KR19990044135A - Heterologous protein production system using algae cells - Google Patents

Abstract

A heterologous protein expression system comprising heterologous gene DNA, such as EPO genomic DNA, a vector inserting the DNA and avian cells expressing the gene with a vector, such as a chicken embryo or quail fibrosarcoma cell line, produces a heterologous protein, such as EPO. Can be used efficiently.

Description

Heterologous protein production system using algae cells

Many recombinant proteins used in medicine are relatively small and simple in structure, and biologically active proteins can be produced in prokaryotes such as E. coli. However, human proteins with high medical utility, such as tissue plasminogen activator (TPA), Factor VII, and EPO, are more complex because they require a process called posttranslational modification to exhibit biological activity. Do. For example, 40% of the molecular weight of EPO is carbohydrate, and glycosylation is much. Carbohydrate moieties of these EPO are known to play an important role in biological activity. Thus, EPO produced in Escherichia coli, yeast or insects was found to be inactive in vivo or only very insignificant, while EPO produced in COS or CHO cells showed complete activity. Thus, this kind of heterologous protein has only been produced in mammalian cells.

Meanwhile, research on gene expression of higher eukaryotic cells in algal systems has been ongoing. One of the earliest known tumor-associated viruses is the chicken Rous sarcoma virus, which reveals that the retroviral oncogene is derived from cellular genes. It played a decisive role in confirming the concept of protooncogene. The study of gene expression has also been conducted using the RSV LTR promoter, which is mainly used for the high efficiency expression of heterologous genes in mammalian cells. In addition, avian embryo cells have been widely used in various animal virus studies.

The present invention relates to a novel expression system for producing biomedically important heterologous proteins, including human erythropoietin (hereinafter referred to as "EPO"), and more particularly to encoding EPO The present invention relates to a method for producing a variety of heterologous proteins by transfecting DNA encoding a protein, such as genomic DNA, into an avian cell.

1 shows the expression of bacterial CAT genes in algal cells. At this time DE and CEF cells were transfected with (-) pRc / CMV with or without CAT sequences. CAT activity was measured by determining the amount of ¹⁴ C- chloramphenicol acetyl produced from ⁽¹⁴ C-chloramphenicol) Chemistry chloramphenicol (acetylated chloramphenicol, AC). The numerical values indicated are representative of five or more independent experiments. In order to obtain the results shown in FIG. 1, 10 μg of the protein was reacted with ¹⁴ C-chloramphenicol at 37 ° C. for 20 minutes.

Figure 2 shows a comparison of CAT gene expression between different cell types and between different promoters. Three promoter-CAT fusion constructs were transfected into DE, CEF, CHO-K1 and HeLa cells, and CAT activity was measured as in FIG. 1. S: SV40 early promoter, C: HCMV MIEP, R: RSV LTR. Marked values are representative of three independent experiments. To obtain the results shown in FIG. 2, 10 μg of the protein was reacted with ¹⁴ C-chloramphenicol at 37 ° C. for 30 minutes.

3 shows the efficiency of DNA transfection in various cells. pCMV-lacZ constructs were transfected into DE, CHO, Vero, HeLa and 293T cells by calcium phosphate-DNA coprecipitation using the conditions used in the experiment of FIG. 2. Two days after transfection, cells were fixed and stained with X-gal. The number of blue cells per 60 mm tissue culture plate was counted. The total number of cells between the plates was about 1 to 3 x 10 ⁵ . Transfection efficiency is calculated relative to DE cells.

4 is a schematic diagram of the structure of cloning and expression vectors of human EPO. Five blocks are five coding regions of EPO. The first PCR was performed using primers 25 and 33. The amplified DNA fragments were cloned and subjected to a second PCR using primers 12 and 9. The curve in primer 12 includes the nucleotide sequence from the first coding site. Therefore, after the second PCR, the entire EPO coding sequence was made, in which the first and second coding sites were combined to form an intron removed therebetween. Primers 12 and 9 contain a HindIII linker after the 5 'end, and the EPO genomic sequence is cloned in various expression vectors.

5 shows various EPO genomic DNA sequences. SY, SH, HE and JM represent EPO genomic DNA sequences cloned according to the present invention, and AM and GI are already reported EPO genomic sequences. Removed introns are not shown in FIG. 5 because introns are removed during cloning between the first and second coding sites.

6 shows the amino acid sequences of the various EPOs. SY, SH, HE and JM represent amino acid sequences of EPO cloned according to the present invention, and AM and GI are already reported amino acid sequences of EPO. The abbreviations for amino acids are as follows.

