KR19990086271A - Novel endonucleases of immune cells and immunoadjuvant using the same - Google Patents

Abstract

The present invention relates to endonucleases, human B-lymphocytes that generate about 10 bp of single-stranded oligonucleotides with CpG motifs that are secreted from immune cells and recognize and process bacterial DNA as foreign substances and are involved in immune responses. Said endonuclease comprising culturing an IM9 cell line or a myeloid U937 cell line treated with TPA in a medium suitable for producing endonucleases and purifying endonucleases synthesized and secreted from said immune cells from this culture. The present invention relates to a preparation method of an agent and an immunoadjuvant comprising about 10 bp single-chain oligonucleotide having a CpG motif formed by treating bacterial DNA with the endonuclease of the present invention.

Description

New Endonuclease of Immune Cells and Novel Endonuclease of Immune Cell and Immune Adjuvant Using the Same

The present invention uses novel endonuclease enzymes and enzymes that produce CpG motifs that are secreted from immune cells and are known to be involved in immune responses by processing and processing bacterial DNA as foreign substances. It relates to an oligonucleotide-derived immune adjuvant obtained specifically for each vaccine antigen of interest.

Mammals build an immune system as a defense against invasion of foreign substances, and congenital (nonspecific) and acquired (antigen-specific) immunity exist. Congenital or nonspecific immunity is the primary resistance to a species' disease, forming four types of barriers: structural, physiological, endocytic and phagocytic, and inflammatory barriers. Examples of structural barriers include membranes of skin and mucus, and physiological barriers include temperature, pH, oxygen pressure, and several water-soluble factors. In addition, intracellular and phagocytic barriers induce extracellular macromolecules into the cell through endocytosis and phagocytosis and digestion. Is an inflammatory response caused by the induction of several types of vascular and chemotactic factors. Acquired immunity differs from innate immunity in traits of specificity, diversity, memory, and self / non-magnetic recognition. This acquired immunity is caused by humoral immunity and cellular immunity caused by the action of B lymphocytes, T lymphocytes, antibodies, and cytokines.

Immune defense against the invasion of microorganisms is caused by innate mechanisms that quickly recognize the specific types of molecules of the microorganism early in the invasion. Proteins and lipids present in microorganisms are well known to elicit an immune system that reacts specifically to antigens. LPS, formyl methionine, lipoarabinomannan, and peptidoglycan are lymphocytes. , Phagocytes, and substances that directly activate the complement system (Marrack, P., and Kapple, JW (1994) Cell 76, 323-332). Recently, many researchers have known that mammals distinguish bacterial DNA from their own DNA as an external substance to activate humoral and cellular immunity and also contribute to innate immunity.

From the fact that many anti-DNA antibodies are produced in autoimmune systemic lupus erythematosus (SLE), DNA has been studied in terms of antigen or autoantigen. The primary concern for SLE is that anti-DNA antibodies are important mediators of kidney damage, skin rash and arthritis caused by these autoimmune diseases [Tan, EM (1989) A Textbook in Rheumatology, 11th. Ed. DJ McCarty, ed. Lea and Febiger, Philadelphoa, PA, 1049; Isenberg, DA et al (1997) The role of antibodies to DNA in systemic lupus erythematosus-A review and introduction to an international workshop on DNA antibodies held in London, May 1996 Lupus 6, 290-304; Swaak, AJG et al (1979) Arthritis Rheum. 22, 226-235; And Isenberg, DA et al (1994) Arthritis Rheum. 37, 169-180. These antibodies were found to bind to ssDNA and structural determinants present in dsDNA [Isenberg, DA et al (1994) Arthritis Rheum. 37, 169-180; Pisetsky, DS (1992) Rheum. Dis. Clin. North am. 18, 437-454; And Shoenfeld, Y., and Isenberg, DA (1989) Immunol. Today 10, 123-126] The cause of this disease is not exactly known, but recent studies have provided strong evidence that DNA antigens play an important role [Shlomchik, MJ et al (1987) Proc. Natl. Acad. Sci. USA 84, 9150-9154; Shlomchik, MJ et al (1990) J. Exp. Med. 171, 265-292; And Tillman, DM et al. (1992) J. Exp. Med. 176, 761-779. The researchers used normal mice and mice with autoimmune diseases as models to study the immune response to bacterial DNA [Gilkeson, GS et al (1989) Clin. Immunol. Immunopathol. 51, 1482-1486; Gilkeson, GS et al (1993) J. Immunol. 151, 1353-1364; And Gilkeson, GS et al (1995) J. Clin. Invest. 95, 1398-1402. Unlike mammalian DNA, bacterial DNA has potent immunological properties that activate polyclonal B cells and produce specific antibodies in mice [Gilkeson, GS et al (1995) J. Clin. Invest. 95, 1398-1402; And Gilkeson, GS et al (1991) Clin. Immunol. Immunopathol. 59, 288-300. This activity is due to differences in the sequence motifs present in the DNA of bacteria and mammals, because they can be recognized as foreign substances, i.e. non-magnetic [Messina, JP et al (1993) Cell. Immunol. 147, 148-157; Krieg, AM et al (1995) Nature 374, 546-549; And Halpern, MD et al (1996) Cell. Immunol. 167, 72-78. Immunization of bacterial DNA to normal mice yielded antibodies capable of binding not only to the bacterial dsDNA but also to mammalian and bacterial ssDNA [Gilkeson, GS et al (1991) Clin. Immunol. Immunopathol. 59, 288-300. However, no autoantibodies were cross-reactive with mammalian dsDNA. Unlike in normal mice, immunizing bacterial dsDNA in preautoimmune (NZB X NZW) F ₁ (NZB / W) mice produced cross-reactive antibodies that bind to mammalian dsDNA [Gilkeson, GS et al. al (1995) J. Clin. Invest. 95, 1398-1402. These results suggest that mice with autoimmune diseases have the ability to produce anti-dsDNA antibodies that cross-react to mammalian DNA when immunizing bacterial DNA, a defect of immunomodulators in NZB / W mice. This is due to the false tolerance of self-reacted anti-dsDNA B cells produced by DNA to their own DNA, which has resulted in an increase in bacterial dsDNA as well as pathogenic autoantibodies that respond to their own dsDNA [ Whoch, MK et al (1997) J. Immunol. 158, 4500-4506.

B cells are stimulated with respect to protein antigens to activate and produce antibodies. The antigens are processed by antigen-presenting cells (APCs) to process protein antigens with major histocompatibility complex (MHC) molecules. It is well known that MHC-restricted T cells are activated by binding to express antigens, and activated T cells secrete cytokines to activate B cells [Parker, DC (1993) Annu. Rev. Immunol. 11, 331-360; And Clark, EA, and Ledbetter, JA (1994) Nature 367, 425-428. In addition, mycoacid lipids, lipoarabinoman lipoglycans (LAMs), a processed form of cell wall components of mycobacteria other than protein antigens, were identified as hCD1b [Beckman, EM et al (1994) Nature 372, 691-. 694; Bendelac, A. (1995) Science 269, 185-186; Sieling, PA et al (1995) Science 269, 227-230; And Prigozy, TI et al (1997) Immunity 6, 187] and hCD1c [Beckman, EM et al (1996) J. Immunol. 157, 2795-2803] is known. The CD1 family is a non-polymorphic cell surface glycoprotein encoded at a different position from the MHC molecule, but CD1-T cell cross-linking is not clearly identified, but mCD1d1 is recognized by CD8 ⁺ and CD4 ⁺ T cells [Castano AR et al ( 1995) Science 269, 223-226; And Cardell, S. et al (1995) J. Exp. Med. 182, 993-1004, hCD1b has been found to be recognized by CD4 ^- CD8 ^- T cells [Bendelac, A. (1995) Science 269, 185-186]. In other words, it is estimated that CD1 may be involved in the expression of various antigens other than proteins found in pathogenic microorganisms. The clues that DNA is involved in anti-DNA-specific B cell stimulation have been observed in several studies. Krishnan and Marion have shown that anti-DNA antibodies are produced when immunized mice by binding DNA to peptides [Krishnaa, MR, and Marion, TN (1993) J. Immunol. 150, 4948-4957. Therefore, in the presence of anti-DNA antibodies in several autoimmune diseases, it is important to confirm whether the activation of B cells for the production of such anti-DNA antibodies depends on MHC-limited T cell stimulation. Waisman et al . Suggested that specific activation of T cells by DNA is associated with DNA expression by MHC class II molecules [Waisman, A. et al (1996) Cell. Immunol. 173, 7-14. In other words, MHC class II molecules on the surface of APC bind DNA and T cells can specifically proliferate in DNA. From these results, we suggest that DNA plays an important role in autoimmune diseases. It was. However, there is little research and information on the processing and expression mechanisms of DNA antigens. In fact, little is known about whether bacterial DNA is processed in APCs and expressed by MHC molecules like protein antigens, or whether there are other molecules involved in expression.

Many researchers found that bacterial DNA also differentiates from its own DNA by vertebrates and contributes to the activation of immune cells. A characteristic of bacterial DNA that is recognized as nonmagnetic by vertebrates is the high frequency of unmethylated CpG dinucleotides. The remarkable differences between bacterial DNA and vertebrate DNA can be summarized as follows. First, the incidence of CpG dinucleotides is 1 in 16 DNAs in bacterial DNA, but only about a quarter in vertebrates compared to bacteria. In other words, CpG inhibition is present in vertebrate DNA [Bird, AP (1995) Trends Genet. 11, 94-100]. Second, CpG dinucleotides present in bacterial DNA have a low frequency of methylation. In vertebrates, about 80% is methylated, whereas micro-cytosine is present with little methylation [Razin, A., and Friedman, J. (1981) Prog. Nucleic Acid Res. Mol. Biol. 25, 33-52]. Third, the incidence of two 5'-purines and two 3'-pyrimidines at both ends of bacterial CpG dinucleotides is higher than in vertebrate DNA [Razin, A., and Friedman, J. (1981). ) Prog. Nucleic Acid Res. Mol. Biol. 25, 33-52]. The unusual structure of this bacterial DNA is called the CpG motif, which has been shown to activate immune function. That is, the presence of two 5'-purines and two 3'-pyrimidines on both sides of the CpG dinucleotide (mitogen CpGs) is much higher than that of other bases (non-stimulating CpGs).

