KR19990086271A - The novel endo New immune cell nuclease and adjuvant using the same - Google Patents

The novel endo New immune cell nuclease and adjuvant using the same Download PDF

Info

Publication number
KR19990086271A
KR19990086271A KR1019980019176A KR19980019176A KR19990086271A KR 19990086271 A KR19990086271 A KR 19990086271A KR 1019980019176 A KR1019980019176 A KR 1019980019176A KR 19980019176 A KR19980019176 A KR 19980019176A KR 19990086271 A KR19990086271 A KR 19990086271A
Authority
KR
South Korea
Prior art keywords
endonuclease
dna
cell
cells
cell line
Prior art date
Application number
KR1019980019176A
Other languages
Korean (ko)
Inventor
전영중
박완제
이나경
정상보
김두식
권형주
Original Assignee
손경식
제일제당 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 손경식, 제일제당 주식회사 filed Critical 손경식
Priority to KR1019980019176A priority Critical patent/KR19990086271A/en
Publication of KR19990086271A publication Critical patent/KR19990086271A/en
Priority claimed from US09/722,776 external-priority patent/US6881561B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases RNAses, DNAses

Abstract

본 발명은 면역세포로부터 분비되고 박테리아 DNA를 외부의 물질로 인식하고 프로세싱하여 면역반응에 관여하는 CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 생성하는 엔도뉴클레아제, 사람의 B-림프아 IM9 세포주 또는 TPA로 처리된 골수형성 U937 세포주를 엔도뉴클레아제를 생성하기에 적절한 배지에서 배양하고 이 배양액으로부터 상기 면역세포에서 합성되어 분비된 엔도뉴클레아제를 정제함을 포함하는 상기 엔도뉴클레아제의 제조방법 및 본 발명 엔도뉴클레아제로 박테리아 DNA를 처리하여 형성된 CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 포함하는 면역보조제에 관한 것이다. The present invention is secreted from the immune cells of DNA Oh bacteria recognized as a foreign matter, and processing by endonuclease to generate the oligonucleotides of about 10 bp having a stranded CpG motif involved in the immune response, who B- lymphoid culturing the bone marrow formation U937 cell line treated with IM9 cell line or TPA in an appropriate medium to produce the endonuclease and the endonuclease, which method comprises purifying the synthesis is secreted by the immune cells endonuclease from the culture medium of claim the stranded oligonucleotides of about 10 bp having a manufacturing method and a CpG motif formed by the process of this invention endonuclease zero bacterial DNA of the present invention relates to an adjuvant comprising nucleotide.

Description

면역세포의 신규한 엔도뉴클레아제 및 이를 사용한 면역보조제(Novel Endonuclease of Immune Cell and Immune Adjuvant Using the Same) The novel endonuclease and adjuvant using the same (Novel Endonuclease of Immune Cell and Immune Adjuvant Using the Same) of immune cells

본 발명은 면역세포로부터 분비되고 박테리아 DNA를 외부의 물질로 인식하고 프로세싱(Processing)하여 면역반응에 관여하는 것으로 알려진 CpG motif를 생성하는 신규한 엔도뉴클레아제(endonuclease) 효소 및 이 효소를 사용하여 목적하는 백신 항원별로 특이하게 얻어지는 올리고뉴클레오타이드 유래 면역 보조제에 관한 것이다. The present invention uses a novel endonuclease (endonuclease) enzyme and the enzyme for generating a CpG motif are known to release from immune cells and recognize bacterial DNA in the foreign material involved in the processing (Processing) on ​​the immune response oligonucleotide obtained by the specific vaccine antigen of interest relates to a nucleotide derived adjuvant.

포유동물은 외부 물질의 침입에 대한 방어수단으로 면역체계를 구축하게 되며 선천(비특이성) 면역과 후천성(항원-특이성) 면역이 존재한다. Mammal is to build the immune system as defense against invasion of foreign matter and congenital (non-specific) and acquired immune-exist (antigen-specific) immune. 선천 또는 비특이성 면역은 한 종이 가지고 있는 질병에 대한 일차적인 저항인데 구조적, 생리적, 세포내적(endocytic)과 식세포적(phagocytic), 그리고 염증반응 방어벽 등 네 가지 형태의 방어벽을 형성한다. Congenital or non-specific immune forms the primary structural resistance inde, physiological, cellular inner (endocytic) and macrophage enemy (phagocytic), and four types of firewall, such as inflammatory diseases with a firewall for paper. 구조적 방어벽의 예로는 피부 와 점액의 막을 들 수 있고, 생리적 방어벽으로는 온도, pH, 산소압, 여러 수용성 인자들이 존재한다. An example of a structural barrier may be a film of the skin and mucus, the physiological barrier is there are temperature, pH, oxygen pressure, various water-soluble factor. 그리고 세포내 및 식세포 방어벽에 의해서는 세포 외부의 거대분자들을 세포내이입(endocytosis)과 식작용(phagocytosis)을 통하여 세포 내부로 끌어 들여 소화하는 체계이며, 염증반응의 방어벽으로는 박테리아의 침입에 의한 조직의 피해 때문에 여러 종류의 혈관작용성이고 주화성인 인자들을 유도하여 일어나는 염증반응이다. And by the firewall and within phagocytic cells are system cell through the inside of the macromolecules of the outer cells transfected (endocytosis) and phagocytosis (phagocytosis) digestion by bringing into the cell, the barrier of the inflammatory response is structure by the penetration of bacteria and several types of the functionality of blood vessels induce the coins adult factor occurs due to inflammation damage. 후천성 면역은 특이성, 다양성, 기억, 그리고 자기/비자기 인식을 가지는 특성에서 선천 면역과 차이가 있다. AIDS is a difference in innate immunity and specificity, diversity, memory, and has a characteristic magnetic / non-self recognition. 이러한 후천성 면역의 특성은 B 임파구, T 임파구, 항체, 그리고 사이토카인 등의 작용에 의해 일어나는 체액성 면역(humoral immunity)과 세포성 면역(cellular immunity)에 의해 일어난다. This is characteristic of the acquired immune B lymphocytes, T lymphocytes, antibodies, and takes place by the humoral immunity caused by the action of such cytokines (humoral immunity) and cellular immunity (cellular immunity).

미생물의 침입에 대한 면역 방어는 침입 초기에 빠르게 미생물의 특이한 형태의 분자들을 인식하는 선천 메카니즘에 의해 일어난다. Immune defense against invasion of microorganisms takes place quickly by congenital mechanisms that recognize the unique aspect of the molecules of the microorganism to break early. 미생물에 존재하는 단백질 그리고 지질은 항원에 특이하게 반응하는 면역체계를 유발하는 물질로 잘 알려져 있고, LPS, 포르밀 메티오닌, 리포아라비노만난(lipoarabinomannan), 그리고 펩티도글라이칸(peptidoglycan) 등은 임파구, 식세포, 그리고 보체 체계를 직접 활성화시키는 물질로 잘 알려져 있다[Marrack, P., and Kapple, JW (1994) Cell 76, 323-332]. Proteins and lipids present in the microorganism is well known as a substance that causes the immune system to specifically respond to the antigen and, LPS, formyl methionine, lipoic arabinose met (lipoarabinomannan), and peptidomimetics, etc. FIG article Mau (peptidoglycan) are lymphocytes , macrophages, and is well known as a substance that directly activate the complement system [Marrack, P., and Kapple, JW (1994) Cell 76, 323-332]. 최근에 많은 연구자들에 의해 포유동물이 박테리아 DNA를 자신의 DNA와 구별하여 외부의 물질로 인식함으로서 체액성 면역과 세포성 면역을 활성화시키고, 또한 선천 면역에도 기여하는 것으로 알려지고 있다. Recently mammals distinguish bacterial DNA and their DNA by recognition of a foreign object by activating the humoral immunity and cellular immunity by a number of researchers in, and also is known to contribute to innate immunity.

자가면역질환인 전신성홍반성 루프스(SLE)에서 안티-DNA 항체가 많이 생성된다는 사실로부터 DNA를 항원 또는 자가항원(autoantigen)의 관점에서 연구하게 되었다. Self was studied in terms of the immune disease is systemic lupus erythematosus (SLE) antigen or self antigen (autoantigen) the DNA from the fact that generated a lot of anti-antibodies in -DNA. SLE의 혈청학적인 최대 관심 사항은 안티-DNA 항체들이며, 이러한 자가면역질환에 의해 일어나는 신장의 피해, 피부의 발진, 관절염 등에 중요한 매개체로 작용한다는 것이다[Tan, EM (1989) A Textbook in Rheumatology, 11th Ed. Serological maximum interest of SLE is deulyimyeo anti -DNA antibodies, this self that it acts as an important mediator of such damage kidneys, skin rashes, arthritis caused by immune disorders [Tan, EM (1989) A Textbook in Rheumatology, 11th Ed. DJ McCarty, ed. DJ McCarty, ed. Lea and Febiger, Philadelphoa, PA, 1049; Lea and Febiger, Philadelphoa, PA, 1049; Isenberg, DA et al (1997) The role of antibodies to DNA in systemic lupus erythematosus - A review and introduction to an international workshop on DNA antibodies held in London, May 1996 Lupus 6, 290-304; Isenberg, DA et al (1997) The role of antibodies to DNA in systemic lupus erythematosus - A review and introduction to an international workshop on DNA antibodies held in London, May 1996 Lupus 6, 290-304; Swaak, AJG et al (1979) Arthritis Rheum. Swaak, AJG et al (1979) Arthritis Rheum. 22, 226-235; 22, 226-235; 및 Isenberg, DA et al (1994) Arthritis Rheum. And Isenberg, DA et al (1994) Arthritis Rheum. 37, 169-180]. 37, 169-180]. 이러한 항체들은 ssDNA와 dsDNA에 존재하는 구조결정 인자에 결합함이 밝혀졌고[Isenberg, DA et al (1994) Arthritis Rheum. These antibodies were found to also bind to structural determinants present in ssDNA and dsDNA [Isenberg, DA et al ( 1994) Arthritis Rheum. 37, 169-180; 37, 169-180; Pisetsky, DS (1992) Rheum. Pisetsky, DS (1992) Rheum. Dis. Dis. Clin. Clin. North Am. North Am. 18, 437-454; 18, 437-454; 및 Shoenfeld, Y., and Isenberg, DA (1989) Immunol. And Shoenfeld, Y., and Isenberg, DA (1989) Immunol. Today 10, 123-126] 이 질병의 원인은 정확하게 알려지지 않았지만, 최근의 연구에서 DNA 항원이 중요한 역할을 한다는 강력한 증거들을 제공하였다[Shlomchik, MJ et al (1987) Proc. Today 10, 123-126] The cause of the disease is not known precisely, and provides strong evidence that DNA plays an important role in antigen recent study [Shlomchik, MJ et al (1987 ) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 84, 9150-9154; USA 84, 9150-9154; Shlomchik, MJ et al (1990) J. Exp. Shlomchik, MJ et al (1990) J. Exp. Med. Med. 171, 265-292; 171, 265-292; 및 Tillman, DM et al. And Tillman, DM et al. (1992) J. Exp. (1992) J. Exp. Med. Med. 176, 761-779]. 176, 761-779]. 연구자들은 박테리아 DNA에 대한 면역반응을 연구하기 위하여 정상인 마우스와 자가면역질환이 있는 마우스를 모델로 이용하였다[Gilkeson, GS et al (1989) Clin. Researchers have a mouse with a normal mouse with autoimmune disease was used as a model to study the immune response to bacterial DNA [Gilkeson, GS et al ( 1989) Clin. Immunol. Immunol. Immunopathol. Immunopathol. 51, 1482-1486; 51, 1482-1486; Gilkeson, GS et al (1993) J. Immunol. Gilkeson, GS et al (1993) J. Immunol. 151, 1353-1364; 151, 1353-1364; 및 Gilkeson, GS et al (1995) J. Clin. And Gilkeson, GS et al (1995) J. Clin. Invest. Invest. 95, 1398-1402]. 95, 1398-1402]. 포유동물의 DNA와는 달리 박테리아 DNA는 폴리클로날 B세포를 활성화시키고 마우스에서 특이성을 가진 항체를 생성시키는 강력한 면역학적인 특성을 가지고 있다[Gilkeson, GS et al (1995) J. Clin. Unlike the DNA of mammalian bacterial DNA has a strong immunological properties that activate polyclonal B cells to produce antibodies with specificity in mice [Gilkeson, GS et al (1995 ) J. Clin. Invest. Invest. 95, 1398-1402; 95, 1398-1402; 및 Gilkeson, GS et al (1991) Clin. And Gilkeson, GS et al (1991) Clin. Immunol. Immunol. Immunopathol. Immunopathol. 59, 288-300]. 59, 288-300]. 이러한 활성도는 박테리아와 포유동물의 DNA에 존재하는 염기서열 motif의 차이 때문이며, 이들이 외부물질 즉, 비자기로 인식될 수 있기 때문이다[Messina, JP et al (1993) Cell. This activity is due to the difference of the nucleotide sequence motif present in the DNA of bacteria and mammals, they can be recognized because the group that is foreign material, non [Messina, JP et al (1993 ) Cell. Immunol. Immunol. 147, 148-157; 147, 148-157; Krieg, AM et al (1995) Nature 374, 546-549; Krieg, AM et al (1995) Nature 374, 546-549; 및 Halpern, MD et al (1996) Cell. And Halpern, MD et al (1996) Cell. Immunol. Immunol. 167, 72-78]. 167, 72-78]. 정상 마우스에 박테리아 DNA를 면역시키면 박테리아의 dsDNA에 대한 항체뿐만 아니라 포유동물과 박테리아의 ssDNA에도 결합할 수 있는 항체가 생성되었다[Gilkeson, GS et al (1991) Clin. When the immune bacterial DNA in normal mice, as well as antibodies to dsDNA of bacteria to mammalian antibody capable of binding to ssDNA in animals and bacteria were generated [Gilkeson, GS et al (1991 ) Clin. Immunol. Immunol. Immunopathol. Immunopathol. 59, 288-300]. 59, 288-300]. 그러나 포유동물 dsDNA에 교차반응(cross-reactive)한 자가항체는 생성되지 않았다. However, a self-cross-reactivity (cross-reactive) to the mammal dsDNA antibodies were not produced. 정상의 마우스에서와는 달리, 조기자가면역(preautoimmune) (NZB X NZW)F 1 (NZB/W) 마우스에 박테리아 dsDNA를 면역시키면 포유동물의 dsDNA에 결합하는 교차반응하는 항체가 생성되었다[Gilkeson, GS et al (1995) J. Clin. Unlike in the normal mice, if early autoimmune bacteria dsDNA in immune (preautoimmune) (NZB X NZW) F 1 (NZB / W) mouse is a cross-reactive antibody binding to dsDNA of a mammal it has been generated [Gilkeson, GS et al (1995) J. Clin. Invest. Invest. 95, 1398-1402]. 95, 1398-1402]. 이와 같은 결과에서 자가면역질환이 유발된 마우스는 박테리아 DNA를 면역시킬 때 포유동물 DNA에 교차반응하는 안티-dsDNA 항체를 생성할 수 있는 능력을 가지며, 이것은 NZB/W 마우스에서 면역조절자의 결함으로 박테리아 DNA에 의해 생성된 자가반응한 안티-dsDNA B 세포가 자기 자신의 DNA에 반응하는 잘못된 관용이 나타났고, 따라서 박테리아의 dsDNA 뿐만 아니라 자기 자신의 dsDNA에 반응하는 병원성의 자가항체가 증가했기 때문이다[Whoch, MK et al (1997) J. Immunol. This is the same result in an autoimmune disease induced mouse has the ability to produce an anti--dsDNA antibodies that cross-react in the mammalian DNA as immune to bacterial DNA, which bacteria's immune regulation defects in NZB / W mice the self is a response generated by the anti-DNA -dsDNA B cells showed the wrong latitude to respond to their own DNA, thus because not only was the pathogenic bacteria of dsDNA autoantibodies that react to their own increasing dsDNA [ Whoch, MK et al (1997) J. Immunol. 158, 4500-4506]. 158, 4500-4506].

단백질 항원에 대하여 B 세포가 자극을 받아 활성화되어 항체가 생성되는 과정은, 항원표현세포(antigen presentation cell: APC)에 의하여 단백질 항원이 프로세싱되어 주요조직적합항원계(major histocompatibility complex: MHC) 분자와 결합하여 항원을 표현해주어 MHC-제한된 T세포가 활성화되고, 활성화된 T 세포가 사이토카인을 분비하여 B 세포를 활성화시키기 때문이라고 잘 알려져 있다[Parker, DC (1993) Annu. Process in which the B cells with respect to the protein antigen is active was stirred by antibody generation, antigen-expressing cells: The protein antigen is processed by the (antigen presentation cell APC) major histocompatibility antigen system (major histocompatibility complex: MHC) molecules and haejueo coupled to express antigen MHC- restricted T cell is activated, that due to the activated T cells that activate B cells to secrete cytokines is well known [Parker, DC (1993) Annu . Rev. Rev. Immunol. Immunol. 11, 331-360; 11, 331-360; 및 Clark, EA, and Ledbetter, JA (1994) Nature 367, 425-428]. And Clark, EA, and Ledbetter, JA (1994) Nature 367, 425-428]. 또한 단백질 항원과는 다른 마이코박테리아(mycobacteria)의 세포벽 구성 성분의 프로세싱된 형태인 마이콜산 지질, 리포아라비노만 리포글리칸(LAMs)은 hCD1b[Beckman, EM et al (1994) Nature 372, 691-694; In addition, the protein antigen and is the processed form mayikol lipid acid, lipoic arabinose only lipoic glycans (LAMs) of the cell wall constituents of the other mycobacteria (mycobacteria) are hCD1b [Beckman, EM et al ( 1994) Nature 372, 691- 694; Bendelac, A. (1995) Science 269, 185-186; Bendelac, A. (1995) Science 269 , 185-186; Sieling, PA et al (1995) Science 269, 227-230; Sieling, PA et al (1995) Science 269, 227-230; 및 Prigozy, TI et al (1997) Immunity 6, 187] 와 hCD1c[Beckman, EM et al (1996) J. Immunol. And Prigozy, TI et al (1997) Immunity 6, 187] and hCD1c [Beckman, EM et al ( 1996) J. Immunol. 157, 2795-2803]가 표현할 수 있다고 알려져 있다. 157, 2795-2803] that is known to be expressed. CD1 류는 MHC분자와 다른 위치에 코딩된 비다형성 세포표면 당단백질로 CD1-T 세포 상호 결합은 명확하게 밝혀지지 않았으나, mCD1d1은 CD8 + 와 CD4 + T 세포에 의해 인식되고[Castano AR et al (1995) Science 269, 223-226; CD1 flow is CD1-T cell cross-coupled to the Vida forming cells glycoprotein surface coding in a different location from the MHC molecules did not clarify, mCD1d1 is recognized by CD8 + and CD4 + T cells [Castano AR et al ( 1995) Science 269, 223-226; 및 Cardell, S. et al (1995) J. Exp. And Cardell, S. et al (1995) J. Exp. Med. Med. 182, 993-1004], hCD1b는 CD4 - CD8 - T 세포에 의해 인식된다고[Bendelac, A. (1995) Science 269, 185-186] 밝혀진 바 있다. 182, 993-1004], hCD1b are CD4 - has been found that the recognition by T cells [Bendelac, A. (1995) Science 269, 185-186] - CD8. 즉, 병원성 미생물에서 발견되는 단백질이 아닌 여러 항원들의 표현에 CD1이 관여할 것이라고 추정하고 있다. In other words, it is estimated the expression of multiple antigens other than protein found on the pathogen would CD1 involved. 안티-DNA-특이성 B 세포 자극에 DNA가 관련되어 있다는 단서는 여러 연구 결과에서 관찰되었다. Clues that the DNA is involved in anti--DNA- specific B cell stimulation was observed in several studies. Krishnan 과 Marion은 DNA를 펩타이드와 결합하여 마우스에 면역했을 때 anti-DNA항체가 생산됨을 보여주었다[Krishnaa, MR, and Marion, TN (1993) J. Immunol. Krishnan and Marion are when the immune mice by combining DNA with peptides have shown that anti-DNA antibody production [Krishnaa, MR, and Marion, TN (1993) J. Immunol. 150, 4948-4957]. 150, 4948-4957]. 따라서 여러 자가면역질환에서 안티-DNA항체가 존재한다는 점에서, 이러한 안티-DNA 항체 생산을 위한 B 세포의 활성화가 MHC-제한된 T 세포 자극에 의존하는지를 확인하는 것은 중요한 의미를 가진다. So, in that many who are anti -DNA antibodies present in autoimmune diseases, but these anti -DNA of B cell activation for the production of antibodies to confirm that rely on MHC- restricted T cell stimulation has an important meaning. Waisman 등은 DNA가 특이하게 T 세포를 활성화하는 것은 MHC class II 분자에 의한 DNA 표현과 관련이 있다고 제안하였다[Waisman, A. et al (1996) Cell. Waisman et al. The DNA is specifically activated T cells proposed to be associated with DNA represented by MHC class II molecules [Waisman, A. et al (1996 ) Cell. Immunol. Immunol. 173, 7-14]. 173, 7-14]. 즉, APC의 표면에 있는 MHC class II 분자들과 DNA가 결합하여 T 세포가 DNA에 특이적으로 증식할 수 있다는 사실을 밝혔으며, 이러한 결과로부터 DNA가 자가면역질환에 중요한 역할을 수행할 것이라고 제안하였다. In other words, it was to combine the MHC class II molecules and DNA on the surface of the APC said the fact that T cells can ever proliferating specifically to DNA, suggested from these results will be DNA that self plays an important role in autoimmune diseases It was. 그러나 DNA 항원의 프로세싱 및 표현 메카니즘에 관한 연구 및 정보는 거의 없는 상태이다. However, the research and information relating to the processing and representation mechanisms of the DNA antigen is substantially free state. 실제로 박테리아 DNA가 단백질 항원처럼 APC에서 프로세싱되고 MHC 분자들에 의해 표현되는지, 아니면 표현에 관여하는 다른 분자가 존재하는지에 대한 정보는 거의 밝혀져 있지 않다. In fact, bacterial DNA has not been shown is not nearly as information as to whether the processing in the APC protein antigen that is expressed by the MHC molecule, or other molecule that contributes to exist.

많은 연구자들은 박테리아의 DNA도 척추동물에 의해 자기의 DNA와 구별되어 면역세포를 활성화시키는데 기여한다고 밝혔다. Many researchers have said that contributes to the DNA of bacteria are distinguished from self DNA by the vertebrate immune cell activation. 척추동물에 의해 비자기로 인식되어지는 박테리아 DNA가 가지는 특성은 메틸화되지 않은 CpG 디뉴클레오타이드가 나타날 빈도가 높다는 것이다. Properties are owned by the bacterial DNA that is recognized by a group non-vertebrate that is high the CpG di-nucleotide frequency that appears not methylated. 박테리아 DNA와 척추동물의 DNA사이에 존재하는 현저한 차이점을 정리하면 다음과 같다. Summarizing the significant differences between bacterial DNA and vertebrate DNA as follows. 첫째로, CpG 디뉴클레오타이드의 발생 빈도가 박테리아 DNA에서는 16개의 디뉴클레오타이드에서 1번으로 높게 나타나는데 척추동물에서는 박테리아와 비교해 약 1/4 정도만 나타난다는 점이다. First, the frequency of CpG di-nucleotide appears higher in 1 in 16 nucleotides in D. bacterial DNA in vertebrate animals is that the bacteria when compared to only about one-fourth. 즉, 척추동물의 DNA에는 CpG 억제가 존재함을 의미하는 것이다[Bird, AP (1995) Trends Genet. That is, DNA of vertebrates is intended to mean that the CpG suppression is present [Bird, AP (1995) Trends Genet. 11, 94-100]. 11, 94-100]. 둘째로, 박테리아 DNA에 존재하는 CpG 디뉴클레오타이드는 메틸화의 빈도가 낮다는 것이다. Second, CpG di-nucleotides present in the bacterial DNA is that the frequency of the low methylation. 척추동물에서는 약 80%가 메틸화되어 있는 반면에 미생물의 사이토신(cytosine)에는 메틸화가 거의 일어나지 않은 상태로 존재한다[Razin, A., and Friedman, J. (1981) Prog. In vertebrates cytosine (cytosine) of microorganisms, while about 80% is methylated, there is not a state of methylation rarely [Razin, A., and Friedman, J. (1981) Prog. Nucleic Acid Res. Nucleic Acid Res. Mol. Mol. Biol. Biol. 25, 33-52]. 25, 33-52]. 세째로, 박테리아의 CpG 디뉴클레오타이드에 두개의 5'-퓨린과 두개의 3'-피리미딘이 양쪽 끝에 나타날 빈도가 척추동물의 DNA에서 보다 높다는 것이다[Razin, A., and Friedman, J. (1981) Prog. Third, the two 5'-purines and two 3'-pyrimidines are frequently appear at each end of the CpG di-nucleotides of bacteria is higher than in vertebrate DNA [Razin, A., and Friedman, J. (1981 ) Prog. Nucleic Acid Res. Nucleic Acid Res. Mol. Mol. Biol. Biol. 25, 33-52]. 25, 33-52]. 이러한 박테리아 DNA의 특이한 구조를 CpG motif라 부르는데 이 구조가 면역작용을 활성화시키는 것으로 밝혀졌다. The unique structure of this bacterial DNA bureuneunde called CpG motif was found to have the structure enable the immune system. 즉, CpG 디뉴클레오타이드 양쪽에 두개의 5'-퓨린과 두개의 3'-피리미딘이 존재할 때가 (미토겐 CpGs) 다른 염기들이 존재할 때(비자극 CpGs) 보다 면역세포 활성화가 훨씬 높게 나타난다. That is, when the two CpG di-5'-purines and two 3'-pyrimidine nucleotides present in each side (mitogen CpGs) When other bases are present (bijageuk CpGs) than immune cell activation is often much higher.