A: Alanine R: Arginine N: Asparagine

D: Aspartic Acid C: Cysteine Q: Glutamine

E: glutamic acid H: histidine I: isoleucine

L: Leucine K: Lysine M: Methionine

F: Phenylalanine P: Proline S: Serine

T: Threonine W: Tryptophan Y: Tyrosine V: Valine

Figure 7 shows a comparison of CAT gene expression between QT-VC and other mammalian cell lines. pCMV-CAT was transfected into QT-VC, CHO-K1 and Vero cells and CAT activity was measured as in FIG. 1. Transfection efficiencies measured by pCMV-lacZ and cotransfection and X-gal staining were regenerated in 3-5% in all cases. For this experiment 50 μg of protein was incubated with ¹⁴ C-chloroamphenicol at 37 ° C. for 1 hour.

8 shows a typical structure of the plasmid used when expressing EPO in QT cells. Two types of BamH I cassettes were prepared capable of expressing genes for human glutamine synthetase (GS). In these BamHI cassettes, the GS cDNA sequence was flanked by the poly A sequence of either promoter of the bovine growth hormone gene and the partial MMTV LTR (-220 to +15 of the RNA initiation site) or the 220 bp HSV tk promoter. A series of pIGAs were produced by inserting a BamHI segment expressing GS into the BamHI site of pCl-neo (Promega, Madison, Wis., USA). The HindIII segment of the SY-EPO cDNA sequence was cloned into the Smal site of pIGA to produce an EPO expression vector, pIGA-EPO.

9 shows the production of EPO using QT-N4D4. QT-N4D4 cells were fused grown in a 10 cm culture dish (day 0) of M-199 containing 10% FBS and 1 mM MSX. EPO levels were measured on the third day. Cells were then split 1: 3 and seeded in 10 cm dishes. On day 6, cells were fused again and the medium was replaced with 10 ml fresh medium containing 2% (•) or 10% (○) FBS. EPO levels were determined by ELISA (R & D system, Minnesota, USA)

10 shows the results of comparing EPO concentrations in DE (●) and QT-N4D4 (○) measured by ELISA and in vitro bioassay.

The present invention is a study for expressing heterologous proteins of eukaryotic cells with high efficiency. It is an object of the present invention to provide a novel heterologous gene expression system capable of producing proteins of higher eukaryotic cells. Another object is to provide a method for the efficient production of proteins of higher eukaryotic cells, such as EPO, which are known to be active only when produced in mammalian cells. Another object of the present invention is to provide a method for producing EPO, in particular EPO.

In order to achieve the object of the present invention, the present invention provides a heterologous gene expression system comprising a DNA encoding a heterologous protein, a vector into which the DNA is inserted, and an avian cell in which the vector is expressed.

The present invention also provides a method for producing a heterologous protein comprising culturing the above-described expression system in a medium to express a heterologous gene and purifying the heterologous protein from cells and the medium.

Preferably, the heterologous protein in the present invention is selected from the group consisting of proteins known to have activity only when expressed in mammalian cells (e.g., EPO, TPA and Factor VIII, etc.), preferably the vector described above is SV A promoter selected from the group consisting of an initial promoter, a major immediate early promoter of human cytomegalovirus (hereinafter referred to as "HCMV MIEP") and an RSV LTR, and preferably the avian cell is a duck In the group consisting of duck embryo cells (hereinafter referred to as "DE"), chicken embryo fibroblasts (hereinafter referred to as "CEF") and quail fibrosarcoma (hereinafter referred to as "QT") It is selected, more preferably QT-VC isolated in the present invention. QT-VC was deposited with the accession number KCTC 0277BP on August 22, 1996, at the Korea Research Institute of Bioscience and Biotechnology Korean Collection for Type Culture, an international depository organization. The deposited QT-VC was transfected into an expression vector comprising SY-EPO cDNA as in FIG. 8.

More preferably, the DNA encoding the heterologous protein is genomic DNA or cDNA.

The present invention also provides an EPO production system comprising a DNA encoding an EPO, a vector into which the DNA is inserted, and an avian cell in which the vector is expressed.

Furthermore, the present invention provides a method for producing EPO, comprising the step of inserting DNA encoding EPO into a vector, transfecting the vector into algae cells, and culturing the transfected algae cells in a medium. to provide.

Preferably the algal cell of the EPO production system is DE or QT, said DNA is genomic DNA encoding EPO, more preferably said DNA is a group consisting of SY, JM, SH and HE shown in FIG. DNA is selected from.

Preferably the vector comprises a promoter selected from the group consisting of SV initial promoter, HCMV MIEP and RSV LTR.

The present invention also provides avian cells as a host for expressing a gene encoding a mammalian protein.

Moreover, the present invention provides a new EPO genomic sequence selected from the group consisting of SY, JM, SH and HE shown in FIG. 5, and also a new EPO selected from the group consisting of JM, SH and HE shown in FIG. 6. Provide an amino acid sequence.