In order to study the activation and function of immune cells by characteristic sequences of bacterial DNA, many researchers used oligodeoxyribonucleotides (ODN). Yamamoto [Yamamoto, S. et al (1992) J. Immunol. 148, 4072-4076 and other researchers [Cowdery, JS et al (1996) J. Immunol. 156, 4570-4575; And Ballas, ZK et al (1996) J. Immunol. 157, 1840-1845] showed that bacterial DNA increases the lytic activity of NK cells and induces production of interferon-γ (IFN-γ). This effect is the palindromic of the CpG motif of bacterial DNA. It was reported to be related to the sequencing [Kuramoto, E. et al (1992) Jpn. J. Cancer Res. 83, 1128-1131; And Kimura, Y. et al (1994) J. Biochem. 116, 991-994. Other researchers have also shown that bacterial DNA binds to DNA-binding proteins and induces B cell activation [Gilkeson, GS et al (1995) J. Clin. Invest. 95, 1398-1402; Yamamoto, S. et al (1992) J. Immunol. 148, 4072-4076; Gilkeson, GS et al (1989) J. Immunol. 142, 1482-1486; Messina, JP et al (1991) J. Immunol. 147, 1759-1764; Field, AK et al (1967) Proc. Natl. Acad. Sci. USA 58, 1004-1010; And Oehler, JR, and Herverman, RB (1978) Int. J. Cancer 21, 221-220. In other words, B cell activation is promoted by the CpG motif consisting of six bases of bacteria. A characteristic of immune response by bacterial infection along with B cell activation is that it produces cytokines, immunomodulators [Van Damme, J. et al (1989) Eur. J. Immunol. 19, 163-168; And Paul, WE et al (1993) Adv. Immunol. 53, 1-29]. CpG motifs have also been shown to be involved in the secretion of IL-12 involved in cellular immunity and IL-6 involved in humoral immunity [Halpern, MD et al (1996) Cell. Immunol. 167, 72-78; Yi, A.-K. et al (1996) J. Immunol. 157, 5394-5402; And Klinman, DM et al (1996) Proc. Natl. Acad. Sci. USA 93, 2879-2883. Thus produced cytokines include IL-6 [Uyttenhove, C. et al (1988) J. Exp. Med. 167, 1417-1427; Muraguchi, A. et al (1988) J. Exp. Med. 167, 332-344; Le, JM, and Vilcek, J. (1989) Lab, Invest. 61, 588-602; And Hirano, T. et al (1990) Immunol. Today 11, 443-449] and IFN-γ, which enhances the function of macrophages that act to eliminate intracellular and external pathogens [Murray, HW (1990) Diagn. Microbial. Infect. Dis. 13, 411-421] and IL-12, which regulates the production of IFN- [gamma] and contributes to the activation of NK cells [Trinchieri, G. (1994) Blood 84, 4008-4027; Zhan, Y., and Cheers, C. (1995) Infect. Immun. 63, 1387-1390; And Bohn, E. et al (1994) Infect. Immun. 62, 3027-3032]. IL-12 and IFN- [gamma] increase type 1 cytokine production [Klinman, DM et al (1996) Proc. Natl. Acad. Sci. USA 93, 2879-2883; Zhan, Y., and Cheers, C. (1995) Infect. Immun. 63, 1387-1390; Bohn, E. et al (1994) Infect. Immun. 62, 3027-3032; And Heinzel, FP et al (1991) Proc. Natl. Acad. Sci. USA 88, 7011-7015] plays an important role in eliminating human pathogens. IL-6 is a type 2 cytokine for the growth and differentiation of T and B cells [Uyttenhove, C. et al (1988) J. Exp. Med. 167, 1417-1427; Muraguchi, A. et al (1988) J. Exp. Med. 167, 332-344; Le, JM, and Vilcek, J. (1989) Lab, Invest. 61, 588-602; And Hirano, T. et al (1990) Immunol. Today 11, 443-449] to stimulate antibody production [Hirano, T. et al (1986) Nature 324, 73-76]. In fact, it was observed that stunned mice that destroyed the IL-6 gene were susceptible to infection [Yi, A.-K. et al (1996) J. Immunol. 157, 5394-5402; And Libert, C. et al (1994) Eur. J. Immunol. 24, 2237-2242. Therefore, bacterial DNA is understood to induce the production of cytokines involved in cellular and humoral immunity. In addition, the induction of B cell proliferation and antibody production by bacterial DNA has been reported recently [Krieg, AM et al (1995) Nature 374, 546-549; Liang, H. et al (1996) J. Clin. Invest. 98, 1119-1129; And Yi, A.-K. et al (1996) J. Immunol. 156, 558-564]. A study by Krieg et al. [Krieg, AM et al (1995) Nature 374, 546-549] revealed that CpG motifs present in ODN are essential for activating B cells to proliferate and to induce IgM secretion. Expression of class II MHC molecules, a typical phenomenon in cell activation, was increased and the cell cycle started from G ₀ to G ₁ . Sato et al. [Sato, Y. et al (1996) Science 273, 352-354] reported that when plasmid DNA with an immunostimulatory DNA sequence (ISS) with a short CpG motif was transfected into mononuclear cells, IFN- Increasing levels of α, IFN-β, and IL-12 were observed. The results of this study show that transfection of plasmids containing ISS with bone marrow stem cells activates macrophages and T cells in the surroundings, which can lead to misplacement of hepatocytes in vivo. Thus, vectors for use in therapies for replacing genes in somatic or hepatocytes should be devised without ISS. On the other hand, for gene vaccines, it can be pointed out that repeating many ISSs in plasmid DNA is one way to increase efficiency.

Bacteria DNA must enter the cell to activate it. ODN attached to cell culture vessels did not activate B cells (Krieg, AM et al (1995) Nature 374, 546-549), and when lipofection of oligonucleotides resulted in increased influx into cells and NK cells Has been found to increase significantly [Yamamoto, T. et al, (1994) Microbiol. Immunol. 38, 831-836. And it has been found that all oligonucleotides with or without the CpG motif do not differ significantly in binding to the cell surface [Krieg, AM et al (1995) Nature 374, 546-549; And Yamamoto, T. et al, (1994) Microbiol. Immunol. 38, 831-836. DNA entering monocytes was found to be degraded in the endosomal compartment [Bennett, RM et al (1985) J. Clin. Invest. 76, 2182-2190], showed that bacterial DNA and transcription factor nuclear factor-kB bind in macrophages and significantly increase the expression of TNF-α, IL1β and plasminogen activator inhibitor-2 mRNA [Stacey, KJ et al (1996) J. Immunol. 157, 2116-2122. Intracellular influx of oligonucleotides via cell surface receptors was expected to occur by endocytosis [Bennett, RM et al (1985) J. Clin. Invest. 76, 2182-2190], but have been studied using fluorescently labeled phosphorothioate oligodeoxynucleotides in peripheral blood, bone marrow cells, and leuchemia cell lines [Loke, SL et al (1989) Proc. Natl. Acad. Sci. USA 86, 3474-3478; Yakubov, LA et al (1989) Proc. Natl. Acad. Sci. USA 86, 6454-6458; And Zhao, Q. et al (1996) Blood 88, 1788-1795]. No characterization and mechanisms have been identified.

To date, bacterial DNA is understood to play an important role in the immune system, and bacterial DNA provides the cause of anti-DNA antibody production, resulting in SLE, an autoimmune disease. In addition, CpG motif of bacterial DNA is introduced into immune cells to activate the cells to promote the release of cytokines and IgM secretion. However, there has been no report on the bacterial DNA that plays such an important role in the mechanism of SLE and how the oligonucleotides with CpG motif are produced in the cell.

In the present invention, the presence of specific endonuclease characteristically biosynthetic and secreted in human B-lympha IM9 cell line and differentiated myelogeneous U937 cell line was identified and its biochemical characteristics were identified. In addition to a series of experimental results that I required for antigenic processing of bacterial DNA, I found that it is an essential enzyme for the production of oligonucleotides with a CpG motif.

1 shows the inventive endonuclease activity of IM9 cells analyzed by DNA-natural-PAGE (endos in IM9 cell lysate (A), medium (B) and medium cultured without serum (C) Nuclease activity was detected by the in-gel system and bovine DNase I (lane 1) and culture medium endonuclease activity (lane 2) were compared (D).

2 shows the present endonucleases activity of DNase I and IM9 culture media analyzed by DNA-natural-PAGE.

3 shows immunoprecipitation of the endonuclease activity of the invention by anti-bovine DNase I antibodies.

Figure 4 shows pretreatment of IM9 cells with actinomycin D and the secretion of endonucleases of the invention (incubation periods where the endonuclease activity of cell lysate (A) and culture medium (B) is indicated after pretreatment Analyzed during).

5 is a comparative analysis of the present endonuclease activity of immune cell lines.

6 shows the present endonuclease activity of IFN-γ or IL-1β treated IM9 cell culture media and cell lysates analyzed by DNA-natural-PAGE.

Figure 7 shows the optimal pH for the activity of the endonuclease of the present invention.

FIG. 8 shows the requirements of divalent cations for endonuclease activity of the invention (A shows endonucleases of Ca ²⁺ and / or Mg ^{2+ at} the indicated concentrations in 20 mM Tris-HCl, pH 7.0. Reaction with 100 ng of plasmid DNA in the presence or absence of 37 to 10 minutes and B is the result of enzymatic reaction for 180 minutes in the presence of 10 mM Mg ²⁺ ).

9 shows proliferation curves of T937, LPS and CHX treated U937 cells.

FIG. 10 shows the results of analysis of the synthesis and secretion of the endonuclease of the present invention by DNA-natural-PAGE with TPA-concentration dependence in U937 cells (cell lysate (A) and culture by incubation at the indicated TPA concentration for 24 hours. Medium (B)).

Figure 11 shows the present endonuclease activity of TPA treated U937 cell lysates and culture media analyzed by in-gel system.

Figure 12 shows the inventive endonuclease activity of L937 treated U937 cell lysate and culture medium (endonuclease activity of cell lysate (A) and medium (B) was determined by DNA-natural-PAGE 1 ng / ml LPA treatment followed for the indicated incubation period).

Figure 13 shows the inventive endonuclease activity of U937 cells treated with stimulating factors (lane 1 is U937 cell culture in RPMI1640 medium containing 10% FBS for 48 hours, lane 2 is TPA (48 hours). 10 ng / ml), lane 3 treated with LPS (1 ng / ml) for 24 hours, lane 4 treated with CHX (10 ug / ml) for 12 hours).

14 shows the endonuclease activity of the invention in nuclei isolated from IM9 cells by autolysis methods.

15 shows apoptotic apoptosis of IM9 cells by CHX treatment.

16 shows the present endonucleases activity of IM9 cell lysates and nuclei analyzed by DNA-natural-PAGE.

Figure 17 shows the requirements of divalent cations for the activity of the endonuclease of the present invention.

18 shows degradation over time of plasmid DNA by endonucleases of the invention.

19 shows this. The reaction products of endonucleases against E. coli DNA, IM9 cell DNA and salmon sperm DNA are shown.

20 shows Southern blot analysis of foreign DNA introduced into IM9 cells.

Figure 21 is a schematic diagram for cloning and sequencing of DNA fragments obtained by the endonuclease reaction of the present invention.

22 shows DNA fragments produced by processing of bacterial DNA in IM9 cells.

23 shows DNA fragments produced by processing of bacterial DNA in U937 cells.

Figure 24 shows the detection result of the reaction product of the endonuclease of the present invention.

25 shows induction of IgM secretion by CpG motif in bacterial DNA or oligonucleotides.

Figure 26 shows the product of the endonuclease reaction of the invention using the EC1 PCR product as a substrate.

Figure 27 shows the product of the endonuclease reaction of the invention using the EC2 PCR product as a substrate.

Figure 28 shows the product of the endonuclease reaction of the invention using HC1 PCR product as substrate.

29 shows inhibition of endonuclease activity by Zn ²⁺ and EDTA.

30 shows the products of the endonuclease reactions of the present invention from EC1 PCR products reacted with the indicated IM9 cell culture medium amounts.

Figure 31 shows products from endonucleases reacted with EC1 PCR products for the indicated times.

FIG. 32 compares short DNA fragments digested by EC2 PCR product (157 bp) and Alu I of the present endonuclease activity.

Figure 33 shows the identification of 3'-exonuclease of the endonuclease of the invention secreted from IM9 cells.

Figure 34 compares endonuclease reaction products, products processed by IM9 cells, and DNase I reaction products of the invention.

35 shows the identification of single chain fragments derived from endonuclease reactions by S1 nuclease reactions.

36 shows the chromatographic fractionation results of IM9 cell culture medium by mono S HR5 / 5 ion exchange chromatography.

37 shows the results of purification of endonucleases by RESOURCE PHE hydrophobic interaction chromatography.

38 shows the SDS-PAGE results of the purified endonuclease of the present invention by ion exchange chromatography and hydrophobic interaction chromatography.

39 shows the result of molecular weight determination of purified endonucleases by SDS-PAGE.

FIG. 40 shows the results of natural-pore gradient gel electrophoresis (4-15%) of mono S chromatographic fractions with inventive endonuclease activity (B) and eluted from the gel band of panel B in agarose gel electrophoresis. Show the endonuclease activity (B) of the protein.