박테리아 DNA의 특징적인 염기서열에 의한 면역세포의 활성화 및 기능을 연구하기 위하여 많은 연구자들이 합성한 올리고데옥시리보뉴클레오타이드(ODN)를 이용하였다. To raise a number of researchers have synthesized to investigate the activation and function of immune cells due to a characteristic base sequence of the bacterial DNA was used for oxy-ribonucleotide (ODN). Yamamoto[Yamamoto, S. et al (1992) J. Immunol. Yamamoto [Yamamoto, S. et al ( 1992) J. Immunol. 148, 4072-4076]와 다른 연구자[Cowdery, JS et al (1996) J. Immunol. 148, 4072-4076] and other researchers [Cowdery, JS et al (1996 ) J. Immunol. 156, 4570-4575; 156, 4570-4575; 및 Ballas, ZK et al (1996) J. Immunol. And Ballas, ZK et al (1996) J. Immunol. 157, 1840-1845]들에 의하면 박테리아 DNA에 의해 NK 세포의 용해활성을 증가시키고 인터페론-γ (IFN-γ)생산을 유도함을 밝혔는데, 이러한 효과는 박테리아 DNA가 가지는 CpG motif의 회귀성(palindromic) 염기서열과 관련이 있는 것으로 보고하였다[Kuramoto, E. et al (1992) Jpn. According to 157, 1840-1845] I increased the lytic activity of NK cells by bacterial DNA and said to interferon -γ (IFN-γ) induces the production, this effect reentry (palindromic) of the CpG motif having the bacterial DNA It was reported to be related to the nucleotide sequence [Kuramoto, E. et al (1992 ) Jpn. J. Cancer Res. J. Cancer Res. 83, 1128-1131; 83, 1128-1131; 및 Kimura, Y. et al (1994) J. Biochem. And Kimura, Y. et al (1994) J. Biochem. 116, 991-994]. 116, 991-994]. 또한 다른 연구자들은 박테리아 DNA가 DNA-결합 단백질들과 결합하고 B 세포 활성화를 유도한다고 밝혔다[Gilkeson, GS et al (1995) J. Clin. In addition, other researchers have stated that bacterial DNA combined with the DNA- binding proteins, and induce B cell activation [Gilkeson, GS et al (1995 ) J. Clin. Invest. Invest. 95, 1398-1402; 95, 1398-1402; Yamamoto, S. et al (1992) J. Immunol. Yamamoto, S. et al (1992) J. Immunol. 148, 4072-4076; 148, 4072-4076; Gilkeson, GS et al (1989) J. Immunol. Gilkeson, GS et al (1989) J. Immunol. 142, 1482-1486; 142, 1482-1486; Messina, JP et al (1991) J. Immunol. Messina, JP et al (1991) J. Immunol. 147, 1759-1764; 147, 1759-1764; Field, AK et al (1967) Proc. Field, AK et al (1967) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 58, 1004-1010; USA 58, 1004-1010; 및 Oehler, JR, and Herverman, RB (1978) Int. And Oehler, JR, and Herverman, RB (1978) Int. J. Cancer 21, 221-220]. J. Cancer 21, 221-220]. 즉, 박테리아의 6개 염기로 구성된 CpG motif에 의하여 B 세포 활성화가 촉진된다는 것이다. This ensures that the B-cell activation is promoted by the CpG motif consisting of the six bases of bacteria. B 세포 활성화와 함께 박테리아의 감염에 의한 면역반응의 특징은 면역조절자인 사이토카인들을 생산한다는 것이다[Van Damme, J. et al (1989) Eur. B cells along with activation of the immune response characterized by the infection of bacteria is that the production of immunomodulatory cytokines design [Van Damme, J. et al ( 1989) Eur. J. Immunol. J. Immunol. 19, 163-168; 19, 163-168; 및 Paul, WE et al (1993) Adv. And Paul, WE et al (1993) Adv. Immunol. Immunol. 53, 1-29]. 53, 1-29]. 또한 CpG motif는 세포성 면역에 관여하는 IL-12와 체액성 면역에 관여하는 IL-6의 분비에도 관여한다고 밝혀졌다[Halpern, MD et al (1996) Cell. In addition, CpG motif has been found to be involved in the secretion of IL-6 involved in IL-12 and humoral immunity are involved in cell-mediated immunity [Halpern, MD et al (1996 ) Cell. Immunol. Immunol. 167, 72-78; 167, 72-78; Yi, A.-K. Yi, A.-K. et al (1996) J. Immunol. et al (1996) J. Immunol. 157, 5394-5402; 157, 5394-5402; 및 Klinman, DM et al (1996) Proc. And Klinman, DM et al (1996) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 93, 2879-2883]. USA 93, 2879-2883]. 이렇게 생산된 사이토카인으로는 T 세포와 B 세포를 활성화시키는데 기여하는 IL-6[ Uyttenhove, C. et al (1988) J. Exp. The thus produced cytokines IL-6 [Uyttenhove contributing to activate the T cells and B cells, C. et al (1988) J. Exp. Med. Med. 167, 1417-1427; 167, 1417-1427; Muraguchi, A. et al (1988) J. Exp. Muraguchi, A. et al (1988) J. Exp. Med. Med. 167, 332-344; 167, 332-344; Le, JM, and Vilcek, J. (1989) Lab, Invest. Le, JM, and Vilcek, J. (1989) Lab, Invest. 61, 588-602; 61, 588-602; 및 Hirano, T. et al (1990) Immunol. And Hirano, T. et al (1990) Immunol. Today 11, 443-449]와 세포내부와 외부의 병원균을 제거시키는 역할을 수행하는 대식세포의 기능을 증진 시켜주는 IFN-γ [Murray, HW (1990) Diagn. Today 11, 443-449] and cells IFN-γ [Murray, HW ( 1990) Diagn that supported the functions of macrophages that acts to remove the internal and external pathogens. Microbial. Microbial. Infect. Infect. Dis. Dis. 13, 411-421], 그리고 IFN-γ의 생산을 조절하고 NK 세포의 활성화에 기여하는 IL-12가 있다[Trinchieri, G. (1994) Blood 84, 4008-4027; 13, 411-421], and regulates the production of IFN-γ and IL-12 contributes to activation of the NK cells [Trinchieri, G. (1994) Blood 84, 4008-4027; Zhan, Y., and Cheers, C. (1995) Infect. Zhan, Y., and Cheers, C. (1995) Infect. Immun. Immun. 63, 1387-1390; 63, 1387-1390; 및 Bohn, E. et al (1994) Infect. And Bohn, E. et al (1994) Infect. Immun. Immun. 62, 3027-3032]. 62, 3027-3032]. IL-12와 IFN-γ는 제1형 사이토카인 생산을 증가시켜[Klinman, DM et al (1996) Proc. IL-12 and IFN-γ increases the Type 1 cytokine production [Klinman, DM et al (1996 ) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 93, 2879-2883; USA 93, 2879-2883; Zhan, Y., and Cheers, C. (1995) Infect. Zhan, Y., and Cheers, C. (1995) Infect. Immun. Immun. 63, 1387-1390; 63, 1387-1390; Bohn, E. et al (1994) Infect. Bohn, E. et al (1994) Infect. Immun. Immun. 62, 3027-3032; 62, 3027-3032; 및 Heinzel, FP et al (1991) Proc. And Heinzel, FP et al (1991) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 88, 7011-7015] 사람의 병원균을 제거시키는데 중요한 역할을 수행한다. USA 88, 7011-7015] plays an important role in removing pathogens of man. IL-6는 제2형 사이토카인으로 T 세포와 B 세포의 성장과 분화를[ Uyttenhove, C. et al (1988) J. Exp. IL-6 is the 2-type cytokines in the growth and differentiation of T cells and B cells [Uyttenhove, C. et al (1988 ) J. Exp. Med. Med. 167, 1417-1427; 167, 1417-1427; Muraguchi, A. et al (1988) J. Exp. Muraguchi, A. et al (1988) J. Exp. Med. Med. 167, 332-344; 167, 332-344; Le, JM, and Vilcek, J. (1989) Lab, Invest. Le, JM, and Vilcek, J. (1989) Lab, Invest. 61, 588-602; 61, 588-602; 및 Hirano, T. et al (1990) Immunol. And Hirano, T. et al (1990) Immunol. Today 11, 443-449] 촉진시켜 항체 생산을 자극한다[ Hirano, T. et al (1986) Nature 324, 73-76]. Today 11, 443-449] and stimulates the production of antibodies by promoting [Hirano, T. et al (1986 ) Nature 324, 73-76]. 실제로 IL-6 유전자를 파괴시킨 기절시킨 쥐는 감염이 쉽게 됨을 관찰하였다[Yi, A.-K. In fact, rats were stunning destroy IL-6 gene was observed that the ease of infection [Yi, A.-K. et al (1996) J. Immunol. et al (1996) J. Immunol. 157, 5394-5402; 157, 5394-5402; 및 Libert, C. et al (1994) Eur. And Libert, C. et al (1994) Eur. J. Immunol. J. Immunol. 24, 2237-2242]. 24, 2237-2242]. 따라서 박테리아 DNA는 세포성 면역과 체액성 면역에 관여하는 사이토카인의 생산을 유도하는 것으로 이해된다. Thus, bacterial DNA is understood to induce the production of cytokines involved in cell-mediated immunity and humoral immunity. 또한 박테리아 DNA에 의해서 B 세포의 증식과 항체생산이 유도됨이 최근 들어 지속적으로 보고되고 있다[Krieg, AM et al (1995) Nature 374, 546-549; There is also a proliferation and antibody production of B cells derived search is ongoing in recent years as reported by bacterial DNA [Krieg, AM et al ( 1995) Nature 374, 546-549; Liang, H. et al (1996) J. Clin. Liang, H. et al (1996) J. Clin. Invest. Invest. 98, 1119-1129; 98, 1119-1129; 및 Yi, A.-K. And Yi, A.-K. et al (1996) J. Immunol. et al (1996) J. Immunol. 156, 558-564]. 156, 558-564]. Krieg 등의 연구[Krieg, AM et al (1995) Nature 374, 546-549]에 의하면 ODN에 존재하는 CpG motif가 B 세포를 활성화시켜 증식이 일어나고 IgM 분비가 유도되는 데에 필수 요건임을 밝혔고, B 세포 활성화때 나타나는 대표적인 현상인 class II MHC분자의 발현이 증가되고 세포주기가 G 0 에서 G 1 으로 시작되었음을 보여주었다. According to studies such as Krieg [Krieg, AM et al (1995 ) Nature 374, 546-549] by the CpG motif present in ODN that activate B cells E. requirements on to which proliferation is going on IgM secretion is induced, B It showed that this cell activation phenomena typical of expression of MHC class II molecules that appears when increased cell cycle starts at the G 0 to G 1. Sato 등의 연구[Sato, Y. et al (1996) Science 273, 352-354]에 의하면 짧은 CpG motif를 가진 면역자극 DNA 서열(ISS)이 존재하는 플라스미드 DNA를 단핵세포내에 형질감염시켰을 때 IFN-α, IFN-β, 그리고 IL-12의 양이 증가함을 볼 수 있었다. Studies, such as Sato [Sato, Y. et al ( 1996) Science 273, 352-354] when the transformant according sikyeoteul infection of immunostimulatory DNA sequence to plasmid DNA (ISS) is present with the short CpG motif within the mononuclear cells to IFN- the amount of α, IFN-β, and IL-12 were able to see that the increase. 이 연구의 결과로부터 ISS를 함유하고 있는 플라스미드를 골수 간(stem)세포들로 형질감염시키면 주위의 대식세포와 T 세포를 활성화시켜 생체내에서 간세포의 재배치가 잘못 일어날 수 있다는 사실을 알 수 있다. When transfected from the results of this study with (stem) between containing the ISS and bone marrow plasmid in cells by activating macrophages and T cells around it it can be seen that the relocation of the liver can occur incorrectly in vivo. 그래서 체세포 또는 간세포의 유전자를 교체하는 치료법에 이용하기 위한 벡터는 ISS가 없도록 고안되어야 할 것이다. So vectors for use in therapies that replace the gene or somatic stem cells will be designed so that the ISS. 반면에 유전자 백신을 위해서는 플라스미드 DNA에 많은 ISS가 반복되어 있도록 만드는 것이 효율을 높일 수 있는 한가지 방법임을 지적할 수 있다. For gene vaccine on the other hand can be pointed out that one way to improve it is efficiency that makes a lot of ISS repeats in the plasmid DNA.

박테리아 DNA가 세포를 활성화시키기 위해서는 세포내로 유입되어야 한다. In order to enable the bacterial DNA to cells to be introduced into the cell. 세포배양 용기에 부착된 ODN은 B 세포를 활성화시키지 못하고[Krieg, AM et al (1995) Nature 374, 546-549], 올리고뉴클레오타이드를 리포펙션(lipofection)시켰을 때는 세포내로의 유입이 증가하고 NK세포의 활성이 크게 증가된다고 밝혀졌다[Yamamoto, T. et al , (1994) Microbiol. The ODN adhered to cell culture vessel does not activate B cells [Krieg, AM et al (1995 ) Nature 374, 546-549], a nucleotide oligonucleotide Lipo peksyeon (lipofection) was increased when the inflow into the cell, and NK cells the activity has been found that a significant increase in [Yamamoto, T. et al, ( 1994) Microbiol. Immunol. Immunol. 38, 831-836]. 38, 831-836]. 그리고 CpG motif를 가졌거나 가지지 않은 올리고뉴클레오타이드 모두가 세포 표면에 결합하는데는 큰 차이가 없음이 밝혀졌다[Krieg, AM et al (1995) Nature 374, 546-549; And for all oligonucleotides that do not have or had the CpG motif is bound to the cell surface it was found to have no significant difference [Krieg, AM et al (1995 ) Nature 374, 546-549; 및 Yamamoto, T. et al , (1994) Microbiol. And Yamamoto, T. et al, (1994 ) Microbiol. Immunol. Immunol. 38, 831-836]. 38, 831-836]. 단핵세포에 유입된 DNA는 endosomal compartment 안에서 분해되는 것이 확인되었고[Bennett, RM et al (1985) J. Clin. The DNA introduced into the monocytes was found to be decomposed in the endosomal compartment [Bennett, RM et al (1985) J. Clin. Invest. Invest. 76, 2182-2190], 대식세포에서 박테리아 DNA와 전사인자 핵인자-kB가 결합하고 TNF-α, IL1β 그리고 플라스미노겐 활성화제 억제제-2 mRNA의 발현이 크게 증가함을 보여주었다[Stacey, KJ et al (1996) J. Immunol. 76, 2182-2190], in macrophages bacterial DNA and transcription factors nuclear factor -kB is engaged and showed that the TNF-α, IL1β and plasminogen activation is significantly increased expression of the inhibitor -2 mRNA [Stacey, KJ et al (1996) J. Immunol. 157, 2116-2122]. 157, 2116-2122]. 세포표면의 수용체를 매개로 한 올리고뉴클레오타이드의 세포내 유입은 세포내이입(endocytosis)에 의해서 일어날 것으로 예상되었으며[Bennett, RM et al (1985) J. Clin. Up to a receptor on the cell surface as a medium inflow of nucleotide cells was expected to occur by cellular transfection (endocytosis) [Bennett, RM et al (1985) J. Clin. Invest. Invest. 76, 2182-2190], 말초혈액, 골수세포, 그리고 류케미아 세포주에서 형광표지된 포스포로티오에이트 올리고데옥시뉴클레오타이드를 이용하여 연구하여 왔으나[Loke, SL et al (1989) Proc. 76, 2182-2190], peripheral blood, bone marrow cells, and ryuke fluorescently labeled phosphorothioate oligonucleotide in the lost cell line thio benzoate to study wateuna by using a nucleotide-oxy [Loke, SL et al (1989 ) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 86, 3474-3478; USA 86, 3474-3478; Yakubov, LA et al (1989) Proc. Yakubov, LA et al (1989) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 86, 6454-6458; USA 86, 6454-6458; 및 Zhao, Q. et al (1996) Blood 88, 1788-1795] 특성 규명과 메카니즘이 밝혀지지는 않았다. And Zhao, Q. et al (1996) Blood 88, 1788-1795] was not disclosed is the characterization and mechanism.

지금까지 박테리아 DNA가 면역체계에서 중요한 역할을 하는 것으로 이해되고 있으며 박테리아 DNA가 안티-DNA 항체 생성의 원인을 제공하여 자가면역질환인 SLE가 발생됨이 알려졌다. So far, the bacterial DNA is understood to play an important role in the immune system and is known that the anti-bacterial DNA -DNA to provide a source of antibodies autoimmune disease SLE balsaengdoem. 또한 박테리아 DNA의 CpG motif가 면역세포내에 유입되어 세포를 활성화시켜 사이토카인들의 분비 및 IgM분비를 촉진하는 것으로 알려졌다. Additionally, the CpG motif of bacterial DNA are introduced into the immune cells by activating a cell known to promote secretion and IgM secretion of cytokines. 그러나 이렇게 중요한 역할을 수행하는 박테리아 DNA가 SLE에서 어떤 메카니즘에 의해 항체를 생성하는데 기여하며, 또한 CpG motif를 가지는 올리고뉴클레오타이드가 세포내에서 어떻게 생성되는지에 대한 연구 결과는 지금까지 보고된 바 없다. However, this SLE in the bacterial DNA that plays an important role, contributing to the creation of the antibody by any mechanism, and also research on whether the oligonucleotide having a CpG motif how generated within cells has not been reported so far.

본 발명에서는 사람의 B-림프아 IM9 세포주와 분화된 골수발생(myelogeneous) U937 세포주에서 특징적으로 생합성, 분비되는 특이한 엔도뉴클레아제의 존재를 발견하여 그 생화학적 특성을 규명하였고, 이 엔도뉴클레아제가 박테리아 DNA의 항원 프로세싱에 요구된다는 일련의 실험적 결과와 아울러 특히, CpG motif를 갖는 올리고뉴클레오타이드의 생성에 필수적인 효소임을 밝혀내었다. In the present invention, the O human IM9 cell line B- lymphoid and myeloid differentiation occurs (myelogeneous) with characteristically biosynthesis, discover the existence of unique endonuclease is secreted from the U937 cell line was identified by its biochemical properties, the endonuclease I revealed that the oligo essential enzyme for the generation of oligonucleotide having a sequence of the experimental results as well as in particular, that the CpG motif requirement for antigen processing of the bacterial DNA.

도 1은 DNA-천연-PAGE에 의해 분석된 IM9 세포의 본 발명 엔도뉴클레아제 활성을 보여준다 (IM9 세포 용해물(A), 배지(B) 및 혈청이 없이 배양된 배지(C)에서의 엔도뉴클레아제 활성이 인-겔 시스템에 의해 검출되었으며 소 DNase I(레인 1)과 배양 배지 엔도뉴클레아제 활성(레인 2)이 비교되어 있다(D)). 1 is in the endo- DNA- shows the present invention endonuclease activity of IM9 cells analyzed by natural -PAGE (IM9 cell lysate (A), medium (B) and a medium (C culture without serum) for the nuclease activity of - was detected by the gel system is compared to the bovine DNase I (lane 1) and the culture medium endonuclease activity (lane 2) (D)).

도 2는 DNA-천연-PAGE에 의해 분석된 DNase I 및 IM9 배양 배지의 본 발명 엔도뉴클레아제 활성을 보여준다. Figure 2 shows the present invention endonuclease activity of the DNase I and IM9 culture media analyzed by natural DNA- -PAGE.

도 3은 안티-소 DNase I 항체에 의한 본 발명 엔도뉴클레아제 활성의 면역침강을 보여준다. Figure 3 is an anti-shows the immunoprecipitation of the invention endonuclease activity by the bovine DNase I antibodies.

도 4는 IM9 세포를 액티노마이신 D로 예비처리하고 본 발명 엔도뉴클레아제의 분비를 보여준다 (세포 용해물(A)과 배양 배지(B)의 엔도뉴클레아제 활성이 예비처리후 표시된 배양 기간동안에 분석되었다). Figure 4 shows the secretion of the present invention, and pre-processes the IM9 cells in liquid actinomycin D endonuclease (cell lysate (A) and culture medium (B) endonuclease activity is shown after the pre-treatment incubation period of during the analyzed).

도 5는 면역 세포주의 본 발명 엔도뉴클레아제 활성을 비교분석한 것이다. 5 is a comparative analysis of the present invention endonuclease activity of immune cells.

도 6은 DNA-천연-PAGE에 의해 분석된 IFN-γ or IL-1β 처리된 IM9 세포 배양 배지 및 세포 용해물의 본 발명 엔도뉴클레아제 활성을 보여준다. Figure 6 shows the DNA- the processed IFN-γ or IL-1β analyzed by natural -PAGE IM9 cell culture media and cell lysates invention endonuclease activity for.

도 7은 본 발명 엔도뉴클레아제의 활성을 위한 최적 pH를 보여준다. Figure 7 shows the optimum pH for activity of the present invention endonuclease.

도 8은 본 발명 엔도뉴클레아제 활성을 위한 2가 양이온의 필요요건을 보여준다 (A는 엔도뉴클레아제를 20 mM Tris-HCl, pH 7.0중의 표시된 농도의 Ca 2+ 및/또는 Mg 2+ 의 존재 또는 부재하에 37에서 10분간 100 ng의 플라스미드 DNA와 반응시킨 결과이며 B는 효소반응을 10 mM Mg 2+ 의 존재하에 180분간 실시한 결과이다). Figure 8 shows the requirements of divalent cations for the present invention endonuclease activity (A is the indicated concentration of the endonuclease 20 mM Tris-HCl, pH 7.0 for Ca 2+ and / or Mg 2+ a result of the presence or absence of the reaction with the plasmid DNA 100 ng 10 minutes at 37 under and B is a result of 180 minutes in the presence of the enzyme reaction 10 mM Mg 2+).

도 9는 TPA, LPS 및 CHX 처리된 U937 세포의 증식 곡선을 나타낸 것이다. Figure 9 shows the growth curve of the U937 cells treated with TPA, LPS and CHX.

도 10은 U937 세포에서 TPA-농도 의존성으로 본 발명 엔도뉴클레아제의 합성 및 분비를 DNA-천연-PAGE에 의해 분석한 결과이다 (표시된 TPA 농도에서 24시간 배양하여 세포 용해물(A) 및 배양배지(B)를 얻었다). Figure 10 is the synthesis and secretion of the present invention endonuclease TPA- with concentration dependent on the U937 cells was analyzed by natural DNA- -PAGE (24 hours incubation at the indicated concentration of TPA cell lysate (A) and incubated for to obtain a medium (B)).

도 11은 인-겔 시스템에 의해 분석된 TPA 처리된 U937 세포 용해물 및 배양배지의 본 발명 엔도뉴클레아제 활성을 보여준다. 11 is a in-the present invention shows the endonuclease activity of the lysate and the culture medium for the gel-treated U937 cells, TPA analysis by the system.

도 12는 LPS 처리된 U937 세포 용해물 및 배양배지의 본 발명 엔도뉴클레아제 활성을 보여준다 (세포 용해물(A) 및 배지(B)의 엔도뉴클레아제 활성이 DNA-천연-PAGE에 의해 1 ng/ml LPA 처리후 표시된 배양 기간에서 분석되었다). Figure 12 shows that LPS-treated U937 cell lysate, and the present invention endonuclease activity of the culture medium for (cellular endonuclease activity of the lysate (A) and a medium (B) for by the natural DNA- -PAGE 1 ng / ml after LPA treatment was analyzed at the indicated incubation period).

도 13는 자극 인자로 처리된 U937 세포의 본 발명 엔도뉴클레아제 활성을 보여준다 (레인 1은 48시간동안 10% FBS를 함유한 RPMI1640 배지에서의 U937 세포 배양물, 레인 2는 48시간동안 TPA(10 ng/ml) 처리, 레인 3은 24시간동안 LPS(1 ng/ml) 처리, 레인4는 12시간동안 CHX(10 ug/ml) 처리한 것이다). While Figure 13 shows the present invention endonuclease activity in U937 cells treated with stimulating factors (lane 1 48 U937 cells in a RPMI1640 medium containing 10% FBS for the time the culture, lane 2 is 48 hours TPA ( 10 ng / ml) treatment, lane 3 LPS (1 ng / ml) treated, for 24 hours lane 4 is one for 12 hours CHX (10 ug / ml) treatment).

도 14은 자가분해 방법에 의해 IM9 세포로부터 분리된 핵에서의 본 발명 엔도뉴클레아제 활성을 보여준다. Figure 14 shows the self invention endonuclease activity in the separated core from the IM9 cells by a separation method.

도 15는 CHX 처리에 의한 IM9 세포의 apoptotic 세포사멸을 보여준다. Figure 15 shows the apoptotic cell death of IM9 cells by CHX treatment.

도 16은 DNA-천연-PAGE에 의해 분석된 IM9 세포 용해물 및 핵의 본 발명 엔도뉴클레아제 활성을 보여준다. Figure 16 shows the present invention endonuclease activity of the lysate and the nucleus for IM9 cells analyzed by natural DNA- -PAGE.

도 17은 본 발명 엔도뉴클레아제의 활성을 위한 2가 양이온의 필요요건을 보여준다. Figure 17 shows the requirement of the divalent cation for activity of the present invention endonuclease.

도 18은 본 발명 엔도뉴클레아제에 의한 플라스미드 DNA의 시간 경과에 따른 분해를 보여준다. Figure 18 shows the degradation over time of the plasmid DNA according to the present invention endonuclease.

도 19는 이. Ido 19. 콜라이 DNA, IM9 세포 DNA 및 연어 정자 DNA에 대한 엔도뉴클레아제의 반응 산물을 보여준다. E. coli DNA, shows the reaction product of IM9 cells endonuclease for DNA and salmon sperm DNA.

도 20은 IM9 세포내로 도입된 외래 DNA의 써던 블롯 분석 결과이다. Figure 20 is a Southern blot analysis of the foreign DNA introduced into the cell IM9.

도 21은 본 발명 엔도뉴클레아제 반응에 의해 수득된 DNA 절편의 클로닝 및 서열분석을 위한 구성도이다. 21 is a configuration diagram for the cloning and sequencing of the DNA fragments obtained by the present invention endonuclease reaction.

도 22는 IM9 세포에서 박테리아 DNA의 프로세싱에 의해 생성된 DNA 절편을 보여준다. Figure 22 shows the DNA fragments produced by the processing of the DNA in the bacterial cell IM9.

도 23은 U937 세포에서 박테리아 DNA의 프로세싱에 의해 생성된 DNA 절편을 보여준다. Figure 23 shows the DNA fragments produced by the processing of the bacterial DNA from U937 cells.

도 24는 본 발명 엔도뉴클레아제의 반응 산물의 검출 결과이다. 24 is a detection result of the reaction product of the present invention endonuclease.

도 25는 박테리아 DNA 또는 올리고뉴클레오타이드내의 CpG motif에 의한 IgM 분비의 유도를 보여준다. Figure 25 shows the induction of IgM secretion by CpG motif in bacterial DNA or oligonucleotides.

도 26은 기질로서 EC1 PCR 산물을 사용한 본 발명 엔도뉴클레아제 반응의 산물을 보여준다. 26 is the present invention using the EC1 PCR product as a substrate shows the product of the reaction endonuclease.

도 27은 기질로서 EC2 PCR 산물을 사용한 본 발명 엔도뉴클레아제 반응의 산물을 보여준다. 27 is the present invention using the PCR product as a substrate EC2 shows the product of the reaction endonuclease.

도 28은 기질로서 HC1 PCR 산물을 사용한 본 발명 엔도뉴클레아제 반응의 산물을 보여준다. 28 is the present invention with HC1 PCR product as a substrate shows the product of the reaction endonuclease.

도 29는 Zn 2+ 및 EDTA에 의한 엔도뉴클레아제 활성의 억제를 보여준다. Figure 29 shows the inhibition of endonuclease activity of the Zn 2+ and EDTA.

도 30은 표시된 IM9 세포 배양 배지 양과 반응된 EC1 PCR 산물로부터 본 발명 엔도뉴클레아제 반응의 산물을 보여준다. Figure 30 shows the product of the present invention endonuclease reaction from the labeled PCR product in which EC1 IM9 cell culture medium volume reaction.

도 31은 표시된 시간동안 EC1 PCR 산물과 반응된 엔도뉴클레아제로부터의 산물을 보여준다. Figure 31 shows the products of the PCR product from EC1, and the reaction endonuclease zero for as long as the time.

도 32는 본 발명 엔도뉴클레아제 활성이 EC2 PCR 산물(157 bp) 및 Alu I에 의해 분해된 짧은 DNA 절편을 비교하여 준다. Figure 32 gives to the invention endonuclease activity compared to a short DNA fragment cleaved by the EC2 PCR product (157 bp), and Alu I.

도 33은 IM9 세포에서 분비된 본 발명 엔도뉴클레아제의 3'-엑소뉴클레아제의 동정을 보여준다. Figure 33 shows the identification of the 3'-exonuclease of the present invention the endonuclease secreted from IM9 cells.

도 34는 본 발명 엔도뉴클레아제 반응 산물, IM9 세포에 의해 프로세싱된 산물 및 DNase I 반응 산물을 비교하여 준다. Figure 34 gives the comparison between the product and the DNase I reaction was processed by the present invention endonuclease reaction product, IM9 cells.

도 35는 S1 뉴클레아제 반응에 의한 엔도뉴클레아제 반응으로부터 유도된 일본쇄 절편의 동정을 보여준다. Figure 35 shows the identification of the stranded fragments derived from endonuclease reaction according to the S1 nuclease reaction.

도 36은 모노 S HR5/5 이온 교환 크로마토그래피에 의한 IM9 세포 배양 배지의 크로마토그래피 분획 결과를 보여준다. Figure 36 shows the results of chromatography fractions IM9 cell culture medium according to the Mono S HR5 / 5 ion exchange chromatography.

도 37은 RESOURCE PHE 소수성 상호작용 크로마토그래피에 의한 엔도뉴클레아제의 정제 결과를 보여준다. Figure 37 shows the purification result of the endonuclease by the RESOURCE PHE hydrophobic interaction chromatography claim.

도 38은 이온 교환 크로마토그래피 및 소수성 상호작용 크로마토그래피에 의한 정제된 본 발명 엔도뉴클레아제의 SDS-PAGE 결과를 보여준다. Figure 38 shows the SDS-PAGE results of the present invention endonuclease purified by ion exchange chromatography and hydrophobic interaction chromatography claim.

도 39는 SDS-PAGE에 의한 정제된 엔도뉴클레아제의 분자량 결정 결과를 보여준다. Figure 39 shows the molecular weight determination of the result of endonuclease purified by SDS-PAGE.