The present inventors conducted a study on whether algal cells can be used as host cells for heterologous gene expression. The present inventors selected and used two germ cells of chicken and duck and three algal cells of one fibrosarcoma cell line of quail. The reason for using chicken and duck embryonic cells is as follows. First, these germ cells can be readily produced from eggs, which are quickly isolated and pass through many passages. Second, chicken and duck cells can be mass cultured at a relatively low cost. Third, certain algal cells, for example cells derived from chicken embryos, are already used as pharmaceuticals. For example, influenza viruses are cultivated in eggs for vaccine production. Finally, the culture conditions required for avian embryonic cells, including medium and temperature, are substantially the same as for mammalian cells, indicating that the physiology of algae and mammalian cells will be similar. In addition, the reason for selecting the QT cell line is that a variety of transformed lines already exist, so that they can form a permanent cell line that expresses heterologous proteins easily from these cell lines, culture conditions and media Is similar to mammalian cells.

I. Cells and plasmids

1. Cell

Table 1 below shows the cells used in the experiment.

cell source HeLa human cervical carcinoma cells ATCC CCL2 Vero African Green Monkey Kidney Cells ATCC CCL81 COS-7 African Green Monkey Kidney Cells Transformed with Wild-type T Antigen of SV40 ATCC CRL1651 CHO-K1 Chinese Hamster Ovary Cells ATCC CCL61 NIH3T3 contacted-inhibited Swiss rat embryonic cells ATCC CRL1651 Ad-5 Transformed Human Embryonic Kidney Cells 293 ATCC CRL1651 SL-29 Chicken Belly Fibroblasts ATCC CRL1590 Duck boat ATCC CCL141 or manufactured by the inventors Quail fibrosarcoma cell line QT6 ATCC CRL1708 Quail fibrosarcoma cell line QT-VC We separated KCTC 0277BP

Cells except for the QT cell line were cultured by adding 10% fetal bovine serum (hereinafter referred to as "FBS") to DMEM (Dulbecco's modified Eagle's medium). QT cell lines were cultured in M199 medium instead of DMEM. Duck embryos were prepared by trypsinizing decapitated duck embryos obtained from ATCC CCL 141 or 10 to 13 days old. These algae cells were cultured in a minimal medium (Eagle) with the addition of a salt solution (Earle's balanced salt solution) containing non essential amino acids and 10% FBS. These cells could be passaged more than about 30 times. 120 μg / ml penicillin G (Sigma P-3032; 1690 units / mg) and 200 μg / ml streptomycin (Sigma S-9137; 750 units / mg) were added to each medium used in the present invention.

2. Plasmid

To measure the efficiency of heterologous protein production in algal cells, a HindIII CAT cassette (Pharmacia, Piscataway, NJ) was inserted into pRc / RSV and pRc / CMV (Invitrogen, San Diego, California, USA) to provide pRc / RSV-CAT and pRc / CMV-CAT was prepared separately. pSVCAT used plasmid p918, which had already been prepared by the present inventors. Three vectors were used as EPO expression vectors. pCMV-gEPO was prepared by cloning the HindIII segment of the EPO genomic sequence to the HindIII site of pRc / CMV. pSV-gEPO was prepared by replacing the CAT sequence of pSV918 with genomic EPO sequences. pIGA-EPO contains both EPO cDNA and NEO and glutamine synthase (GS) genes regulated by HCMV MIEP. To measure the efficiency of transfection, the plasmid pCMV-lacZ was prepared by inserting the bacterium lacZ segment into the HindIII site of pRc / CMV.

II. DNA transfection and gene expression analysis methods

The inventors have tested whether avian embryonic cells can be used instead of mammalian cells to express heterologous genes with high efficiency. To date, algal germ cells have been used for culturing viruses, but no heterologous protein of higher eukaryotic cells is expressed in these cells. For this experiment, it is necessary to establish a method for efficiently performing transfection in algal cells. In other words, in order to express heterologous genes in avian cells, development of a technique for transfecting DNA into target cells is required. To date, no technique for transfecting DNA into avian embryonic cells has been reported. Accordingly, the present inventors have developed a method for easily transfecting DNA into CEF and DE cells.

We chose a method using calcium phosphate-DNA co-precipitation among the available techniques, since this method has been used successfully in a variety of adherent cells and can also be used to prepare permanent cell lines. We conducted experiments under various conditions and found that the following method was optimal.