FIG. 41 shows SDS polyacrylamide gel electrophoresis and natural-gradient PAGE gel elution results of the active bands of the present endonucleases purified by ion exchange chromatography.

42 shows the effect of cations on purified endonuclease activity in isolated U937 cell nuclei.

In one aspect, the present invention provides a novel endonuclease that is secreted from immune cells and recognizes and processes bacterial DNA as an external substance to produce about 10 bp single stranded oligonucleotides with a CpG motif that is involved in the immune response. To provide. The endonuclease of the present invention was found to be 72.4 kD by molecular weight measurement by SDS-PAGE.

In another aspect, the present invention is directed to culturing a human B-lympha IM9 cell line or a myeloid U937 cell line treated with TPA in a medium suitable for producing the endonucleases described above and synthesized and secreted from the cultured immune cells from the culture medium. It provides a method for producing the endonuclease comprising purifying the endonuclease.

In another aspect, the present invention provides an adjuvant comprising about 10 bp single chain oligonucleotides having a CpG motif formed by treating bacterial DNA with the endonuclease of the present invention.

The invention will be explained in detail through the following examples.

Example 1

Synthesis and Secretion of Endonuclease of the Invention in Immune Cells

The enzymatic activity of DNase I is widely distributed in human tissues and body fluids and accordingly digestive function [Nadano D. et al (1993)Clin. Chem.39, 448-452; And Yasuda T. et al (1993)Clin. Chim. Acta.218, 5-16] in addition to physiological in vivo It has been assumed that the function will exist. DNase I is known to cleave internucleosomal DNA during apoptosis [Peitsch M. C. et al (1993)EMBO J.12, 371-377] The enzyme is also present in human serum and its biochemical properties have been reported [Love J. D., and Hewitt R. R. (1979).J. Biol. Chem.254, 12588-12594; And Kishi K. et al (1990)Am. J. Hum. Genet.47, 121-126. Serum DNase I was found to be secreted by the pancreas [Love J. D., and Hewitt R. R. (1979)J. Biol. Chem.254, 12588-12594; And Ito K. et al (1984)J. Biochem.95, 1399-1406], research in other organizations is still ongoing. Messina et al. [Messina, J. P. et al (1991)J. Immunol.147, 1759-1764] showed that DNase I did not completely degrade the bacterial DNA to produce CpG motifs that activate B cells and macrophages. On the other hand, bacterial DNA that did not treat DNase I promoted the release of cytokines and IgM by activating immune cells. This pattern was consistent with treatment of ODN cells with CpG motif. Therefore, in the present invention, assuming that a new type of endonuclease capable of recognizing and processing external DNA to generate a CpG motif may exist in immune cells, the presence of such enzymatic activity in experiments using several immune cell lines Confirmed.

1-1 Cell Culture and Pretreatment

Human B-lympha (IM9 and RPMI1788) cell lines, T-lympha (Molt-4 and Jurkat) cell lines, and myeloid (U937) cell lines were purchased from the American Type Culture Collection ([ATCC] Rockville, MD). Cells were cultured in RPMI1640 medium containing 10% fetal calf serum (FBS, Gibco BRL) while maintaining the number of 4-5 × 10 ⁵ cells per ml. Cell culture was carried out in an incubator (Forma) containing 5% CO ₂ at 37 ^° C. Cell number and viability during cell culture were measured periodically by trypan blue exclusion using a hemocytometer. Cell viability was maintained at 95% or higher in all experiments. Actinomycin D (ACD, Sigma) was pretreated at 0.33 ug / ml in IM9 cell lines to confirm the endothelial biosynthesis in cells [Cooper HL, and Braverman R. (1977) Nature 269, 527-529 ]. Endonuclease enzyme activity was measured at regular time intervals after treatment with ACD for 30 minutes, treated with ACD, washed, and incubated for 48 hours in RPMI1640 medium containing 10% FBS.

As a result, DNA-natural-PAGE nuclease activity assay was performed to analyze whether endonuclease enzymatic activity appeared in cell culture medium and cell lysate of cells involved in various immune responses. Endonuclease activity secreted in the tested cell cultures could only be observed in the IM9 cell line (FIG. 5B, lane 2). However, it was confirmed that endonuclease activity was always present in cell lysates in culture of human T-lympha cell line, Molt-4 cell line (FIG. 5A, lane 4), but not in cell culture. The enzymatic activity of this endonuclease could not be observed in cell culture or cell lysates in the myelogenous cell line U937 cell line, B-lymphocyte cell line RPMI1788 cell line, and T-lympha cell line Jurkat cell line. In addition, as shown in FIG. 4, it could be observed that the endonuclease biosynthesis (FIG. 4A) and secretion into the cell culture medium (FIG. 4B) in the cells were markedly reduced initially after ACD pretreatment. These experimental results show that the synthesis and secretion of endonucleases in the IM9 cell line is closely related.

To determine how cytokines involved in the immune response affect endonuclease synthesis and secretion, interferon-γ (IFN-γ, 10 units / ml, Genetech Inc) and interleukin-1β (IL-1β, 10 units / ml, Genetech Inc.). As a result of analysis of DNA-natural-PAGE while culturing cells for 24 hours in a medium containing interleukin, as shown in FIG. 6, it was found that these cytokines did not significantly affect endonuclease secretion. In addition, it was observed that mitogen, LPS or TPA, had no effect on the secretion of endonucleases.

The synthesis and secretion of endonucleases were observed by treatment of 12-O-tetradecanoyl phorbol 13-acetate (TPA, Sigma) with differentiating monocytes at different concentrations over time in U937 cells. Cycloheximide (CHX, 10 mg / ml, Sigma) and mitogen lipopolysaccharide (LPS, 1 ng / ml, Sigma) were treated with U937 cells and compared with TPA treated cells. The cells were treated with phosphate-buffered saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na ₂ HPO ₄ , 1.8 mM KH ₂ PO ₄ , pH 7.4) to observe the cell appearance when the cells were treated with various substances. After washing, cytocentrifuge slides were prepared and confirmed by staining with Wright-Giemsa (Sigma). As a result, human myeloid leuchemia cell lines, such as U937, show a mature morphology and stop growth while differentiated by TPA stimulation, whereas cell proliferation occurs by LPS stimulation. When the growth curve of the cells by the mitogen is drawn as shown in FIG. In other words, U937 cell line was differentiated by TPA and the growth of cells was stopped due to the change of the shape of the cells, and the cell proliferation was observed by LPS. On the other hand, treatment with CHX, one of the apoptosis-inducing substances, resulted in cell death. Experiments were performed to observe whether endonucleases were produced and secreted under these cell culture conditions. In Figure 10 it can be seen that the intracellular biosynthesis of the endonuclease increases with increasing TPA concentration (Fig. 10A) and at the same time it can be observed that the enzyme is continuously secreted outside the cell (Fig. 10B). Endonuclease biosynthesis was seen to increase significantly from the TPA concentration of 10 pg / ml (FIG. 10A), when 10 ng / ml of TPA was treated in U937 cell culture medium and the endonuclease activity was observed at regular intervals. 11 shows the same result. Endonuclease enzyme activity is synthesized and released from 6 hours after TPA treatment, the synthesis and secretion appear the most after 24 hours. When the LPS for proliferating cells was treated at a concentration of 1 ng / ml and the activity of the endonuclease was measured at regular time intervals, the results as shown in FIG. 12 were observed. Enzyme activity appeared in the cell lysate 12 hours after LPS treatment, and high enzyme activity was observed after 24 hours, whereas such enzyme activity was not observed at all in the cell culture for 24 hours. When the CH937, a substance that induces apoptosis, was treated in the U937 cell line, the cell death could be observed under a microscope, and it did not affect the endonuclease biosynthesis at all (FIG. 13, lane 4). Enzyme activity when treated with TPA, LPS, and CHX in the U937 cell line is summarized in FIG. 13.

Preparation of 1-2 Cell Lysates and Measurement of Endonuclease Activity in DNA-Natural-PAGE

Cell culture was centrifuged for 5 minutes at 1,500 rpm to take the supernatant. Cells were washed twice with cold PBS followed by 0.5% Nonidet P-40 (NP-40) buffer containing 150 mM NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA and 1 mM PMSF (lysis buffer). Solution) was resuspended to 1 x 10 ⁷ cells / ml. 4 ^o C then allowed to stand for 15 minutes to dissolve the cells by centrifugation at 12,000 rpm for 15 min at 4 ^o C and the supernatant was used as cell lysates.

A modified natural polyacrylamide gel assay system was used to measure and characterize endonuclease activity. Using a Hoefer Tall Mighty Small (0.75 mm x 8 cm x 11 cm) vertical electrophoresis device, a 7% polyacrylamide gel without SDS was used to supercoiled plasmid DNA (pGEM-T vector, 3.0 kb, Promega). ) Was copolymerized to a final concentration of 150 ug / ml. Protein samples of cell culture or cell lysate were loaded at 10 ug per well, followed by electrophoresis at 4 ^° C. After electrophoresis, the gel was washed three times with distilled water and reacted by shaking at 37 ^o C for 4 hours in a reaction buffer consisting of 20 mM Tris-HCl (pH 7.0), 1 mM CaCl ₂ and 10 mM MgCl ₂ (TCM buffer). I was. In order to elucidate the reaction specificity of the endonuclease on DNA-natural-PAGE, the enzyme activity was observed when the reaction time was changed. Reaction in which the gel is 37 ^o staining in TCM buffer containing ethidium bromide in 1 ug / ml of C for 30 min and photographed with 302 nm transfected room Lumi-ordinator (transilluminator). The location of nuclease activity in the gel was observed as a black band on an orange background. Bovine pancreatic DNase I (RNase-free 10-50 × 10 ³ units / ml, Boehringer Mannheim) was used as a standard for endonuclease activity.

The DNA-natural-PAGE nuclease assay system designed in the present invention shows that the enzyme activity in cell culture medium and cell lysate can be selectively measured with sensitivity (FIG. 1). A strong activity band was observed at the site of endonuclease activity in cell culture and cell lysate containing 10 ug of protein. As a result of analyzing the biosynthesis and secretion of the endonuclease according to the culture time of the IM9 cell line is shown in FIG. The degree of endonuclease enzyme activity in the cell lysate was almost constant when incubated for 48 hours (FIG. 1A), but in the cell culture medium, a considerable amount of endonuclease activity was accumulated under the same experimental conditions (FIG. 1B). It could be observed. When the cultured IM9 cell line was washed several times with PBS and then transferred to a serum-free medium, the major endonuclease activity bands observed in FIG. 1B were observed, but there was no DNase I enzyme activity. Appeared (FIG. 1C). These results indicate that the endonucleases observed in IM9 cell culture medium and cell lysate were not derived from FBS, which is a culture medium component, but were synthesized in cells and secreted into the medium. The weak nuclease activity band rapidly shifted on electrophoresis in the cell culture of FIG. 1B was confirmed to be DNase I compared to DNase I of a cow purchased from Boehringer Mannheim (FIG. 1D).

In FIG. 2, enzyme activity was measured for 1 hour and 4 hours under different reaction solutions under DNA-natural-PAGE. When reacted in 20 mM Tris-HCl (pH 7.0) buffer containing 10 mM Mg ²⁺ for 1 hour, only the endonuclease secreted from the IM9 cell line showed enzymatic activity as shown in FIG. 2A. However, when the reaction time was extended for 4 hours under the same reaction conditions (FIG. 2B), DNase I present in FBS together with the purchased DNase I also showed enzymatic activity at the same position. From the above results, the endonuclease produced and secreted in the IM9 cell line showed a different migration distance from DNase I on the natural-PAGE, and it was confirmed that the reactivity of the enzymes was different under the given reaction conditions.