도 40은 본 발명 엔도뉴클레아제 활성을 갖는 모노 S 크로마토그래피 분획의 천연-기공 구배 겔 전기영동(4-15%) 결과(B) 및 아가로즈 겔 전기영동에서 패널 B의 겔 밴드로부터 용출된 단백질의 엔도뉴클레아제 활성(B)을 보여준다. 40 is the present invention endonuclease of Mono S chromatography fractions having an activity of natural-eluted from the gel bands in panel B in the pore gradient gel electrophoresis (4-15%) results (B) and agarose gel electrophoresis It shows the endonuclease activity (B) of the protein.

도 41은 이온 교환 크로마토그래피에 의해 정제된 본 발명 엔도뉴클레아제의 SDS 폴리아크릴아미드 겔 전기영동 및 활성 밴드의 천연-구배 PAGE 겔 용출 결과를 보여준다. Figure 41 is an ion exchange chromatography of the the present invention is purified by our endonuclease SDS polyacrylamide gel electrophoresis and a band of the active natural-PAGE gel shows the gradient elution results.

도 42는 분리된 U937 세포핵내의 정제된 엔도뉴클레아제 활성에 미치는 양이온의 영향을 보여준다. Figure 42 shows the effect of cations on the endonuclease activity in the tablets separated U937 cell nucleus.

한 가지 관점에서, 본 발명은 면역세포로부터 분비되고 박테리아 DNA를 외부의 물질로 인식하고 프로세싱하여 면역반응에 관여하는 CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 생성하는 신규한 엔도뉴클레아제를 제공한다. In one aspect, the invention being secreted from immune cells, bacteria recognize the DNA in the foreign matter, and processing by a novel endo New generating a stranded oligonucleotides of about 10 bp having a CpG motif involved in the immune response nuclease It provides. 본 발명의 엔도뉴클레아제는 SDS-PAGE에 의한 분자량 측정결과 72.4 kD로 확인되었다. Endonuclease of the present invention was found to be 72.4 kD molecular weight measurements by SDS-PAGE.

다른 관점에서, 본 발명은 사람의 B-림프아 IM9 세포주 또는 TPA로 처리된 골수형성 U937 세포주를 상기된 엔도뉴클레아제를 생성하기에 적절한 배지에서 배양하고 이 배양액으로부터 상기 면역세포에서 합성되어 분비된 엔도뉴클레아제를 정제함을 포함하는 상기 엔도뉴클레아제의 제조방법을 제공한다. In another aspect, the invention is cultured in an appropriate medium to produce the said the myelodysplastic U937 cell line treated with B- lymphoblastic IM9 cell line or TPA human endonuclease synthesized by the immune cells from the culture fluid secretion of which comprises a purified endo-nuclease provides a process for the preparation of the said endonuclease.

또 다른 관점에서, 본 발명은 본 발명의 상기 엔도뉴클레아제로 박테리아 DNA를 처리하여 형성된 CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 포함하는 면역보조제를 제공한다. In yet another aspect, the present invention provides oligonucleotides of about 10 bp having a stranded CpG motif formed by processing the endonuclease zero bacterial DNA of the present invention provides an adjuvant comprising a nucleotide.

본 발명은 이하 실시예를 통하여 상세하게 설명될 것이다. The invention will now be described in detail through the following examples.

실시예 1 Example 1

면역세포에서 본 발명 엔도뉴클레아제의 합성 및 분비 Synthesis and secretion of the present invention endonuclease in immune cells

DNase I의 효소활성은 사람의 조직과 체액에 넓게 분포되어 있으며 이에 따라 소화 기능[Nadano D. et al (1993) Clin. The enzymatic activity of DNase I is widely distributed in tissues and body fluids of a person and this digestion according [Nadano D. et al (1993) Clin. Chem. Chem. 39, 448-452; 39, 448-452; 및 Yasuda T. et al (1993) Clin. And Yasuda T. et al (1993) Clin . Chim. Chim. Acta. Acta. 218, 5-16] 이외에 생리적인 생체내 218, within 5-16] In addition to the physiological in vivo 기능이 존재할 것이라고 추정되어왔다. This feature has been estimated that exist. DNase I은 apoptosis 과정중에 뉴클레오좀간(internucleosomal) DNA를 절단하는 것으로 알려진[Peitsch MC et al (1993) EMBO J. 12, 371-377] 한편 이 효소는 사람의 혈청에도 존재하여 그 생화학적 특성이 보고되었다[Love JD, and Hewitt RR (1979) J. Biol. DNase I is its biochemical properties nucleoside jomgan (internucleosomal) is known to cut the DNA [Peitsch MC et al (1993 ) EMBO J. 12, 371-377] while the enzyme in the apoptosis process, in the presence of human serum It was reported [Love JD, and Hewitt RR ( 1979) J. Biol. Chem. Chem. 254, 12588-12594; 254, 12588-12594; 및 Kishi K. et al (1990) Am. And Kishi K. et al (1990) Am . J. Hum. J. Hum. Genet. Genet. 47, 121-126]. 47, 121-126]. 혈청의 DNase I은 췌장에서 분비된다고 밝혀졌으나[Love JD, and Hewitt RR (1979) J. Biol. DNase I in serum jyeoteuna found that secreted by the pancreas [Love JD, and Hewitt RR ( 1979) J. Biol. Chem. Chem. 254, 12588-12594; 254, 12588-12594; 및 Ito K. et al (1984) J. Biochem. And Ito K. et al (1984) J. Biochem. 95, 1399-1406], 다른 조직에서의 연구는 아직도 계속되고있다. 95, 1399-1406], studies in other organizations is still continuing. Messina 등의 연구결과[Messina, JP et al (1991) J. Immunol. Findings such as Messina [Messina, JP et al ( 1991) J. Immunol. 147, 1759-1764]에 의하면 DNase I은 박테리아의 DNA를 완전히 분해하여 B 세포와 대식세포를 활성화시키는 CpG motif를 생성시키지 못함을 밝혔다. According to 147, 1759-1764] DNase I is said does not produce the CpG motif of bacterial DNA to completely decompose the activating phagocytic cells and for B. 반면에 DNase I을 처리하지 않은 박테리아 DNA는 면역세포들을 활성화시켜 사이토카인과 IgM분비를 촉진시킨다고 발표하였으며 이러한 양상은 CpG motif를 가진 ODN들을 세포에 처리하였을 때와 일치하는 결과를 보였다. On the other hand, not treated with DNase I DNA of bacteria is to activate the immune cells were released sikindago promote cytokine secretion of IgM and this aspect is shown a result when the matching process ODN with a CpG motif to cells. 따라서 본 발명에서는 외부의 DNA를 인식하여 프로세싱시켜 CpG motif를 생성시킬 수 있는 새로운 형태의 엔도뉴클레아제가 면역세포에 존재할 수 있다는 가정하에 여러 종류의 면역 세포주들을 사용한 실험에서 이와 같은 효소활성의 존재를 확인하였다. Therefore, the existence of the present invention, this enzyme activity, such as in the experiments using the various types of immune cells on the assumption that a new type capable of generating a CpG motif to the processing by recognizing the external DNA endonuclease I may be present in the immune cell confirmed.

1-1 세포배양 및 전처리 1-1 Cell culture and pre-processing

사람의 B-림프아 (IM9 및 RPMI1788) 세포주, T-림프아 (Molt-4 및 Jurkat) 세포주, 그리고 골수발생 (U937) 세포주는 American Type Culture Collection ([ATCC] Rockville, MD)에서 구입하였다. B- lymphoblastic (IM9 and RPMI1788) cell lines, T- lymphoblastic (Jurkat and Molt-4) cell line, generated, and bone marrow (U937) cell lines, the human was purchased from American Type Culture Collection ([ATCC] Rockville, MD). 세포는 열처리한 우태아혈청(FBS, Gibco BRL) 10%를 함유하는 RPMI1640 배지에서 1ml당 4-5 x 10 5 개의 세포수를 유지하면서 배양하였다. Cells were incubated with heat-treated fetal bovine serum keep the number of 4-5 x 10 5 cells per 1ml in RPMI1640 medium containing (FBS, Gibco BRL) 10% . 세포배양은 37 o C 에서 5% CO 2 를 함유한 인큐베이터(Forma)에서 수행하였다. Cell culture was performed in an incubator (Forma) containing 5% CO 2 at 37 o C. 세포수와 세포배양중 생존율은 혈구계를 이용하여 트리판 블루 배제(trypan blue exclusion) 방법으로 주기적으로 측정 하였다. Of the cell number and cell culture survival rate using the blood cell system it was periodically measured by the trypan blue exclusion method (trypan blue exclusion). 모든 실험에서 세포의 생존율은 95% 이상을 유지시켰다. The survival rate of the cells in all experiments was maintained for more than 95%. 세포내에서 엔도뉴클레아제가 생합성되는지를 확인하기 위하여 IM9 세포주에 액티노마이신 D (ACD, Sigma)를 0.33 ug/ml로 전처리 하였다[Cooper HL, and Braverman R. (1977) Nature 269, 527-529]. In the cell endonuclease I the liquid actinomycin D (ACD, Sigma) in the IM9 cells were pre-treated with 0.33 ug / ml to verify that the biosynthesis [Cooper HL, and Braverman R. ( 1977) Nature 269, 527-529 . IM9 세포주를 ACD로 처리하여 30분간 배양한 후 세척하고 10% FBS를 함유한 RPMI1640 배지에서 48시간 동안 배양하면서 일정한 시간 간격으로 엔도뉴클레아제 효소활성을 측정하였다. After treatment and incubated for 30 minutes IM9 cell line with ACD were washed and measure the endonuclease activity at regular time intervals, while in a RPMI1640 culture medium containing 10% FBS 48 h.

그 결과 여러 종류의 면역반응에 관여하는 세포들의 세포배양액 과 세포용해물에서 엔도뉴클레아제 효소활성이 나타나는지를 분석하기 위하여 DNA-천연-PAGE 뉴클레아제 활성 검정을 수행하였다. The result was performed natural DNA- -PAGE nuclease activity assay to analyze if these endonuclease enzyme activity in lysates of cell culture medium and cells involved in several types of immune responses. 실험한 세포 배양액 중에서 분비된 엔도뉴클레아제 활성은 IM9 세포주에서만 관찰할 수 있었다(도 5B, 레인 2). The endonuclease activity secreted from a cell culture experiment was observed only in IM9 cell line (Figure 5B, lane 2). 그러나, 사람의 T-림프아 세포주인 Molt-4 세포주 배양시 세포 용해물에서는 항상 엔도뉴클레아제 활성이 존재함을(도 5A, 레인 4) 확인할 수 있었으나 세포배양액에서는 관찰할 수 없었다. However, for the City T- lymphoblastic cell line Molt-4 cells cultured human cell lysates but always can see that there is a second endonuclease activity (Figure 5A, lane 4) could be observed in cell culture. 골수발생 세포주인 U937 세포주, B-림프아 세포주인 RPMI1788 세포주, 그리고 T-림프아 세포주인 Jurkat 세포주에서는 이 엔도뉴클레아제의 효소활성을 세포배양액, 또는 세포 용해물에서 모두 관찰할 수 없었다. In the bone marrow cell line, U937 cell line generation, B- lymphoblastic cell line RPMI1788 cell line, and T- lymphoblastic cell line, Jurkat cell line was not observed both the enzyme activity of the endonuclease in the cell culture, or cell lysate. 또한, 도 4에 나타난 것처럼 세포내에서의 엔도뉴클레아제 생합성(도 4A)과 세포배양액으로의 분비(도 4B)는 ACD전처리 후 초기에 현저하게 줄어들었음을 관찰할 수 있었다. In addition, Figure 4 endonuclease biosynthesis (Fig. 4A) and secretion to the cell culture medium (Fig. 4B) in the cell as shown in was observed to decrease significantly in the early post Empty ACD pretreatment. 이러한 실험 결과는 IM9 세포주에서 엔도뉴클레아제의 합성과 분비가 밀접하게 관계되어 있음을 보여준다. These results show that the synthesis and secretion of the endonuclease from the IM9 cell line is closely related.

면역반응에 관여하는 사이토카인이 엔도뉴클레아제 합성 및 분비에 어떤 영향을 주는지를 확인하기 위하여 인터페론-γ (IFN-γ, 10 units/ml, Genetech Inc) 와 인터루킨-1β (IL-1β, 10 units/ml, Genetech Inc.)를 처리하였다. Interferon -γ (IFN-γ, 10 units / ml, Genetech Inc) and interleukin -1β (IL-1β, 10 to identify the cytokines involved in the immune response, what the effect of the endonuclease synthesis and secretion It was treated with units / ml, Genetech Inc.). 인터루킨을 포함하는 배지에서 24시간 동안 세포를 배양하면서 DNA-천연-PAGE로 분석한 결과, 도 6에서 나타난 바와 같이 이러한 사이토카인들은 엔도뉴클레아제 분비에 크게 영향을 미치지 않음을 볼 수 있었다. Were cultured in the medium containing IL-cells for 24 hours was analyzed by natural DNA- -PAGE, these cytokines, as shown in Figure 6 it could be seen does not have a significant effect on the secretion endonuclease. 또한, 미토겐인 LPS나 TPA도 엔도뉴클레아제의 분비에 아무런 영향을 미치지 않음이 관찰되었다. Also, a mitogen LPS or TPA also does not affect the secretion of endonuclease was observed.

단핵세포를 분화시키는 물질인 12-O-테트라데카노일포르볼 13-아세테이트(TPA, Sigma)를 U937 세포에 서로 다른 농도에서 시간에 따라 처리하면서 엔도뉴클레아제의 합성 및 분비를 관찰하였다. The substance is 12-O- tetra-decanoyl phorbol 13-acetate (TPA, Sigma) to differentiate the mononuclear cells, while treatment with time at different levels in U937 cells was observed the synthesis and secretion of endonuclease. 사이클로헥시미드(CHX, 10 mg/ml, Sigma)와 미토겐인 리포폴리삭카라이드(LPS, 1 ng/ml, Sigma)를 U937 세포에 처리하여 TPA를 처리한 세포와 비교하였다. Cyclohexylene when compared with the mid (CHX, 10 mg / ml, Sigma) and the mitogen the Lipoic polysaccharides cells treated with TPA in the (LPS, 1 ng / ml, Sigma) treatment in U937 cells. 세포에 여러 물질들을 처리하였을 때 세포 모양을 관찰하기 위하여 세포를 포스페이트-완충된 염수 (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 1.8 mM KH 2 PO 4 , pH 7.4)로 세척한 다음 세포원심분리 슬라이드(cytocentrifuge slides)를 준비하고 Wright-Giemsa (Sigma)로 염색하여 확인하였다. When processing a number of substances in the cell phosphate Cells In order to observe the cell shape - in a buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4, 1.8 mM KH 2 PO 4, pH 7.4) washed cells were then prepared for centrifugation slide (cytocentrifuge slides) and confirmed by staining with Wright-Giemsa (Sigma). 시험결과, U937과 같은 사람의 골수성 류케미아 세포주는 TPA 자극에 의해 분화되었을 때 세포 모양이 성숙된 형태를 나타내며 성장이 멈추게 되는 반면에 LPS 자극에 의해서는 세포증식이 일어나게 된다. The test results, myeloid cell lines Mia ryuke of people, such as U937 is a cell proliferation is stimulated by the LPS to occur whereas the cell type represents the shape of the mature growth is stopped when the differentiation by TPA stimulation. 이와 같은 미토겐에 의한 세포의 성장곡선을 그려보면 도 9에서와 같이 나타난다. As it is shown in Figure 9, as the same mitogen Figuring the growth curve of the cells by. 즉, U937 세포주가 TPA에 의해서 분화되어 세포의 모양이 변하면서 성장이 멈추었음을 알 수 있었고 LPS에 의해서는 세포 증식이 일어남을 관찰할 수 있었다. I.e., U937 cell line is differentiated by TPA was found that the growth is stopped while the shape of the cell change was observed for the cell proliferation occurs by LPS. 반면에 apoptosis를 유발하는 물질중 하나인 CHX를 처리하였을 때는 세포가 죽어가는 결과를 볼 수 있었다. On the other hand, when one of CHX was treated to induce apoptosis of the substance I could see the result go the cells die. 이와 같은 세포배양 조건에서 엔도뉴클레아제가 생성되고 분비되는지를 관찰하기 위한 실험을 수행하였다. Such a cell was carried out an experiment to observe whether the endonuclease I produced and secreted in the culture conditions. 도 10에서는 TPA 농도 증가에 따라 엔도뉴클레아제의 세포내 생합성이 증가함을(도 10A) 볼 수 있으며 동시에 효소가 세포 외부로 지속적으로 분비됨을 관찰할 수 있었다(도 10B). 10 can also see the endo that the increase in the biosynthesis of cellular nucleases (Figure 10A) with increasing concentration and TPA was observed that the enzyme is continuously secreted into the cell outside at the same time (Fig. 10B). 엔도뉴클레아제 생합성은 10 pg/ml 의 TPA 농도에서부터 크게 증가됨을 볼 수 있었고(도 10A) 10 ng/ml의 TPA를 U937 세포배양액에 처리하고 일정한 시간 간격으로 엔도뉴클레아제 활성을 관찰하였을 때 도 11과 같은 결과가 나타났다. Endonuclease biosynthesis when observing the 10 pg / ml of endonuclease activity from TPA concentration could largely to be increased (Fig. 10A) 10 ng / ml of TPA to the treatment and at regular time intervals to the U937 cell culture the results were as shown in FIG. 11. 엔도뉴클레아제 효소 활성은 TPA 처리 후 6 시간부터 합성되어 분비되기 시작하여 24시간 후에 합성 및 분비가 가장 많이 나타남을 볼 수 있다. Endonuclease activity can be seen that the synthesis and secretion appears most 24 hours after the start secretion is synthesized from 6 hours after TPA treatment. 세포를 증식시키는 LPS를 1 ng/ml의 농도로 처리한 후 일정한 시간 간격으로 엔도뉴클레아제의 활성을 측정하였을 경우에는 도 12와 같은 결과를 관찰할 수 있었다. And then treated with LPS to proliferate the cells with 1 ng / ml concentration in case of measuring the activity of the endo-nuclease a specific time interval, there was observed the results shown in Figure 12. LPS처리 12시간 후부터 세포 용해물에 효소활성이 나타나기 시작하여 24시간 후에는 높은 효소 활성을 관찰할 수 있는 반면에 세포 배양액에서는 이와 같은 효소활성이 24시간 동안 전혀 관찰되지 않았다. LPS for 12 hours after the cells begin to appear after the enzymatic activity in the lysate for 24 hours is in the other hand to observe high activity cell culture was not observed at all during this enzymatic activity is 24hr. Apoptosis를 유도하는 물질인 CHX를 U937 세포주에 처리했을 때 세포가 죽어가는 현상을 현미경으로 관찰할 수 있었고 이때 엔도뉴클레아제 생합성에는 전혀 영향을 미치지 않음을 볼 수 있었다(도 13, 레인 4). When processing a material of CHX to induce Apoptosis in U937 cell line had cells to observe the dying phenomenon under the microscope could see this time no way affected include the biosynthesis endonuclease (Fig. 13, lane 4). U937 세포주에서 TPA, LPS, 그리고 CHX를 처리하였을 때의 효소활성을 도 13에 요약하였다. In the U937 cell line summarizes the TPA, LPS, and the enzyme activity at the time when the processing CHX in Fig.

1-2 세포 용해물의 제조 및 DNA-천연-PAGE에서 엔도뉴클레아제 활성 측정 1-2 cells prepared and endonuclease activity measured in lysates of DNA- natural -PAGE

세포배양액은 1,500 rpm에서 5분간 원심분리하여 상층액을 취하였다. Cell culture media was the supernatant and separated for 5 minutes and centrifuged at 1,500 rpm. 세포는 차가운 PBS로 두 번 세척한 후 150 mM NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA 와 1 mM PMSF를 함유하는 0.5% Nonidet P-40 (NP-40) 완충용액(용해 완충용액)에 1 x 10 7 개 세포/ml 되게 재부유시켰다. Cells from 0.5% containing a double After washing 150 mM NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA and 1 mM PMSF with cold PBS Nonidet P-40 (NP-40) buffer (lysis buffer solution) in 1 x 10 7 cells / ml were resuspended presented. 4 o C 에 15분간 방치하여 세포를 용해시킨 후 4 o C 에서 15분 동안 12,000 rpm으로 원심분리하여 상층액을 세포 용해물로 사용하였다. 4 o C then allowed to stand for 15 minutes to dissolve the cells by centrifugation at 12,000 rpm for 15 min at 4 o C and the supernatant was used as cell lysates.

엔도뉴클레아제 활성을 측정하고 특성을 규명하기 위하여 변형된 천연 폴리아크릴아미드 겔 검정 시스템을 사용하였다. A modified natural polyacrylamide gel test system to measure the endonuclease activity, and the characterization was used. Hoefer Tall Mighty Small (0.75 mm x 8 cm x 11 cm) 수직형 전기영동 장치를 이용하여, SDS가 없는 7% 폴리아크릴아미드 겔을 초나선형(supercoiled) 플라스미드 DNA(pGEM-T 벡터, 3.0 kb, Promega)를 최종농도 150 ug/ml 되게 공중합화시켰다. Hoefer Tall Mighty Small (0.75 mm x 8 cm x 11 cm) vertical by using an electrophoretic apparatus, a second 7% polyacrylamide gel without a SDS spiral (supercoiled) plasmid DNA (pGEM-T vector, 3.0 kb, Promega ) was Chemistry final concentration of copolymer to be 150 ug / ml. 세포배양액 또는 세포 용해물의 단백질 시료를 각 웰당 10 ug 씩 로딩한 후에 4 o C에서 전기영동을 수행하였다. The protein samples of the cell lysate or cell culture medium after loading by each of 10 ug per well was performed at 4 o C electrophoresis. 전기영동 후 겔을 증류수로 세 번 세척하고 20 mM Tris-HCl (pH 7.0), 1 mM CaCl 2 그리고 10 mM MgCl 2 (TCM buffer)로 구성된 반응 완충용액에서 37 o C에서 4 시간 동안 흔들어 주면서 반응시켰다. Three times to wash the gel with deionized water after electrophoresis, and 20 mM Tris-HCl (pH 7.0 ), 1 mM CaCl 2 and 10 mM MgCl 2 (TCM buffer) shaking for 4 hours at 37 o C in a reaction buffer consisting of reaction It was. DNA-천연-PAGE 상에서 엔도뉴클레아제의 반응 특이성을 규명하기 위하여 반응시간을 변화시켰을 때의 효소 활성을 관찰하였다. DNA- observed enzyme activity when the reaction time was changed to investigate the reaction specificity of the endonuclease on the natural -PAGE. 반응시킨 겔은 37 o C의 1 ug/ml의 에티듐 브로마이드를 함유하는 TCM 완충용액에서 30분 동안 염색하고 302 nm 트랜실루미네이터(transilluminator)로 사진을 찍었다. Reaction in which the gel is 37 o staining in TCM buffer containing ethidium bromide in 1 ug / ml of C for 30 min and photographed with 302 nm transfected room Lumi-ordinator (transilluminator). 겔에서 뉴클레아제 활성이 나타나는 위치는 오렌지색의 바탕에 검정색의 밴드로 관찰할 수 있었다. Position is the active nuclease that appears in the gel could be observed as a black band on the basis of orange. 엔도뉴클레아제 활성의 표준물질로 소 췌장의 DNase I (RNase-없는 10-50 x 10 3 units/ml, Boehringer Mannheim)를 사용하였다. Endonuclease was used for the bovine pancreas as a reference material of the active DNase I (RNase- 10-50 x 10 3 units / ml, Boehringer Mannheim not).

본 발명에서 고안한 DNA-천연-PAGE 뉴클레아제 검정 시스템에 의해서 세포배양액 과 세포용해물에서 효소활성을 민감성과 함께 선택적으로 측정할 수 있음을 보여주고 있다(도 1). By a natural DNA- -PAGE nuclease test system designed in the present invention it shows that it is possible to selectively measured with a sensitive cell culture media and cell lysate from the enzymatic activity (Figure 1). 10 ug의 단백질을 함유하고 있는 세포배양액 과 세포 용해물에서 엔도뉴클레아제 활성이 나타나는 부위에 강한 활성띠를 관찰할 수 있었다. For in that it contains a protein of 10 ug cell culture media and cell lysates were observed in a strong band in the active region is the active endonuclease it appears. IM9 세포주의 배양시간에 따른 엔도뉴클레아제의 생합성 및 분비를 분석한 결과는 도 1과 같다. Analysis of the biosynthesis and secretion of the endonuclease of the incubation time of IM9 cell line is shown in Figure 1; 세포 용해물에서의 엔도뉴클레아제 효소활성 정도는 48시간 동안 배양할 경우 거의 일정하게 관찰되었으나(도 1A), 세포배양액에서는 같은 실험 조건에서 상당히 많은 엔도뉴클레아제 활성이 축적됨을(도 1B) 관찰할 수 있었다. Endonuclease in the cell lysates enzyme activity degree, but substantially constant observed when cultured for 48 hours (Fig. 1A), cell of a significant amount of endonuclease activity accumulation in experimental conditions such as the culture medium (Fig. 1B) It could be observed. 배양한 IM9 세포주를 여러 차례 PBS로 세척한 다음 혈청-없는 배지로 옮겨 배양했을 때, 도 1B에서 관찰되었던 주된 엔도뉴클레아제 활성띠는 그대로 관찰할 수 있었으나 DNase I 효소활성은 전혀 존재하지 않는 것으로 나타났다(도 1C). Washing the IM9 cell line cultured as many times PBS, and then serum-when moved incubated with free medium, as also the main endonuclease activity bands were observed in 1B is but can be directly observed not at all DNase I enzyme activity present found (Fig. 1C). 이러한 결과에서 IM9 세포배양액 과 세포 용해물에서 관찰된 엔도뉴클레아제는 세포가 배양된 배지 성분인 FBS에서 유래된 것이 아니라 세포에서 합성되어 배지로 분비되었다는 것을 알 수 있다. This results in the endonuclease observed in IM9 cell culture media and cell lysates are prepared in the cell, rather than the cells cultured in the culture medium derived from ingredients of FBS can be seen that the secretion into the medium. 도 1B의 세포배양액중 전기영동 상에서 빠르게 이동한 약한 뉴클레아제 활성띠는 DNase I임을 Boehringer Mannheim에서 구입한 소의 DNase I 과 비교하여 확인할 수 있었다(도 1D). FIG low nuclease activity band as quickly moved on the electrophoresis of the cell culture solution of 1B was confirmed as compared with bovine DNase I was purchased from Boehringer Mannheim that DNase I (Fig. 1D).

도 2에서는 DNA-천연-PAGE에서 서로 다른 반응용액의 조건에서 1 시간과 4시간 동안 효소활성을 측정한 결과이다. Figure 2 shows the result of measurement for one hour and enzyme activity for 4 hours at different conditions of the reaction solution in the natural DNA- -PAGE. 10 mM Mg 2+ 을 포함하는 20 mM Tris-HCl (pH 7.0) 완충용액에서 1시간 반응시켰을 때, 도 2A에서 나타나는 바와 같이 IM9 세포주에서 분비된 엔도뉴클레아제만 효소활성을 보였다. 10 mM Mg 2+ 20 mM Tris- HCl (pH 7.0) when sikyeoteul 1 h in a buffer solution containing, a first endonuclease secreted from IM9 cell line as shown in Figure 2A, only showed the enzyme activity. 그러나 동일 반응조건에서 반응시간을 연장하여 4시간 동안 반응시킨 결과(도 2B) 구입한 DNase I 과 함께 FBS에 존재하는 DNase I도 동일한 위치에서 효소활성을 나타냄이 관찰되었다. However, this was observed indicating the same to extend the reaction time at reaction conditions for 4 hours in which the result (Fig. 2B) purchased DNase I and DNase I enzyme activity even at the same positions that are FBS together for. 이상과 같은 결과로부터 IM9 세포주에서 생성되고 분비되는 엔도뉴클레아제는 천연-PAGE상에서 DNase I과 서로 다른 이동거리를 보여 주었고, 주어진 반응조건에서 효소의 반응성도 각기 상이함을 확인하였다. Endonuclease from the results described above that is produced and secreted from the IM9 cell line was found that showed a different moving distance and DNase I on natural -PAGE, the reactivity of the enzyme also is diverse in the given reaction conditions.

