KR20000000623A - Process for producing chitosanase using recombinant e. coli - Google Patents

Abstract

PURPOSE: A process for producing chitosanase having an excellent anticancer activity is provided by hydrolyzing insoluble chitosan to useful chitosan, such as chitosan-oligosaccharide or soluble low molecular weight sugar, using recombinant E.coli. CONSTITUTION: Chitosanase is massively produced by the following steps of: purifying chitosanase from Matsuebacter chitosanotabidus 3001; determining the internal and N-terminal amino acid sequences of the purified chitosanase; isolating a chitosanase encoding gene; cloning the gene into pFLAG-ATS plasmid; tranforming E.coli DH10B with the recombinant plasmid; isolating chitosanase from the transformed E.coli by using chromatography, affinity chromatography or centrifugation.

Description

Method for producing chitosanase using recombinant E. coli.

The present invention relates to chitosanase, a chitosan degrading enzyme having excellent anticancer effects, and more particularly, to E. Coli DH10B, which is a host, as a vector carrying a gene encoding chitosanase, a chitosan degrading enzyme. It relates to a chitosanase production method characterized in that the transformed and the resulting transformant is cultured under appropriate conditions.

Chitosan is collectively referred to as deacetylated chitin obtained by alkali treatment of chitin, a biopolymer in which N-acetyl β-D-glucosamine is β (1,4) -bound biopolymer. Chitosan, a macromolecule of β-1,4-linked amino glucose, is widely distributed in nature, and is especially extracted from fungus yeast and shells of shellfish such as shrimp and crabs. Recently, chitosan has anti-cancer effects, lowers cholesterol in blood, artificial skin. It is a high value-added natural polymer, and its use is expanding to various fields such as medicine, biochemistry, pharmacy, enzymatics, and agriculture. However, since chitosan obtained in nature is not useful because it is a non-soluble polymer, it is urgent to produce chitosan oligosaccharides or water-soluble chitosan low molecular sugars having high physiological activity.

Chitosanase, an enzyme that hydrolyzes chitosan, hydrolyzes β-1,4 bonds of chitosan to produce oligosaccharides to low molecular sugars and is generally known as an ex vivo secretory enzyme secreted from living organisms. It is detected by, mold, radiation equality.

However, when using chitosanase secreted from general microorganisms, the use of barchitosan, which is enormous in time and economic burden during the enrichment and purification of enzymes, is limited.

Therefore, in order to solve this problem, the present invention intends to produce a large amount of chitosanase by genetic recombination and transformation method using a gene of Matsuebacter chitosanotabidus 3001, which is known to secrete chitosanase using genetic engineering technology. Is the purpose.

It is another object of the present invention to provide chitosan oligosaccharides and water-soluble chitosan low molecular sugars, which are excellent in plant bioprotective ability by decomposing chitosan using mass-produced chitosanases, and which will be particularly noticed as leaders in agrochemical plant cultivation. .

Figure 1- Restriction map of the pChoU ₁ plasmid with choA gene

Figure 2-Sequence of choA gene of M. chitosanotabidus 3001.

Figure 3-Restriction diagram of the pFLAG-ATS plasmid, the vector of the present invention.

The present invention isolates a gene encoding chitosanase from Matsuebacter chitosanotabidus 3001, an aerobic gram-negative soil microorganism found to secrete chitosanase, and recombines it into a plasmid having an appropriate restriction enzyme digestion site to transform it into E. coli, which is harmless to humans. The invention is intended to convert to mass production of chitosanase.

The present invention purifies and concentrates chitosanase produced by separating M. chitosanotabidus 3001 from nature, and then determines the amino acid sequence to isolate the gene encoding chitosanase based on this. Only the chitosanase coding region of the heredity is isolated and introduced into a mass expression product and transformed into E. coli DH10B, which is harmless to humans. At this time, after adjusting the pH to 7.2, E. coli DH10B transformed with a medium containing yeast 0.025%, sodium chloride 0.05%, polypeptone 0.025%, and colloidal chitosan was grown in large quantities to collect E. coli. The chitosanase can be crushed and purified in the cells of E. coli, for example, by chromatography, affinity chromatography, centrifugation, or a combination thereof.

The activity of enzymes produced in this way is the same or higher than the enzymes produced by expression only and the optimum conditions are pH 4.0-9.0 and 30-40 ° C.

By the following examples will be described the present invention in more detail.

(Example 1)

Isolation and Purification of Chitosanase

Chitosanase was isolated using M. chitosanotabidus 3001, which is known to secrete chitosanase. Known ammonium sulfate fractionation and isoelectric chromatography are used to separate and purify from the microorganism's medium. At this time, the medium of M. chitosanotabidus 3001 is composed of 1% colloidal chitosan, 0.025% yeast extract, 0.025% peptone, 0.025% K ₂ HPO ₄ , 0.07% KH ₂ PO ₄ and 0.03% MgSO ₄ . The colloidal chitosan added at this time acts as a substrate for measuring the activity of the chitosanase and its activity is measured using a known Schale Method.

(Example 2)

Purification of Chitosanase Internal and N-terminal Amino Acids

The N-terminal amino acid is obtained by AAAGVIPVGDSRVY, digested with trypsin to determine the internal amino acid sequence of the purified chitosanase, separated by SDS-phage (SDS-PAGE), followed by electroblowing by a known method of Nippon Millipore. It is blotted to the PVDF film using a blotting method. Chitosanase activity was measured using Western Blotting method using chitosanase antibody manufactured by Takara Biochemical, and amino acid sequence was determined using Shimadzu protein sequence analyzer DSQ-10.