1-3 Antibody Production and Immunoprecipitation for DNase I

Blood was collected from the tails of Sprague-Dawley (SD, 150-200 g) mice to obtain pre-immune sera. Bovine pancreatic DNase I (Sigma) was used to immunize the protein bands corresponding to DNase I on 7% native-PAGE in small pieces in sterile PBS. 100 ug of protein in SD mice was immunized according to standard methods [Harlow, E., and Lane, D. (1988) Antibodies, A laboratory manual, Cold Spring Harbor, New York]. Ten days after four inoculations, blood was collected from rats to determine antibody titer and specificity. Anti-DNase I antibodies were purified from serum containing DNase I using ImmunoPure plus protein A / G IgG Purification Kit (Pierce) and Sepharose-CL 4B conjugated with bovine DNase I. 50 ml of cell culture medium or 50 ml of human plasma diluted 10-fold in PBS were immunoprecipitated with beads combining the purified anti-DNase I antibody and protein A-Sepharose CL 4B. Immunoprecipitation was performed by shaking slowly at 4 ^o C for 6 hours. Immunoprecipitated supernatants were taken to measure endonuclease enzyme activity on DNA-natural-PAGE.

FIG. 3A shows that the prepared antibody recognizes DNase I derived from FBS, and also has cross-reactivity with DNase I present in human serum. Of course, preimmune serum did not recognize DNase I in FBS and human serum. The cross-reactivity of each secreted endonuclease and DNase I was analyzed using the prepared DNase I antibody. The supernatant immunized with the IM9 cell line culture with anti-DNase I antibody did not show rapidly moving DNase I enzyme activity, but the enzyme activity of the secreted endonuclease was recovered as it was without immunoprecipitation (FIG. 3B). Could. These results provide further evidence that the endonuclease secreted from the IM9 cell line is clearly distinguished from DNase I immunologically.

Partial Purification and Characterization of 1-4 Endonuclease Activity

In order to partially purify the endonuclease from the culture medium of the IM9 cell line, the protein band of the enzyme-activated region was eluted after electrophoresis as in Preparation Example 1-2. Protein strips of nuclease-activated sites were cut into small pieces, transferred to eppendorf microtubes, and shaken for 10 hours at 4 ^o C with 20 mM Tris-HCl (pH 7.0) buffer. Was performed. The sample was centrifuged at 14,000 rpm for 10 minutes at 4 ^o C, and the supernatant was dispensed by 20 ul for the experiment. The eluted 20 ng of recovered protein sample was reacted with ultra plasmid DNA at 37 ^° C. for 10 minutes in 20 mM Tris-HCl buffer (pH 7.0) containing various concentrations of cations. To measure the effect of pH on enzyme activity, enzyme activity was measured in 20 mM MOPS buffer containing 1 mM CaCl ₂ and 10 mM MgCl ₂ at different pH. To analyze the enzymatic activity of endonucleases according to the reaction time, the enzyme reaction was carried out at regular intervals in 20 mM Tris-HCl buffer (pH 7.0) containing 10 mM MgCl ₂ for 180 minutes at 37 ^° C. Observed. The reaction was followed by the addition of TE (10 mM Tris-HCl, pH 7.6, 1 mM EDTA) buffer containing DNA sample buffer (30% glycerol, 0.5% bromophenol blue, and 0.5% xylene cynol). To stop the reaction. The reaction product was confirmed by electrophoresis on a 1% agarose gel containing ethidium bromide (0.5 ug / ml).

The pH of the isolated enzyme with the optimum activity was observed at 7.0, but it was observed that the catalytic activity appeared in a relatively wide range of pH (Fig. 7). It can be seen that the enzymatic activity of the endonuclease in 20 mM Tris-HCl (pH 7.0) buffer is Mg ²⁺ dependent and not affected by Ca ²⁺ (FIG. 8A). In the Ca ²⁺ concentration range of 1-10 mM range, the enzyme activity was not expressed, but linear DNA was formed from the plasmid by the enzyme activity depending on the Mg ²⁺ concentration. In parallel, Mg ²⁺ -dependent linear DNA formation was observed according to the reaction time of the endonuclease. The reaction of the conversion of the ultra plasmid DNA into the linear DNA began to appear after 10 minutes of reaction and gradually increased to 60 minutes, and the nuclease activity lasted more than 180 minutes under these experimental conditions (FIG. 8B). Therefore, it can be seen that the enzyme converts the super plasmid DNA into linear DNA and then continues to digest it. From these results, it was confirmed that the activity of endonuclease secreted by IM9 immune cells is Mg ²⁺ -dependent. .

In the present invention, Mg ²⁺ -dependent endonuclease activity was produced in a constant amount in the IM9 cell line and was continuously secreted into the cell culture fluid. In addition, the endonuclease was different from DNase I in FBS and human serum as a result of the difference in the distance traveled in natural-PAGE and immunoprecipitation using anti-DNase I antibody. Compared to endonucleases, which have been reported to affect DNA cleavage during the apoptosis process, they are distinguished from various biochemical properties such as cation dependence of enzymatic activity, migration distance in natural-PAGE, and optimal pH required for activity. Shows the difference. In addition, from the fact that differentiation of U937 cell line produces and secretes endonucleases, it has been found that the endonuclease has a very important biological function in the immune response to recognize and degrade the appropriate DNA. In other words, the hypothesis that endonuclease secreted out of the cell can play an important role in close association with the defense against foreign DNA is very interesting. The function of these endonucleases has been shown by Stacey et al . Recently that macrophages accept bacterial DNA, resulting in cell activation [Stacey, KJ et al (1996) J. Immunol. 157, 2116-2122] and Higashi et al . [Higashi, N. et al (1993) Cell. Immunol. 150, 333-342, which supports the fact that cytotoxicity mediated by monocytes / macrophages can be caused by nucleases.

Example 2

Characterization of Mg ²⁺ -dependent Endonuclease Inducing DNA Cleavage Between Nucleosomes

Apoptosis is defined as a characteristic form of apoptosis in which chromatin cleavage occurs at various nucleosome sizes by the action of chromatin aggregation, membrane blebbing, and endonucleases [Wyllie, AH et al (1984) J. Pathol. 142, 67-77; Wyllie, AH (1980) Nature 284, 555-556; And Kerr, JFR et al (1972) Br. J. Cancer. 26, 239-257. Activation of endonucleases is an important part of the apoptosis process [Arends, MJ, and Wyllie, AH (1990) Am. J. Pathol. 136, 593-608, many researchers have proposed enzymes involved in the cleavage of several nucleosomes. Enzymes involved in internucleosome cleavage of DNA include DNase I [Peitsch MC et al (1993) EMBO J. 12, 371-377], DNase II [Torriglia A. et al (1995) J. Biol. Chem. 270, 28579-28585; And Barry MA, and Eastman A. (1993) Arch. Biochem. Biophys. 300, 440-450, and NUC-18 [Kawabata, H. et al (1997) Biochem. Biophys. Res. Commun. 233, 133-138]. In addition, many researchers have found that Ca ²⁺ / Mg ²⁺ -dependent [Stratling WH et al (1984) J. Biol. Chem. 259, 5893-5898; Pandey S. et al (1997) Biochemistry 36, 711-720; And Ribeiro JM, and Carson DA (1993) Biochemistry 32, 9129-9136 or Mg ²⁺ -dependent [Anzai N. et al (1995) Blood 86, 917-923; Kawabata H. et al (1993) Biochem. Biophys. Res. Commun. 191, 247-254; Sun XM, and Cohen GM (1994) J. Biol. Chem. 269, 14857-14860; And Kawabata, H. et al (1997) Biochem. Biophys. Res. Commun. 233, 133-138] It has been suggested that endonucleases can cleave DNA between nucleosomes in various tissues and cells. However, there is still clear evidence that different types of different endonucleases are involved in different cellular systems or that there is an unknown enzyme that induces chromatin cleavage when cell death occurs actively in all types of cells. It is not presented. Therefore, researches to identify endonucleases that act on apoptosis and to identify the exact mechanism by which enzymes are activated have been of great interest in recent years.

In Preparation Example 1, it was found that human B-lympha IM9 cell line synthesized endonucleases and secreted into cell culture medium using DNA-natural-PAGE. The enzyme showed different characteristics from other endonucleases that have been identified so far, such as movement distance in natural-PAGE, pH for optimal enzymatic activity, and divalent ions required for enzymatic activity.

In the present invention, the enzyme activity presumed to be the same as the endonuclease present in the cell culture solution and cell lysate disclosed in Preparation Example 1 was also present in the nucleus of the cell, and the accumulation of this enzyme was observed in the nucleus during the apoptosis process. Could. The fact that these endonucleases act on the nucleus and induce nucleosome cleavage is probably a protective action in the sense of eliminating cells that are supposed to be killed. CH9 treatment with IM9 cell line confirmed agarose gel electrophoresis of oligonucleosome fragmentation of DNA, known as the apex of biochemical phenomena of apoptosis. When the nuclei isolated from the IM9 cell line were reacted in the presence of Mg ²⁺ , typical DNA cleavage was observed. DNA cleavage by autolysis was clearly Mg ²⁺ -dependent and Ca ^{2+ -independent} . Endonuclease enzymatic activity in the nucleus was also observed in the DNA-natural-PAGE assay system. The optimum pH for the activity of this enzyme was also found to be 6.5-7.5. This result can be presented as experimental evidence that the endonuclease synthesized and secreted by the IM9 cell line identified in Preparation Example 1 and the enzyme present in the nucleus are identical. This endonuclease, which is present in the nucleus of IM9 cells, is also known to be present in many tissues and cells by Mg ²⁺ -dependent endonucleases [Anzai N. et al (1995) Blood 86, 917-923; Kawabata H. et al (1993) Biochem. Biophys. Res. Commun. 191, 247-254; Sun XM, and Cohen GM (1994) J. Biol. Chem. 269, 14857-14860; And Kawabata, H. et al (1997) Biochem. Biophys. Res. Commun. 233, 133-138]. However, there are no researchers who have identified Mg ²⁺ -dependent endonucleases as protein bands or enzyme activity bands in the electrophoretic analysis of the endonucleases involved in apoptosis.

The endonucleases observed in the present invention are Ca ²⁺ / Mg ²⁺ -dependent endonucleases, enzymes involved in internucleosome cleavage of DNA, which have been discovered so far [Stratling WH et al (1984) J. Biol. Chem. 259, 5893-5898; Pandey S. et al (1997) Biochemistry 36, 711-720; And Ribeiro JM, and Carson DA (1993) Biochemistry 32, 9129-9136], DNase I [Peitsch MC et al (1993) EMBO J. 12, 371-377], DNase II [Torriglia A. et al (1995) J Biol. Chem. 270, 28579-28585; And Barry MA, and Eastman A. (1993) Arch. Biochem. Biophys. 300, 440-450, NUC-18 [Kawabata, H. et al (1997) Biochem. Biophys. Res. Commun. 233, 133-138], and calcium dependence, differences in distance traveled in natural-PAGE, and optimal activity pH. Although the physiological significance of the Mg ²⁺ -dependent endonuclease disclosed in the present invention is not clearly identified, it can be assumed that it plays an important role in the apoptosis process from the fact that it is also observed in the nucleus of cells during the apoptosis process. Therefore, enzymatically identifying the activation mechanism and specific function of the endonuclease can provide useful information for understanding the apoptosis process.

2-1 Induction of Apoptosis

After culturing human B-lympha (IM9) cell line, apoptosis was induced by treatment with 10 ug / ml CHX (Sigma) and incubation for 24 hours [Chow, SC et al, (1995) Exp. Cell. Res. 216, 149-159. Changes in the shape of apoptosis-induced cells by CHX were confirmed by staining with Wright-Giemsa (Sigma) after preparing a cell centrifuge slide.