1-3 DNase I에 대한 항체생산 및 면역침강 Antibody production and immunoprecipitated for 1-3 DNase I

면역전 혈청을 얻기 위하여 Sprague-Dawley (SD, 150-200 g) 쥐의 꼬리에서 혈액을 채취하였다. Blood samples were collected from Sprague-Dawley (SD, 150-200 g) tail of the mice to get myeonyeokjeon serum. 소의 췌장 DNase I (Sigma)를 7% 천연-PAGE 상에서 DNase I에 해당하는 위치의 단백질 띠를 멸균한 PBS에서 작은 조각으로 잘라 면역하는데 이용하였다. Bovine pancreatic DNase I (Sigma) for 7% was used to immune cut into small pieces in PBS sterilized protein band in a position corresponding to DNase I on natural -PAGE. SD 쥐에 단백질 100 ug을 표준 방법[Harlow, E., and Lane, D. (1988) Antibodies, A laboratory manual, Cold Spring Harbor, New York]에 따라 면역하였다. 100 ug of protein in the SD rats were immune according to standard procedures [Harlow, E., and Lane, D. (1988) Antibodies, A laboratory manual, Cold Spring Harbor, New York]. 4회 접종하고 10일 후에 쥐에서 혈액을 채취하여 항체 역가와 특이성을 측정하였다. 4 doses and measured the antibody with specificity to draw blood from the mice after 10 days. DNase I을 함유하고 있는 혈청에서 안티-DNase I 항체를 ImmunoPure plus protein A/G IgG 정제 키트(Pierce) 와 소의 DNase I이 결합된 Sepharose-CL 4B를 이용하여 정제하였다. In serum containing the DNase I was purified using an anti-I antibodies -DNase the ImmunoPure plus protein A / G IgG Purification Kit (Pierce) and bovine DNase I Sepharose CL-4B with are combined. 정제한 안티-DNase I 항체 와 프로테인 A-Sepharose CL 4B를 결합한 비드로 50 ml 의 세포배양액 또는 PBS에 10배 희석한 사람 혈장 50 ml를 면역침강시켰다. A 10-fold diluted human plasma, 50 ml to 50 ml of cell culture media or PBS as a combination of purified anti -DNase I antibody and protein A-Sepharose CL 4B beads were immunoprecipitated. 면역침강은 4 o C에서 6시간동안 서서히 흔들어 주면서 수행하였다. Immunoprecipitation was carried out and gently shaken for 6 hours at 4 o C. 면역침강한 상층액을 취하여 DNA-천연-PAGE 상에서 엔도뉴클레아제 효소활성을 측정하였다. Take the supernatant was measured by immunoprecipitation endonuclease activity on the natural DNA- -PAGE.

도 3A는 제조한 항체가 FBS에서 유래한 DNase I을 인식함을 보여주고, 또한 사람 혈청에 존재하는 DNase I과 교차반응성을 가짐을 볼 수 있었다. Figure 3A shows that the antibodies produced recognize the DNase I derived from FBS, it could also be seen by having cross-reactivity with DNase I present in the human serum. 물론, 면역전 혈청은 FBS와 사람 혈청의 DNase I은 인식할 수 없었다. Of course, myeonyeokjeon serum DNase I in FBS and human serum could not be recognized. 이와 같이 제조된 DNase I 항체를 이용하여 분비되는 엔도뉴클레아제와 DNase I 각각에 대한 교차반응성을 분석하였다. Cross-reactivity to this way is secreted by the producing DNase I antibodies endonuclease and DNase I each were analyzed. IM9 세포주 배양액을 안티-DNase I 항체로 면역침강한 상층액에서는 빠르게 이동하는 DNase I 효소활성이 나타나지 않았으나, 분비된 엔도뉴클레아제의 효소 활성은 면역침강되지 않고 그대로 회수됨을(도 3B) 관찰할 수 있었다. In the immunoprecipitation of IM9 cell line culture with an anti-I antibodies -DNase supernatant did not show DNase I enzyme activity moving fast, the enzyme activity of the secreted endonuclease that is not recovered as immunoprecipitation (Fig. 3B) to observe could. 이러한 결과로부터 IM9 세포주에서 분비된 엔도뉴클레아제는 DNase I과 면역학적으로 확연히 구분된다는 또 하나의 증거를 확보하였다. From these results the endonuclease secreted from IM9 cell line is secured to one more evidence that distinguished by DNase I and immunologically.

1-4 엔도뉴클레아제 활성의 부분 정제 및 특성 규명 1-4 identified partial purification and properties of endonuclease activity

IM9 세포주의 배양액으로부터 엔도뉴클레아제를 부분 정제하기 위하여, 제조실시예 1-2와 같이 전기영동한 후 효소활성이 있는 부위의 단백질 띠를 용출하였다. In order from the culture broth of IM9 cell line to purify part of the endonuclease after electrophoresis as in Example 1-2 it was eluted with a protein band of the active site of the enzyme. 뉴클레아제 활성이 있는 부위의 단백질띠를 자르고 작게 조각을 내어 에펜도르프 마이크로튜브(eppendorf microtubes)에 옮긴 후 20 mM Tris-HCl (pH 7.0) 완충용액으로 4 o C에서 10 시간 동안 흔들어 주어 단백질 용출을 수행하였다. Nuclease given first cutting the protein band of the region which is active small taking the piece by shaking in Eppendorf micro tubes were transferred to (eppendorf microtubes) 20 mM Tris- HCl (pH 7.0) 4 o C in a buffer solution for 10 hours the protein eluted It was performed. 이 시료를 4 o C에서 14,000 rpm으로 10 분간 원심분리한 후 상층액을 20 ul 씩 분주하여 실험에 이용하였다. The sample was removed after 4 o C in 10 minutes and centrifuged at 14,000 rpm and the supernatant was dispensed by 20 ul was used for the experiment. 용출한 20 ng의 회수한 단백질 시료를 여러 농도의 양이온을 함유하는 20 mM Tris-HCl 완충용액(pH 7.0)에서 초나선 플라스미드 DNA와 37 o C에서 10분 동안 반응시켰다. In the second spiral the recovered protein samples of the elution 20 ng in 20 mM Tris-HCl buffer solution (pH 7.0) containing various concentrations of the cationic plasmid DNA and 37 o C, the reaction was carried out for 10 minutes. 효소활성에 대한 pH의 효과를 측정하기 위해서는 서로 다른 pH의 1 mM CaCl 2 와 10 mM MgCl 2 를 함유하는 20 mM MOPS 완충용액에서 효소활성을 측정하였다. A 20 mM MOPS enzyme activity in a buffer solution containing 1 mM CaCl 2 to each other with 10 mM MgCl 2 in a different pH in order to measure the effect of pH on the enzyme activity was measured. 반응시간에 따른 엔도뉴클레아제의 효소활성을 분석하기 위하여, 효소반응을 37 o C에서 180분 동안 10 mM MgCl 2 를 함유하고 있는 20 mM Tris-HCl 완충용액(pH 7.0)에서 일정한 시간 간격으로 관찰하였다. To analyze the endo-enzymatic activity of nucleases in accordance with the reaction time, in the enzyme reaction 37 o from C 180 bun 10 mM MgCl 2 containing and 20 mM Tris-HCl buffer in a solution for (pH 7.0) at regular time intervals It was observed. 반응은 DNA 시료 완충용액(30% 글리세롤, 0.5% 브로모페놀 블루, 그리고 0.5% 크실렌 사이놀)을 함유한 TE (10 mM Tris-HCl, pH 7.6, 1 mM EDTA) 완충용액을 첨가한 후에 얼음에 넣어 반응을 정지시켰다. The reaction ice after the addition of DNA sample buffer (30% glycerol, 0.5% bromophenol blue, and 0.5% play between xylene) containing a TE (10 mM Tris-HCl, pH 7.6, 1 mM EDTA) buffer solution the reaction was stopped to put on. 반응산물은 에티듐 브로마이드(0.5 ug/ml)을 함유하고 있는 1% 아가로즈 겔에서 전기영동을 수행하여 확인하였다. Reaction products in ethidium bromide (0.5 ug / ml) 1% agarose gel that contains in it was confirmed by performing a gel electrophoresis.

분리된 효소가 최적 활성을 갖는 pH는 7.0으로 관찰 되었으나 비교적 넓은 범위의 pH에서 촉매활성이 나타남을 관찰할 수 있었다(도 7). pH of the separated enzyme having an optimal activity was observed with the catalyst activity seen in a relatively wide range of pH was observed at 7.0 (Fig. 7). 20 mM Tris-HCl (pH 7.0) 완충용액에서 엔도뉴클레아제의 효소 활성은 Mg 2+ 의존적이고, Ca 2+ 에 의해서는 영향을 받지 않음을 알 수 있다(도 8A). 20 mM Tris-HCl (pH 7.0 ) endo-enzymatic activity of nucleases in the buffer solution is to find out will not be affected by and Mg 2+ dependent, Ca 2+ (Fig. 8A). 1-10 mM범위의 Ca 2+ 농도 구간에서는 효소활성이 발현되지 않았으나, Mg 2+ 농도에 의존하여 효소활성에 의해 플라스미드로부터 선형 DNA가 형성됨을 볼 수 있었다. 1-10 in the Ca 2+ concentration in the mM range section did not have the enzyme activity expressed by the enzyme activity depending on the concentration of Mg 2+ could be seen that the linear DNA formed from a plasmid. 이와 병행하여 엔도뉴클레아제의 반응시간에 따른 Mg 2+ -의존적인 선형 DNA 형성을 관찰하였다. In parallel, Mg 2+ in accordance with the response time of the endonuclease-dependent linear DNA was observed to form. 초나선 플라스미드 DNA가 선형 DNA로 전환되는 반응은 10분 동안 반응시켰을 때 나타나기 시작하여 60분까지 점차 증가하였으며 이와 같은 실험 조건에서 뉴클레아제 활성은 180분 이상 지속되었다(도 8B). Second spiral reaction plasmid DNA is converted to linear DNA was increased gradually to start to appear when reacted for 10 minutes to 60 minutes this nuclease activity in the same experimental conditions was continued over 180 minutes (FIG. 8B). 따라서, 이 효소는 초나선 플라스미드 DNA를 선형 DNA로 전환시킨 후 계속해서 분해시킴을 알 수 있으며, 이러한 결과들로부터 IM9 면역세포가 분비하는 엔도뉴클레아제의 활성은 Mg 2+ -의존성임을 확인하였다. Thus, the enzyme, and the second spiral plasmid DNA to find out Sikkim Subsequently decomposition was converted to linear DNA, these results from the activity of the endo-nuclease secreting the immune IM9 cells are Mg 2+ - was identified dependencies .

본 발명에서는 Mg 2+ -의존성인 엔도뉴클레아제 활성이 IM9 세포주에서 일정한 양으로 생성되고 지속적으로 세포배양액으로 분비됨을 보여 주었다. In the present invention, Mg 2+ - it showed that the dependence of endonuclease activity is produced in a constant amount from the IM9 cell line continuously secreting the cell culture. 또한 이 엔도뉴클레아제는 FBS와 사람 혈청에 존재하는 DNase I과 다르다는 것을 천연-PAGE에서 이동거리의 차이와 안티-DNase I항체를 이용한 면역침강의 결과로 확인할 수 있었다. In addition, the endonuclease was confirmed as a result of immunoprecipitation using difference and anti -DNase I antibody of the moving distance that is different from the DNase I present in FBS and human serum from natural -PAGE. 지금까지 apoptosis 과정중 DNA 절단에 작용하는 것으로 보고되어 있는 엔도뉴클레아제와 비교하여 볼 때 효소활성의 양이온 의존도, 천연-PAGE에서의 이동거리 그리고 활성에 요구되는 최적 pH 등 여러 생화학적 특성에서 구분되는 차이점을 보여주고 있다. In comparison with the endonuclease, which is reported to act on the DNA breakage of apoptosis process so far cation dependence of enzymatic activity, separated from the moving distance and the number of biochemical properties including optimum pH required for the activity of the natural -PAGE which shows the difference. 또한 U937 세포주가 분화하면서 엔도뉴클레아제가 생성되고 분비된다는 사실로부터 면역반응에서 엔도뉴클레아제가 외부의 DNA를 인식하여 적절한 크기로 분해할 수 있는 매우 중요한 생물학적 기능을 가지고 있음을 규명하였다. In addition, we identified that the U937 cell line as endonuclease I endonuclease produced and secreted from immune response from the fact that differentiation I have a very important biological functions that can be decomposed into a suitable size to recognize the external DNA. 즉, 세포밖으로 분비되는 엔도뉴클레아제가 외부 DNA에 대한 방어체계에 밀접한 관련성을 가지고 중요한 역할을 수행할 수 있다는 가정은 매우 흥미로운 것이다. That is, assuming cells endonuclease secreted out that I can play an important role with closely related to the defense against foreign DNA will be very interesting. 이러한 엔도뉴클레아제의 기능은 Stacey 등이 최근에 제시한 바와 같이 대식세포가 박테리아 DNA를 받아들인 결과 세포가 활성화된다는 연구 결과[Stacey, KJ et al (1996) J. Immunol. Features of this endonuclease are Stacey, etc. The results of this study that the macrophage cells are the result of activation accept the bacterial DNA, as recently proposed in [Stacey, KJ et al (1996 ) J. Immunol. 157, 2116-2122]와 Higashi 등이 밝힌 실험 결과[Higashi, N. et al (1993) Cell. Experimental results such as 157, 2116-2122] and said Higashi [Higashi, N. et al (1993 ) Cell. Immunol. Immunol. 150, 333-342]로서 단핵세포/대식세포에 의해 매개되는 세포독성이 뉴클레아제에 의해서 일어날 수 있다는 사실을 뒷받침하고 있다. 150, 333-342] and as a support that can occur by a nuclease cytotoxic agents mediated by monocytes / macrophages.

실시예 2 Example 2

뉴클레오좀간 DNA 절단을 유도하는 Mg 2+ -의존성 엔도뉴클레아제의 특성 확인 Mg inducing nucleoside jomgan DNA cut 2+ - determine characteristics of the dependent endonuclease

apoptosis는 염색질 응집, membrane blebbing, 그리고 엔도뉴클레아제의 작용에 의해 여러 종류의 뉴클레오좀 크기로 염색질의 절단이 일어나는 세포사멸의 특징적인 형태로 정의된다[ Wyllie, AH et al (1984) J. Pathol. apoptosis is chromatin aggregation, membrane blebbing, and is defined as the characteristic form of cell death, the cleavage of chromatin occurs by the action of an endonuclease with different types of nucleosome size [Wyllie, AH et al (1984 ) J. Pathol. 142, 67-77; 142, 67-77; Wyllie, AH (1980) Nature 284, 555-556; Wyllie, AH (1980) Nature 284 , 555-556; 및 Kerr, JFR et al (1972) Br. And Kerr, JFR et al (1972) Br. J. Cancer. J. Cancer. 26, 239-257]. 26, 239-257]. 엔도뉴클레아제의 활성화는 apoptosis 과정의 중요한 부분을 차지하며[Arends, MJ, and Wyllie, AH (1990) Am. Activation of the endonuclease and is an important part of the process of apoptosis [Arends, MJ, and Wyllie, AH (1990) Am. J. Pathol. J. Pathol. 136, 593-608], 많은 연구자들에 의해 여러 종류의 뉴클레오좀 절단에 관여하는 효소들이 제안되었다. 136593-608], it has been proposed various kinds of enzymes involved in nucleosome cut by many researchers. DNA의 뉴클레오좀간 절단에 관여하는 효소로는 DNase I[Peitsch MC et al (1993) EMBO J. 12, 371-377], DNase II[Torriglia A. et al (1995) J. Biol. Examples of the enzymes relating to the nucleoside jomgan cutting of DNA DNase I [Peitsch MC et al ( 1993) EMBO J. 12, 371-377], DNase II [Torriglia A. et al (1995) J. Biol. Chem. Chem. 270, 28579-28585; 270, 28579-28585; 및 Barry MA, and Eastman A. (1993) Arch. And Barry MA, and Eastman A. (1993 ) Arch. Biochem. Biochem. Biophys. Biophys. 300, 440-450], 그리고 NUC-18[Kawabata, H. et al (1997) Biochem. 300, 440-450], and NUC-18 [Kawabata, H. et al (1997) Biochem. Biophys. Biophys. Res. Res. Commun. Commun. 233, 133-138]이 작용할 것이라고 제안되었다. 233133-138] was suggested that work. 또한, 많은 연구자들은 Ca 2+ /Mg 2+ -의존성[Stratling WH et al (1984) J. Biol. In addition, many researchers Ca 2+ / Mg 2+ - dependent [Stratling WH et al (1984) J. Biol. Chem. Chem. 259, 5893-5898; 259, 5893-5898; Pandey S. et al (1997) Biochemistry 36, 711-720; Pandey S. et al (1997) Biochemistry 36, 711-720; 및 Ribeiro JM, and Carson DA (1993) Biochemistry 32, 9129-9136] 또는 Mg 2+ -의존성의[Anzai N. et al (1995) Blood 86, 917-923; And Ribeiro JM, and Carson DA (1993 ) Biochemistry 32, 9129-9136] , or Mg 2+ - [Anzai N. et al dependency (1995) Blood 86, 917-923; Kawabata H. et al (1993) Biochem. Kawabata H. et al (1993) Biochem . Biophys. Biophys. Res. Res. Commun. Commun. 191, 247-254; 191, 247-254; Sun XM, and Cohen GM (1994) J. Biol. Sun XM, and Cohen GM (1994 ) J. Biol. Chem. Chem. 269, 14857-14860; 269, 14857-14860; 및 Kawabata, H. et al (1997) Biochem. And Kawabata, H. et al (1997) Biochem. Biophys. Biophys. Res. Res. Commun. Commun. 233, 133-138] 엔도뉴클레아제가 여러 종류의 조직과 세포들에서 뉴클레오좀간 DNA를 절단할 수 있다고 제안하였다. 233133-138] endonuclease I proposed that can cut DNA in the nucleosome jomgan various types of tissues and cells. 그러나, 여러 종류의 다른 엔도뉴클레아제들이 서로 다른 세포체계에 관련되어 있는지 또는 모든 종류의 세포에서 세포의 사멸이 활발하게 일어날 때 염색질 절단을 유도하는 알려지지 않은 효소가 존재하는지는 아직까지 명확한 증거가 제시되지 않고 있다. However, there is still clear evidence to that unknown enzyme that induces chromatin cut when happen to that many different kinds of endonuclease that are related to other cell systems or actively death of cells in all types of cells present there is not presented. 따라서 apoptosis에 작용하는 엔도뉴클레아제를 확인하고 효소가 활성화되는 정확한 메카니즘을 규명하는 연구가 최근 들어 지대한 관심의 대상이 되고 있다. Therefore, it is confirmed that the endonuclease acting on apoptosis and the subject of great interest in recent studies have to investigate the precise mechanism enzyme is active.

제조실시예1에서는 DNA-천연-PAGE를 이용하여 사람의 B-림프아 IM9 세포주가 엔도뉴클레아제를 합성하고 세포배양액으로 분비함을 밝혀내었다. Example 1 In DNA- ah human B- lymphoid using natural -PAGE IM9 cell line is synthesized endonuclease and revealed that the secreted into the cell culture medium. 그리고 이 효소가 지금까지 규명된 다른 엔도뉴클레아제들과 천연-PAGE에서의 이동거리, 최적 효소활성을 나타내는 pH, 효소활성을 위해 요구되는 2가 이온등의 특성이 서로 다르다는 것을 보여 주었다. And the enzyme is required for the two other endonuclease and the moving distance, pH, enzyme activity indicates an optimum enzyme activity in the natural -PAGE identified so far have shown that the properties of the ion and the like are different from each other.

본 발명에서는 제조실시예1 에서 밝힌 세포배양액 및 세포 용해물에 존재하는 엔도뉴클레아제와 동일한 것으로 추정되는 효소활성이 세포의 핵에도 존재함을 밝혔으며 apoptosis 과정중 이 효소가 핵에 축적됨을 관찰할 수 있었다. Was present invention revealed that the enzyme activity is also present nucleus of the cell is estimated to be the same as the endonuclease present in the cell culture media and cell lysate identified in example 1, the observation of the of the apoptosis process, the enzyme is accumulated in the nucleus Could. 이러한 엔도뉴클레아제가 핵에 작용하여 뉴클레오좀 절단을 유도한다는 사실은 아마도 사멸에 이르도록 되어 있는 세포를 없앤다는 의미에서 방어 작용이라 말할 수 있을 것이다. The fact that this endonuclease I derived a nucleosome cut by acting on the nuclei will be said to be acting in a defensive sense, perhaps eliminating the cells that are to arrive at death. IM9 세포주에 CHX를 처리하였을 때 apoptosis의 생화학적 현상의 정점으로 알려진 DNA의 올리고뉴클레오좀 절편형성을 아가로즈 겔 전기영동에서 확인할 수 있었다. Up of DNA, known as the apex of the biochemical phenomena of apoptosis when treated in the CHX IM9 cell line was found to form a nucleosome fragments in agarose gel electrophoresis. IM9 세포주에서 분리한 핵을 Mg 2+ 존재하에서 반응시켰을 때도 전형적인 DNA 절단을 볼 수 있었다. Sikyeoteul reaction when a nucleus isolated from IM9 cell line under Mg 2+ there could be seen a typical DNA breakage. 자가분해에 의한 DNA 절단은 명확하게 Mg 2+ -의존성이고 Ca 2+ -비의존성임을 확인할 수 있었다. DNA cleavage by the self-decomposition is clearly Mg 2+ - it was confirmed that the non-dependent-dependent and Ca 2+. 또한 핵에 존재하는 엔도뉴클레아제 효소활성을 DNA-천연-PAGE 검정 시스템에서 관찰할 수 있었다. There was also observed the endonuclease enzyme activity present in the nucleus in the natural DNA- -PAGE black system. 이 효소의 활성을 위한 최적 pH 역시 6.5-7.5로 밝혀졌다. Optimum pH for the activity of this enzyme also was found to be 6.5-7.5. 이와 같은 결과는 제조실시예1에서 밝힌 IM9 세포주에 의해 합성되고 분비되는 엔도뉴클레아제와 핵에 존재하는 효소가 동일함을 입증하는 실험적 증거로 제시될 수 있다. These results can be presented in the experimental evidence that the enzymes present in the endonuclease and the nucleus, which is synthesized and secreted by the IM9 cell lines identified in Example 1 is the same. 또한 IM9 세포의 핵에 존재하는 이 엔도뉴클레아제는 많은 연구자들에 의해 여러 조직과 세포들에 존재하는 것으로 알려진 Mg 2+ -의존성 엔도뉴클레아제[Anzai N. et al (1995) Blood 86, 917-923; Also present in the nucleus of IM9 cells endonuclease is much by researchers known to exist in many tissues and cells Mg 2+ - dependent endonuclease [Anzai N. et al (1995) Blood 86, 917-923; Kawabata H. et al (1993) Biochem. Kawabata H. et al (1993) Biochem . Biophys. Biophys. Res. Res. Commun. Commun. 191, 247-254; 191, 247-254; Sun XM, and Cohen GM (1994) J. Biol. Sun XM, and Cohen GM (1994 ) J. Biol. Chem. Chem. 269, 14857-14860; 269, 14857-14860; 및 Kawabata, H. et al (1997) Biochem. And Kawabata, H. et al (1997) Biochem. Biophys. Biophys. Res. Res. Commun. Commun. 233, 133-138]와 깊은 관계가 있을 것으로 추정된다. 233, 133-138] and is believed to be closely related. 그러나 아직까지 apoptosis에 관여하는 엔도뉴클레아제를 보고한 연구 결과에서 Mg 2+ -의존성 엔도뉴클레아제를 전기영동 분석에서 단백질띠나 효소활성띠로 규명한 연구자는 없었다. But yet in a research report endonuclease involved in apoptosis Mg 2+ - no one identified protein bands or enzyme activity Tire dependency endonuclease from electrophoretic analysis of researchers.

본 발명에서 관찰한 엔도뉴클레아제는 지금까지 밝혀진 DNA의 뉴클레오좀간 절단에 관여하는 효소인 Ca 2+ /Mg 2+ -의존성 엔도뉴클레아제[Stratling WH et al (1984) J. Biol. Endonuclease was observed in the present invention are Ca 2+ / Mg of enzymes responsible for nucleoside jomgan cleavage of DNA found so far 2+ - dependent endonuclease [Stratling WH et al (1984) J. Biol. Chem. Chem. 259, 5893-5898; 259, 5893-5898; Pandey S. et al (1997) Biochemistry 36, 711-720; Pandey S. et al (1997) Biochemistry 36, 711-720; 및 Ribeiro JM, and Carson DA (1993) Biochemistry 32, 9129-9136], DNase I[Peitsch MC et al (1993) EMBO J. 12, 371-377], DNase II[Torriglia A. et al (1995) J. Biol. And Ribeiro JM, and Carson DA (1993 ) Biochemistry 32, 9129-9136], DNase I [Peitsch MC et al (1993) EMBO J. 12, 371-377], DNase II [Torriglia A. et al (1995) J Biol.. Chem. Chem. 270, 28579-28585; 270, 28579-28585; 및 Barry MA, and Eastman A. (1993) Arch. And Barry MA, and Eastman A. (1993 ) Arch. Biochem. Biochem. Biophys. Biophys. 300, 440-450], NUC-18[Kawabata, H. et al (1997) Biochem. 300, 440-450], NUC-18 [Kawabata, H. et al (1997) Biochem. Biophys. Biophys. Res. Res. Commun. Commun. 233, 133-138]들과 칼슘 의존성, 천연-PAGE에서의 이동거리 차이, 그리고 최적활성 pH 면에서 구분될 수 있다. 233, 133-138] and the calcium-dependent, and can be separated from the pH if the movement distance difference, and the optimum activity at the natural -PAGE. 본 발명에서 밝힌 Mg 2+ -의존성 엔도뉴클레아제의 생리적인 중요성은 명확하게 규명되지 않았으나, apoptosis 과정중 세포의 핵에서도 관찰된다는 사실로부터 apoptosis 과정에서 중요한 역할을 수행할 것으로 추정할 수 있다. Mg 2+ revealed in the present invention the physiological significance of the dependent endonuclease can be expected to play an important role in the apoptosis process, from the fact that although not clearly identified, observed in the nuclei of cells from apoptosis process. 따라서 엔도뉴클레아제의 활성화 메카니즘과 명확한 기능을 효소학적 측면에서 밝힌다면 apoptosis 과정을 이해하는 데에 유용한 정보를 제공할 수 있다. So, if said activation mechanism and a clear feature of the endonuclease from the enzymatic side can provide useful information to understand the process of apoptosis.

2-1 Apoptosis 유도 2-1 Apoptosis induction

사람 B-림프아 (IM9) 세포주를 배양한 다음에 apoptosis는 10 ug/ml의 CHX(Sigma)를 처리하고 24 시간동안 배양하여 유도하였다[Chow, SC et al ,(1995) Exp. Cultured human B- lymphoblastic (IM9) cell line, and then to apoptosis induced by treatment for 24 hours and the CHX (Sigma) of 10 ug / ml [Chow, SC et al, (1995) Exp. Cell. Cell. Res. Res. 216, 149-159]. 216, 149-159]. CHX에 의해 apoptosis가 유도된 세포의 모양 변화는 세포원심분리 슬라이드를 준비한 후 Wright-Giemsa (Sigma)로 염색하여 확인하였다. Shape change of cell apoptosis is induced by CHX after preparing the cells, centrifuged slide was confirmed by staining with Wright-Giemsa (Sigma).

도 15A에서 CHX(10 ug/ml)를 IM9 세포주에 24 시간 동안 처리하였을 때 특징적인 뉴클레오좀간 DNA 절단의 형태인 DNA 조각 형성을 볼 수 있었다. Also the CHX (10 ug / ml) from 15A to IM9 cell line could be seen the form of a DNA fragment forming a characteristic nucleoside jomgan cut DNA by treatment for 24 hours. CHX의 효과는 12시간 후부터 나타나기 시작하여 24 시간 후에는 많은 양의 DNA 조각이 형성되는 현상을 관찰하였다. Effect of CHX is 24 hours after the start to appear after 12 hours was observed a phenomenon that a large amount of DNA fragments are formed. Apoptosis에 의해 세포가 죽을 때 일어나는 세포의 형태를 관찰하기 위하여 Wright-Giemsa로 염색해 본 결과는 도 15C와 같다. In order to observe the morphology of the cells occurs when the cells are killed by Apoptosis results in the dyed Wright-Giemsa are shown in FIG 15C. CHX를 처리한 세포에서는 apoptosis가 일어나는 세포가 많이 존재하였으며, 세포가 쭈그러지고 염색질이 모이며 핵이 조각나는 특징적인 세포모양 변화가(도 15C) 정상적으로 성장하는 세포(도 15B)와 비교되었다. In the CHX-treated cells were compared with cells (Fig. 15B) that apoptosis was taking place the cell is present much, the cells are jjugeureo chromatin is the parent nucleus and a piece I characteristic cell shape change is grown normally (Fig. 15C).