When cells were fused at 50-70% in a 100 mm culture dish, a total of 10 μg DNA was added to HBS buffer (140 mM NaCl, 5 mM KCl, 0.75 mM Na ₂ HPO ₄ 2H ₂ O, 6 mM glucose, 25 mM HEPES). Incubated together at room temperature for 30 minutes. 10 ml of normal medium containing FBS was added and incubated at 37 ° C. for 20 hours. However, CHO-KI was incubated for 8 hours. Cells were treated with 10 mL 100 μM chloroquine and incubated at 37 ° C. for 3 hours. After exchange with 10 ml fresh medium, the cells were incubated for 1-2 days. Culture supernatants were collected and centrifuged at 1000 rpm for 10 minutes to remove cells and debris. To measure transfection efficiency, cells were transfected with pCMV-lacZ, washed once with PBS, fixed with 0.5% glutalaldehyde (in PBS) for 10 minutes after 3 days of transfection, and 1 mM MgCl. Wash twice with 4 ml PBS containing ₂ for 2 to 10 minutes each. For X-gal staining, staining solution (4 mM K ₃ Fe (CN) ₆ , 4 mM K ₄ Fe (CN) ₆ 3H ₂ O, 2 mM MgCl ₂ and 400 μg / ml X-gal (dissolved in dimethylformamide solution) Containing PBS] was added to the fixed cells and incubated overnight at 37 ℃ for 4 hours. When the reaction was completed, the cells were washed once with PBS. Stained cells were kept in PBS.

CAT was analyzed by the following method.

Two to three days after transfection, cells were harvested, washed once with PBS and suspended in 0.25M Tris-HCl, pH 7.5. Total protein was prepared by repeating the freezing and thawing four times and heating at 65 ° C. for 7 minutes. The same amount of protein was analyzed for CAT activity at 37 ° C. for 30 minutes. The amount of protein and reaction time were varied according to the experiment. For example, since the CAT activity of cell extracts prepared from DE cells is very high, only 10 μg protein and reaction time of 20 to 30 minutes may be used. Under these conditions, CAT activity in other mammalian cells is very low or It was insignificant. Virtually all ¹⁴ C-chloroamphenicol was converted when CAT activity was found in other cells. The conversion of ¹⁴ C-chloramphenicol into the acetylated form was determined by cutting the site containing the unreacted substrate and the acetylated form by measuring the amount of radioactivity with a liquid scintillation meter.

III. Gene Expression in DE and CEF

Gene expression levels of DE and CEF were measured using CAT genes. At this time, the present inventors first selected and used a promoter (HCMV MEIP) from the major immediate-early region of HCMV, which is to induce high efficiency gene expression in various cell types. Because it is known. In the plasmid pCMV-CAT, the bacterial CAT gene is in position to be regulated by the HCMV MIEP. As negative control, plasmid Rc / CMV with promoter but without CAT sequence was used. These plasmids were transfected with DE and CEF cells and CAT activity was measured to assess the extent of transfection and gene expression. One representative example from several independent transfections is shown in FIG. 1. Transfection of the control plasmid showed no CAT activity in both cells. However, when pCMV-CAT was transfected, CAT activity was easily detected in both cells. Five or more independent transfection assays showed that CAT activity was always higher in DE cells than in CEF cells. The difference in CAT activity between these two cells varied by 10-50 fold depending on the experiment. These results indicate that avian cells can be easily transfected with DNA and heterologous genes can be efficiently expressed.

Ⅳ. Comparison of gene expression between algae and mammalian cells and between different promoters

Three different promoters were used to compare gene expression levels between avian and mammalian cells.

(1) SV40 early promoter used during early transcription phase of SV40 infection

(2) HCMV MIEP expressing IE1 and IE2 regulatory proteins immediately after HCMV infection

(3) RSV LTR of avian retroviruses

Such promoters are known to be very potent in mammalian cells and have often been used for high efficiency heterologous gene expression.

The promoter-CAT fusion constructs were transfected into four different cell lines, DE, CEF, CHO-K1 and HeLa, and then CAT activity was measured to compare gene expression efficiency between promoters and cell types. It was. For this semi-quantitative comparison, all transfection and CAT analyzes were performed simultaneously under the same conditions. One example of such an experimental result is shown in FIG. 2. Incubated for 30 minutes using 10 ㎍ of the cell extract in the CAT reaction. Under these specific conditions, CAT expression levels derived from these three promoters were relatively very low in CHO and HeLa cells (FIG. 2). CAT activity was detected only when a large amount of protein was reacted for a longer reaction time. In contrast, CAT activity was readily detected in algal cells (FIG. 2). The exception was the case of the SV40 promoter in CEF cells. As a result, it was confirmed that expression in avian cells was more efficient than in mammalian cells.

HCMV MIEP worked very strongly in DE cells. In Figure 2, the CAT reaction conditions were chosen to show adequate CAT activity in other samples. When the CAT reaction was performed under limited conditions using protein samples prepared by transfecting DE cells with pCMV-CAT (ie, when CAT conversion was less than 50%), the CAT activity of the other samples was substantially undetectable. Therefore, the difference in CAT activity between protein samples from DE cells transfected with HCMV-CAT and samples from other transfections is at least a 100-fold difference. These results indicate that heterologous genes are expressed very effectively in DE cells, especially under the control of HCMV MIEP.