In FIG. 15A, when CHX (10 ug / ml) was treated with IM9 cell line for 24 hours, DNA fragmentation was observed, which is a form of characteristic internucleosome DNA cleavage. The effect of CHX began to appear after 12 hours and after 24 hours, a large amount of DNA fragments were formed. Staining with Wright-Giemsa in order to observe the morphology of the cells that occurs when the cells die by apoptosis is shown in Figure 15C. In the cells treated with CHX, many apoptosis-producing cells were present, and the characteristic cell-like changes in which the cells collapsed, chromatin collected, and nucleus fragmented (FIG. 15C) were compared with normal growing cells (FIG. 15B).

2-2 Confirmation of DNA Cleavage by Endonuclease of IM9 Cell Line Treated with CHX

Incubated IM9 cell line with 5 x 10 ⁵ cells / ml cell number, treated with 10 ug / ml CHX (Sigma) and incubated for 24 hours, taking 1 x 10 ⁶ cells at regular time intervals. Method [Blin, N., and Stafford, DW (1976) Nucleic Acids Res. 3, 2303-2308] DNA was extracted according to the modified method. 1 x 10 ⁶ cells were washed twice with PBS and resuspended in TE buffer followed by DNA extraction buffer (10 mM Tris-HCl, pH 7.6, 10 mM EDTA, 100 mM NaCl, 0.2% SDS, and 100 ug). 1 ml / ml proteinase K) was added and reacted at 50 ^o C for 8 hours, then the sample was treated twice with phenol / chloroform to remove protein, 0.3 M sodium acetate (pH 5.2) was added, followed by cold ethanol. Precipitated. This precipitate was dissolved in TE (10 mM Tris-HCl, pH7.6, 1 mM EDTA) buffer, treated with RNase A, and electrophoresed on a 1.8% agarose gel. The electrophoretic gel was left in a solution containing 0.5 ug / ml of ethidium bromide for 30 minutes and photographed under UV light.

CH9 treated IM9 cells were taken at regular time intervals to prepare and lyse cell lysates and nuclei, followed by DNA-natural-PAGE nuclease activity gel assay to confirm enzymatic activity of endonucleases in the nucleus. Was performed. In the results of FIG. 16A, it can be seen that the endonuclease enzyme activity is uniformly expressed in the cell lysate when the IM9 cell line is incubated for 24 hours. However, the cell lysate of CHX-treated cells showed a decrease in enzyme activity for 6-12 hours (FIG. 16B), whereas the accumulation of enzyme activity in the nucleus (FIG. 16C) was observed.

2-3 Isolation and Autolysis of Cell Nuclei

To isolate the nuclei of the cells, 1 x 10 ⁷ cells were washed three times with cold PBS and then with 0.5 ml of cold buffer containing 50 mM Tris-HCl (pH 8.0), 5 mM MgCl ₂ and 0.9 M sucrose. Dissolve for 20 min at 4 ^o C. The prepared cell lysate was placed on 0.5 ml of 1.2 M sucrose solution and centrifuged at 800 x g for 40 minutes. The nucleus present in the precipitate was obtained by suspending with 20 mM Tris-HCl (pH 7.0) buffer.

The autolysis of the isolated nuclei was carried out by reacting at constant time intervals at 37 ^o C with varying concentrations of Mg ²⁺ and Ca ²⁺ . The reaction was terminated by adding 0.5 ml of DNA extraction buffer containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1% SDS and proteinase K. After the mixture was reacted at 50 ^° C. for 3 hours, the sample was treated twice with phenol / chloroform to remove the protein, 0.3 M sodium acetate (pH 5.2) was added, and then precipitated with cold ethanol. The precipitate was dissolved in TE buffer, treated with RNase A, and electrophoresed on a 1.8% agarose gel. The electrophoretic gel was left in a solution containing 0.5 ug / ml of ethidium bromide for 30 minutes and photographed under UV light.

As a result of measuring the endonuclease enzyme activity in the nucleus of the IM9 cell line using a method of autolyzing the nuclei of isolated cells, fragments of DNA were generated depending on the concentration of Mg ²⁺ (1 mM, 10 mM). The phenomenon was observed. However, when Mg ²⁺ was replaced with Ca ²⁺ under the same experimental conditions, such DNA cleavage was not observed. Under conditions where Ca ²⁺ and Mg ²⁺ are present, the same type of DNA as Mg ²⁺ is present. Fragment formation appeared (FIG. 14A). In other words, it can be interpreted as a result of DNA degradation due to endonuclease enzyme activity depending on the concentration of Mg ²⁺ . DNA fragmentation did not occur in the nucleus in the presence of 1 mM Zn ²⁺ and 5 mM EDTA (Fig. 14B) for 0-4 hours at fixed concentrations of Mg ²⁺ (10 mM) and Ca ²⁺ (10 mM). As a result of observing DNA fragmentation, DNA fragmentation began 30 minutes after the reaction when Mg ²⁺ alone was present, and the digested DNA fragments accumulated for 60-240 minutes (FIG. 14C). However, DNA fragmentation was not observed for 4 hours in the presence of Ca ²⁺ (FIG. 14D). Through the above experimental results, it was confirmed that Mg ²⁺ is absolutely required for DNA fragment formation for endonuclease activity in IM9 cell nucleus.

Partial Purification and Characterization of Endonucleases in 2-4 Cell Nuclei

Partial purification of the endonuclease present in the nucleus of the cell was performed by dissolving the nucleus and eluting from the protein band of the active site by the method of Preparation Examples 1-4. The bivalent ion dependence was observed by the method of Preparation Example 1-4 while measuring the enzyme activity using the ultra plasmid DNA as a substrate. In addition, changes in enzyme activity were observed when ZnCl ₂ , an inhibitor of apoptosis, and EDTA, a chelating agent, were treated.

To characterize the endonuclease enzyme activity present in the nucleus of IM9 cells identified in DNA-natural-PAGE, the enzyme was isolated and eluted by native-PAGE. As a result of observing the cation-dependency of the endonuclease, it was confirmed that Mg ²⁺ -dependent like the enzyme present in the cell culture solution (FIG. 17). Endonuclease enzyme activity was completely inhibited by Zn ²⁺ , an apoptosis inhibitor, and EDTA, a chelating agent. From these results, it can be seen that Mg ²⁺ is required for the conversion of the ultra plasmid DNA into the linear DNA, which can be interpreted to be consistent with the results shown in FIG. 8.

Example 3

Characterization of endonuclease action and reaction products on immune DNA in immune cells

To date, bacterial DNA, which is recognized as an external substance, has been shown to have a number of structural determinants that do not exist in mammalian DNA, and this factor is known to activate immune cells [Gilkeson, GS et al (1995) J. Clin . Invest. 95, 1398-1402; Gilkeson, GS et al (1991) Clin. Immunol. Immunopathol. 59, 288-300; Messina, JP et al (1993) Cell. Immunol. 147, 148-157; Krieg, AM et al (1995) Nature 374, 546-549; And Halpern, MD et al (1996) Cell. Immunol. 167, 72-78. One of the characteristic differences between mammalian and bacterial DNA is the fact that mammals are significantly methylated in the cytosine of CpG dinucleotides with significant CpG inhibition [Bird, AP (1995) Trends Genet. 11, 94-100; Razin, A., and Friedman, J. (1981) Prog. Nucleic Acid Res. Mol. Biol. 25, 33-52; And Han, J. et al (1994) Antisense Res. Dev. 4, 53-65. Recently, researchers have found that CpG motifs present in bacterial DNA rapidly activate polyclonal B cells to promote IgM secretion [Krieg, AM et al (1995) Nature 374, 546-549; Liang, H. et al (1996) J. Clin. Invest. 98, 1119-1129; And Yi, A.-K. et al (1996) J. Immunol. 156, 558-564], the cell cycle is stopped by anti-IgM antibodies, and the bacterial CpG motif inhibits c- myc expression in B cells where apoptosis occurs and inhibits the expression of myn , blc ₂ , and bcl-X _L mRNAs. It has been suggested to protect cells from apoptosis by increasing [Y, A.-K. et al (1996) J. Immunol. 157, 4918-4925. Another study reported that CpG motif directly activates B cells to promote IL-6 and IL-12 secretion in a short time [Halpern, MD et al (1996) Cell. Immunol. 167, 72-78; Yi, A.-K. et al (1996) J. Immunol. 157, 5394-5402; And Klinman, DM et al (1996) Proc. Natl. Acad. Sci. USA 93, 2879-2883. CpG motifs have also been shown to act on NK cells and induce IFN-γ in weakly CD4 ⁺ cells [Bird, AP (1995) Trends Genet. 11, 94-100; And Yamamoto, S. et al (1992) Microbiol. Immunol. 36, 983-997]. Therefore, activation of immune cells by CpG DNA increases humoral immunity by induction of IL-6 and cellular immunity is increased by secretion of IFN-γ. It is also known that bacterial DNA is activated as macrophages digest, causing TNF-α, IL-1β, and plasminogen activator inhibitor-2 mRNA production [Stacey, KJ et al (1996) J. Immunol. 157, 2116-2122.

In the present invention, the enzymatic activity and end product of the endonuclease which performs the role of recognizing and digesting bacterial DNA in immune cells were identified. In addition, it was confirmed that the appropriately processed DNA fragments in the cell culture were introduced into the cells and processed by the action of endonucleases in the cells. External DNA introduced into immune cells was finally broken down into fragments of about 10 bases of Japanese chains by the action of endonucleases in the cells. The CpG motif consisted of two purine bases at the 5'-end and two pyrimidine bases at the 3'-end. In addition, it was observed that IM9 cell line, B cell, secretes IgM by stimulation of oligonucleotide or PCR amplified DNA with CpG motif. However, it was also confirmed that secretion of IgM was not promoted by DNAs in which the CpG motif was methylated or DNA in eukaryotic cells. These results are consistent with previous findings that CpG motifs act on B cells and macrophages to promote secretion of IgM and cytokines. However, the process of decomposing bacterial DNA to generate CpG motifs and accompanying enzymes was first identified in the present invention.

Bacterial DNA Processing by 3-1 Endonuclease

The culture medium of the IM9 cell line was used as an enzyme source to study the specific activity of the endonuclease and the characteristics of the final reaction product. The IM9 cell line was incubated for 48 hours in 37 ^° C., 5% CO ₂ incubator in RPMI1640 medium containing 10% FBS and used as enzyme source. In addition, the enzyme source containing only the endonuclease secreted from the IM9 cell line without DNase I was cultured for 36 hours in a medium without FBS, and the cell culture solution was used.

Plasmids (pGEM-T vector, 3.0 kb) used as substrates of enzymes were analyzed for alkaline lysis in Escherichia coli [Birboim, HC, and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523], and extracted twice with phenol / chloroform, followed by ethanol precipitation. The genomic DNA of E. coli and the DNA of IM9 cells are described by Blin and Stafford [Blin, N., and Stafford, DW (1976) Nucleic Acids Res. 3, 2303-2308] was extracted according to the modified method. The cells were washed twice with PBS and then resuspended in TE buffer followed by DNA extraction buffer (10 mM Tris-HCl, pH 7.6, 10 mM EDTA, 50 mM NaCl, 0.2% SDS, 20 ug / ml RNase A). After 10 minutes of treatment at 37 ^o C was added to the proteinase K 100 ug / ml and reacted at 50 ^o C for 8 hours. The reaction solution was extracted three times with phenol / chloroform to remove proteins and genomic DNA was obtained by ethanol precipitation. Salmon sperm DNA was also extracted and used in the same manner as above. The amount of LPS present in DNA was determined by Limulus amebocyte lysate assay [Sullivan, JD et al (1976) In Mechanisms in Bacterial Toxicology, AW Bernheimer, ed. Wiley, New York, p. It was determined by the method to determine that the content was 2.5 ng / ml or less.