2-2 CHX를 처리한 IM9 세포주의 엔도뉴클레아제에 의한 DNA 절단 확인 DNA disconnection confirmation by the endonuclease of IM9 cell line treated with 2-2 CHX

IM9 세포주를 5 x 10 5 개 세포/ml의 세포수로 배양하면서10 ug/ml의 CHX(Sigma)를 처리하고 24 시간 동안 배양하면서 일정한 시간 간격으로 1 x 10 6 개의 세포를 취하여 Blin 과 Stafford의 방법[Blin, N., and Stafford, DW (1976) Nucleic Acids Res. The IM9 cell line by taking a 5 x 10 5 cells / and of ml incubated with cell handling CHX (Sigma) of 10 ug / ml and 1 x at regular time intervals, for 24 hours 10 6 cells of Blin and Stafford method [Blin, N., and Stafford, DW (1976) Nucleic Acids Res. 3, 2303-2308]을 변형한 방법에 따라 DNA를 추출하였다. 3, 2303-2308; the DNA was extracted according to a modified method. 1 x 10 6 개의 세포를 PBS로 2회 세척하고 TE 완충용액으로 재부유시킨 후 DNA 추출 완충용액(10 mM Tris-HCl, pH 7.6, 10 mM EDTA, 100 mM NaCl, 0.2% SDS, 그리고 100 ug/ml 프로테인아제 K) 1 ml을 첨가하여 50 o C에서 8 시간 동안 반응시킨 후 시료를 페놀/클로로포름으로 2회 처리하여 단백질을 제거하고 0.3 M 아세트산 나트륨(pH 5.2)를 첨가한 다음 차가운 에탄올로 침전시켰다. 1 x 10 6 cells in PBS to a washed twice and then resuspended in TE buffer solution of DNA extraction buffer (10 mM Tris-HCl, pH 7.6, 10 mM EDTA, 100 mM NaCl, 0.2% SDS, and 100 ug / ml protein kinase K) by the 1 ml was added to treatment twice with a sample with phenol / chloroform and then reacted for 8 hours at 50 o C to remove the protein and the addition of 0.3 M sodium acetate (pH 5.2) the following cold ethanol precipitate. 이 침전물을 TE (10 mM Tris-HCl, pH7.6, 1 mM EDTA) 완충용액으로 녹인 후 RNase A를 처리하고 1.8% 아가로즈 겔에서 전기영동을 수행하였다. This precipitate was dissolved in TE (10 mM Tris-HCl, pH7.6, 1 mM EDTA) buffer solution was treated with RNase A and perform electrophoresis in 1.8% agarose gel. 전기영동한 겔을 0.5 ug/ml의 에티듐 브로마이드가 들어 있는 용액에 30분 동안 방치한 후 UV에서 사진을 찍었다. After the electrophoresis, the gel was allowed to stand for 30 minutes in a solution containing ethidium bromide and the 0.5 ug / ml photographed in UV.

CHX를 처리한 IM9 세포를 일정한 시간 간격으로 취하여 세포 용해물과 핵을 준비하고 용해시킨 다음, 핵에 존재하는 엔도뉴클레아제의 효소활성을 확인하기 위하여 DNA-천연-PAGE 뉴클레아제 활성 겔 검정을 수행하였다. To take the IM9 cells treated with CHX a specific time interval, preparing a cell lysate and nuclear and to check for the next dissolved, endo activity of nuclease present in the nucleus of natural DNA- -PAGE nuclease activity gel black It was performed. 도 16A의 결과에서 IM9 세포주를 24시간 동안 배양할 때 세포 용해물에 엔도뉴클레아제 효소활성이 일정하게 나타남을 볼 수 있다. Also there is a cell lysate endonuclease activity to be found for the constant appears when cultured for 24 hours in the cell line IM9 result of 16A. 그러나 CHX를 처리한 세포의 세포 용해물에서는 6-12 시간 동안 효소 활성이 감소함을 볼 수 있고(도 16B), 반면에 그 핵에서는 효소활성이 축적되는(도 16C) 현상을 관찰하였다. But was observed in the treated cell lysate CHX cells can see that the enzyme activity decreased during the time, and 6-12 (Figure 16B), while the nuclei in the (FIG. 16C) that the enzymatic activity accumulated in the developer.

2-3 세포핵의 분리 및 자가분해 Isolation and self-decomposition of 2-3 nucleotides

세포의 핵을 분리하기 위해 1 x 10 7 개의 세포를 차가운 PBS로 3회 세척한 다음 50 mM Tris-HCl (pH 8.0), 5 mM MgCl 2 그리고 0.9 M 수크로즈를 포함하는 차가운 완충용액 0.5 ml로 4 o C에서 20분 동안 용해시켰다. Washed 1 x 10 3 times the seven cells in cold PBS to remove the nucleus of the cell, and then 50 mM Tris-HCl (pH 8.0 ), with 5 mM MgCl 2 and 0.9 0.5 ml of cold buffer solution containing M sucrose at 4 o C for 20 minutes to dissolve. 준비된 세포 용해물을 1.2 M 수크로즈 용액 0.5 ml 위에 올려놓고 800 x g 에서 40분 동안 원심분리하였다. Place the cell lysate prepared 1.2 M over a number of 0.5 ml of sucrose solution and centrifuged at 800 x g for 40 minutes. 침전물에 존재하는 핵을 20 mM Tris-HCl (pH 7.0) 완충용액으로 현탁하여 얻었다. Nuclei present in the precipitate was 20 mM Tris-HCl (pH 7.0) was obtained which was suspended in a buffer solution.

분리한 핵의 자가분해는 Mg 2+ 와 Ca 2+ 의 농도를 변화시키면서 37 o C에서 일정한 시간 간격으로 반응시켜 수행하였다. Self-decomposition of the nucleus is removed while changing the concentration of Mg 2+ and Ca 2+ was carried out by reacting a specific time interval from 37 o C. 반응은 10 mM Tris-HCl(pH 7.5), 100 mM NaCl, 1 mM EDTA, 1% SDS 그리고 프로테이나제 K를 포함하는 DNA 추출 완충용액 0.5 ml을 넣어 종결시켰다. The reaction was 10 mM Tris-HCl (pH 7.5), it was terminated 100 mM NaCl, 1 mM EDTA, 1% SDS and a proteinase into 0.5 ml DNA extraction buffer containing K. 이 혼합물을 50 o C에서 3 시간 동안 반응시킨 후 시료를 페놀/클로로포름으로 2회 처리하여 단백질을 제거하고 0.3 M 아세트산 나트륨(pH 5.2)를 첨가한 다음 차가운 에탄올로 침전시켰다. The mixture was a 50 o was reacted for 3 hours in a sample C treated with phenol / chloroform twice to remove the protein and the addition of 0.3 M sodium acetate (pH 5.2) and then precipitated with cold ethanol. 이 침전물을 TE 완충용액으로 녹인 후 RNase A를 처리하고 1.8% 아가로즈 겔에서 전기영동을 수행하였다. This precipitate was dissolved in TE buffer solution was treated with RNase A and perform electrophoresis in 1.8% agarose gel. 전기영동한 겔을 0.5 ug/ml의 에티듐 브로마이드가 들어 있는 용액에 30분 동안 방치한 후 UV에서 사진을 찍었다. After the electrophoresis, the gel was allowed to stand for 30 minutes in a solution containing ethidium bromide and the 0.5 ug / ml photographed in UV.

분리한 세포의 핵을 자가분해시키는 방법을 이용하여 IM9 세포주의 핵에 존재하는 엔도뉴클레아제 효소활성을 측정한 결과 Mg 2+ 농도(1 mM, 10 mM)에 의존적으로 DNA의 조각들이 생성되는 현상을 관찰하였다. Using the self-decomposition method of the nucleus of the cell separation results of measuring the endonuclease enzyme activity present in the nucleus of a cell line IM9 Mg 2+ concentration (1 mM, 10 mM) is generated dependently on to a piece of DNA the phenomenon was observed. 그러나 동일한 실험 조건에서 Mg 2+ 을 Ca 2+ 로 대체하였을 경우에는 이와 같은 DNA 절단이 관찰되지 않았으며 Ca 2+ 과 Mg 2+ 이 같이 존재하는 조건에서는 Mg 2+ 만 존재할 때와 같은 유형으로 DNA 조각 형성이 나타났다(도 14A). However, when replacing the Mg 2+ to Ca 2+ in the same experimental conditions were such DNA cleavage was observed in the condition that the Ca 2+ and Mg 2+ present as DNA, by type, such as only in the presence of Mg 2+ the pieces were formed (Fig. 14A). 즉, Mg 2+ 의 농도에 의존하는 엔도뉴클레아제 효소활성에 의하여 DNA가 분해되는 결과로 해석할 수 있다. That is, it can be interpreted by the endonuclease activity of the enzyme depends on the concentration of Mg 2+ as a result of DNA degradation. 1 mM Zn 2+ 와 5 mM EDTA 존재하에서는 핵에서 DNA 조각 형성이 일어나지 않았으며(도 14B) Mg 2+ (10 mM) 와 Ca 2+ (10 mM)의 고정된 농도 조건에서 0-4시간 동안 DNA 조각 형성을 관찰한 결과, Mg 2+ 단독으로 존재할 때는 반응 30분 후부터 DNA조각 형성이 시작되었으며 60-240분 동안에는 절단된 DNA 조각이 축적됨을 관찰하였다(도 14C). 1 mM Zn 2+ and 5 mM EDTA in the presence under fixed concentrations of the DNA fragment was formed did not occur in the nucleus (Fig. 14B) Mg 2+ (10 mM) and Ca 2+ (10 mM) for 0-4 hours as a result of observing the formed DNA fragment, when present in an Mg 2+ alone after 30 minutes of reaction, a DNA fragment forming began was observed that the cut DNA fragment 60-240 minutes during accumulation (Figure 14C). 그러나 Ca 2+ 존재시는 4시간 동안에 DNA 조각 형성이 관찰되지 않았다(도 14D). However, the presence of the Ca 2+ was not a DNA fragment formation observed during 4 hours (FIG. 14D). 이상과 같은 실험 결과를 통하여 IM9 세포핵에 존재하는 엔도뉴클레아제 활성에는 DNA 조각 형성을 위해 Mg 2+ 이 절대적으로 요구됨을 확인하였다. Through the experimental results as described above endonuclease activity present in the cell nucleus, the IM9 Mg 2+ was absolutely required to check for the DNA fragment formed.

2-4 세포의 핵에 존재하는 엔도뉴클레아제의 부분 정제 및 특성 연구 Partial Purification and Characterization of 2-4 endonuclease present in the nucleus of the cell

세포의 핵에 존재하는 엔도뉴클레아제의 부분 정제는 핵을 용해시킨 후 제조실시예 1-4의 방법으로 활성이 있는 부위의 단백질띠에서 용출하여 수행하였다. Partial Purification of the endonuclease present in the nucleus of the cell was performed by dissolving the protein bands eluted from the nucleus of the region which is active in the method of Production Example 1-4. 초나선 플라스미드 DNA를 기질로 이용하여 효소 활성을 측정하면서 제조실시예 1-4의 방법으로 2가 이온 의존성을 관찰하였다. A second spiral method in Production Example 1-4 by measuring the enzyme activity using the plasmid DNA as the substrate 2 is observed ion dependence. 또한, apoptosis의 저해물질로 알려진 ZnCl 2 와 킬레이트화제인 EDTA를 처리하였을 때 효소활성의 변화도 관찰하였다. In addition, changes in enzyme activity was observed even when the handle is ZnCl 2 and the chelating agent known as inhibitors of apoptosis EDTA.

DNA-천연-PAGE에서 확인한 IM9 세포의 핵에 존재하는 엔도뉴클레아제 효소 활성의 특성을 규명하기 위하여 효소를 천연-PAGE로 분리하여 용출하였다. Enzymes in order to clarify the features of the endonuclease enzyme activity present in the nuclei of IM9 cells identified in natural DNA- -PAGE was eluted and separated by natural -PAGE. 엔도뉴클레아제의 양이온-의존성을 관찰한 결과 세포배양액에 존재하는 효소와 같이 Mg 2+ -의존성임을 확인하였다(도 17). As a result of observing a dependency, such as an enzyme present in the cell culture medium Mg 2+ - - cation of the endonuclease was identified dependencies (FIG. 17). Apoptosis 저해물질인 Zn 2+ 와 킬레이트화제인 EDTA에 의해서는 엔도뉴클레아제 효소활성이 완전히 저해됨을 볼 수 있다. By Apoptosis inhibitor of Zn 2+ and the chelating agent EDTA has endonuclease activity to see completely inhibited. 이러한 결과들로부터 초나선 플라스미드 DNA가 선형 DNA로 전환되는데 Mg 2+ 가 요구됨을 알 수 있으며 이는 도 8에서 밝힌 결과와 일치하는 것으로 해석할 수 있다. There is a second spiral plasmid DNA from these results converted to linear DNA is Mg 2+ is required to find out, which can be interpreted as consistent with the results identified in Fig.

실시예 3 Example 3

면역세포에서 외부 DNA에 대한 엔도뉴클레아제 작용 및 반응산물의 특성 규명 Identification endonuclease features of the action and reaction products of the foreign DNA in immune cells

지금까지 외부물질로 인식되는 박테리아 DNA는 포유동물의 DNA에는 존재하지 않는 여러 가지 구조 결정인자가 존재한다고 밝혀져있으며, 이 인자가 면역세포를 활성화시킨다고 알려졌다[Gilkeson, GS et al (1995) J. Clin. So far, the bacterial DNA to be recognized as foreign matter that has been identified several structural determinants are present that are not present in mammalian DNA, known sikindago This factor activates the immune cells [Gilkeson, GS et al (1995 ) J. Clin . Invest. Invest. 95, 1398-1402; 95, 1398-1402; Gilkeson, GS et al (1991) Clin. Gilkeson, GS et al (1991) Clin. Immunol. Immunol. Immunopathol. Immunopathol. 59, 288-300; 59, 288-300; Messina, JP et al (1993) Cell. Messina, JP et al (1993) Cell. Immunol. Immunol. 147, 148-157; 147, 148-157; Krieg, AM et al (1995) Nature 374, 546-549; Krieg, AM et al (1995) Nature 374, 546-549; 및 Halpern, MD et al (1996) Cell. And Halpern, MD et al (1996) Cell. Immunol. Immunol. 167, 72-78]. 167, 72-78]. 포유동물과 박테리아 DNA의 특징적인 차이점중 하나는 포유동물은 상당한 CpG 억제와 CpG 디뉴클레오타이드의 사이토신(cytosine)에 선택적으로 메틸화되어 있다는 사실이다[Bird, AP (1995) Trends Genet. One of the distinctive differences between mammalian and bacterial DNA are mammals is that it is selectively methylated in cytosine (cytosine) of the significant CpG suppression and CpG di-nucleotides [Bird, AP (1995) Trends Genet. 11, 94-100; 11, 94-100; Razin, A., and Friedman, J. (1981) Prog. Razin, A., and Friedman, J. (1981) Prog. Nucleic Acid Res. Nucleic Acid Res. Mol. Mol. Biol. Biol. 25, 33-52; 25, 33-52; 및 Han, J. et al (1994) Antisense Res. And Han, J. et al (1994) Antisense Res. Dev. Dev. 4, 53-65]. 4, 53-65]. 최근에 연구자들은 박테리아 DNA에 존재하는 CpG motif가 폴리클로날 B 세포를 빠르게 활성화시켜 IgM 분비를 촉진하며[Krieg, AM et al (1995) Nature 374, 546-549; Recently, researchers facilitate IgM secretion by the CpG motif present in bacterial DNA rapidly activate polyclonal B cell and [Krieg, AM et al (1995 ) Nature 374, 546-549; Liang, H. et al (1996) J. Clin. Liang, H. et al (1996) J. Clin. Invest. Invest. 98, 1119-1129; 98, 1119-1129; 및 Yi, A.-K. And Yi, A.-K. et al (1996) J. Immunol. et al (1996) J. Immunol. 156, 558-564], 안티-IgM 항체에 의해 세포주기가 멈추게 되고, 박테리아의 CpG motif는 apoptosis가 일어나는 B 세포의 c- myc 발현을 저해하며 myn , blc 2 , 그리고 bcl-X L mRNA 발현을 증가시켜 apoptosis로부터 세포를 보호해준다고 제안하였다[Y, A.-K. 156, 558-564], cell cycle has been stopped by the anti -IgM antibody, CpG motif of the bacteria inhibit the c- myc expression of B cell apoptosis is occurring, and the myn, blc 2, and bcl-X L mRNA expression increase was proposed haejundago protect cells from apoptosis [Y, A.-K. et al (1996) J. Immunol. et al (1996) J. Immunol. 157, 4918-4925]. 157, 4918-4925]. 또 다른 연구에서는 CpG motif가 직접 B 세포를 활성화시켜 짧은 시간 안에 IL-6 와 IL-12 분비를 촉진시킨다고 보고하였다[Halpern, MD et al (1996) Cell. Another study reported that activate the B cells are direct CpG motif promotes IL-6 and IL-12 secretion within a short time [Halpern, MD et al (1996 ) Cell. Immunol. Immunol. 167, 72-78; 167, 72-78; Yi, A.-K. Yi, A.-K. et al (1996) J. Immunol. et al (1996) J. Immunol. 157, 5394-5402; 157, 5394-5402; 및 Klinman, DM et al (1996) Proc. And Klinman, DM et al (1996) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 93, 2879-2883]. USA 93, 2879-2883]. 또한 CpG motif는 NK 세포에 작용하여 약하게 CD4 + 세포에서 IFN-γ를 유도하는 것으로 밝혀졌다[Bird, AP (1995) Trends Genet. In addition, CpG motif have been shown to weakly acts on NK cells induces IFN-γ from CD4 + cells [Bird, AP (1995) Trends Genet. 11, 94-100; 11, 94-100; 및 Yamamoto, S. et al (1992) Microbiol. And Yamamoto, S. et al (1992) Microbiol. Immunol. Immunol. 36, 983-997]. 36, 983-997]. 따라서 CpG DNA에 의한 면역세포의 활성화는 IL-6의 유도에 의해 체액성 면역을 증가시키고 IFN-γ의 분비로 세포성 면역이 증가된다. Therefore, activation of immune cells by CpG DNA is increased the humoral immunity by induction of IL-6 increases the secretion of cell-mediated immunity by IFN-γ. 또한 박테리아 DNA를 대식세포가 소화하면서 활성화되어 TNF-α, IL-1β, 그리고 플라스미노겐 활성화제 억제제-2 mRNA 생성을 유발 시킨다고 알려졌다[Stacey, KJ et al (1996) J. Immunol. Also it is activated while the macrophage the bacteria digest DNA TNF-α, IL-1β , and plasminogen activator inhibitor known sikindago induce -2 mRNA produced [Stacey, KJ et al (1996 ) J. Immunol. 157, 2116-2122]. 157, 2116-2122].

본 발명에서는 면역세포에서 박테리아 DNA를 인식하여 분해시키는 역할을 수행하는 엔도뉴클레아제의 효소활성 특성 및 효소반응 최종산물의 특성을 규명하였다. In the present invention, the enzyme activity was identified characteristics and properties of the final products of the enzymatic reaction endonuclease that acts to decompose to recognize bacterial DNA in immune cells. 또한 세포배양액에서 적절하게 프로세싱된 DNA 조각이 세포에 유입되어 세포내에서 엔도뉴클레아제의 작용에 의해 프로세싱됨을 확인하였다. In addition, it was confirmed that the proper DNA fragment processing in the cell culture medium is introduced into the processing cells by the action of the endonuclease in the cell. 면역세포내로 유입된 외부의 DNA는 세포내에서 엔도뉴클레아제의 작용에 의해 최종적으로 약 10개 염기의 일본쇄 조각으로 분해됨을 확인하였고, 엔도뉴클레아제에 의해서 세포내에서 분해된 DNA 조각에는 5'-말단에 두개의 퓨린 염기 그리고 3'-말단에 두 개의 피리미딘 염기로 구성된 CpG motif가 존재함을 규명하였다. Of the foreign DNA introduced into the immune cells by the action of the endonuclease in the cell of claim finally about 10 was confirmed decomposed into stranded piece of the base, the endonuclease with DNA pieces degraded in the cells by, the two purine bases on the 5'-end and was identified that the presence CpG motif consisting of two pyrimidine bases on the 3'-end. 또한 CpG motif가 존재하는 올리고뉴클레오타이드나 PCR로 증폭된 DNA의 자극에 의해 B 세포인 IM9 세포주가 IgM을 분비함을 관찰할 수 있었다. It could also be that a CpG motif is present up by the stimulation of the DNA amplified by PCR nucleotide or B cell IM9 cell line observed that secrete IgM. 그러나 CpG motif가 메틸화된 DNA나 진핵세포의 DNA에 의해서는 IgM의 분비가 촉진 되지 않음을 아울러 확인하였다. However, the CpG motif does not promote the secretion of IgM by the DNA of the methylated DNA, or eukaryotic cells as well as confirmation. 이러한 결과들은 CpG motif가 B 세포와 대식세포 등에 작용하여 IgM과 사이토카인의 분비를 촉진시킨다는 기존의 연구 결과와도 일치하였다. These results were in the CpG motif acts on B cells and macrophages, consistent with previous findings sikindaneun promoting the secretion of IgM and cytokines. 그러나 박테리아 DNA를 분해하여 CpG motif를 생성하는 과정과 이에 수반되는 효소에 대하여는 본 발명에서 최초로 규명하였다. However, it was studied for the first time in the invention with respect to the enzymes involved generating a CpG motif decomposing bacteria and its DNA.

3-1 엔도뉴클레아제에 의한 박테리아 DNA 프로세싱 Bacterial DNA processing by 3-1 endonuclease

엔도뉴클레아제의 효소활성 특이성과 최종 반응산물의 특성을 연구하기 위한 효소원으로 IM9 세포주의 배양액을 이용하였다. The enzymatic activity and specific properties of the final reaction product of the endonuclease as an enzyme source for the study was used a culture medium of the cell line IM9. IM9 세포주를 10% FBS를 함유하는 RPMI1640 배지에서 37 o C, 5% CO 2 인큐베이터에서 48시간 배양하여 효소원으로 사용하였다. The IM9 cell line in RPMI1640 medium containing 10% FBS 37 o C, and 48 hours in 5% CO 2 incubator were used as the enzyme source. 또한 DNase I이 없는 IM9 세포주에서 분비된 엔도뉴클레아제만 존재하는 효소원은 FBS가 없는 배지에서 세포를 36 시간 배양하여 세포배양액을 이용하였다. In addition, an enzyme source that exists only endonuclease secreted by the cell line IM9 no DNase I was used for the cell culture 36 hours Cells were incubated in FBS-free medium.

효소의 기질로 사용한 플라스미드(pGEM-T 벡터, 3.0 kb)는 대장균에서 알카리 용해방법[Birboim, HC, and Doly, J. (1979) Nucleic Acids Res. Plasmid (pGEM-T vector, 3.0 kb) was used as substrate for the enzyme alkaline melting method in E. coli [Birboim, HC, and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523]으로 파쇄, 페놀/클로로포름으로 2회 추출한 후, 에탄올 침전반응을 수행하여 획득하였다. 7, 1513-1523] is extracted twice with crushing, phenol / chloroform, ethanol precipitation was obtained by performing the reaction. 대장균의 게놈성 DNA 와 IM9 세포의 DNA는 Blin 과 Stafford의 방법[Blin, N., and Stafford, DW (1976) Nucleic Acids Res. Genomic DNA and the DNA of IM9 cells of E. coli is the method of Blin and Stafford [Blin, N., and Stafford , DW (1976) Nucleic Acids Res. 3, 2303-2308]을 변형한 방법에 따라 추출하였다. 3, 2303-2308] was extracted according to a modified method. 세포를 PBS로 2회 세척한 후 TE 완충용액으로 재부유시킨 후 DNA 추출 완충용액(10 mM Tris-HCl, pH 7.6, 10 mM EDTA, 50 mM NaCl, 0.2% SDS, 20 ug/ml RNase A)을 첨가하여 37 o C에서 10분간 처리한 뒤 프로테이나제 K를 100 ug/ml 되게 첨가하여 50 o C에서 8시간 반응시켰다. After washing twice the cells with PBS then resuspended in TE buffer solution of DNA extraction buffer (10 mM Tris-HCl, pH 7.6, 10 mM EDTA, 50 mM NaCl, 0.2% SDS, 20 ug / ml RNase A) to a 37 o C to the back of proteinase K for 10 minutes to be added to a 100 ug / ml was added in 8 hours at 50 o C. 이 반응액을 페놀/클로로포름으로 3회 추출하여 단백질을 제거한 후 에탄올 침전반응을 통하여 게놈성 DNA를 얻었다. The reaction solution was extracted three times with phenol / chloroform to remove the protein to obtain the genomic DNA by ethanol precipitation. 연어 정자 DNA도 상기와 같은 방법으로 추출하여 사용하였다. Salmon sperm DNA was also extracted using the same method as described above. DNA에 존재하는 LPS의 양은 Limulus amebocyte 용해물 검정[Sullivan, JD et al (1976) In Mechanisms in Bacterial Toxicology, AW Bernheimer, ed. Lysate test for the amount of LPS present in the DNA Limulus amebocyte [Sullivan, JD et al (1976) In Mechanisms in Bacterial Toxicology, AW Bernheimer, ed. Wiley, New York, p. Wiley, New York, p. 217] 방법에 의해 결정하여 2.5 ng/ml 이하임을 확인하였다.. 217] and determined by the method was confirmed that 2.5 ng / ml or less.

10% FBS를 함유한 배지와 FBS가 없는 배지에서 배양한 IM9 세포배양액에서의 효소활성을 비교하기 위하여 100 ng의 플라스미드 DNA에 배양액을 20 ul를 혼합한 후 37 o C에서 일정한 시간 간격으로 반응시켰다. After the culture solution in the 100 ng of plasmid DNA mixed with 20 ul 37 o C to compare the enzyme activity in 10% FBS by IM9 cell culture cultured in a medium without the medium with FBS containing reacted a specific time interval, . 이후의 세포배양액을 이용한 엔도뉴클레아제 활성 측정은 FBS에 존재하는 DNase I의 효과를 배제하기 위하여 FBS가 없는 배지에서 배양한 세포 배양액을 이용하였다. Endonuclease activity was measured using a cell culture medium subsequent to a cell culture incubated in FBS-free medium was used to exclude the effect of DNase I present in the FBS. 또한 DNA 종류에 대해 엔도뉴클레아제의 반응성이 차이 나는지를 관찰하기 위하여 대장균, IM9 세포주, 그리고 연어 정자 게놈성 DNA 100 ng에 대하여 위와 같은 조건에서 반응시켜 효소활성을 1% 아가로즈 겔 전기영동상에서 확인하였다. In addition, on the E. coli, IM9 cell line, and the salmon sperm genomic activity is reacted under the same conditions as described above with respect to the DNA 100 ng 1% agarose gel electrophoresis to observe naneunji reactivity endonuclease differences in DNA types confirmed.

