KR19990043809A - New flu live virus - Google Patents

Abstract

The present invention relates to a novel cold-adaptive influenza virus that can be used as a vaccine against influenza, and more particularly, by incubating several times at a low temperature of 24 ° C using a flu strain (Influenza virus), which is grown in fertilized eggs as a parent strain. The present invention relates to a cold-acting influenza virus obtained, a method for preparing the same, a recombinant influenza virus obtained by co-infection with the same host cell as a flu virus, and a use thereof as a live vaccine. Is a flu virus that exhibits temperature sensitivity, excellent growth ability in fertilized eggs, and significant reduction in biotoxicity, and can be usefully used as an effective live vaccine of the flu.

Description

New flu live virus

The present invention relates to a novel cold-adaptive influenza virus that can be used as a vaccine against influenza, and more particularly, by incubating several times at a low temperature of 24 ° C using a flu strain (Influenza virus), which is grown in fertilized eggs as a parent strain. The present invention relates to a cold-acting influenza virus obtained, a method for producing the same, and a recombinant flu virus obtained by co-infection with the same host cell as the flu virus that is used therein, and the use of them as a live vaccine.

Influenza virus is a respiratory infection that spreads not only in humans, but also in livestock and other animals such as birds, pigs, horses, seals, whales, minks, and others. The flu virus usually infects the upper respiratory system, but can also penetrate the lungs and cause fatal diseases.

When pandemic pandemic of Spanish influenza occurred in 1918, more than 2 million people died (Epidemic and Peace 1918, Greenwood press, 145-170, 1976), Asian Virus (H2N2) in 1957, 1968 Hundreds of thousands of people have died from the worldwide epidemic of the Hong Kong virus (H3N2) and the Russian virus (H1N1) in 1977. In addition to this global pandemic of the 10-year cycle, more than 10,000 patients are killed each year due to epidemic flu (Mobid Mortal Wkly. Rep. 36, 273, 1987).

On the other hand, the cost of losing the flu worldwide is enormous. For example, the cost of one pandemic flu is estimated at $ 3-50 billion (Diseases of importance in the United States, Natl. Acad. Press, 342, 1985; Am. J. Med. 82, 26, 1987), therefore, if vaccination could provide 80% of prevention, it would save about $ 2.5 billion.

Influenza viruses have antigenic-to-mutant (antigenic shift / antigenic drift) of their surface antigens, Hemagglutinin (abbreviated "HA") and Neuraminidase (abbreviated "NA"). Easily modified to counteract the effects of existing flu virus infections or vaccine prevention. Therefore, it is necessary to prepare a vaccine having a similar immunogenicity in anticipation of a flu virus that is likely to spread in the future, and a new vaccine should be administered every 1-2 years.

The World Health Organization (abbreviated as "WHO") monitors the emergence of viruses and releases the next flu virus at the beginning of each year. When the WHO announces the next influenza virus, the virus strain should be produced as a vaccine, and the growth of these viruses is generally poor in fertilized eggs cultured for 10 days, a host used for the preparation of the vaccine. Therefore, in the fertilized egg, the virus strains that are actively growing are used together. In type A influenza virus, A / PR / 8/34 or A / X-31 is the parent strain that provides the remaining six genes except HA and NA in vaccine production. Widely used (Influenza, Plenum Medical Book Company, 291, 1987).

The current flu vaccine is a killed vaccine, which is a type of purified virion that was first developed in the early 1930's by inactivating formalin or β-propiolactone. A whole virion vaccine and virion were converted into a twin-ether mixture, sodium desoxycholate, triton N101, ethylmethyl-ammonium bromide There is a disrupted virus vaccine that is purified by pulverizing the virus by treatment with a non-ionic detergent such as ammoniumbromide, and a subunit vaccine that separates and purified the virus surface antigens HA and NA. ).

To date, these vaccines have been used mainly for the prevention of the flu and have been reported to have a protective effect of about 70-80%. However, these vaccines have the following problems as vaccines.

First, careful attention is required to ensure that there are no live virulence viruses during the inactivation of the virus and no modification of immunogenicity.

Second, four vaccines accumulate in high concentrations of circulating antibodies such as IgM and IgG, but IgA, which is a cause of local resistance, is difficult to prevent infection in the early stage.

Third, cell-mediated responses are less likely to occur than live vaccines.

Fourth, the duration of immunity is particularly short in adults.

Fifth, because it is an injection, there are difficulties in administering it especially to children.

Sixth, due to yearly continuous administration of heterologous proteins, side effects such as hypersensitivity reactions and side effects due to protein of fertilized eggs that may be introduced during the purification process may occur.

In order to improve the problems of the four vaccines, the development of other alternative vaccines is required, and live vaccines are currently being developed and tested as potential candidates.

Such live vaccines have to be significantly reduced in toxicity and have a property that does little harm to the human body and a genetic stability that does not return toxicity after administration. The production of attenuated live vaccines has been attempted in several ways as follows.

The first is to obtain a temperature-sensitive mutant by inducing mutations (J. Infect. Dis. 128, 479, 1973), and the second is to select mutants that replicate well at low temperatures by continuous passage at low temperatures. (Vaccine 3, 335, 1985), and third, using a host-range mutant that infects and replicates easily with animals other than humans, but not easily with humans (Science 218, 1330). , 1982).

However, most cases of temperature-sensitive mutations are made by point mutations in one or two genes, and there is a problem in that return mutations can easily occur (Bull. WHO. 59, 165, 1981). The influenza virus gene has the potential risk of introducing human flu virus into another highly toxic virus (Option for the control of Influenza, Excerpta Medica 207, 1986).