Highly efficient CAT expression in DE cells is likely the result of effective transfection into the cell population, rather than because these cells can induce strong gene expression. To distinguish this possibility, we transfected pCMV-lacZ into DE and other animal cells. After transfection cells were stained with X-gal and transfection efficiency was measured by measuring the number of blue cells. The number of stained cells as shown in FIG. 3 was always similar in DE and other animal cells, indicating that high efficiency CAT expression seen in DE cells is due to high efficiency expression in individual cells.

Ⅴ. Cloning of Human Erythropotin

In order to confirm whether DE cells can actually be used for the expression of pharmaceutically useful human proteins, we isolated genomic DNA encoding human EPO genes. The EPO gene is targeted because it is a secreted protein that can help DE cells secrete it. We also used genomic clones of EPO instead of cDNA to examine whether human genes can be properly spliced in DE cells to produce functional mRNAs.

The DNA used for EPO cloning was made from four human blood cells. Human peripheral blood lymphocytes were separated from heparin-treated blood cells by Ficoll-Hypaque gradient centrifugation. Total DNA was prepared from this and used for a polymerase chain reaction using a specific oligonucleotide primer (see FIG. 4). The region around the start codon was very rich in GC, so the EPO sequence was cloned by two-step PCR using two different pairs of primers.

To obtain genomic DNA for EPO, TES (10 mM Tris-HCl pH 7.8; 1 mM EDTA; 0.7% SDS) was used to degrade human peripheral blood lymphocytes and at 50 ° C. with 400 μg / ml proteinase K. After treatment for 1 hour, phenol: chloroform extraction, ethanol precipitation treatment to prepare the whole DNA. Gene amplification reactions (PCR) were performed using oligonucleotide primers specific for the EPO gene and 0.1 μg of whole genomic DNA.

Primer # 25 (sense, 5 'to 3'): GAAGCTGATAAGCTGATAACC

Primer # 33 (antisense, 5 'to 3'): TGTGACATCCTTAGATCTCA

The sample was amplified by repeating the following conditions: 1 minute denaturation at 92 ° C, primer annealing at 55 ° C for 1 minute, and primer extension at 72 ° C for 1 minute. Since the DNA fragments amplified by this reaction did not contain the first 13 nucleotides at the N-terminal region, a second PCR was performed using the primers described below (HindIII underlined, the dark ones start codon and Stop codon). The relative positions of these primers are as shown in FIG. 4. Taq DNA polymerase (POSCO chem, Korea) and pfr polymerase (STRATGENE, Califonia, USA) were used for DNA amplification.

Primer # 12 (sense, 5 'to 3'):

C AAGCTT CGGAG ATG GGGTGCACGAATGTCCTGCCTGGCTGTGGC

Primer # 9 (antisense, 5 'to 3'):

C AAGCTT TCA TCTGTCCCCTGTCCTGC

The DNA amplified by the second PCR was cloned into pCRII (Invitrogene), and HindIII segments containing the genomic sequence of EPO were inserted into various expression vectors as described above. In this experiment, amplified DNA was placed under the control of an HCMV MIEP or SV40 early promoter to prepare pCMV-gEPO and pSV-gEPO, respectively. However, in the expression experiments performed in paragraphs (1) and (8), SY-EPO having the same amino acid sequence as that of known EPO was used (section VI).

Ⅵ. Nucleotide Sequence Analysis of the Cloned EPO Genome

The genomic structure of EPO cloned in the above manner differs from the native EPO genome in vivo . That is, the wild type EPO genomic DNA has five coding sites and four introns between them. However, the DNA cloned in the above-described process forms one coding site by closely coupling the first coding site and the second coding site, and is formed of four coding sites and three introns (FIG. 4).

Analysis of EPO gene sequences isolated from four individuals showed that the nucleotide sequence of EPO cloned from these sites at the intron position showed a significant difference from the sequences from two known EPOs (AM-EPO and GI-EPO) (FIG. 5). ). This difference may not be due to the experimental error sometimes seen during cloning using DNA amplification methods. Cloning and sequencing were repeated using DNA prepared from the same person (but at different times) and the same nucleotide sequence was obtained. As another control, nucleotide sequences were determined by amplifying already cloned EPO under almost identical conditions. At this time, the same nucleotide sequence was obtained again.