일차로 10% FBS를 함유한 RPMI1640배지 및 IM9 세포배양액을 직접 취하여 각각 박테리아의 DNA를 분해시키는 정도를 생체외(in vitro) 반응으로 관찰하였다. Taking a RPMI1640 medium and IM9 cell culture medium containing 10% FBS to the ability of a primary directly decompose DNA in the bacteria was observed by ex vivo (in vitro) reaction, respectively. 도 18A의 결과에서는 10% FBS를 함유하는 RPMI1640배지에서 플라스미드 DNA의 분해 정도를 나타내고 있다. The results of Figure 18A shows the degree of decomposition of the plasmid DNA in a RPMI1640 medium containing 10% FBS. 이 결과는 도 1D에서 나타난 결과와 다르게 배지에 DNase I이 존재하는 데도 효소활성이 크게 나타나지 않음을 보여주었다. The results showed different results and also to FIG. 1D shown in the DNase I present in the culture medium it does not appear significant enzyme activity. 이는 배지의 조성이 DNase I활성에 영향을 줄 수 있는 이온이나 저해물질을 포함하는 것으로 생각할 수 있다. This can be thought of as comprising ions and inhibitors on the composition of the medium may affect the DNase I activity. 반면에 세포배양 후 FBS가 없는 배양액과 10% FBS 함유 배양액에서는 플라스미드 DNA가 반응시간에 따라 분해됨을 볼 수 있었다(도 18B 및 18C). On the other hand, in cell culture medium containing no FBS and the 10% FBS culture medium after the culture was able to see the decomposed according to the reaction time, the plasmid DNA (FIG. 18B and 18C). 즉, IM9 세포주에 의하여 분비된 엔도뉴클레아제에 의하여 플라스미드 DNA가 분해됨을 알 수 있는데, 도 18B 와 18C를 비교해보면 10% FBS를 함유한 배지에서의 세포 배양액에서 효소활성이 더 높게 나타남을 지적할 수 있다. That is, IM9 point to appear by the endonuclease secreted by the cell line The plasmid DNA that may know decomposed, more do Comparing 18B and 18C enzyme activity in the cell culture fluid in containing 10% FBS medium increased can do. 이는 세포수를 2 x 10 5 /ml로 동일하게 세포배양을 시작했어도 FBS를 함유한 조건에서 세포의 성장이 활발하게 일어나고 엔도뉴클레아제도 많이 분비됨을 알 수 있다. This may be the number of cells 2 x 10 5 / ml with the same happening to cells in culture, even if the starting conditions FBS containing actively growing cells secrete a lot to know that the endonuclease system. 또한 세포배양액에 존재하는 엔도뉴클레아제의 작용이 서로 다른 종의 DNA에 어떻게 작용하는지를 시험한 결과는 도 19에서 볼 수 있듯이 대장균 DNA, 진핵세포인 IM9 세포주 DNA, 그리고 연어 정자 DNA 모두를 엔도뉴클레아제가 분해하는 것으로 나타났다. In addition, as shown in results of 19 tested how acting on Endo of nuclease different functional species of DNA present in the cell culture medium of E. coli DNA, eukaryotic cells, IM9 cell line DNA, and all of salmon sperm DNA endo New I appeared to nuclease degradation.

3-2 박테리아 DNA의 세포내 유입 및 DNA 염기서열 분석 Intracellular influx and DNA Sequence Analysis of 3-2 bacterial DNA

열처리한 10% FBS를 함유한 RPMI1640 배지와 IM9 세포주를 48시간 배양한 세포배양액을 1:1로 혼합한 배지에서 IM9 세포주를 배양하였다. For containing a heat-treated 10% FBS RPMI1640 medium and the cell line IM9 48 hours incubation the cell culture 1: The IM9 cell line from a mixture of a first medium and cultured. 박테리아 DNA (25 ug/ml)를 준비한 배양액에 넣어주고 IM9 세포주를 1 x 10 6 /ml 의 세포수로 배양하면서 일정한 시간 간격으로 세포를 취하여 세포에 유입된 DNA를 추출하였다. To put the culture liquid prepared for bacterial DNA (25 ug / ml) were incubated with the cell line IM9 a number of 1 x 10 6 / ml cells take the cell to a constant time interval, extracting the DNA introduced into the cell.

박테리아 DNA를 IM9 세포주에 처리한 후 일정한 시간 간격으로 세포를 취하여 PBS로 3회 세척하였다. After treatment the bacterial DNA to IM9 cells were washed three times with PBS the cells taken at regular time intervals. 이 세포를 차가운 용해 완충용액(10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1 mM PMSF, 그리고 0.5% NP-40)에 재부유시킨 후 제조실시예 1-2의 방법에 따라서 세포 용해물을 얻었다. The cold cell lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1 mM PMSF, and 0.5% NP-40) was resuspended to the method of Preparation Example 1-2 Therefore, to obtain a cell lysate. 세포 용해물에 DNA 추출 완충용액을 동등한 부피로 첨가하여 42 o C에서 3시간 동안 방치한 후 페놀/클로로포름을 2회 처리하여 단백질을 제거시키고 에탄올로 침전시켜 세포 용해물에 존재하는 DNA를 추출하였다. After standing for a cell 3 hours and the DNA extraction buffer for lysates was added to an equivalent volume of 42 o C for treated twice with phenol / chloroform to remove the protein and extract the DNA was precipitated with ethanol present in the cell lysate . 침전물을 TE 완충용액으로 녹인 후 RNase A를 처리하여 써던 블롯팅(southern blotting)의 시료로 이용하였다. The precipitate was dissolved in TE buffer and RNase A was used to process the samples of the Southern blotting (southern blotting).

세포 용해물에서 추출한 DNA를 1.8% 아가로즈 겔에서 전기영동한 후 써던 이동을 실시하였다. After the DNA extracted from the cell lysate was electrophoresed in 1.8% agarose gel was subjected to Southern movement. 전기영동한 아가로즈 겔을 알칼리 용액(1.5 M NaCl, 0.5 M NaOH)200 ml정도에 20분 동안 흔들어 주고 증류수로 씻은 후, 중성화 용액(1.5 M NaCl, 0.5 M Tris-HCl, pH7.5)200 ml 정도에 20분 동안 방치한 후 다른 중성화 용액에 담그어 흔들어 주었다. An electrophoretic agarose gel by the alkaline solution (1.5 M NaCl, 0.5 M NaOH) to give after shaking for 20 minutes to about 200 ml, washed with distilled water, neutralization solution (1.5 M NaCl, 0.5 M Tris-HCl, pH7.5) 200 after standing for 20 minutes to approximately ml was immersed in and shake other neutralizing solution. 20X SSC 용액 (175.3 g의 NaCl, 88.2 g의 나트륨 시트레이트 그리고 0.5 M EDTA를 2 ml 넣고 증류수를 첨가하여 1 ℓ 되게한 후 121 o C에서 멸균하여 사용)이 담긴 용기에 또 다른 네모진 용기를 거꾸로 뒤집어 놓아 용액의 수면 위로 바닥이 올라와 있게 하였다. 20X SSC solution (175.3 g of NaCl, put into 2 ml of sodium citrate and 0.5 M EDTA of 88.2 g was added to distilled water to make 1 ℓ using sterilized at 121 o C) for another bounding rectangle container in a vessel containing was inverted upside down so released to the surface of the solution came up the floor. 그 바닥 위에 20X SSC로 포화된 폭이 2 mm 정도 큰 Whatman No.3 페이퍼를 공기방울이 없게 올려놓아 양쪽의 20X SSC를 연결시켰다. Placing that is saturated with 20X SSC width 2 mm above the bottom level greater Whatman No.3 paper to prevent air bubbles were connected to both ends of 20X SSC. 페이퍼위에 아가로즈 겔을 뒤집어 올려놓고, Hybond + 나일론 막을 공기방울이 생기지 않게 올려놓았다. Place upside down on a paper agarose gel, it was placed droplets Hybond + nylon membrane air does not occur. Hybond + 나일론 막위에 4변 모두가 아가로즈 겔보다 2 mm작은 Whatman No.3 페이퍼 3장을 공기방울이 생기지 않게 올려놓은 후, 종이타올을 그 위에 10-20 cm 높이로 쌓고 약 500g 정도의 무게를 위에 올려 놓았다. Hybond + nylon membrane over all four sides built a small 2 mm Whatman No.3 paper 3 than the agarose gel, 10-20 cm tall with a paper towel over it and then put up no air bubbles weight of about 500g It was placed on top. 파라필름을 겔 주변의 바닥을 두르고 모세관 이동을 8시간 동안 수행하였다. Wearing a floor around the Para film gel was carried out capillary move for eight hours. DNA가 이동된 막은 UV를 120,000 uJ/cm의 에너지로 2분 동안 쬐어 주어서 UV-가교시켰다. Giving the film a UV DNA moves broiling for 2 minutes of 120,000 uJ / cm of energy was UV- crosslinked.

박테리아 DNA를 엔도뉴클레아제로 37 o C에서 30분간 반응하여 생성된 100-200 bp의 반응 생성물을 1% 아가로즈 겔 전기영동 후에 진 클린 키트(Gene Clean Kit, Promega, Inc.)로 gel에서 DNA를 회수하여 DNA 탐침으로 이용하였다. From the gel to a clean kit (Gene Clean Kit, Promega, Inc. ) binary bacterial DNA of the reaction product of the 100-200 bp generated by 30 min at 37 o C zero endonuclease in 1% agarose gel electrophoresis of DNA It was used as the DNA probe was recovered. 이 DNA 50-100 ng을 100 o C 물에서 3분 동안 끓이고 급속히 얼음에 식혀 DNA 가닥을 분리시킨 후 32 P로 표지하였다. After the DNA is 50-100 ng boiled for 3 minutes at 100 o C water was rapidly separate the DNA strands to cool on ice was labeled with 32 P. DNA 표지 반응은 랜덤 프라이머 10 ng, 4 ul의 완충용액(50 mM Tris-HCl, pH8.0, 5 mM MgCl 2 , 2 mM DTT, 0.5 mM HEPES, pH 6.6), 25 uM dATP, 25 uM dGTP, 25 uM dTTP, 60 uCi [α- 32 P] dCTP, 그리고 클레노우 효소 5 unit를 넣은 혼합액 20 ul를 37 o C에서 2 시간동안 반응시키는 랜덤 프라이밍 방법을 이용하였다. DNA labeling reaction was 10 ng random primers, buffer solution 4 ul (50 mM Tris-HCl , pH8.0, 5 mM MgCl 2, 2 mM DTT, 0.5 mM HEPES, pH 6.6), 25 uM dATP, 25 uM dGTP, 25 uM dTTP, 60 uCi [α- 32 P] dCTP was used, and the random priming method of the reaction for 2 hours, the mixture 20 ul into the Klenow enzyme 5 unit at 37 o C. 여기에 0.5 M EDTA 2 ul를 넣어 반응을 정지시킨 다음 같은 부피의 3 M 아세트산 나트륨 (pH 5.2), 보조첨가제로 20 ug의 연어 정자 DNA를 넣고 2배 부피의 에탄올을 첨가하여 침전시켰다. Here a 0.5 M EDTA to stop the reaction was put in a 2 ul and then insert the same volume of 3 M sodium acetate (pH 5.2), 20 ug of salmon sperm DNA as a secondary additive for precipitated by addition of ethanol of two times by volume. 이 침전물을 TE 완충용액으로 녹인 후 100 o C에서 끓이고 얼음속에서 급속히 냉각시켰다. The precipitates from 100 o C was dissolved in TE buffer was boiled rapidly cooled on ice.

UV-가교시킨 Hybond + 나일론 막을 68 o C로 미리 중탕시킨 예비하이브리드화 용액(6X SSC, 5X Denhardt's 용액, 0.05% 피로인산나트륨, 0.5% SDS, 그리고 100 ug/ml의 연어 정자 DNA)에 넣고 68 o C에서 최소한 1시간 이상 흔들어 주었다. UV- crosslinking was Hybond + nylon membrane was placed in a 68 o pre-bath was pre-hybrid with Chemistry solution C (6X SSC, 5X Denhardt's solution, 0.05% sodium pyrophosphate, 0.5% SDS, and 100 ug / ml of salmon sperm DNA) 68 in o C was shaken for at least 1 hour. 그 후 얼음에서 식힌 랜덤 프라이밍 방법에 의해 준비된 표지된 탐침을 넣고 12시간 정도 하이브리드화시켰다. Then put the labeled probes prepared by the random priming method and cooled in ice was hybridized to approximately 12 hours. 이 필터를 세척용액 I (2X SSC, 0.1% SDS)에 옮긴 다음 상온에서 10분 정도 씻어주었다. Moving the filter to a washing solution I (2X SSC, 0.1% SDS) and then washed for 10 minutes at room temperature. 68 o C에서 미리 중탕시킨 세척용액 I로 필터를 옮겨 25분 정도 흔들면서 씻어주고, 역시 68 o C에서 미리 중탕시킨 세척용액 II(0.2X SSC, 0.1% SDS)로 옮겨 Geiger 계수기로 측정하여 방사능이 감지되는 정도를 측정하면서 씻어 주었다. 68 o moving the cleaning solution to the filter I which in the pre-bath C and washed shaking 25 minutes, also having pre-washing bath 68 o C in a solution II (0.2X SSC, 0.1% SDS ) to move as measured by Geiger counter radioactivity It washed, measuring the extent to which they are detected. 이 필터를 X-선 필름과 함께 intensifying screen이 포함되어 있는 카세트에 넣고 -70 o C에서 12-24 시간 방치한 다음 현상하였다. This filter with the X- ray film into a cassette that contains the intensifying screen was allowed to stand for 12-24 hours at -70 o C were the following symptoms:

박테리아 DNA 또는 플라스미드 DNA를 세포 배양시 넣어 주고서 1시간 동안 37 o C 에서 배양한 후 세포 용해물에 존재하는 DNA 조각을 1.8% 아가로즈 겔 전기영동 후, 써던 이동에 의해서 확인된 50-200 bp위치에 해당하는 겔을 진 클린 키트(Promega Inc.)로 회수하였다. After bacterial DNA or plasmid DNA to a cell culture upon giving up and incubated for one hour at 37 o C the DNA fragment present in the cell lysate by 1.8% agarose gel electrophoresis into gel, a 50-200 bp confirmed by Southern movement Jin the gel corresponding to the position to recover a clean kit (Promega Inc.). 이 DNA조각들을 도 21에서와 같은 방법으로 pGEM-T 벡터 (Promega Inc.)에 넣어 대장균에서 클로닝하여 Sanger의 디데옥시리보뉴클레오타이드 쇄 종결방법[Sanger, F. et al (1977) Proc. The same way as in Figure 21, the DNA fragment pGEM-T vector put in (Promega Inc.) and cloned in E. coli terminator dideoxy chain of ribonucleotide Sanger method [Sanger, F. et al (1977 ) Proc. Natl. Natl. Acad. Acad. Sci. Sci. USA 74, 5463-5467]을 시퀘나제(Sequenase) TM 버전 2.0 DNA 서열분석 키트(USB)를 사용하여 염기서열을 확인하였다. USA 74, 5463-5467] to sikwe the nucleotide sequence was confirmed by using xylanase (Sequenase) TM Version 2.0 DNA sequencing kit (USB). 서열분석 프라이머는 하기 표 1에 나타낸 M13 전방/역전 프라이머를 이용하였다. Sequencing primers were used for M13 forward / reverse primers shown in Table 1 below. 클로닝된 DNA 서열을 BLAST (Basic Local Alignment Search Tools) 프로그램을 이용하여 박테리아 또는 플라스미드 DNA의 잘려진 조각임을 확인하였다. The DNA sequences were cloned using the BLAST (Basic Local Alignment Search Tools) program to confirm that bacteria or a truncated fragment of the plasmid DNA.

올리고뉴클레오타이드 Oligonucleotide 이용 Use
ABCDEFGH ABCDEFGH TTAAAACGTTCACAAGTGAACGTTTTAGCAGCGCTAAAATTAGCGCTGCTCCCGGCCGCCATGTTGGGAGCTCTCCCGTTTTCCCAGTCACGACCAGGAAACAGCTATGAC TTAAAACGTTCACAAGTGAACGTTTTAGCAGCGCTAAAATTAGCGCTGCTCCCGGCCGCCATGTTGGGAGCTCTCCCGTTTTCCCAGTCACGACCAGGAAACAGCTATGAC CpG motifCpG motifCpG motifCpG motifPCR 프라이머PCR 프라이머서열분석(pUC/M13 전방)서열분석(pUC/M13 역전) CpG motifCpG motifCpG motifCpG motifPCR primer PCR primer sequence analysis (pUC / M13 forward) sequencing (pUC / M13 reverse)

시험결과 25 ug/ml의 박테리아 DNA와 함께 IM9 세포를 배양했을 때, 세포 배양액에서 DNA가 적절하게 프로세싱되어 세포내로 유입됨을 써던 하이브리드화를 통하여 확인하였다(도 20). IM9 cells when cultured with the bacterial DNA of the test results 25 ug / ml, the DNA was confirmed by the processing that is properly introduced into the cells in the cell culture Southern hybridization (Fig. 20). 세포배양 30분 후부터 100-200 bp의 DNA 유입을 관찰하였으며 배양 시간에 따라 세포내에서 100-200 bp의 DNA의 양이 감소함을 볼 수 있었다. 30 minutes after the cell culture was observed in the 100-200 bp DNA inlet could see that the decrease in the amount of 100-200 bp of DNA in the cell according to the incubation time. 이 결과로부터 IM9 세포주는 외부에서 적절하게 프로세싱시킨 DNA를 세포내로 유입하게 되며 세포내에서 프로세싱을 지속적으로 진행함을 암시한다. IM9 cell line from this result is that the DNA introduced was properly processed from the outside into the cells suggesting that the continuous process proceeds to the processing in the cell.

또한 엔도뉴클레아제 효소활성에 의한 생성물의 특성을 규명하기 위하여 세포내에 유입된 박테리아의 DNA를 추출하여 도 21에 설명된 방법으로 DNA 염기서열을 분석하였다. Also it analyzed the DNA base sequence by the methods described in Figure 21 to extract the DNA of the bacteria introduced into the cells in order to investigate the properties of the product according to the endonuclease activity. 염기서열 분석 결과는 하기 표 2에 제시된 바와 같이 특징적인 염기서열로 5' 쪽에 두개의 퓨린 염기와 3' 쪽에 두개의 피리미딘 염기가 존재하는 CpG motif가 엔도뉴클레아제 반응 생성물에 나타난 것을 볼 수 있다. Sequencing results to the CpG motif of the two pyrimidine bases with a characteristic base sequence as shown in Table 2 on the side, the two purine bases, and page 3, 5 there can be seen that shown in the endonuclease reaction product have. 특징적인 CpG motif는 면역체계에서 B 세포 또는 대식세포를 활성화시켜 사이토카인과 IgM 분비를 촉진시키는 것으로 알려져 있으며 박테리아 DNA에 높은 빈도로 나타나는 것으로 알려져 있다. Characteristic CpG motif is to activate the B cells or macrophages in the immune system known to promote cytokine secretion and IgM are known to appear at a high frequency in bacterial DNA. 이 결과로부터 IM9 세포배양액의 엔도뉴클레아제 및 세포내에서의 효소활성에 의한 DNA 프로세싱이 면역세포를 활성화시키는 역할을 수행하는 CpG motif를 생성한다는 새로운 사실을 밝혀내었다. This result has been found a new fact that the DNA processing by the enzymatic activity of the endonuclease in the cell and the IM9 cell cultures produce a CpG motif that will serve to activate the immune cell.

상기 표 2에서 각 서열의 기원은 다음과 같다: The origin of each sequence in the above Table 2 is as follows:

EC1-완전한 게놈의 이.콜라이 염기 2874223 내지 2885223(5416-5614) EC1- the complete genome E. coli bases 2874223 to 2885223 (5416-5614)

EC2-완전한 게놈의 이.콜라이 염기 4067762 내지 4083201(4741-4852) EC2- the complete genome E. coli bases 4067762 to 4083201 (4741-4852)

EC3-완전한 게놈의 이.콜라이 염기 2244905 내지 2255428(2027-2108) EC3- of the complete genome of E. coli bases 2244905 to 2255428 (2027-2108)

EC4-완전한 게놈의 이.콜라이 염기 2244905 내지 2255428(2064-2109) EC4- of the complete genome of E. coli bases 2244905 to 2255428 (2064-2109)

EC5-이.콜라이 플라스미드 합성 클로닝 벡터 pET31F(258 376) EC5- E. coli plasmid cloning vector synthesis pET31F (258 376)

EC6-이.콜라이로부터의 플라스미드 pKF3(2004-2066) Plasmid pKF3 EC6- from E. coli (2004-2066)

EC7-클로닝 벡터 pGEM-5Zf(-)(75-170) EC7- cloning vector pGEM-5Zf (-) (75-170)

EC8-미국특허 제4921698호의 서열 EC8- U.S. Patent sequence of No. 4,921,698

PD1-pGEM-T 벡터(401-519) PD1-pGEM-T vector (401-519)

PD2-pGEM-T 벡터(1130-1306) PD2-pGEM-T vector (1130-1306)

PD3-pGEM-T 벡터(2513-2610) PD3-pGEM-T vector (2513-2610)

PD4-pGEM-T 벡터(1685-1795) PD4-pGEM-T vector (1685-1795)

EC9-완전한 게놈의 이.콜라이 염기 220025 내지 231029(829-872) EC9- the complete genome E. coli base 220 025 to 231 029 (829-872)

HC1-호모 사피엔스 새텔라이트 2 반복 요소 DNA HC1- Homo sapiens saetel light element DNA repeat 2

3-3 세포내에 유입된 DNA의 프로세싱 확인 Check processing of the DNA introduced into the cell 3-3

세포내로 프로세싱되어 유입된 50-200 bp의 클로닝된 DNA조각이 세포내에서 프로세싱이 얼마나 더 진행되는지와 DNA 염기서열의 종류에 따라 세포에 미치는 영향을 확인하기 위하여 PCR 증폭을 수행하였다. The cloned DNA fragment in the cell and processed into the inlet 50-200 bp The PCR amplification was carried out to determine the effect on cells according to the type of processing and that is how much more progress of DNA sequences in the cell. PCR 반응액은 0.2 mM dNTP, 각각 10 pmole의 프라이머, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , 그리고 2.5 units의 Taq 폴리머라제를 포함하고 있다. PCR reaction solution includes a 0.2 mM dNTP, 10 pmole each primer, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2, and 2.5 units of Taq polymerase. PCR 프라이머로는 5'-CTCCCGGCCGCCATG-3' 및 5'-TTGGGAGCTCTCC-3' (표 1)을 합성하여 이용하였다. A PCR primer was used to synthesize the 5'-CTCCCGGCCGCCATG-3 'and 5'-TTGGGAGCTCTCC-3' (Table 1). PCR반응은 다음과 같은 조건에서 35회 반복하였다: 변성(30초간 94 o C); PCR reactions were repeated 35 times under the following conditions: denaturation (30 seconds 94 o C); 프라이머 어닐링(30초간 42 o C); Primer annealing (30 seconds 42 o C); 프라이머 연장(50초간 72 o C). Primer extension (50 seconds 72 o C). PCR 생성물은 TBE 완충용액에서 8% 천연-PAGE를 수행한 후 에티듐 브로마이드로 염색한 후 PCR반응 생성물을 겔에서 DNA를 추출하였다. PCR product DNA was extracted for PCR reaction product was then stained with ethidium bromide was carried out for 8% -PAGE natural in TBE buffer gel. 추출한 DNA를 엔탄올로 침전시킨 후 세포 배양에 이용하기 위해서는 PBS로 녹였고 엔도뉴클레아제의 활성을 측정하기 위해서는 TE 완충용액에 녹였다. In order to use the cell culture after precipitation with ethanol the extracted DNA yen was dissolved in PBS to determine the activity of the endonuclease was dissolved in TE buffer solution.

엔도뉴클레아제의 작용에 의해 절단된 100-200bp의 박테리아 DNA를 클로닝한 벡터에서 PCR 증폭하여 획득한 생성물이 세포내에 유입되어 최종 산물이 어떠한 형태로 존재하는지 확인하기 위하여 PCR 생성물인 EC1, EC2, 그리고 HC1 DNA 조각을 랜덤 프라이머와 클레노우 효소를 이용한 랜덤-프라이밍 방법으로 DNA를 32 P로 표지하였다. PCR product, EC1, EC2 in order to ensure that the product obtained by PCR amplification from a cloned bacterial DNA of 100-200bp cut by the action vector is introduced into the cell is the final product present in any form of the endonuclease, HC1 and the random DNA fragment using random primers and Klenow enzyme the DNA was labeled with 32 P as a priming method. 32 P로 표지된 DNA조각을 IM9 세포주와 U937 세포주 그리고 TPA를 처리한 U937 세포주에 100 ng/ml로 넣고, 일정한 시간 간격으로 DNA가 세포에 유입되는지를 확인하였다. Into a DNA fragment labeled with 32 P to 100 ng / ml to IM9 cell line U937 and U937 cell lines treated with the cell line and TPA, it was confirmed that the DNA is introduced into the cell at regular time intervals. 세포내에서 엔도뉴클레아제의 효소활성을 저해시키기 위해서는 0.2 mM ZnSO 4 (Sigma)를 처리하였다. In order to inhibit the enzymatic activity of the endo-nuclease in the cell it was treated with 0.2 mM ZnSO 4 (Sigma). 세포내로 유입된 DNA는 세포 용해물에서 다시 DNA를 회수한 다음 TBE 완충용액에서 20% 천연-PAGE를 수행하고 겔을 말려서 방사선 사진 촬영(autoradiography)을 수행하여 세포내에서 DNA가 프로세싱되는 과정과 엔도뉴클레아제 작용에 의한 최종 반응산물을 확인하였다. The DNA introduced into the cells, cells were again recovered DNA from melt by performing the following process in 20% of natural -PAGE TBE buffer solution and the gel dried perform radiographs (autoradiography) DNA that is processed in a cell and for the endo nuclease was confirmed that the final reaction product according to the action.

32 P로 표지된 EC1 DNA 조각을 IM9 세포주에 유입시킨 후 세포에 유입된 DNA를 세포 용해물에서 추출하여 20% 천연-PAGE를 수행한 후, 프로세싱된 32 P로 표지된 DNA를 겔에서 추출하여 표 1에 나타난 합성한 여러 종류의 올리고뉴클레오타이드들과 어닐링시켜 염기서열을 비교하였다. After entering the EC1 DNA fragment labeled with 32 P to IM9 cell line after extracting the DNA introduced into the cells in the cell lysate by performing a 20% natural -PAGE, extracts labeled with 32 P The processed DNA in the gel by annealing the various types of oligonucleotide synthesis in which as shown in Table 1 it was compared to the nucleotide sequence. 세포내에서 추출한 32 P로 표지된 DNA 일정량과 각각의 올리고뉴클레오타이드 10 ng을 6X SSC에서 혼합한 다음 100 o C에서 5분간 끓인 후 온도를 30초에 1 o C씩 Tm 이하로 낮추어 어닐링시켰다. Cells raised the extracted within a 32 P-labeled DNA in a fixed amount and each mixed with 10 ng oligonucleotide in 6X SSC, then was annealed at 100 o C by lowering the temperature below the Tm by 30 sec 1 o C and then boiled for 5 minutes. 어닐링시킨 반응물을 TBE 완충용액에서 20% 천연-PAGE를 4 o C에서 수행한 후 방사선 촬영을 통해서 세포내에 유입된 DNA와 상보적으로 결합하는 올리고뉴클레오타이드를 확인하였다. Oligonucleotide was annealed to combine the reactants to 20% natural -PAGE in TBE buffer solution in a 4 o DNA and complementary flows into the cells after performing the C through the radiographic ever confirmed the nucleotide. 표준으로는 DNA와 올리고뉴클레오타이드를 어닐링시키지 않은 혼합물과 세포내에 유입된 DNA 단독으로 변성, 어닐링시킨 DNA를 이용하였다. Standards was used as the DNA and the oligonucleotide-modified, was annealed DNA with the DNA alone did not flow into the annealed oligonucleotide mixture and cells. 합성한 올리고뉴클레오타이드들의 염기서열들은 EC1 DNA조각에 존재하는 올리고 A, B 와 EC1 DNA에 존재하지 않는 올리고 C, D, E를 이용하였다(표 1). Oligonucleotide synthesized nucleotide sequence of the nucleotides are oligonucleotides present in the DNA fragment EC1 is not present in A, B and EC1 DNA was used for C, D, E (Table 1).