To compare enzymatic activity in IM9 cell culture medium cultured in medium containing 10% FBS and in medium without FBS, 20 ul of the culture medium was mixed with 100 ng of plasmid DNA and reacted at 37 ^° C. at regular time intervals. . Subsequent determination of endonuclease activity using the cell culture solution was performed using cell culture cultured in a medium without FBS in order to exclude the effect of DNase I present in the FBS. In order to observe the difference in the reactivity of the endonuclease against DNA types, 100 ng of E. coli, IM9 cell line, and salmon sperm genomic DNA were reacted under the above conditions, and the enzyme activity was observed on 1% agarose gel electrophoresis. Confirmed.

First, RPMI1640 medium and IM9 cell culture medium containing 10% FBS were directly taken and the extent of degradation of bacteria DNA was observed in vitro. The results of FIG. 18A show the degree of degradation of plasmid DNA in RPMI 1640 medium containing 10% FBS. This result showed that, unlike the results shown in FIG. 1D, the enzyme activity was not significantly increased even though DNase I was present in the medium. It can be considered that the composition of the medium contains ions or inhibitors that may affect DNase I activity. On the other hand, in the culture medium without FBS and the culture medium containing 10% FBS after cell culture, the plasmid DNA could be seen to be degraded according to the reaction time (FIGS. 18B and 18C). In other words, it can be seen that the plasmid DNA is degraded by endonucleases secreted by the IM9 cell line. Comparing FIGS. 18B and 18C, the enzyme activity is higher in the cell culture medium containing 10% FBS. can do. This indicates that even if the cell number was started to be the same as 2 x 10 ⁵ / ml, the growth of cells occurs actively and the endonuclease is secreted much under the conditions containing FBS. In addition, as a result of testing how the endonuclease action in the cell culture fluid acts on DNA of different species, as shown in FIG. 19, E. coli DNA, eukaryotic IM9 cell line DNA, and salmon sperm DNA were all ended. Clease has been shown to degrade.

3-2 Intracellular Inflow and DNA Sequence Analysis of Bacterial DNA

IM9 cell lines were cultured in a 1: 1 mixture of RPMI1640 medium containing heat-treated 10% FBS and a cell culture medium incubated for 48 hours with an IM9 cell line. Bacterial DNA (25 ug / ml) was added to the prepared culture medium and the IM9 cell line was cultured in a cell number of 1 x 10 ⁶ / ml to take the cells at regular intervals to extract the DNA introduced into the cells.

After bacterial DNA was treated with the IM9 cell line, cells were taken at regular time intervals and washed three times with PBS. The cells were resuspended in cold lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1 mM PMSF, and 0.5% NP-40), followed by the method of Preparation Example 1-2. Thus cell lysate was obtained. DNA extraction buffer was added to the cell lysate in an equal volume and left at 42 ^o C for 3 hours, followed by two treatments with phenol / chloroform to remove proteins and precipitated with ethanol to extract the DNA present in the cell lysate. . The precipitate was dissolved in TE buffer and treated with RNase A to use as a sample for southern blotting.

DNA extracted from the cell lysate was electrophoresed on 1.8% agarose gel, followed by Southern migration. Shake the electrophoretic agarose gel in about 200 ml of alkaline solution (1.5 M NaCl, 0.5 M NaOH) for 20 minutes, wash with distilled water, and then neutralize the solution (1.5 M NaCl, 0.5 M Tris-HCl, pH7.5) After standing for about 20 minutes in ml and shaken by dipping in another neutralization solution. Place another square container in a container containing 20X SSC solution (175.3 g NaCl, 88.2 g sodium citrate and 2 ml of 0.5 M EDTA, add 1 liter of distilled water and sterilize at 121 ^o C). Turn upside down so that the bottom is above the surface of the solution. On the bottom, Whatman No. 3 paper, 2 mm wide, saturated with 20X SSC, was placed without air bubbles to connect both 20X SSCs. The agarose gel was placed upside down on the paper and the Hybond ⁺ nylon membrane was placed without bubbles. On the Hybond ⁺ nylon membrane, all four sides of the Whatman No. 3 paper, which is 2 mm smaller than the agarose gel, were placed without air bubbles.Then, the paper towels were stacked 10-20 cm high and weighed about 500g. Put on top. Parafilm was run around the gel and capillary transfer was performed for 8 hours. The DNA-transferred membrane was UV-crosslinked by UV exposure at 120,000 uJ / cm for 2 minutes.

The reaction product of 100-200 bp generated by reacting bacterial DNA with an endonuclease at 37 ^° C. for 30 minutes was subjected to 1% agarose gel electrophoresis, followed by DNA clean gel (Gene Clean Kit, Promega, Inc.). Was recovered and used as a DNA probe. 50-100 ng of this DNA was boiled in 100 ^° C. water for 3 minutes and rapidly cooled to separate DNA strands and labeled with ³² P. DNA labeling reaction was performed with 10 ng of random primer, 4 ul of buffer (50 mM Tris-HCl, pH8.0, 5 mM MgCl ₂ , 2 mM DTT, 0.5 mM HEPES, pH 6.6), 25 uM dATP, 25 uM dGTP, A random priming method was used in which 20 ul of the mixed solution containing 25 uM dTTP, 60 uCi [α- ³² P] dCTP, and 5 units of Klenow enzyme were reacted at 37 ^° C. for 2 hours. 2 ul of 0.5 M EDTA was added thereto to stop the reaction. Then, the same volume of 3 M sodium acetate (pH 5.2) and 20 ug of salmon sperm DNA were added as co-additives. The precipitate was dissolved in TE buffer, boiled at 100 ^° C. and rapidly cooled in ice.

The UV-crosslinked Hybond ⁺ Nylon membrane was placed in a prehybridized solution (6X SSC, 5X Denhardt's solution, 0.05% sodium pyrophosphate, 0.5% SDS, and 100 ug / ml salmon sperm DNA) pre-bathed at 68 ^° C. ^o Shake at least one hour at C. Thereafter, labeled probes prepared by a random priming method cooled on ice were added and hybridized for about 12 hours. The filter was transferred to Washing Solution I (2X SSC, 0.1% SDS), and then washed for 10 minutes at room temperature. Transfer the filter to wash solution I pre-heated at 68 ^o C and shake for 25 minutes to wash. Also transfer to wash solution II (0.2X SSC, 0.1% SDS) pre-heated at 68 ^o C and measure radioactivity with Geiger counter. Rinse while measuring the degree of detection. The filter was placed in a cassette containing an intensifying screen together with the X-ray film and left for 12-24 hours at -70 ^o C and then developed.

Bacterial DNA or plasmid DNA was incubated at 37 ^o C for 1 hour, and then the DNA fragments present in the cell lysate were subjected to 1.8% agarose gel electrophoresis, followed by 50-200 bp confirmed by Southern migration. The gel corresponding to the site was recovered with Gin Clean Kit (Promega Inc.). These DNA fragments were cloned in Escherichia coli in the pGEM-T vector (Promega Inc.) in the same manner as in FIG. 21 to terminate Sanger's dideoxyribonucleotide chain [Sanger, F. et al (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467] was sequenced using the Sequenase ™ version 2.0 DNA sequencing kit (USB). Sequencing primers were used with the M13 forward / reverse primers shown in Table 1 below. The cloned DNA sequence was identified as a truncated piece of bacterial or plasmid DNA using the BLAST (Basic Local Alignment Search Tools) program.

Oligonucleotides Use ABCDEFGH TTAAAACGTTCACAAGTGAACGTTTTAGCAGCGCTAAAATTAGCGCTGCTCCCGGCCGCCATGTTGGGAGCTCTCCCGTTTTCCCAGTCACGACCAGGAAACAGCTATGAC CpG motifCpG motifCpG motifCpG motifPCR primer PCR primer sequencing (pUC / M13 forward) Sequencing (pUC / M13 inversion)

As a result, when IM9 cells were incubated with 25 ug / ml of bacterial DNA, DNA was properly processed in the cell culture solution and confirmed through the hybridization that used to enter the cells (FIG. 20). After 30 minutes of cell culture, DNA inflow of 100-200 bp was observed, and the amount of DNA of 100-200 bp was decreased in the cell according to the culture time. These results suggest that the IM9 cell line enters the cell with appropriately processed DNA from the outside and continues processing in the cell.

In addition, in order to characterize the product by the endonuclease enzyme activity, the DNA of bacteria introduced into the cell was extracted and the DNA sequence was analyzed by the method described in FIG. 21. The sequencing results show that the CpG motif, which has two purine bases on the 5 'side and two pyrimidine bases on the 3' side, is shown in the endonuclease reaction product as a characteristic sequence as shown in Table 2 below. have. The characteristic CpG motif is known to stimulate cytokine and IgM secretion by activating B cells or macrophages in the immune system and appearing at high frequency in bacterial DNA. From these results, it was revealed that DNA processing by endonuclease and intracellular enzymatic activity of IM9 cell culture media produced CpG motifs that play a role in activating immune cells.

The origin of each sequence in Table 2 is as follows:

E. coli bases 2874223 to 2885223 of the EC1-complete genome (5416-5614)

E. coli bases of EC2-complete genome 4067762 to 4083201 (4741-4852)

E. coli bases 2244905 to 2255428 (2027-2108) of the EC3-complete genome

E. coli bases 2244905 to 2255428 (2064-2109) of the EC4-complete genome

EC5-E.coli plasmid synthesis cloning vector pET31F (258 376)

Plasmid pKF3 from EC6-E.coli (2004-2066)

EC7-cloning vector pGEM-5Zf (-) (75-170)

Sequence of EC8-US Patent No. 4921698

PD1-pGEM-T vector (401-519)

PD2-pGEM-T vector (1130-1306)

PD3-pGEM-T vector (2513-2610)

PD4-pGEM-T vector (1685-1795)

E. coli bases 220025 to 231029 (829-872) of the EC9-complete genome

HC1- Homo sapiens satelite 2 repeat element DNA

3-3 Confirm the processing of DNA introduced into the cell

PCR amplification was performed to determine the effect of 50-200 bp cloned DNA fragments processed and introduced into the cells on the cells according to the processing and intracellular processing. The PCR reaction solution contained 0.2 mM dNTP, 10 pmole primer, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl ₂ , and 2.5 units of Taq polymerase. As PCR primers, 5'-CTCCCGGCCGCCATG-3 'and 5'-TTGGGAGCTCTCC-3' (Table 1) were synthesized and used. The PCR reaction was repeated 35 times under the following conditions: denaturation (94 ^° C. for 30 seconds); Primer annealing (42 ^° C. for 30 seconds); Primer extension (72 ^° C. for 50 seconds). PCR products were subjected to 8% native-PAGE in TBE buffer, stained with ethidium bromide, and PCR products were extracted from the gel with DNA. The precipitated DNA was precipitated with entanol and then dissolved in PBS for cell culture, and dissolved in TE buffer to measure endonuclease activity.

PCR products, EC1, EC2, which were obtained by PCR amplification of 100-200 bp bacterial DNA cleaved by the action of endonuclease, were introduced into the cell to confirm the final product. The DNA was labeled with ³² P using a random priming method using a random primer and a cleno enzyme. DNA fragments labeled with ³² P were placed in IM9 cell line, U937 cell line, and T937-treated U937 cell line at 100 ng / ml, and DNA was introduced at regular intervals. To inhibit the enzymatic activity of endonucleases in cells, 0.2 mM ZnSO ₄ (Sigma) was treated. Intracellular DNA is recovered from the cell lysate, followed by 20% natural-PAGE in TBE buffer solution, and autoradiography by drying the gel to process DNA within the cell and endo The final reaction product by nuclease action was identified.