The four EPO genes and the amino acid sequences of AM and GI are shown in FIG. 6. The amino acid sequences of AM, GI and SY were identical. However, the amino acid sequence of the three people (JM, SH, HE) is different from the two to three amino acid sequences of GI- and AM-EPO, indicating that polymorphism exists among people. When comparing AM- or GI-EPO, HE-EPO had three amino acids different at the C-terminal region, while SH-EPO had three different amino acids distributed throughout the polypeptide, and JM-EPO had two amino acids. The polypeptides differed one by one at the intermediate and C-terminal sites (see FIG. 6). For example, among the 191 EPO amino acids, AM-EPO and GI-EPO were serine, alanine, and valine at positions 36, 100, and 170, respectively, while SH-EPO was arginine, serine, and tyrosine. In addition, AM-EPO and GI-EPO were valine, lysine and arginine at the 170th, 177th, and 191th positions, respectively, while HE-EPO was tyrosine, glutamine, and glycine. In the case of JM-EPO, the 54th and 170th positions were lysine and tyrosine, while the controls were threonine and valine. The above experimental results show that the EPO gene has polymorphism on the amino acid sequence as well as on the DNA sequence.

Iii. Expression of EPO in DE Cells

In this experiment, the degree of EPO expression was compared between DE cells and other cell lines.

EPO expression vectors were transfected into various cells, including DE, CEF, CHO, HeLa, VERO and 293T. VERO cells were used because they are frequently used for the expression of heterologous genes, and 293T cells have high efficiency in DNA transfection and have strong viral transactivators such as E1A, E1B and large T antigens. Was used because of its very high expression. 2 to 3 days after transfection, the amount of EPO in the culture supernatant was measured by an enzyme linked immunoadsorbent assay, and the transfection efficiency was measured by X-gal staining of cells attached to the culture vessel. Determined by. Transfection efficiency was performed by transfecting the lacZ expression vector simultaneously with the EPO expression vector as described in II above. Representative results of this analysis are shown in Table 2 below.

cell HCMV MIEP SV40 initial promoter HCMV / SV40 293 314 17.5 18 CHO 139.4 10.4 13.5 VERO 250 10.7 23.5 NIH3T3 89 79.4 1.1 DE 4335 13.8 314.8

There was little difference in EPO production between cell types when using the SV40 early promoter. However, when HCMV MIEP was used, DE cells produced significantly higher EPO than other cell lines tested. HCMV MIEP showed high activity compared to the SV40 early promoter in almost all experimental cells. This difference was particularly evident in DE cells, which produced 315 times as many EPOs. Among the various cells used in the experiment, DE cells always produced the highest amount of EPO. CHO cells are the parent cell of the cells that produce EPO currently used in the human body. However, in this transient system the level of EPO in these CHO cells is at least 30 times lower than in DE cells. The difference between DE and 293T cells is also remarkable. The transfection efficiency of 293T is about 30 times higher than other cells, including DE cells. In addition, 293T cells produce a powerful viral transcription transactivator. Nevertheless, the ability of DE to produce 10 times more EPO than 293T means that DE induces gene expression very strongly.

In conclusion, the above results indicate that human EPO is effectively produced and released from DE cells, and HCMV MIEP is a promoter capable of inducing heterogeneous gene expression very efficiently in DE cells.

In summary, we have found that DE cells produce bacteria and human proteins at very high efficiency. It was confirmed that all of the experimented promoters induce higher rate expression of genes in DE cells than in other cell lines used in the present invention. In particular, HCMV MIEP showed a very good effect in DE cells. The high expression of the heterologous genes observed was not due to the large number of transfected cells. Transfecting DE cells with an expression vector containing the EPO genomic DNA sequence produced a large amount of EPO in the culture supernatant, indicating that the DE cells performed splicing and secretion appropriately.

In order to use DE cells for industrial purposes, it is necessary to develop a technique for culturing these cells on a large scale. There are two ways. First, it is possible to use the primary cell itself as a producer line. Large amounts of DE cells can be readily prepared from duck embryos 10-13 days of age. It is easy to obtain 10 ⁹ to 10 ¹⁰ cells from at least 15 passages from one embryo. It is therefore possible to transfect DE cells with an expression vector and select transfected cells at the earliest possible stage, which requires 4 to 7 passages. Even if less than 5% of the cells described above have been transfected, a large amount of transfected cells can be used, suggesting that it is not impossible to massively culture the original duck germ cells with the original cells. Second, duck embryonic cells can be transformed at an early stage using a large amount of specific oncozin available. Transformed DE cells can be used to make a production strain and to control the production of high quality proteins. It should be observed whether the transformed DE cells can still maintain high efficiency of gene expression ability. Although many biological problems must be solved, the study of these cells for the production of various proteins is well worth it.

Iii. Expression of Heterologous Genes in Transformed Avian Cell Lines

The above experiments showed that DE cells have great potential as producers of heterologous proteins such as EPO. However, the DE cells used in these experiments are the first cells and in vitro (in vitro)in No more cell division after 30-40 passages. Thus, if DE cells are transformed or no specific techniques such as those described above are developed, these germ cells will be difficult to use for the industrial production of heterologous proteins.