The array is SDKNKRAALTKIXGALQSAFDTQQDKY.

Example 3

Acquisition of Genes Encoding Chitosanases

To amplify the choA gene fragment of M. chitosanotabidus 3001 from the internal amino acid sequence, PCR (polymerase chain reaction) reaction is performed using two primers, 5'-TCCGACAGAACAAGCGCGCG-3 'and 5'-AGATCTTGGTCAGCGCCG-3'.

At this time, 0.1 nM of each primer, 2.5 dM of each dNTP, 100 ng of template DNA, 0.2 unit of DNA polymerizer, and 10 × reaction buffer were mixed to perform a PCR reaction, which was denatured (94 ° C., 1 minute), primer annealing. A series of reactions of (45 ° C., 2 minutes) and polymerization (72 ° C., 3 minutes) is carried out in 30 iterations.

As a result, a base sequence of 90 base pairs was determined, and 5'-d (GTACATATTGTCGTTAGAACGCGTAATACGACTCA) -3 'and 5'-d (CGTTAGAACGCGTAATACGACTCACTATATAGGGAGA) using a known cassette and CASSETTE method to obtain larger fragments were obtained. PCR was performed using -3 'primers and complementary primers 5'-AGATCTTGGTCAGCGCCG-3' and 5'-TACTTGTCCTGCTGCGTGT-3 'to obtain 300 base pairs of chitosanase gene fragments. The sequence of this fragment is determined by conventional methods and the amino acid sequence is determined from the nucleotide sequence of the plasmid DNA corresponding to the complementary region of amino acids determined from the purified chitosanase.

This 300-base pair is a hybridization probe of the Genomic Library Screening. Southern hybridization is performed to confirm the presence of the chitosanase gene (ChoA) at the restriction site of the Sac I enzyme. Perform a live library.

After the total DNA of M. chitosanotabidus 3001 was isolated, the genomic DNA was digested with restriction enzyme SacI and cloned into λZapII digested with SacI containing the DNA fragment of 2000 to 6000 base pairs.

Libraries are screened by plaque hybridization using 300 base pair PCR products as probes.

After selecting a positive plaque, restriction analysis revealed that the positive plaque had 2500 base pair fragments in another direction, converting the positive plaque on λZapII into plasmid form by in vivo cleavage and plasmid It is called pChoU ₁ . 1 is a restriction map of the pChoU ₁ plasmid with the choA gene _.

E. coli with pChoU1 was tested using a colloidal chitosan as the only carbon source, indicating a clean degradation region, indicating that pChoU1 contains the chitosanase gene.

Deletion assays are performed to determine the portion encoding the chitosanase gene to confirm that it is between the 1,425 base pair portion of pChoU1 and the 396 base pair and the 1821 base pair.

The arrangement of ChoA gene of M. chitosanotabidus 3001 is the same as in the second degree.

The double line is the shine-dalgarno sequence, the single line is the signal peptide, the box is the N-terminal amino acid of the ChoA gene of E. coli, and the curve is the amino acid determined from the purified chitosanase. Indicates.

Example 4

Primers were synthesized to have restriction sites at both ends of the chitosanase coding region (ChoA), in particular, BamHI and XhoI, to form amplified fragments, and then treated with these restriction enzymes, followed by pFLAG-ATS as a carrier for mass expression. Plasmids (Qiagen) are also recombinant after treatment with the same restriction enzymes. Restriction diagram of the pFLAG-ATS plasmid is shown in FIG.

At this time, by using a TAKARA company's recombination kit (Ligation Kit) is carried out by 1 hour treatment at 16 ℃, both restriction enzymes to form a protruding end, recombination is possible without additional treatment.

The recombinant plasmid is transformed into the host cell E. coli DH10B by the following method.

Host cell E. coli DH10B is incubated in a 500 ml flask and cooled on ice. Then, the cells were separated by centrifugation at 400 rpm, and 250 ml of sterilized water treated at 121 ° C. for 20 minutes was added to wash the cells. Finally, 25 ml of 10% glycerol solution was added and the solution was frozen immediately using liquid nitrogen. Recombinant plasmids are used as host cells and transformed by known eletrophoration methods in amounts of 0.01 μg / ml.

By the above method, a gene encoding chitosanase, a chitosan degrading enzyme from M. chitosanotabidus 3001, was recombined into a plasmid, and the recombinant plasmid was transformed into E. coli DH10B, which is harmless to humans and readily available. It is possible to mass-produce chitosanase.

Chitosanase is an enzyme secreted by certain microorganisms in vitro, and it can be obtained from such microorganisms. However, when the chitosanase enzyme is secreted from ordinary microorganisms, the chitosanase is not only small but also concentrated and purified. Since a huge time and economic burden in the process is a problem, it is possible to produce a large amount by genetic engineering as in the present invention, not only mass production is possible, but also the activity of these enzymes compared to the enzymes produced and expressed in general Because of its high, it has a favorable effect in terms of space and economy.

Therefore, the mass production of chitosanase enzymes according to the present invention enables the mass production of chitosan oligosaccharides and water-soluble chitosan low molecular sugars, and their use can be extended to various fields such as pharmaceutical cosmetics and skin protectants.

Claims (4)

E. coli transformed with a recombinant plasmid comprising a chitosanase gene of M. chitosanotabidus 3001. A method for producing chitosanase, comprising culturing the transformant of claim 1 under appropriate conditions. The transformed Escherichia coli, wherein the transformed Escherichia coli of claim 1 is particularly E. coli DH10B. A method for producing a chitosanase, wherein the transformed Escherichia coli of claim 2 is E. coli DH10B.