^{A 32} P-labeled EC1 DNA fragment was introduced into an IM9 cell line, followed by 20% natural-PAGE by extracting DNA from the cell from the cell lysate, followed by extracting the processed ³² P-labeled DNA from the gel. The nucleotide sequences were compared by annealing with various kinds of oligonucleotides synthesized in Table 1. A predetermined amount of ³² P labeled DNA extracted from the cells and 10 ng of each oligonucleotide were mixed in 6X SSC, boiled at 100 ^° C. for 5 minutes, and then annealed by lowering the temperature to 1 ^° C or less in 30 seconds. The annealed reactants were subjected to 20% native-PAGE at 4 ^° C. in TBE buffer and confirmed oligonucleotides complementarily bound to the DNA introduced into the cells by radiographic imaging. As a standard, a mixture in which DNA and oligonucleotides were not annealed, and DNA denatured and annealed by DNA introduced into cells were used. The base sequences of the synthesized oligonucleotides were used oligos A, B, and oligos C, D, and E, which are not present in the EC1 DNA fragment (Table 1).

Human B-lympha IM9 cell line, myeloid U937 cell line and TPA were treated to confirm foreign DNA influx and processing in the cell line by differentiation-induced U937 cell line. As a result, 100-200 bp of the nucleotide sequence identified above was identified by PCR amplification of bacterial DNA fragments labeled with ³² P. External DNA influx and intracellular processing in the IM9 cell line is shown in the results of FIG. 22. The DNA fragment of 157 bp (EC1) is bound to the cell membrane at 4 ^o C but not into the cell, and processing occurs within the cell depending on the incubation time at 37 ^o C and 20% after 24 hours. It was found that about 10 bp of DNA fragment was produced as the final product on the natural-PAGE. This DNA fragment, which was judged to be 10 bp, was found to be a Japanese chain structure in subsequent experiments, and was confirmed to be a Japanese chain DNA even at 20% denaturation-PAGE (8.3 M urea). External DNA uptake and intracellular processing observed in U937 cell line and U937 cell line differentiated with TPA treatment are as in FIG. 23. In the U937 cell line not treated with TPA, as a result of FIG. 23A, it could be seen that external DNA binds to or enters the cell but no processing occurs. However, in FIG. 23B, foreign DNA influx and intracellular processing were confirmed by the U937 cell line differentiated by TPA treatment. On the other hand, it can be seen that DNA processing was inhibited intracellularly by 0.2 mM Zn ²⁺ as shown in FIG. 23B.

The results of the experiments so far indicate that the immune cells process the external DNA to produce the final reaction product of 10 bases, and then confirm the sequence characteristics of the DNA fragments. Labeled with ³² P of EC1 DNA product amplified by PCR reaction and introduced into the cell, the DNA fragments of 10 bases processed by intracellular endonuclease were synthesized with several kinds of synthetic oligonucleotides matching the partial sequence of EC1. Annealing with the nucleotides was able to confirm the nucleotide sequence that is complementarily bonded (Fig. 24). Oligonucleotides that bind the most complementary results from annealing were Oligo A of Table 1, the nucleotide sequence present in EC1 DNA, and the sequence having the AACGTT motif. From this result, the enzyme activity of the endonuclease specifically confirmed that the CpG motif known as the base sequence of bacterial DNA that activates immune cells inside the cell was generated.

3-4 IgM Secretion of IM9 Cell Lines by Bacterial DNA

Oligonucleotides with CpG motifs known to activate B cells to secrete cytokines and IgM were synthesized. In the DNA fragments produced by the endonuclease action, oligo A present in EC1, oligo B present in EC2, and oligo E without CpG motif were synthesized (Table 1). In addition, EC1, EC2 PCR products containing several CpG motifs, and various types of DNA were used in the experiment. In order to methylate the CpG motif, 100-200 bp fragments prepared by treating bacterial DNA with endonucleases were prepared. The methylation reaction was performed using 30 ug of DNA in 15 units of CpG methylase and 160 uM S-adenosylmethionine buffer (10 mM Tris-HCl, pH 7.9, 10 mM MgCl ₂ , 50 mM NaCl, and 1 mM DTT). ) ^Was reacted at 37 ^° C. for 3 hours. CpG methylation was confirmed by treatment of Hpa II.

The IM9 cell line, a human B-lympha cell line, was set to 2 × 10 ⁵ / ml at the beginning of culture in RPMI 1640 medium containing 10% FBS, and 25 ug / of various oligonucleotides and DNA obtained in advance were obtained. Cell cultures were obtained after treatment with ml and incubation for 24 hours.

From μ- chain - the plate pyeongjeo 0.1 M carbonate buffer solution in the anti (pH 9.6) of specific IgM (5 ug / ml, Sigma ) was allowed to stand at 100 ul / well of 4 ^o C for 16 hours. This plate was washed three times with PBS, then left for 2 hours at room temperature with 1% BSA and three times with TPBS (0.05% Tween-20 in PBS). Appropriately diluted cell culture medium or purified human IgM (Sigma) was put in 100 ul / well and left at room temperature for 2 hours, and washed three times with TPBS. Wasabi peroxidase-linked anti-human Ig diluted to 1 / 4,000 in PBS containing 1% BSA was left at room temperature for 1 hour and then washed with TPBS. It was developed by treating with o -phenylenediamine dihydrochloride dissolved in 0.05 M phosphate buffer (pH 5.0) for 30 minutes. The color reaction was stopped by treatment with 0.67 NH ₂ SO ₄ and the IgM was quantified using a microplate reader.

When the amount of secreted IgM was measured after 48 hours by treating IM9 cell line with synthesized oligonucleotides, it was confirmed that CpG motif was secreted at 2-3 ng / ml in oligo A and oligo C. It was confirmed that the oligo E without the synthesis at 0.5 ng / ml (Fig. 25). IgM was also secreted at 2-3 ng / ml by PCR products (Table 1. EC1, EC2 DNA) of bacterial DNA with multiple bacterial DNAs and CpG motifs, but after methylation of CpG motifs of bacterial DNA, cell line cultures It was observed that the secretion of IgM did not occur when the treatment was in (Fig. 25). Compared with bacterial DNA, salmon sperm DNA did not increase IgM secretion. From the above results, it was confirmed that the CpG motif of bacterial DNA increased the secretion of IgM by activating the IM9 cell line, which is consistent with the findings of the previous studies using the synthesized CpG motif.

3-5 Characterization of Endonuclease Enzyme Activity Involved in External DNA Processing

EC1, EC2, HC1 DNA amplified by PCR was labeled with ³² P by random-priming method using random primers and Klenow enzyme. In addition, to obtain shorter DNA, EC2 DNA was treated with Alu I (Promega Inc), fragmented, and the 5'-end was labeled with ³² P and used as a substrate. In order to study the characteristics of the enzymatic activity of the endonuclease, EC1 DNA was used by 5'-end labeling or 3'-end labeling. 5'-terminal labeling was performed by mixing 10 ng EC1 DNA, [γ- ³² P] ATP 50 uCi, kinase buffer and 5 units of polynucleotide kinase (Promega Inc.) and reacting at 37 ^° C. for 1 hour. The 3'-terminal label was mixed with 10 ng EC1 DNA, [α- ³² P] CTP 50 uCi, TdT buffer and 5 units of terminal deoxytransferase (Boehringer mannheim) for 1 hour at 37 ^o C. Used as.

Treated with 5 ng of EC1, EC2, HC1 DNA and Alu I labeled by the random-priming method prepared above, 5'-terminal labeled EC2 DNA was mixed with 20 ul of FBS-free IM9 cell culture solution at 37 ^° C. The reaction was carried out at time intervals. In addition, enzyme activity was also measured by increasing the amount of cell culture. The reaction solution was treated with phenol / chloroform to remove proteins, precipitated with cold ethanol, electrophoresed in 20% natural-PAGE and 20% modified-PAGE (8.3 M urea) in TBE buffer, and the gel dried and radiographed. Photographing was performed to analyze the reaction products for enzymatic activity. In order to compare the enzyme activity of DNase I in FBS, 20 ml of RPMI1640 medium containing 10% FBS was reacted with various substrates. In addition, it was confirmed how Zn ²⁺ (1 mM), an inhibitor of endonuclease, and EDTA (10 mM), a chelating agent, affect the enzyme activity. At this time, bromophenol blue (BPB) and xylene cynol (XC) were used as standard materials of molecular weight. In denaturation-PAGE, BPB was located at 8 bases, XC at 28 bases, and 12 bp and 45 bp, respectively, in natural-PAGE.

In order to study the properties of endonuclease enzyme activity and the final reaction product, EC1, EC2 and HC1 DNA shown in Table 2 were labeled with ³² P using a random-priming method and used as a substrate. As a result of the reaction of these substrates with IM9 cell culture cultured in a medium without FBS, it could be seen that the DNA final reaction product of about 10 bases was generated as shown in FIGS. 26, 27, and 28. From these results, it was found that the endonuclease does not specifically recognize the nucleotide sequence of the DNA, and it can be seen that the DNA fragment of about 10 bases is produced by acting on the external DNA regardless of the nucleotide sequence. In addition, Zn ²⁺ , an inhibitor of endonuclease, and EDTA, a chelating agent, resulted in inhibition of enzymatic activity (FIGS. 26, 27, 28, and 29). In addition, it could be seen that the degradation of DNA was not caused by RPMI1640 medium containing 10% FBS (FIGS. 26, 27, 28, and 29). These results confirm in vitro experiments that the reaction product is formed by the processing of the DNA introduced by the endonuclease action in the cell. The final reaction product of the endonuclease enzyme activity studied so far was composed of DNA fragments of about 10 bases, which increased the amount of endonuclease (FIG. 30) and continued the reaction time up to 24 hours. Even in the case (Fig. 31), the DNA fragment of about 10 bases, which is the final product formed by the enzymatic reaction, was found to be no longer degraded. In other words, the endonuclease disclosed in the present invention was found to have no activity on DNA fragments of about 10 bases or less.

In addition, in FIG. 32, DNA fragments generated by treating the DNA fragments amplified by PCR with Alu I and endonucleases are formed before the final product is produced. Could see. The substrate used in this experiment was labeled with ³² P at the 5'-end of the Alu I-reacted DNA, and the 5 'to generate single-stranded DNA was generated from the result of about 10 bases of the labeled end product. -Exonuclease enzyme activity was confirmed to not exist.

In order to confirm that the endonuclease of the IM9 cell line has 3'-exonuclease or 5'-exonuclease enzymatic activity, EC2 DNA labeled with ³² P at the 5'- or 3'-end, respectively, was used as a substrate. The reaction product was reacted with an endonuclease at 37 ^° C. for 1 hour, and then radiographed in the same manner as above to compare reaction products. In addition, in order to confirm how the endonuclease enzyme activity is expressed in the single-stranded DNA, the labeled DNA was boiled at 100 ^° C. for 5 minutes, cooled rapidly on ice, reacted with the endonuclease as above, and the reaction product was confirmed.

33 shows that the endonuclease acts on the substrate labeled at the 5′-end to form a DNA fragment of about 10 bases (5′-terminal label, lane 2), which is shown in FIG. 32. Same results as shown. That is, it was confirmed that there is no 5'-exonuclease activity in the endonuclease. However, the substrate labeled with ³² P at the 3'-end shows that the DNA fragment of about 10 bases, the end product of the enzymatic reaction, was not formed on the radiograph, which acts as a 3'-exonuclease enzyme. ^It is shown that the 3'-terminus labeled with ³² P has been degraded into mononucleotides. However, the substrate labeled with ³² P was boiled at 100 ^o C for 10 minutes, then rapidly cooled down on ice, converted to a Japanese chain, and the endonuclease was reacted with the DNA substrate labeled at the 5'- or 3'-end. All of the enzymatic products formed labeled DNA fragments of about 10 bases. Based on the above experimental results, it was found that the 3'-exonuclease enzyme activity did not act on the Japanese chain.