In the following experiments we examined whether transformed algal cell lines, ie quail fibrosarcoma, could be used for EPO production. The quail fibrosarcoma, QT-VC, used in this study was subcloned into QT6 (ATCC CRL1708). This is a cell line derived from fibrosarcoma produced by treating Japanese quail with methylcholanthrene. QT-VC differs from its parent line in at least two ways. First, QT-VC grows faster than its parent in M199 medium containing 10% FBS used in the present invention. QT-VC splits every 12-24 hours, and its doubling time is 24-36 hours. Second, AT-VC cells are generally rounder than QT6, which grow in elongated form. Like its parent, QT-VC does not grow well when inoculated with low density of cells. Therefore, when the cells were continuously cultured, the cells were fused and then inoculated by dividing the cells into ⅓ to ½.

1) Gene expression analysis in QT-VC cell line

We compared the gene expression levels between mammalian cells using QT-VC and pCMV-CAT. HCMV MIEP was selected and used because it was found that HCMV MIEP induced gene expression in various cell types including algal cells as a promoter (see Section IV). pCMV-CAT was transfected with three cell lines, CHO, HeLa and Vero. To make this comparison quantitative, all transfection and CAT analyzes were performed under the same conditions at the same time. Transfection efficiency was measured by coatfection pCMV-lacZ and staining with X-gal. In all cases the efficiency was about 3%. Under these conditions, the degree of CAT expression in QT-VC cells was always two to three times higher than the mammalian cell line used in the present invention (FIG. 7). Although the level of gene expression in QT-VC cells is lower than in DE cells, quail fibrosarcoma is at least as good as mammalian cell lines, indicating that this fibrosarcoma can be used as a heterologous protein producer.

2) Preparation of EPO Expression Vector for QT-VC Cells

Other EPO expression vectors were prepared to test the high degree of heterologous protein expressed in QT cells. The basic strategy for preparing the expression vector is as follows.

First, HCMV MIEP was used to induce the expression of heterologous genes because it has already been found to be one of the strong promoters in avian cells as well as mammalian cells.

Second, human glutamine synthase (GS) gene was used for target gene amplification. In general, genes are amplified to increase the amount of protein using any selected label in the presence of certain chemicals. The best example is the dihydrofolate reductase (DHFR) gene. As the concentration of methotrexate (MTX) in the medium was gradually increased, the number of copies of heterologous genes and the amount of each protein were increased. However, this system cannot be directly applied to QT cells where such mutants are not yet available because the host cells must be incomplete in the gene DHFR. For this reason, the GS gene was selected and used. In this case, only multiple copies of the GS gene have resistance to methionine sulfoximine (MSX), so the host cell does not need to lack the GS gene.

The overall structure of the EPO expression vector prepared for use in QT cells is shown in FIG. 8. In this structure, the cDNA sequence of EPO is regulated by HCMV MIEP, the bacterial Neo gene is used as the first selection marker, and the human GS gene is also present as the second selection marker in the same plasmid. The basis of the expression vector used in this particular experiment was the introns of the pCI-neo (Promega, USA) and β-globin genomes using HCMV MIEP. We have prepared a pair of other constructs in which the GS gene is induced by partial MMTV LTR (-220 to +15) or 220 bp HSV tk promoters. In both cases, the degree of gene amplification was comparable (data not shown). Detailed procedures and additional data regarding the preparation of expression vectors are available upon request.

3) Preparation of QT-VC Cell Line Stably Expressing EPO

EPO expression vectors were transfected into the cells by calcium phosphate precipitation as described in Section II to prepare QT-VC cell lines that constantly express EPO. EPO production was confirmed by ELISA 3 days after transfection and transfected cells were treated with G418 (0.8 mg / ml) and MSX (25 μΜ). When cells resistant to G418 were grown and fused, the cells were diluted and subcloned. Since QT-VC cells do not grow effectively at low cell densities, cells were seeded in 10 cm culture dishes in various numbers (10 ² , 10 ³ , 10 ⁴ , 10 ⁵ / plate). The colonies that grew apart from the other colonies were then separated into plastic O rings and transferred to 96-well plates. EPO production was measured when cells were 70% fused. Subclones produced at 200 U / ml or higher were continuously transferred to 12-well, 6-well, 60 mm culture dishes to increase cell number. Once the cells were fused in 60 mm dishes, cells were separated into 6-well plates and treated with various concentrations of MSX (100 μM, 250 μM, 1 mM). This method was used to produce large amounts of EPO and to select several fast-growing subclones.

One subclone obtained through this method is QT-N4D4. As shown in FIG. 9, this subclone produced 1200 U / ml when grown for 3 days after fusion. N4D4 still showed a productivity of 1000 U / ml when the cells were split 1: 3 and seeded in 10 cm dishes and grown again for 3 days. The cells still produced 400 U / ml EPO when the medium was changed to fresh medium containing 2% FBS. This result indicates that QT cells can produce large amounts of EPO.