사람의 B-림프아 IM9 세포주 와 골수발생 U937 세포주 그리고 TPA를 처리하여 분화가 유도된 U937 세포주에 의한 외부 DNA의 유입 및 세포주내에서의 프로세싱을 확인하였다. Oh the human IM9 cell line B- lymphoid and myeloid cell lines U937 and the generation process by TPA was confirmed that the processing of the DNA in the external inlet and the cell line by the U937 cell line differentiated induced. 실험 결과, 앞에서 염기서열을 밝힌 100-200 bp를 PCR 증폭하여 32 P로 표지시킨 박테리아 DNA 조각으로 확인할 수 있었다. Experimental results, amplifies the 100-200 bp revealed the nucleotide sequence in front of PCR it was confirmed that the bacterial DNA fragment labeled with 32 P. IM9 세포주에서 외부 DNA 유입 및 세포내에서 프로세싱은 도 22의 결과에 나타난 바와 같다. In IM9 cell line DNA in the external inlet and the processing cell is as shown in the results of Figure 22. 157 bp(EC1)의 DNA 조각이 4 o C에서는 세포내로 유입되지는 않고 세포막에 결합되어 있음을 알 수 있고, 37 o C에서의 배양 시간에 따라 세포내에서 프로세싱이 일어나며 24시간 후에는 20% 천연-PAGE 상에서 약 10 bp의 DNA 조각이 최종산물로 생성됨을 알 수 있었다. The 157 bp (EC1) of the DNA fragment 4 o C it can be seen that it is coupled to a cell membrane without has been introduced into the cell, it occurs that processing in the cell according to the incubation time at 37 o C 24 hours after 20% DNA fragments of about 10 bp on the natural -PAGE could see the edited into the final product. 10 bp로 판단되었던 이 DNA 조각은 이후의 실험에서 일본쇄 구조인 것으로 밝혀졌으며 20% 변성-PAGE (8.3 M urea)에서도 일본쇄 DNA임을 확인할 수 있었다. This DNA fragment was determined to be 10 bp could been found to be stranded structure in the subsequent experiments confirm that stranded DNA in 20% modified -PAGE (8.3 M urea). U937 세포주와 TPA 처리로 분화된 U937 세포주에서 관찰한 외부 DNA 유입 및 세포내에서의 프로세싱은 도 23에서와 같다. Processing in the foreign DNA within the inlet and the cells observed in the U937 cell line with differentiated U937 cells and TPA treated the same as in Fig. TPA를 처리하지 않은 U937세포주에서는 도 23A의 결과로 외부 DNA가 세포에 결합하거나 또는 유입은 되지만 전혀 프로세싱이 일어나지 않음을 알 수 있었다. The not treated with TPA U937 cell line is outside the DNA binding to the cell as a result of the Figure 23A, or the inlet is at all, but was found processing is not occur. 그러나 도 23의 B에서는 TPA를 처리하여 분화된 U937세포주에 의하여 외부 DNA의 유입과 세포내 프로세싱을 확인할 수 있었다. However, in B of FIG. 23 could be by the U937 cell line differentiated by treatment with TPA to determine the inlet and intracellular processing of external DNA. 한편, 도 23의 B에서 볼 수 있는 바와 같이 0.2 mM Zn 2+ 에 의해 세포내에서 DNA 프로세싱이 저해 받았음을 알 수 있었다. On the other hand, it was found to inhibit DNA processing is received in the cells by 0.2 mM Zn 2+, as can be seen in the Figure 23 B.

지금까지의 실험 결과에서 면역세포가 외부의 DNA를 프로세싱하여 10개 염기의 최종 반응산물을 생성하는 것으로 밝힌데 이어 이 DNA 조각의 염기서열 특성을 확인하였다. In the experiment result up to now, the immune cells to the processing of the foreign DNA after having said to be generating a final reaction products of 10 bases was confirmed that the nucleotide sequence characteristic of the DNA fragment. PCR반응에 의해 증폭된 EC1 DNA 생성물을 32 P로 표지하여 세포내로 유입시킨 후, 세포내 엔도뉴클레아제에 의해 프로세싱된 10개 염기의 DNA 조각을 EC1의 부분 서열과 일치하는 여러 종류의 합성 올리고뉴클레오타이드들과 어닐링시켜 상보적으로 결합되는 염기서열을 확인할 수 있었다(도 24). Was introduced into the cell to cover the EC1 DNA product amplified by PCR reaction with 32 P, cells the DNA fragment of 10 base processing by the in-endonuclease oligonucleotide synthesis several types of matching the partial sequence of the EC1 was annealed with the oligonucleotide was confirmed by nucleotide sequence combined with the complementary (Fig. 24). 어닐링 결과 가장 많이 상보적으로 결합한 올리고뉴클레오타이드는 표 1의 Oligo A로서 EC1 DNA에 존재하는 염기서열이며 AACGTT motif를 가진 서열이었다. Annealing results oligonucleotide bound most complementary nucleotide base sequence was a sequence with the motif AACGTT present in EC1 Oligo A DNA as shown in Table 1. 이 결과로 부터 엔도뉴클레아제의 효소활성에 의해 세포 내부에서 면역세포를 활성화시키는 박테리아 DNA의 염기서열로 알려진 CpG motif가 생성되었다는 사실을 구체적으로 확인하였다. As a result of the fact that a CpG motif known as the base sequence of the bacterial DNA that activates immune cells generated from the inner cell by the enzymatic activity of the endonuclease was specifically confirmed from.

3-4 박테리아 DNA에 의한 IM9 세포주의 IgM분비 확인 Check IgM secretion of IM9 cell line by 3-4 bacterial DNA

B 세포를 활성화시켜 사이토카인들과 IgM을 분비시키는 것으로 알려진 CpG motif를 가진 올리고뉴클레오타이드들을 합성하였다. Activated B cells by oligonucleotides having CpG motif are known to secrete cytokines and IgM were synthesized oligonucleotide. 엔도뉴클레아제 작용에 의해 생성된 DNA 조각중 EC1에 존재하는 올리고 A, EC2에 존재하는 올리고 B 그리고 CpG motif가 없는 올리고 E를 합성하였다(표 1). Oligonucleotide to oligonucleotide present in the DNA of the fragment generated by endonuclease action EC1 present in A, B and EC2 oligonucleotide without a CpG motif was synthesized by E (Table 1). 또한 CpG motif를 여러 개 함유하고 있는 EC1, EC2 PCR 생성물 그리고 여러 종류의 DNA를 실험에 이용하였다. Further it was used the EC1, EC2 PCR product and different types of DNA containing multiple CpG motif in the experiment. CpG motif를 메틸화시키기 위해서 박테리아 DNA를 엔도뉴클레아제로 처리하여 얻은 100-200 bp 조각을 준비하였다. The bacterial DNA was prepared for 100-200 bp pieces obtained treated with endonuclease in order to methylation of a CpG motif. 메틸화 반응은 30 ug의 DNA를 15 unit의 CpG 메틸라제와 160 uM S-아데노실메티오닌이 함유된 완충용액(10 mM Tris-HCl, pH 7.9, 10 mM MgCl 2 , 50 mM NaCl, 그리고 1 mM DTT)을 혼합하여 37 o C에서 3시간 동안 반응시켰다. The methylation reaction is a 30 ug DNA containing methyl CpG unit 15 cyclase with 160 uM S- adenosyl-methionine in a buffer solution (10 mM Tris-HCl, pH 7.9, 10 mM MgCl 2, 50 mM NaCl, and 1 mM DTT ) were mixed and reacted for 3 hours at 37 o C. CpG 메틸화는 Hpa II를 처리하여 확인하였다. CpG methylation was confirmed by Hpa II process.

사람의 B-림프아 세포주인 IM9 세포주를 10% FBS를 함유한 RPMI 1640 배지에서 배양 초기에 세포수를 2 x 10 5 /ml로 하였으며, 미리 확보된 여러 종류의 올리고뉴클레오타이드와 DNA를 25 ug/ml로 처리하고 24시간 배양 후 세포배양액을 획득하였다. It was the the B- lymphoblastic cell line IM9 cell line of the person in the initial culture in RPMI 1640 medium containing 10% FBS to the cell number 2 x 10 5 / ml, 25 ug several types of DNA oligonucleotides with the pre-gain / ml and treated with the cell culture medium was obtained after 24 hour incubation.

평저 평판을 0.1 M 카보네이트 완충용액(pH 9.6)에 있는 안티-사람μ-쇄-특이적 IgM (5 ug/ml, Sigma)을 100 ul/웰로 4 o C에서 16시간 동안 방치하였다. From μ- chain - the plate pyeongjeo 0.1 M carbonate buffer solution in the anti (pH 9.6) of specific IgM (5 ug / ml, Sigma ) was allowed to stand at 100 ul / well of 4 o C for 16 hours. 이 평판을 PBS로 3회 세척한 다음 1% BSA로 실온에서 2시간 동안 방치하고 TPBS (0.05% Tween-20 in PBS)로 3회 세척하였다. Washed three times with PBS, the plate was allowed to stand for 2 hours at room temperature and then in 1% BSA and washed three times with TPBS (0.05% Tween-20 in PBS). 적당히 희석한 세포배양액 또는 정제한 사람의 IgM (Sigma)을 100 ul/well씩 넣어주고 실온에서 2시간 동안 방치한 후 TPBS로 3회 세척하였다. The IgM (Sigma) of appropriately diluted cell culture medium or a purified human washed three times with TPBS and then allowed to stand at room temperature for 2 hours to put each 100 ul / well. 여기에 1% BSA를 함유한 PBS에 1/4,000로 희석한 고추냉이 퍼옥시다제-연결된 안티-사람 Ig를 1시간 동안 실온에서 방치한 후 TPBS로 세척하였다. Here 1% BSA in PBS by 1 / a horseradish peroxidase was diluted with 4000 containing a multi-drug-linked anti-human Ig was allowed to stand at room temperature for 1 hour and washed with TPBS. 여기에 0.05 M 포스페이트 완충용액(pH 5.0)에 녹아 있는 o -페닐렌디아민 디하이드로클로라이드를 30분 동안 처리하여 발색시켰다. Here in 0.05 M phosphate buffer solution, dissolved in o (pH 5.0) - a-phenylenediamine dihydrochloride, it was treated for 30 minutes color development. 발색반응을 0.67 NH 2 SO 4 를 처리하여 멈추고 마이크로플레이트 판독기를 이용하여 IgM을 정량하였다. The color reaction stopped by treating 0.67 NH 2 SO 4 was assayed for IgM by using a microplate reader.

합성한 올리고뉴클레오타이드들로 IM9 세포주를 처리하여 48시간 후에 분비된 IgM의 양을 측정하였을 때, CpG motif를 가진 올리고 A 와 올리고 C에서는 2-3 ng/ml로 분비되는 것을 확인할 수 있었으나, CpG motif가 없는 올리고 E에 의해서는 0.5 ng/ml로 합성된 것을 확인할 수 있었다(도 25). When processes the IM9 cell line oligonucleotide synthesized with nucleotides measured the amount of the secreted IgM in 48 hours, the oligonucleotides and oligonucleotide A with a CpG motif C were able to see that the secretion of 2-3 ng / ml, CpG motif the oligonucleotide was confirmed that the synthesized with 0.5 ng / ml by the E-free (Fig. 25). 또한 박테리아 DNA와 CpG motif를 여러 개 가진 박테리아 DNA의 PCR 생성물(Table 1. EC1, EC2 DNA)들에 의해서도 2-3 ng/ml로 IgM을 분비하였으나, 박테리아 DNA의 CpG motif를 메틸화한 다음 세포주 배양액에 처리하였을 경우에는 IgM의 분비가 일어나지 않음을 관찰하였다(도 25). In addition, although the secretion of IgM to 2-3 ng / ml even by the PCR product of bacterial DNA with multiple bacterial DNA with CpG motif (Table 1. EC1, EC2 DNA), methylation of the CpG motif of bacterial DNA following the cell line culture medium If after treatment there was observed in the secretion of IgM not occur (Fig. 25). 박테리아의 DNA와 비교하여 연어정자 DNA에 의해서도 IgM의 분비는 증가되지 않았다. IgM secretion was not increased even by comparison with the DNA of bacteria in salmon sperm DNA. 이상의 결과로부터 박테리아 DNA의 CpG motif가 IM9 세포주를 활성화시켜 IgM의 분비를 증가시켰다는 사실을 확인하였고, 이전의 여러 연구자들이 합성한 CpG motif를 사용하여 밝힌 연구 결과들과 일치하였다. From the above results to the CpG motif of bacterial DNA activates the IM9 cell line was confirmed that sikyeotdaneun increases the secretion of IgM, it was consistent with the results announced by many researchers previously have used a synthetic CpG motif.

3-5 외부 DNA 프로세싱에 관여하는 엔도뉴클레아제 효소활성의 특성 3-5 endonuclease characteristics of the enzyme activity involved in the external processing DNA

PCR로 증폭된 EC1, EC2, HC1 DNA를 랜덤 프라이머와 클레노우 효소를 이용한 랜덤-프라이밍방법에 의하여 32 P로 표지하였다. The EC1, EC2, HC1 DNA amplified by PCR using random primers and Klenow enzyme to random-priming, by way was labeled with 32 P. 또한 더 짧은 DNA를 얻기 위하여 EC2 DNA를 Alu I으로(Promega Inc) 처리하여 조각내어 5'-말단을 32 P로 표지하여 기질로 이용하였다. In addition to taking more Alu I DNA the EC2 to obtain a short DNA (Promega Inc) was treated piece was used for the 5'-end as the substrate 32 and labeled with P. 엔도뉴클레아제의 효소활성의 특성을 연구하기 위하여 EC1 DNA를 5'-말단 표지 또는 3'-말단 표지하여 이용하였다. EC1 the DNA in order to study the nature of the endonuclease activity of the enzyme was used in the 5'-end or 3'-end labeled cover. 5'-말단 표지는 10 ng EC1 DNA, [γ- 32 P] ATP 50 uCi, 키나제 완충용액 그리고 5 unit의 폴리뉴클레오타이드 키나제 (Promega Inc.)를 섞고 37 o C에서 1시간 반응시켜 수행하였다. 5'-end cover 10 ng EC1 DNA, [γ- 32 P] ATP 50 uCi, kinase buffer solution and mixing the polynucleotide kinase (Promega Inc.) in 5 unit was performed by 1 h at 37 o C. 3'-말단 표지는 10 ng EC1 DNA, [α- 32 P] CTP 50 uCi, TdT 완충용액 그리고 5 unit의 터미널 데옥시트랜스퍼라제(Boehringer mannheim)를 혼합하여 37 o C에서 1시간 동안 반응시켜 기질로 이용하였다. 3'-end cover 10 ng EC1 DNA, [α- 32 P] CTP 50 uCi, TdT buffer solution and reacted for 1 hour at 37 o C a mixture of the terminal deoxy transferase (Boehringer mannheim) of the substrate unit 5 It was used to.

위에서 준비한 랜덤-프라이밍 방법으로 표지한 5 ng의 EC1, EC2, HC1 DNA 그리고 Alu I으로 처리하고 5'-말단 표지한 EC2 DNA를 20 ul의 FBS가 없는 IM9 세포배양액과 혼합하여 37 o C에서 일정한 시간 간격으로 반응시켰다. Prepared above random - EC1 of 5 ng labeled with a priming method, EC2, HC1 and the DNA treated with Alu I and the 5'-end-labeled by mixing with IM9 cell culture a DNA-free EC2 of 20 ul FBS constant at 37 o C and it reacted in a time interval. 또한 세포배양액의 양을 증가시켜서도 효소활성을 측정하였다. In addition, to measure the enzyme activity is also increased by the amount of the cell culture. 이 반응액을 페놀/클로로포름으로 처리하여 단백질을 제거하고 차가운 에탄올로 침전시켜 TBE 완충용액에서 20% 천연-PAGE와 20% 변성-PAGE (8.3 M 우레아)로 전기이동 시키고 겔을 건조시킨 후 방사선 사진 촬영을 해서 효소활성에 대한 반응산물을 분석하였다. After the reaction solution was treated with phenol / chloroform to remove proteins, and moving cold ethanol to precipitate an electrically by 20% and 20% modified natural -PAGE -PAGE (8.3 M urea) in TBE buffer solution, the gel was dried radiographs by recording the reaction products were analyzed for enzyme activity. FBS에 존재하는 DNase I의 효소활성과도 비교하기 위하여 10% FBS가 포함된 RPMI1640 배지 20 ml 와 여러 기질들과도 반응시켰다. The enzymatic activity of DNase I present in FBS and also with RPMI1640 medium was 20 ml and the number of substrates containing 10% FBS and also response to the comparison. 또한 엔도뉴클레아제의 저해물질인 Zn 2+ (1 mM) 과 킬레이트화제인 EDTA (10 mM)이 효소활성에 어떠한 영향을 미치는지 확인하였다. In addition, it was confirmed how the impact on inhibition of Zn 2+ (1 mM) and the chelating agent in the enzyme activity EDTA (10 mM) of the endonuclease. 이때 분자량의 표준 물질로는 브로모페놀 블루(BPB)와 크실렌 사이놀(XC)을 이용하였다. The molecular weight of a standard substance was used as a between the bromophenol blue (BPB) and xylene play (XC). 변성-PAGE에서 BPB는 8개 염기에 위치하고 XC는 28개 염기에 위치하며, 천연-PAGE에서는 각각 12 bp 와 45 bp에 위치하였다. In the modified -PAGE BPB is located in the eight base XC is located in the base 28, in the natural -PAGE was located at 12 bp and 45 bp, respectively.

엔도뉴클레아제 효소활성의 특성 및 최종 반응생성물의 특성을 연구하기 위하여 표 2에 제시된 EC1 과 EC2 그리고 HC1 DNA를 랜덤-프라이밍 방법을 이용하여 32 P로 표지한 후 기질로 이용하였다. Was used as a substrate and then labeled with 32 P using the priming method - endo the EC1 and EC2 and HC1 DNA set forth in Table 2 random to nuclease to study the properties of the properties of the enzyme activity and the final reaction product. 이러한 기질들을 FBS가 없는 배지에서 배양한 IM9 세포배양액으로 반응시킨 결과 도 26과 도 27 그리고 도 28에 제시된 바와 같이 약 10개 염기의 DNA 최종 반응물이 생성되었음을 볼 수 있었다. A result of the reaction of these substrates to IM9 cell culture cultured in the absence of FBS medium 26 and 27 and could be seen that about 10 the reaction generated DNA end of a base as shown in Fig. 이 결과에서 엔도뉴클레아제는 DNA의 염기서열을 특이적으로 인식하지는 못한다는 것을 알 수 있었으며, 염기서열에 관계없이 외부의 DNA에 작용하여 약 10 염기의 DNA 조각을 만들어 냄을 알 수 있다. In this results endonuclease it can be seen was found that does not recognize the base sequence of DNA specifically, by acting on the outside of DNA regardless of the nucleotide sequence to create a DNA fragment of about 10 base clearance. 그리고 엔도뉴클레아제의 저해물질인 Zn 2+ 와 킬레이트화제인 EDTA에 의해서 효소활성이 저해되는 결과를 볼 수 있었다(도 26, 27, 28, 29). And were able to see the results of the enzyme activity inhibited by the chelating agents of Zn 2+ and inhibition of the endonuclease EDTA (26, 27, 28, 29). 또한 10% FBS를 함유한 RPMI1640 배지에 의해서도 DNA의 분해가 발생되지 않음을 알 수 있었다(도 26, 27, 28, 29). Were also able to know the decomposition of the DNA is not generated even by a RPMI1640 medium containing 10% FBS (Fig. 26, 27, 28, 29). 이상과 같은 결과들은 세포내에서 엔도뉴클레아제 작용에 의해 유입된 DNA의 프로세싱으로 형성되는 반응생성물과 동일함을 생체외(in vitro) 실험으로 확인한 것이다. Results described above will verify as non-living body is the same as the reaction product formed by the processing of the introduced DNA by the endonuclease action in the cell (in vitro) test. 지금까지 연구한 엔도뉴클레아제 효소활성의 최종 반응생성물이 약 10개 염기의 DNA조각으로 이루어짐을 확인할 수 있었는데, 엔도뉴클레아제의 양을 증가시키고(도 30) 반응시간을 24시간까지 지속시켰을 경우에도(도 31) 효소반응에 의해 형성된 최종산물인 약 10개 염기의 DNA조각은 더 이상 분해되지 않음을 알 수 있었다. The study endonuclease enzymes the final reaction product of the active was able to resolve constituted by any DNA fragment of approximately 10 bases, endo increase in the amount of nuclease and (30) the reaction time so far sikyeoteul continued for up to 24 hours (Fig. 31) DNA fragment in the final product of about 10 base formed by the enzyme reaction in the case was found to be no longer decomposed. 즉, 본 발명에서 밝힌 엔도뉴클레아제는 약 10개 염기 이하의 DNA 조각에는 활성을 나타내지 않음을 알 수 있었다. That is, the endonuclease identified in the present invention it was found that the claim does not represent an active DNA fragment of approximately 10 bases or less is.

또한, 도 32에서는 PCR로 증폭한 EC2 DNA 생성물을 Alu I으로 처리하여 생성된 DNA 조각을 엔도뉴클레아제로 반응시킨 결과 최종 생성물이 생성되기 이전에 형성되는 엔도뉴클레아제 반응산물들인 여러 DNA 조각들을 볼 수 있었다. In addition, a number of DNA segments which are endonuclease reaction product formed prior to Figure 32 the result of the reaction the DNA fragment generates a EC2 DNA product amplified by PCR was treated with Alu I zero endonuclease end product is created I could see. 이 실험에서 이용한 기질은 Alu I으로 반응시킨 DNA의 5'-말단에 32 P로 표지하여 사용했는데, 표지된 효소반응 최종산물이 약 10개 염기로 나타난 결과로부터 일본쇄 DNA를 생성하기 위한 5'-엑소뉴클레아제 효소활성은 존재하지 않는 것으로 확인하였다. Substrate was used in this experiment used a 32 P labeled the 5'-end of the DNA was reacted with Alu I, 5 for generating stranded DNA resulting from the labeled enzyme reaction end product is shown to be about 10 bases' - exonuclease enzyme activity was found to be non-existent.

IM9 세포주의 엔도뉴클레아제가 3'-엑소뉴클레아제 또는 5'-엑소뉴클레아제 효소활성을 가지는지 확인하기 위하여 5'- 또는 3'-말단에 각각 32 P로 표지된 EC2 DNA를 기질로 이용하여 엔도뉴클레아제로 37 o C에서 1시간 동안 반응시킨 후 상기와 동일한 방법으로 방사선 사진 촬영하여 반응생성물을 비교하였다. IM9 cell line of endonuclease I in the 3'-5'-exonuclease or exonuclease substrate for each of the EC2 DNA labeled with 32 P in the 5'-or 3'-end in order to ensure that the enzyme activity of It was used in the reaction for 1 hour at 37 o C zero endonuclease was compared to the reaction product radiographs taken with the same method. 또한 일본쇄 DNA에는 엔도뉴클레아제 효소활성이 어떻게 나타나는지 확인하기 위하여 표지된 DNA를 100 o C에서 5분간 끓인 후 얼음에서 급속히 냉각시키고 엔도뉴클레아제와 위에서처럼 반응시키고 반응생성물을 확인하였다. Also stranded DNA has confirmed the endonuclease enzyme after the DNA marker to verify how this activity appears boiled for 5 minutes at 100 o C and rapidly cooled on ice endonuclease was reacted as above with the reaction product.

도 33의 결과에서 5'-말단에 표지한 기질에 엔도뉴클레아제가 작용하여 약 10개 염기의 DNA 조각이 형성(5'-말단 표지, 레인 2)되는 것을 보여 주었는데, 이 결과는 도 32에 나타난 결과와 같다. Be endonuclease I act on the substrate labeled on the 5'-end of the 33 gave the results show that the DNA fragment of about 10 bases are formed (5'-end labeling, lane 2), the results in Fig. 32 and it appeared as a result. 즉, 엔도뉴클레아제에 5'-엑소뉴클레아제 활성이 존재하지 않음을 확인하였다. That is, it was confirmed that the endonuclease not present the 5'-exonuclease activity. 그러나 3'-말단에 32 P로 표지한 기질에서는 효소반응 최종 생성물인 약 10개 염기의 DNA 조각이 방사선 사진 촬영에서 형성되지 않음을 보여 주는데, 이는 3'-엑소뉴클레아제 효소활성이 작용하여 32 P로 표지된 3'-말단이 모노뉴클레아타이드로 분해되었음을 보여준다. However, as a 32 P labeled substrate to the 3'-end juneunde show the DNA fragment of the enzyme reaction from about 10 bases in the end product it is not formed in the radiographs, which acts a 3'-exonuclease activity the 3'-end labeled with 32 P show that the degradation by nucleases mono Tide. 그러나 32 P로 표지한 기질을 100 o C에서 10분간 끓여준 후 얼음에서 급속히 온도를 낮춰 일본쇄로 전환시킨 후, 엔도뉴클레아제를 반응시키면 5'- 또는 3'-말단에 표지된 DNA 기질에서 모두 효소반응 생성물로 약 10개 염기의 표지된 DNA 조각을 형성하였다. However, after kkeulyeojun a substrate labeled with 32 P at 100 o C 10 bungan rapidly lowering the temperature from the ice after conversion to stranded, when the reaction endonuclease in a DNA substrate labeled on the 5'-or 3'-end all to form a labeled DNA fragment of approximately 10 bases by the enzyme reaction product. 이상의 실험 결과에 근거하여 3'-엑소뉴클레아제 효소활성이 일본쇄에는 작용하지 않음을 알 수 있었다. And showed that 3'-exonuclease activity does not act is stranded based on the above experimental results.

세포배양액에 존재하는 엔도뉴클레아제의 효소활성에 의해 생성된 최종 반응산물과 세포내에서 프로세싱되어 생성된 최종 생성물 그리고 DNase I의 작용에 의해 생성된 반응생성물을 비교하기 위하여, 소의 췌장 DNase I (Beohringer Mannheim) 5 unit 과 랜덤-프라이밍 방법에 의해 32 P로 표지한 EC1 DNA를 10 mM Tris-HCl, pH 7.6, 10 mM MgCl 2 완충용액에서 37 o C에서 1 시간 동안 반응시켰다. In order to compare the cell is processed in the final reaction product and cells produced by the enzymatic activity of the endonuclease present in the culture medium produced the final product and the reaction product generated by the action of DNase I, bovine pancreatic DNase I ( the reaction was carried out for 1 hour at the EC1 a DNA labeled with 32 P by the priming method 10 mM Tris-HCl, pH 7.6 , 10 mM MgCl 2 in a buffer solution 37 o C - Beohringer Mannheim) 5 unit and random. 이 반응생성물을 20% 천연-PAGE 와 20% 변성-PAGE (8.3 M urea)를 수행한 후 방사선 사진 촬영을 해서 엔도뉴클레아제의 효소활성 최종 반응산물과 비교하였다. After the reaction product was carried out for 20% and 20% modified natural -PAGE -PAGE (8.3 M urea) to the radiographs were compared to the enzymatic activity of the final reaction product endonuclease. 또한 엔도뉴클레아제 효소활성의 최종 생성물이 일본쇄로 존재한다는 것을 확인하기 위하여 S1 뉴클레아제로 처리하여 확인하였다. In addition, it was confirmed by S1 nuclease treatment agent to ensure that the end product of endonuclease activity that present in a stranded. S1 뉴클레아제 효소활성은 랜덤-프라이밍 방법에 의해 32 P로 표지된 기질에 작용하여 생성된 엔도뉴클레아제 반응 최종 생성물 과 S1 뉴클레아제 반응 완충용액(7X 완충용액, 0.3 M 아세트산 칼륨, pH 4.6, 2.5 M NaCl, 10 mM ZnSO 4 , 50% 글리세롤)에 포함된 3 unit의 S1 뉴클레아제와의 혼합물을 37 o C에서 1시간 동안 반응시켜서 확인하였다. S1 nuclease enzyme activity random - the endonuclease reaction end product with S1 nuclease reaction buffer created by acting on the substrate labeled with 32 P by the priming method (7X buffer solution, 0.3 M potassium acetate, pH a mixture of a 4.6, 2.5 M NaCl, 10 mM ZnSO 4, the S1 nuclease of the unit 3 includes a 50% glycerol) was confirmed by reaction for 1 hour at 37 o C. 최종 반응생성물은 동일한 실험 방법으로 방사선 사진 촬영하여 확인하였다. The final reaction product was confirmed by radiographs taken in the same test method.

