; (b) denaturing the DNA collection to obtain a collection of single-stranded fragment polynucleotides and single-stranded template polynucleotides; (c) annealing the single-stranded polynucleotide of the collection under annealing conditions to obtain a two-stranded annealed polynucleotide collection; (d) incubating the collection of annealed polynucleotides with DNA polymerase under conditions to fully or partially stretch the double-stranded polynucleotides to obtain a DNA collection containing the extended double-stranded polynucleotides; (e) repeating steps (b) to (d) until the DNA collection containing the elongated double-stranded polynucleotide contains the mutated polynucleotide, At least one of these primers is non-terminal if (1) standard DNA polymerization conditions are used in step (b) or (2) one or more constant sequence primers are used if full extension is formed in step (d) A method of producing a double stranded mutant polynucleotide, characterized in that it must be a primer. 32. The method of claim 31, wherein the first template polynucleotide is at least two base pairs different from the second template polynucleotide. 33. The method of claim 32, wherein the two base pairs are separated from each other. 34. The method of claim 33, wherein said two base pairs are separated from each other by at least about 15 base pairs.