In conclusion, these results indicate that QT cells have great potential as producers of heterologous proteins.

Iii. Biological Activity of EPO Produced in Algal Cells

EPO is highly glycosylated and this glycosylation is necessary for biological activity. For example, EPO produced in E. coli or yeast is inactive or very weakly active in vivo. Bioassay was performed using spleen cells isolated from rats treated with phenylhydrazine in vitro to determine whether EPO expressed on DE or QT cells was biologically active.

EPO Assay: After transfection of various cells, the absolute amount of EPO production was recently determined by the enzyme bound immunosorbent method used to measure EPO levels in human serum (R & D Systems Inc., Minnesota, USA). Bioassays were performed in vitro with the Krystal method modified by Goldberg et al. To measure the biological activity of EPO. Phenylhydrazine (60 mg / kg body weight / day) was injected for two days and splenocytes were obtained from F1 hybrid mice (Seoul National University Laboratory Aminal Center) 3 days after the last injection. , Lymphoprep ^™ (NYCOMED PARMA AS, Oslo, Norway) produced splenic cell suspension. Splenocytes (final concentration 4 × 10 ⁶ cells / ml) in 24-well tissue culture plates were collected at various standard doses of EPO (CILAG AG International, Switzerland; 2000 U / ml of specific activity) or unknown samples. Incubated for 22 hours and pulsed with 4 μCi / well tritiated thymidine (Amersham Co.) for 2-3 hours. Cells were harvested, washed several times with PBS, and then lysed with 0.3N NaOH and 0.1% SDS. Radioactivity was calculated on a Pharmacia Wallac 1410 scintillation meter in LSC cocktail solution.

EPO levels were measured by two methods, ELISA and bioassay, using culture supernatants from QT-N4D4 cells or DE cells transfected with EPO expression vectors. ELISA measures absolute concentrations and is recently used to determine EPO concentrations in human serum. Bioassays, on the other hand, use control EPO produced from mammalian cells to determine biological activity and have recently been used in humans. Figure 10 compares the differences in the degree of EPO determined by these two methods. The ratio of values (mU) was 1 ± 0.15, and the specific activity of EPO produced from DE cells was measured at 105 U / μg. Therefore, the degree of EPO measured by ELISA was very similar to that obtained by bioassay. This result indicated that EPO prepared from these algal cells had biological activity similar to EPO commercially available.

Claims (21)

DNA encoding erythropotin; A vector into which the DNA is inserted; Algal cells in which the vector is expressed; Containing erythropotin production system. The system of claim 1, wherein said algal cell is DE or CEF or QT. The system of claim 2, wherein the QT is QT-VC. The erythropotin production system according to claim 1, wherein the DNA is genomic DNA encoding erythropotin. The erythropoin production system of claim 1, wherein the DNA encoding the erythropotin is selected from the group consisting of SY, JM, SH, and HE shown in FIG. 5. The system of claim 1, wherein the vector comprises a promoter selected from the group consisting of an SV40 initial promoter, an HCMV MIEP, and an RSV LTR. Inserting the DNA encoding erythropotin into the vector; Transfecting said vector into avian cells; Culturing the transfected algal cells in medium; A method for producing erythropotin comprising a step. The method of claim 7, wherein the algal cell is DE or CEF or QT. The method of claim 8, wherein the QT is QT-VC. The method for producing erythropotin according to claim 7, wherein the DNA encoding the erythropotin is genomic DNA. The method of claim 7, wherein the DNA encoding the erythropoinin is selected from the group consisting of SY, JM, SH, and HE shown in FIG. 5. The method of claim 7, wherein the vector comprises a promoter selected from the group consisting of an SV40 initial promoter, an RSV LTR, and an HCMV MIEP. EPO genomic gene having a DNA sequence selected from the group consisting of SY, JM, SH and HE shown in FIG. EPO having an amino acid sequence selected from the group consisting of JM, SH and HE shown in FIG. Avian cells as host cells for expressing a gene encoding erythropoinin. The algal cell of claim 15, wherein the algal cell is DE or CEF or QT. The algal cell of claim 16, wherein the QT is QT-VC. DNA encoding human heterologous protein; A vector into which the DNA is inserted; Algal cells in which the vector is expressed; Human heterologous protein production system comprising. The system of claim 18, wherein the human heterologous protein is selected from the group consisting of TPA, FactorⅧ and EPO. Inserting the DNA encoding the human heterologous protein into the vector; Transfecting the vector into algal cells; Culturing the transfected algal cells in medium; Method for producing a human heterologous protein comprising a step. The method of claim 20, wherein the human heterologous protein is selected from the group consisting of TPA, FactorⅧ, and EPO.