엔도뉴클레아제의 효소활성에 의해 생성된 최종 생산물 과 DNase I의 작용에 의해 생성된 반응생성물을 비교한 결과, 도 34에 나타난 것과 같이 세포 배양액의 엔도뉴클레아제(레인 2)와 세포 내부의 엔도뉴클레아제(레인 3)에 의해 프로세싱된 DNA 반응산물은 모두 약 10개 염기의 DNA 조각 이었으나, DNase I의 작용(레인 4)에 의해서는 10개 염기 이하로 분해된 DNA 조각이 나타나며 계속 분해되어 모노뉴클레오타이드로 분해됨을 볼 수 있었다. Comparison of the final produced by the enzymatic activity of the endonuclease products and the reaction product generated by the action of DNase I, the cell culture medium as shown in Figure 34 endonuclease within the first (lane 2) and cell endonuclease the DNA reaction products processed by a (lane 3) all yieoteuna DNA fragment of about 10 bases, the action of DNase I appears and the DNA fragment digested with not more than 10 bases by a (lane 4) continuing the decomposition are there to see the decomposed into mono nucleotides. 또한 엔도뉴클레아제반응에 의한 최종 생성물이 일본쇄로 존재한다는 것을 확인하기 위하여 S1 뉴클레아제로 처리하여 효소반응 생성물을 관찰하였다. In addition, endo-nuclease was observed that the enzyme reaction product was treated with S1 nuclease to make sure that the final product that the reaction according to the present in a stranded. 엔도뉴클레아제의 최종산물인 약 10개 염기의 반응산물을 S1 뉴클레아제와 다시 반응시켰을 때 도 35에서처럼 완전히 모노뉴클레오타이드로 분해되었음을 볼 수 있었다. When the end product of the reaction product of from about 10 bases of the endonuclease reacted again with S1 nuclease it could be seen that, as shown in Figure 35 completely degraded to mono nucleotides. 즉, 엔도뉴클레아제의 효소활성에 의해 생성된 약 10개 염기의 DNA 조각은 일본쇄로 존재한다는 명확한 증거를 제시하였다. That is, DNA fragment of about 10 bases produced by the enzymatic activity of the endonuclease was presented clear evidence that present in a stranded.

실시예 4 Example 4

IM9 세포주에서 분비되는 엔도뉴클레아제 의 정제 및 특성 규명 Identification and characterization of the purified endonuclease secreted from IM9 cell line

IM9 세포주가 지금까지 규명된 뉴클레아제들과 구분되는 Mg 2+ -의존성 엔도뉴클레아제를 생합성하고 분비한다는 사실을 밝혔다. He said that the biosynthesis and secretion dependent endonuclease - IM9 cells are separated Mg 2+ with a nuclease identified so far. 또한 IM9 세포주의 핵에도 이 효소가 존재하여 apoptosis 과정에 관여하고 있음을 제시하였다. Also presented by the enzyme is present in the nucleus of IM9 cell line that is involved in the apoptosis process. Apoptosis에 관여하는 엔도뉴클레아제들은 Mg 2+ -의존성 엔도뉴클레아제[Anzai N. et al (1995) Blood 86, 917-923; Endonuclease involved in Apoptosis are Mg 2+ - dependent endonuclease [Anzai N. et al (1995) Blood 86, 917-923; Kawabata H. et al (1993) Biochem. Kawabata H. et al (1993) Biochem . Biophys. Biophys. Res. Res. Commun. Commun. 191, 247-254; 191, 247-254; Sun XM, and Cohen GM (1994) J. Biol. Sun XM, and Cohen GM (1994 ) J. Biol. Chem. Chem. 269, 14857-14860; 269, 14857-14860; 및 Kawabata, H. et al (1997) Biochem. And Kawabata, H. et al (1997) Biochem. Biophys. Biophys. Res. Res. Commun. Commun. 233, 133-138], Ca 2+ /Mg 2+ -의존성 엔도뉴클레아제[Stratling WH et al (1984) J. Biol. 233, 133-138], Ca 2+ / Mg 2+ - dependent endonuclease [Stratling WH et al (1984) J. Biol. Chem. Chem. 259, 5893-5898; 259, 5893-5898; Pandey S. et al (1997) Biochemistry 36, 711-720; Pandey S. et al (1997) Biochemistry 36, 711-720; 및 Ribeiro JM, and Carson DA (1993) Biochemistry 32, 9129-9136], DNase I[Peitsch MC et al (1993) EMBO J. 12, 371-377], 그리고 NUC18[Kawabata, H. et al (1997) Biochem. And Ribeiro JM, and Carson DA (1993 ) Biochemistry 32, 9129-9136], DNase I [Peitsch MC et al (1993) EMBO J. 12, 371-377], and NUC18 [Kawabata, H. et al ( 1997) Biochem. Biophys. Biophys. Res. Res. Commun. Commun. 233, 133-138] 등이 있으나, 이들 엔도뉴클레아제의 정제 및 생화학적 특성 그리고 생리적인 기능에 대하여는 명확히 규명되지 않고 있다. 233, 133-138], but the like, have not been clearly defined with respect to the purification and biochemical properties, and physiological functions of the these endonuclease. 또한 박테리아 DNA를 외부 물질로 인식하여 프로세싱하는 기능에 관여하는 엔도뉴클레아제도 보고된 바 없다. Also it not reported endonuclease involved in the processing capability to recognize bacterial DNA as foreign material system. 따라서 본 발명에서는 IM9 세포주에서 합성되고 분비되는 엔도뉴클레아제를 세포배양액에서 정제하여 그 특성을 규명하였다. Therefore, in the present invention, to give the endonuclease, which is synthesized and secreted from the IM9 cells in cell culture medium were identified and characterized.

4-1 단백질원 및 엔도뉴클레아제 효소활성 측정 4-1 protein source and endonuclease activity measurement

엔도뉴클레아제를 분비하는 IM9 세포주를 열처리한 10% FBS를 함유하는 RPMI1640 배지에서 대량 배양하여 세포배양액을 효소원으로 사용하였다. The cell culture was used as an enzyme source and mass cultivation in RPMI1640 medium containing 10% FBS endonuclease followed by heat treatment at a IM9 cell line secreting claim. 세포배양액과 IM9 세포주를 분리하기 위하여 1,500 xg에서 5분간 원심분리하여 세포배양액을 수득하였다. The cell culture was obtained by separated for 5 minutes and centrifuged at 1,500 xg to remove the cell culture and cell line IM9. 총 10 ℓ의 세포배양액을 4 o C에서 30분간 14,000 x g 로 원심분리하여 상층액을 효소원으로 사용하였다. The supernatant by centrifuging the cell culture fluid of a total of 10 ℓ to 4 o C 30 bungan 14,000 x g in was used as the enzyme source.

엔도뉴클레아제 정제과정에서 효소 활성은 초나선 플라스미드 DNA를 기질로 이용하여 선형 DNA 형성과 분해되는 정도로 측정하였다. Endonuclease activity in the purification process was determined, so that decomposition and linear DNA formed by the second spiral plasmid DNA as a substrate. 10 mM MgCl 2 를 함유한 20 mM Tris-HCl (pH7.0) 완충용액에 100 ng의 플라스미드 DNA를 넣고 단백질 정제 과정중의 시료 20 ul와 혼합하여 37 o C에서 10분간 반응시켰다. In 10 mM MgCl 20 mM Tris-HCl containing 2 (pH7.0) into a plasmid DNA, 100 ng of the protein purification process the sample buffer 20 ul with mixing to 37 o C in the reaction was carried out for 10 minutes. 효소반응은 DNA 시료 완충용액으로 정지시키고 1% 아가로즈 겔에서 전기영동하여 효소활성을 확인하였다. The enzymatic reaction was determined to stop the DNA sample buffer and enzyme activity by electrophoresis on 1% agarose gel.

4-2 엔도뉴클레아제의 정제 4-2 Purification of endo nuclease

세포배양액에 황산암모늄을 서서히 가하여 80% 포화되도록 한 후 14,000 x g 에서 원심분리 하여 침전물을 20 mM 아세트산 나트륨(pH 5.2) 완충용액에 하룻밤 동안 투석하였다. Cell culture and the precipitate by centrifugation at 14,000 x g and then gradually added to 80% saturated ammonium sulfate and dialyzed overnight in 20 mM sodium acetate (pH 5.2) buffer solution. 이 효소용액중 5 ml을 동일한 완충용액으로 미리 평형시킨 모노 S 컬럼(0.5 x 5.0 cm, Pharmacia LKB)에 주입하였다. The enzyme solution of 5 ml was injected on Mono S column (0.5 x 5.0 cm, Pharmacia LKB) were pre-equilibrated with the same buffer solution. 동일한 완충용액에서 0 -0.08 M NaCl 직선 농도구배(15 ml)를 형성하여 단백질을 1차로 용출하였고, 0.08 M NaCl이 포함된 동일 완충용액 15 ml를 더 통과시켰다. Forming a 0 -0.08 M NaCl linear gradient (15 ml) in the same buffer to elute the protein was primarily, 0.08 M NaCl was further passed through the same buffer solution containing a 15 ml. 이어서 0.08 -0.2 M NaCl 직선 농도구배(20 ml)를 형성하여 2차로 단백질을 용출하였다. Followed by elution of the protein to form a second drive 0.08 -0.2 M NaCl linear gradient (20 ml). 각 분획의 부피는 1 ml이고 유속은 0.5 ml/min 이었다. The volume of each fraction was 1 ml and flow rate of 0.5 ml / min. 이상의 과정을 반복하여 엔도뉴클레아제를 가진 분획을 모아 센트리콘으로 농축한 후 1.5 M (NH 4 ) 2 SO 4 를 함유한 50 mM 인산나트륨(pH 7.0) 완충용액으로 평형시켰다. After repeating the above process to collect the fraction having the endonuclease was concentrated by cent silicon 1.5 M (NH 4) 2 SO 4 a (pH 7.0) 50 mM sodium phosphate containing was equilibrated with a buffer solution. 이 효소원을 동일한 완충용액으로 평형시킨 RESOURCE PHE 컬럼(0.64 x 30 mm, 1 ml, Pharmacia LKB)에 주입하여 소수성 상호작용 크로마토그래피를 수행하였다. It was poured into the enzyme source RESOURCE PHE column (0.64 x 30 mm, 1 ml, Pharmacia LKB) equilibrated with the same buffer solution was carried out for hydrophobic interaction chromatography. 동일한 완충용액 15 ml로 씻어 준 후, 1.5-0 M (NH 4 ) 2 SO 4 직선 농도구배를(25 ml) 형성하여 단백질을 용출하였다. Washed with 15 ml of the same buffer solution, 1.5-0 M (NH 4) 2 SO 4 to form a linear gradient (25 ml) and eluted proteins. 효소활성이 있는 분획을 센트리콘으로 농축한 후 20 mM Tris-HCl (pH 7.0) 완충용액으로 평형시켰다. After concentrating the fractions with enzymatic activity as cent silicon 20 mM Tris-HCl (pH 7.0) were equilibrated with a buffer solution.

IM9 세포배양액을 황산암모늄으로 농축하여 정제에 이용하였다. IM9 by concentration of the cell culture fluid by ammonium sulfate was used for purification. 황산암모늄 분별침전을 농도차이를 두고 수행하였으나 효소분리에 많은 영향을 미치지 않아 80%의 농도로 처리하여 단백질을 침전시켜 정제를 실행하였다. But do distinctions between the concentration of ammonium sulfate fractionation and do not have much effect on the enzyme separation by 80% the concentration of precipitated proteins was carried out the purification. 모노 S 컬럼을 통과시킨 시료에서 효소활성은 0.08-0.2 M NaCl 직선 농도구배에서 회수되었다(도 36). In passed a Mono S column sample enzyme activity it was recovered in the 0.08-0.2 M NaCl linear concentration gradient (Fig. 36). 양이온 교환수지에서 효소활성이 있는 분획을 소수성 상호작용 크로마토그래피인 RESOURCE PHE 컬럼을 통과시켰다. The fractions with the enzyme activity in the cation-exchange resin was passed through a hydrophobic interaction chromatography on a RESOURCE PHE column. 1.5-0 M (NH 4 ) 2 SO 4 직선 농도구배로 단백질을 용출하였을때 직선 농도구배중 0.7 M (NH 4 ) 2 SO 4 농도구배에 나타난 단백질 분획에서 엔도뉴클레아제 효소활성을 관찰할 수 있었다(도 37). 1.5-0 M (NH 4) 2 SO 4 of the linear gradient elution the protein when a linear gradient of 0.7 M (NH 4) 2 can be observed the endonuclease enzymatic activity in the protein fractions indicated on the SO 4 concentration gradient It was (Fig. 37). 약 10 g의 단백질을 포함하는 10 리터의 IM9 세포주 배양액에서 정제된 엔도뉴클레아제를 정량한 결과 약 10 ug이 회수된 것으로 나타났다. After a determination of the endonuclease purified from the IM9 cell line culture solution 10 liters containing about 10 g of protein was found that about 10 ug recovered.

4-3 천연 기공 구배 PAGE 및 SDS-PAGE에 의한 분자량 측정 4-3 natural porosity gradient PAGE and molecular weight determined by SDS-PAGE

양이온 교환수지 크로마토그래피에서 효소활성이 있는 분획을 모아 센트리콘으로 농축한 용액을 4-15% 직선 농도구배의 아크릴아미드 구배 겔에 주입하여 4 o C에서 4 -5 mA로 18 시간 전기영동을 수행하였다. In the cation-exchange resin chromatography and the enzymatic activity in the collected fractions which cent injecting a solution enriched in silicon on 4-15% acrylamide gradient gel of linear gradient of 4 o C to -5 4 mA for 18 hours to perform electrophoresis It was. 전기이동 후 쿠마시 브릴리언트 블루 R-250으로 염색하여 단백질띠를 확인하였다. When Kumar After electrophoresis the protein band was confirmed by staining with Brilliant Blue R-250. 단백질 띠에 해당하는 부위를 염색하기 전에 잘라내어 작은 조각으로 만든 후 20 mM Tris-HCl (pH7.0) 완충용액에서 4 o C에서 8시간 동안 용출하였다. Protein strip in the 20 mM Tris-HCl (pH7.0) buffer solution, and then made into small pieces cut out before dyeing to a portion at 4 o C for 8 hours and eluted. 용출된 단백질 분획중 엔도뉴클레아제 효소활성이 있는 부위를 초나선 플라스미드 DNA를 기질로 이용하여 확인하였다. The endonuclease enzymes cho spiral plasmid DNA in the active region of the eluted protein fraction was confirmed by using as a substrate. 효소활성이 있는 분획을 농축하여 SDS-폴리아크릴아미드 겔 전기영동을 수행하였다. By concentration of the fractions with enzyme activity were performed SDS- polyacrylamide gel electrophoresis. 이때 사용한 stacking gel은 4%이고 running gel은 7%였다. The stacking gel was 4% and 7% running gel is used. 천연 기공 구배 PAGE의 표준 단백질은 페리틴(ferritin)(440 kD), 카탈라제(232 kD), 락테이트 데하이드로게나제(140 kD) 그리고 소혈청알부민(67 kD)의 혼합액을 사용하였고, SDS-PAGE의 표준 단백질로는 마이오신(myosin)(200 kD), β-갈락토시다제(116.3 kD), 포스포릴라제 B (97.4 kD), 소혈청알부민(66.2 kD) 그리고 난알부민(45 kD)의 혼합물을 사용하였다. Was used a mixture of standard proteins of the natural porosity gradient PAGE is ferritin (ferritin) (440 kD), catalase (232 kD), lactate dehydrogenase (140 kD), and bovine serum albumin (67 kD), SDS-PAGE the myosin is in a standard protein (myosin) (200 kD), β- galactosidase (116.3 kD), phosphorylase B (97.4 kD), bovine serum albumin (66.2 kD) and ovalbumin (45 kD) the mixture was used.

모노 S 컬럼에서 용출된 효소활성이 있는 단백질 분획을 농축하여 4-15% 천연 기공 구배 겔 전기영동을 수행한 결과, 효소활성이 있는 단백질띠를 확인할 수 있었다(도 40). By concentration of the protein fraction in the enzyme activity eluted from the mono S column result of the porosity gradient 4-15% native gel electrophoresis confirmed the protein band with the enzyme activity (Fig. 40). 효소활성이 나타난 단백질 띠는 명확하게 단일띠를 형성하지 않고 표준 단백질과 비교하여 140 kD 주위에 약간 퍼져 있음을 관찰할 수 있었다. Protein band is the enzyme activity was shown to clearly observe without forming a single band that some spread around 140 kD as compared to standard proteins. 효소활성이 나타난 부위의 단백질을 용출하고 농축하여 SDS-PAGE를 수행한 결과(도 41) 크로마토그래피에 의해 정제된 엔도뉴클레아제(도 38)와 동일한 위치에서 순수하게 정제된 단백질띠를 확인하였고, 분자량이 약 72.4 kD임을 확인하였다(도 39). After elution the protein of the enzyme activity appeared site and concentrated by performing SDS-PAGE (Fig. 41) purified by chromatography endonuclease (Fig. 38) and was confirmed that the protein band purified purely in the same position It was identified as a molecular weight of about 72.4 kD (Fig. 39). 천연 기공 구배 겔 전기영동의 결과와 SDS-PAGE의 결과를 비교하였을 때 엔도뉴클레아제는 호모다이머 형태로 존재하여 효소활성을 갖는 것으로 확인할 수 있었다. When comparing the results with the results of SDS-PAGE of natural pore gradient gel electrophoresis endonuclease it was confirmed to have the activity to exist as a homodimer form.

4-4 정제한 효소의 특성 확인 4-4 confirm the characteristics of the purified enzyme

엔도뉴클레아제 효소활성이 4시간 동안 나타나지 않는 U937 세포주에서 분리한 핵을 기질로 사용하였다. The endonuclease activity was used as a nucleus isolated from U937 cell line does not appear as a substrate for 4 hours. 20 mM Tris-HCl (pH 7.0) 완충용액에 함유된 분리한 핵에 1 mM Ca 2+ , 1 mM Mg 2+ , 1 mM Zn 2+ 그리고 EDTA를 첨가해 효소활성 특이성을 37 o C에서 10분간 반응시켜 확인하였다. 20 mM Tris-HCl (pH 7.0 ) to separate the nuclei contained in a buffer solution, 1 mM Ca 2+, 1 mM Mg 2+, 1 mM Zn 2+ and the enzyme activity specificity by addition of EDTA 10 minutes at 37 o C It was confirmed by the reaction.

U937 세포주에서 분리한 핵을 기질로 이용하여 정제한 효소의 이온 요구성을 관찰한 결과 Mg 2+ 존재하에 효소활성이 나타남을 확인하였고, apoptosis의 저해물질인 Zn 2+ 와 킬레이트화제인 EDTA에 의해서 효소활성이 완전히 저해되었음을 볼 수 있었다(도 42). Were made using the nuclear isolated from U937 cell line as the substrate confirmed the ion I As a result of observing the structure activity Mg 2+ under the presence of a purified enzyme appears, by which the inhibitor of apoptosis and Zn 2+ chelator EDTA the enzyme activity was visible that completely inhibited (FIG. 42). 이러한 효소활성의 특성은 상기한 효소활성 특성과 일치하는 것이다. Properties of these enzyme activities is consistent with the enzymatic activity characteristics.

본 발명의 엔도뉴클레아제는 외부의 박테리아 DNA를 적절하게 분해하여 세포가 DNA를 유입하는 기능을 가지고 있으며 또한 세포에 유입된 DNA는 세포 내부의 엔도뉴클레아제에 의해 프로세싱이 일어나고 프로세싱된 외부 DNA의 CpG motif에 의하여 면역세포가 활성화되어 항체의 분비를 촉진하는 특징을 지니고 있다. Endonuclease of the present invention is to decompose properly to the outside of bacterial DNA cells have the ability to introduce a DNA, and also the DNA introduced into the cell occurs and the processing by the endonuclease within the cell of claim processed foreign DNA of the immune cells activated by CpG motif it has the characteristics of promoting the secretion of the antibody. 따라서, 본 발명의 엔도뉴클레아제는 면역보조제로서 그 산업상 이용가치가 있는 것이다. Thus, the endonuclease of the present invention is that the use of the value that the industry as adjuvant.

Claims (8)

  1. 면역세포로부터 분비되고 박테리아 DNA를 외부의 물질로 인식하고 프로세싱하여 면역반응에 관여하는 CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 생성하는 엔도뉴클레아제. The endonuclease to release from immune cells and recognize bacterial DNA with a foreign object, and processing to produce a stranded oligonucleotides of about 10 bp having a CpG motif involved in the immune response.
  2. 제1항에 있어서, 면역세포가 사람의 B 림프아 IM9 세포주 또는 12-O-테트라데카노일포르볼 13-아세테이트 처리된 U937 세포주인 엔도뉴클레아제. According to claim 1, wherein the immune cell is a human B cell line IM9 lymphoblastic or 12-O- tetra-decanoyl phorbol 13-a U937 cell line, endonuclease treatment acetate.
  3. 제1항 또는 2항에 있어서, SDS-PAGE에 의한 분자량이 72.4 kD인 엔도뉴클레아제. The method of claim 1 or 2, wherein the endonuclease having a molecular weight by SDS-PAGE 72.4 kD.
  4. 제1항 또는 2항에 있어서, 효소활성이 Mg 2+ 의존성인 엔도뉴클레아제. According to claim 1 or 2, wherein the endonuclease activity is Mg 2+ dependent.
  5. 제1항 또는 2항에 있어서, 반응의 최적 pH가 6.6 내지 7.6인 엔도뉴클레아제. According to claim 1 or 2, wherein the optimum pH of the reaction 6.6 to 7.6 endonuclease.
  6. 제1항 또는 2항에 있어서, DNase I과는 천연-PAGE에서 효소활성의 이동 거리가 뚜렷하게 구분되는 엔도뉴클레아제. The method of claim 1 or 2, DNase I and the second endonuclease that distinct travel of the enzyme activity in the natural -PAGE.
  7. 사람의 B-림프아 IM9 세포주 또는 TPA로 처리된 골수형성 U937 세포주를 엔도뉴클레아제를 생성하기에 적절한 배지에서 배양하고 이 배양액으로부터 상기 면역세포에서 합성되어 분비된 엔도뉴클레아제를 정제함을 포함하는, CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 생성하는 엔도뉴클레아제의 제조방법. That the myelodysplastic U937 cell line treated with B- lymphoblastic IM9 cell line or TPA human cultured in an appropriate medium to produce the endonuclease and purifying the endonuclease is secreted synthesized in immune cells from the culture medium oligonucleotides of about 10 bp stranded method of endonuclease to produce a nucleotide having, CpG motif containing.
  8. 제1항의 엔도뉴클레아제로 박테리아 DNA를 처리하여 형성된 CpG motif를 갖는 약 10 bp의 일본쇄 올리고뉴클레오타이드를 포함하는 면역보조제. The adjuvant comprising a stranded oligonucleotides of about 10 bp having a CpG motif of claim 1 formed by treating the bacterial DNA endonuclease zero.
KR1019980019176A 1998-05-27 1998-05-27 The novel endo New immune cell nuclease and adjuvant using the same KR19990086271A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1019980019176A KR19990086271A (en) 1998-05-27 1998-05-27 The novel endo New immune cell nuclease and adjuvant using the same

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
KR1019980019176A KR19990086271A (en) 1998-05-27 1998-05-27 The novel endo New immune cell nuclease and adjuvant using the same
AU77889/98A AU7788998A (en) 1998-05-27 1998-05-30 Novel endonuclease of immune cell, process for producing the same and immune adjuvant using the same
JP2000550977A JP2002516086A (en) 1998-05-27 1998-05-30 New endonuclease immune cells, methods for making the same and immunoadjuvant using the same
PCT/KR1998/000136 WO1999061592A1 (en) 1998-05-27 1998-05-30 Novel endonuclease of immune cell, process for producing the same and immune adjuvant using the same
US09/722,776 US6881561B1 (en) 1998-05-27 2000-11-27 Endonuclease of immune cell, process for producing the same and immune adjuvant using the same
US10/860,844 US20070173468A9 (en) 1998-05-27 2004-06-04 Novel endonuclease of immune cell, process for producing the same and immune adjuvant using the same
JP2008244255A JP2009060909A (en) 1998-05-27 2008-09-24 Novel endonuclease of immunocyte, method for production thereof, and immunoadjuvant using the same

Publications (1)

Publication Number Publication Date
KR19990086271A true KR19990086271A (en) 1999-12-15

Family

ID=19537785

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1019980019176A KR19990086271A (en) 1998-05-27 1998-05-27 The novel endo New immune cell nuclease and adjuvant using the same

Country Status (4)

Country Link
JP (2) JP2002516086A (en)
KR (1) KR19990086271A (en)
AU (1) AU7788998A (en)
WO (1) WO1999061592A1 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR19990086271A (en) * 1998-05-27 1999-12-15 손경식 The novel endo New immune cell nuclease and adjuvant using the same
EP1146907A2 (en) * 1999-02-05 2001-10-24 Genzyme Corporation Use of cationic lipids to generate anti-tumor immunity
US7138262B1 (en) * 2000-08-18 2006-11-21 Shire Human Genetic Therapies, Inc. High mannose proteins and methods of making high mannose proteins
PT1986612E (en) 2006-02-07 2012-11-06 Shire Human Genetic Therapies Stabilized composition of glucocerebrosidase
US9453847B2 (en) 2010-07-19 2016-09-27 Shire Human Genetic Therapies, Inc. Mannose receptor C type 1 (MRC1) codon optimized cell line and uses thereof
EP2863941B1 (en) 2012-03-02 2018-12-19 Shire Human Genetic Therapies, Inc. Velaglucerase for treating type iii gaucher disease

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
ES2267100T5 (en) * 1994-07-15 2011-04-08 Coley Pharmaceutical Group, Inc. Immunomodulatory oligonucleotides.
KR19990086271A (en) * 1998-05-27 1999-12-15 손경식 The novel endo New immune cell nuclease and adjuvant using the same

Also Published As

Publication number Publication date
JP2002516086A (en) 2002-06-04
WO1999061592A1 (en) 1999-12-02
JP2009060909A (en) 2009-03-26
AU7788998A (en) 1999-12-13

Similar Documents

Publication Publication Date Title
Spencer et al. On the origin of crystallizable RNA from yeast
Sparwasser et al. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor‐α‐mediated shock
Megiovanni et al. Polymorphonuclear neutrophils deliver activation signals and antigenic molecules to dendritic cells: a new link between leukocytes upstream of T lymphocytes
Tomcsányi et al. Processing enzyme ribonuclease E specifically cleaves RNA I: an inhibitor of primer formation in plasmid DNA synthesis
SUHADOLNIK et al. Biochemical evidence for a novel low molecular weight 2-5A-dependent RNase L in chronic fatigue syndrome
Khare et al. An NLRP7-containing inflammasome mediates recognition of microbial lipopeptides in human macrophages
Stacey et al. Macrophages ingest and are activated by bacterial DNA.
Mao et al. Altered monocyte responses to defined TLR ligands in patients with primary biliary cirrhosis
Blüml et al. Essential role of microRNA‐155 in the pathogenesis of autoimmune arthritis in mice
Losick et al. NF-κB translocation prevents host cell death after low-dose challenge by Legionella pneumophila
Schatz et al. Cannabinoid receptors CB1 and CB2: a characterization of expression and adenylate cyclase modulation within the immune system
KR100230909B1 (en) Method for extracting nucleic acids from a wide range of organisms
US6239116B1 (en) Immunostimulatory nucleic acid molecules
JP6453855B2 (en) Compositions and methods for activating dependent signaling "stimulators of interferon gene"
Handman et al. Passive transfer of Leishmania lipopolysaccharide confers parasite survival in macrophages.
AU2003250334B2 (en) Immunostimulatory oligonucleotides and uses thereof
US7879810B2 (en) Immunostimulatory nucleic acid molecules
Butcher et al. Toxoplasma gondii rhoptry kinase ROP16 activates STAT3 and STAT6 resulting in cytokine inhibition and arginase-1-dependent growth control
Hermann et al. Cytokine induction by purified lipoteichoic acids from various bacterial species–Role of LBP, sCD14, CD14 and failure to induce IL‐12 and subsequent IFN‐γ release
Joshi et al. Targeted gene deletion of Leishmania major genes encoding developmental stage‐specific leishmanolysin (GP63)
Andrade et al. Differential tissue distribution of diverse clones of Trypanosoma cruzi in infected mice
Hameed et al. Cytolysis by Ca-permeable transmembrane channels. Pore formation causes extensive DNA degradation and cell lysis.
Kyburz et al. Bacterial peptidoglycans but not CpG oligodeoxynucleotides activate synovial fibroblasts by toll‐like receptor signaling
Kennedy et al. Neutrophil apoptosis and the resolution of infection
Coler et al. Development and characterization of synthetic glucopyranosyl lipid adjuvant system as a vaccine adjuvant