In order to compare the final reaction product produced by the enzymatic activity of the endonuclease in the cell culture, the final product produced by intracellular processing and the reaction product produced by the action of DNase I, the pancreatic DNase I of bovine Beohringer Mannheim) 5 units and EC1 DNA labeled with ³² P by the random-priming method were reacted at 37 ^° C. in 10 mM Tris-HCl, pH 7.6, 10 mM MgCl ₂ buffer for 1 hour. The reaction product was subjected to 20% natural-PAGE and 20% denaturation-PAGE (8.3 M urea) and radiographed to compare the final product of the enzymatic activity of the endonuclease. In addition, it was confirmed by treatment with S1 nuclease to confirm that the final product of the endonuclease enzyme activity is present in the Japanese chain. The S1 nuclease enzymatic activity was determined by the random-priming method and the end product of the endonuclease reaction produced by acting on the ³² P-labeled substrate and the S1 nuclease reaction buffer (7X buffer, 0.3 M potassium acetate, pH). 4.6, 2.5 M NaCl, 10 mM ZnSO ₄ , 50% glycerol) and the mixture with 3 units of the S1 nuclease was confirmed by reacting for 1 hour at 37 ^° C. The final reaction product was confirmed by radiographic imaging in the same experimental method.

Comparing the final product produced by the enzymatic activity of the endonuclease and the reaction product produced by the action of DNase I, as shown in Figure 34, the endonuclease (lane 2) of the cell culture and the inside of the cell The DNA reaction products processed by the endonucleases (lane 3) were all DNA fragments of about 10 bases, but the action of DNase I (lane 4) resulted in fragments of DNA degraded to 10 bases or less and continued degradation. Can be seen to degrade to mononucleotide. In addition, in order to confirm that the final product by the endonuclease reaction is present in the Japanese chain, the enzymatic reaction product was observed by treatment with S1 nuclease. When the reaction product of about 10 bases, the end product of the endonuclease, was reacted with the S1 nuclease again, it could be seen that it was completely decomposed into mononucleotides as shown in FIG. 35. In other words, there is clear evidence that the DNA fragment of about 10 bases produced by the enzymatic activity of the endonuclease is present in the Japanese chain.

Example 4

Purification and Characterization of Endonuclease from IM9 Cell Line

It was found that the IM9 cell line biosynthesizes and secretes Mg ²⁺ -dependent endonucleases that are distinct from the nucleases identified to date. The enzyme also exists in the nucleus of the IM9 cell line, suggesting its involvement in the apoptosis process. Endonucleases involved in apoptosis include Mg ²⁺ -dependent endonucleases [Anzai N. et al (1995) Blood 86, 917-923; Kawabata H. et al (1993) Biochem. Biophys. Res. Commun. 191, 247-254; Sun XM, and Cohen GM (1994) J. Biol. Chem. 269, 14857-14860; And Kawabata, H. et al (1997) Biochem. Biophys. Res. Commun. 233, 133-138], Ca ²⁺ / Mg ²⁺ -dependent endonucleases [Stratling WH et al (1984) J. Biol. Chem. 259, 5893-5898; Pandey S. et al (1997) Biochemistry 36, 711-720; And Ribeiro JM, and Carson DA (1993) Biochemistry 32, 9129-9136], DNase I [Peitsch MC et al (1993) EMBO J. 12, 371-377], and NUC18 [Kawabata, H. et al (1997) Biochem. Biophys. Res. Commun. 233, 133-138], but the purification, biochemical properties and physiological functions of these endonucleases are not clearly identified. In addition, no endonucleases involved in the function of recognizing and processing bacterial DNA as foreign substances have been reported. Therefore, in the present invention, the endonuclease synthesized and secreted in the IM9 cell line was purified from the cell culture medium and its characteristics were characterized.

4-1 Determination of protein source and endonuclease enzyme activity

The cell culture fluid was used as an enzyme source by culturing the IM9 cell line secreting endonuclease in RPMI1640 medium containing 10% FBS after heat treatment. In order to separate the cell culture medium and IM9 cell line, centrifugation was carried out at 1,500 × g for 5 minutes to obtain a cell culture solution. A total of 10 L of cell culture solution was centrifuged at 14,000 x g for 30 minutes at 4 ^o C to use the supernatant as the enzyme source.

In the endonuclease purification process, enzymatic activity was determined to the extent that linear DNA formation and degradation were carried out using the ultra plasmid DNA as a substrate. 100 ng of plasmid DNA was added to 20 mM Tris-HCl (pH 7.0) buffer containing 10 mM MgCl ₂ , and mixed with 20 ul of the sample in the protein purification process for 10 minutes at 37 ^° C. Enzyme reaction was stopped with DNA sample buffer and electrophoresed on 1% agarose gel to confirm enzyme activity.

4-2 Purification of Endonucleases

Ammonium sulfate was slowly added to the cell culture solution to allow 80% saturation, followed by centrifugation at 14,000 x g , and the precipitate was dialyzed in 20 mM sodium acetate (pH 5.2) buffer overnight. 5 ml of this enzyme solution was injected into a mono S column (0.5 × 5.0 cm, Pharmacia LKB) previously equilibrated with the same buffer. Protein was eluted first by forming a 0 -0.08 M NaCl linear gradient (15 ml) in the same buffer, and further passed through 15 ml of the same buffer containing 0.08 M NaCl. Then a 0.08 -0.2 M NaCl linear concentration gradient (20 ml) was formed to elute the protein secondly. The volume of each fraction was 1 ml and the flow rate was 0.5 ml / min. The above procedure was repeated to collect fractions with endonucleases, concentrated to centricon, and equilibrated with 50 mM sodium phosphate (pH 7.0) buffer containing 1.5 M (NH ₄ ) ₂ SO ₄ . This enzyme source was injected into a RESOURCE PHE column (0.64 x 30 mm, 1 ml, Pharmacia LKB) equilibrated with the same buffer to perform hydrophobic interaction chromatography. After washing with 15 ml of the same buffer, a 1.5-0 M (NH ₄ ) ₂ SO ₄ linear gradient was formed (25 ml) to elute the protein. Enzyme-rich fractions were concentrated to centricon and equilibrated with 20 mM Tris-HCl (pH 7.0) buffer.

IM9 cell culture was concentrated to ammonium sulfate and used for purification. Fractional precipitation of ammonium sulfate was carried out with a difference in concentration, but the purification was performed by precipitating the protein by treating it at a concentration of 80% because it did not affect much on the enzyme separation. Enzyme activity in the sample passed through the mono S column was recovered in a 0.08-0.2 M NaCl linear gradient (Fig. 36). The enzymatic fraction in the cation exchange resin was passed through a RESOURCE PHE column, hydrophobic interaction chromatography. When the protein was eluted with a 1.5-0 M (NH ₄ ) ₂ SO ₄ linear gradient, the endonuclease enzyme activity was observed in the protein fraction shown in the 0.7 M (NH ₄ ) ₂ SO ₄ concentration gradient in the linear gradient. (FIG. 37). Purified endonucleases were quantified in 10 liter IM9 cell line cultures containing about 10 g of protein, indicating that about 10 ug was recovered.

4-3 Molecular weight measurement by natural pore gradient PAGE and SDS-PAGE

In the cation exchange resin chromatography, fractions with enzymatic activity were collected and concentrated into centricon and injected into a 4-15% linear gradient acrylamide gradient gel, followed by electrophoresis at 4 ^o C at 4 -5 mA for 18 hours. It was. After electrophoresis, the protein band was confirmed by staining with Coomassie Brilliant Blue R-250. Before staining the region corresponding to the protein band was cut into small pieces and eluted for 8 hours at 4 ^° C in 20 mM Tris-HCl (pH 7.0) buffer solution. The site with endonuclease enzymatic activity in the eluted protein fraction was identified using ultra-stranded plasmid DNA as a substrate. Enzyme-activated fractions were concentrated to perform SDS-polyacrylamide gel electrophoresis. The stacking gel used was 4% and the running gel was 7%. The standard protein of the natural pore gradient PAGE was a mixture of ferritin (440 kD), catalase (232 kD), lactate dehydrogenase (140 kD) and bovine serum albumin (67 kD), and SDS-PAGE Standard proteins of myosin (200 kD), β-galactosidase (116.3 kD), phosphorylase B (97.4 kD), bovine serum albumin (66.2 kD) and egg albumin (45 kD) A mixture of was used.

The protein fraction with enzymatic activity eluted from the mono S column was concentrated and 4-15% natural pore gradient gel electrophoresis was performed to confirm the protein band with enzymatic activity (FIG. 40). Protein bands showing enzymatic activity did not clearly form a single band but were slightly spread around 140 kD compared to standard protein. As a result of eluting and concentrating the protein at the site where the enzyme activity appeared, SDS-PAGE was performed (FIG. 41), and the purified protein band was confirmed at the same position as the endonuclease (FIG. 38) purified by chromatography. It was confirmed that the molecular weight was about 72.4 kD (FIG. 39). When comparing the results of natural pore gradient gel electrophoresis with the results of SDS-PAGE, it was confirmed that the endonuclease was present in the homodimer form and had enzymatic activity.

4-4 Characterization of Purified Enzyme

Nuclei isolated from the U937 cell line in which the endonuclease enzyme activity was not shown for 4 hours were used as a substrate. 1 mM Ca ²⁺ , 1 mM Mg ²⁺ , 1 mM Zn ²⁺ and EDTA were added to the isolated nucleus contained in 20 mM Tris-HCl (pH 7.0) buffer for 10 minutes at 37 ^o C. Reaction was confirmed.

Using the nucleus isolated from the U937 cell line as a substrate, the ion requirement of the purified enzyme was observed. The enzyme activity was observed in the presence of Mg ²⁺ , and Zn ²⁺ , an inhibitor of apoptosis, and EDTA, a chelating agent, were observed. It could be seen that the enzyme activity was completely inhibited (FIG. 42). Such enzymatic activity is consistent with the enzymatic activity.

The endonuclease of the present invention has a function of properly digesting external bacterial DNA so that cells can introduce DNA, and the DNA introduced into the cell is processed by an endonuclease inside the cell and processed external DNA. Immune cells are activated by the CpG motif to promote the secretion of antibodies. Therefore, the endonuclease of the present invention is of industrial value as an adjuvant.

Claims (8)

An endonuclease that is secreted from immune cells and recognizes and processes bacterial DNA as an external substance to produce about 10 bp single-chain oligonucleotides with a CpG motif that is involved in an immune response. The endonuclease of claim 1, wherein the immune cells are human B lymphoblastic IM9 cell line or 12-O-tetradecanoylphorball 13-acetate treated U937 cell line. The endonuclease according to claim 1 or 2, wherein the molecular weight by SDS-PAGE is 72.4 kD. The endonuclease according to claim 1 or 2, wherein the enzymatic activity is Mg ²⁺ dependent. The endonuclease according to claim 1 or 2, wherein the optimum pH of the reaction is from 6.6 to 7.6. The endonuclease according to claim 1 or 2, wherein DNase I is distinct from the moving distance of enzymatic activity in native-PAGE. Human B-lympha IM9 cell line or myeloid U937 cell line treated with TPA was cultured in a medium suitable for producing endonuclease and purified from this culture synthesized and secreted endonucleases from said immune cells. A method of making an endonuclease comprising a single chain oligonucleotide of about 10 bp having a CpG motif. An adjuvant comprising about 10 bp of single stranded oligonucleotide having a CpG motif formed by treating bacterial DNA with the endonuclease of claim 1.