Until now, the virus most commonly used as a live vaccine has been a flu strain produced by a low temperature adaptation method. In the former Soviet Union, two kinds of low temperature adapted attenuated strains have been used for many years. One is the A / Leningrad / 134/17/57 (H2N2) strain, obtained by passage 17 times at 25 ° C. It has been known that there is a temperature-sensitive variation in the PA, NP, and M proteins of the virus (J. Gen. 53, 215, 1981). The other strain was A / Leningrad / 134/47/57 (H2N2) strain obtained by passage 47 times at 25 ° C. It was confirmed that there is a temperature-sensitive variation in PB2, PA, NP, M, NS proteins, etc. Infect Immun. 44, 730, 1984). This strain was further passaged at 25 ° C. to further reduce the toxicity of the A / Leningrad / 134/17/57 strain to address the problem of minor side effects in young children. However, immunogenicity is known to be inferior to A / Leningrad / 134/17/57 strains.

And, although not yet available, the promising candidate for live vaccines is the A / Ann Arbor / 6/60 (H2N2) low temperature adaptive virus (Nature 213, 612, 1967). Cold-adapted A / Ann Arbor / 6/60 strains were obtained by passage in primary chick kidney cells and fertilized eggs in stages at 33 ° C, 30 ° C and 25 ° C. This strain has a temperature sensitive phenotype that inhibits replication at 38-39 ° C., where wild-type viruses replicate, has a low temperature adaptability that replicates well at 25 ° C., and a reduced toxicity phenotype that inhibits replication above or below the animal's respiratory tract. (Rev. Infect. Dis. 2, 421, 1980; Arch. Virol. 64, 171, 1980). Genomic analysis of the virus revealed mutations in all eight genomic genes (Virology 167, 554-567, 1988).

As a parent strain of the A / Ann Arbor / 6/60 virus, a recombinant virus with a H1N1 or H3N2 influenza virus was produced and used in humans. As a result, the recombinant virus can be infected with humans and maintain its attenuated characteristics. The presence of immunogenicity, in particular, promoted the induction of IgA and showed genetically stable properties but little contagion.

Compared to four vaccines currently used as live vaccines, virus strains by cold adaptation have the following advantages.

First, degeneration of the viral antigen protein that occurs during the inactivation of the vaccine can prevent immunogenicity from being reduced,

Secondly, it can prevent hypersensitivity reactions caused by continuous intramuscular administration of heterologous protein every year.

Third, the production of secretion antibody IgA is induced to enhance the immune effect required for the prevention of infection,

Fourth, it can be easily inoculated by nasal spray rather than injection, reducing rejection and especially effective for vaccination of young children.

Fifth, there is the ability to inhibit the growth of wild-type virus when administering a live vaccine strain may be expected to have a therapeutic effect.

Therefore, the present inventors have the advantages as described above, while researching to develop a strain for live vaccines due to high temperature adaptation, which is more stable and productive, the A / X-31 virus, which is active in fertilized eggs, is grown at a low temperature of 24 ° C. The present invention was completed by confirming that the low-temperature-adapted influenza virus was passaged at and co-infected with the same host cell as the wild-type influenza virus to obtain a recombinant influenza virus.

An object of the present invention is to provide a cold-acting influenza virus for influenza live vaccines, which can reduce the toxicity, effectively maintain the genetic stability and improve productivity of the disease caused by the infection of the flu virus.

Figure 1 compares the toxicity of nasal infection of flu virus A / X-31 and 50 μl of cold-acting influenza virus HTCA-A101 (10 ⁷ pfu / ml) in mice.

Δ: PBS control group; □: A / X-31 virus infection;

○: HTCA-A101 virus infection;

Figure 2a shows the average weight change of surviving mice over time when the wild-type A / PR / 8/34 virus in the nasal infection of the mice at different concentrations,

Δ: PBS control group; □: 10 ⁴ pfu virus infection;

○: 10 ⁵ pfu virus infection; ▲: 10 ⁶ pfu virus infection;

■: 10 ⁷ pfu virus infection; ●: 10 ⁸ pfu virus infection;

Figure 2b shows the number of mice that die over time when wild-type A / PR / 8/34 virus was infected in the nasal cavity at different concentrations in mice.

In order to achieve the above object, the present invention provides a novel cold-acting flu virus that can be used as a vaccine against the flu.

Specifically, the present invention provides a cold-acting influenza virus that shows excellent growth capacity and a significant reduction in biotoxicity in fertilized eggs obtained by passage of a large number of flu viruses grown in fertilized eggs at a low temperature of 24 ° C.

The present invention also provides a cDNA gene of the cold-adapted virus.

In another aspect, the present invention is to inject the flu virus active in fertilized egg into the fertilized egg and incubated for several days at low temperature, the virus is recovered by subcultured in such a way that the virus is recovered from the fertilization of the fertilized egg and injected again into the fertilized egg to obtain the virus It provides a manufacturing method.

The present invention also provides a recombinant influenza virus obtained by co-infecting the low-temperature adaptation virus with wild-type flu virus and fertilized egg.

In another aspect, the present invention provides a use of the cold-acting influenza virus and the recombinant flu virus obtained using the same as a live vaccine.

Hereinafter, the present invention will be described in detail.

I. Preparation of cold-acting flu virus.

The present invention provides a low-temperature adaptation flu virus by subcultured several times at a low temperature as a flu virus parent strain growing actively in fertilized eggs.

In the present invention, in order to obtain a high-productivity cold-acting influenza virus, a type A flu virus strain, which is a type of host mutant that is continuously adapted in fertilized eggs, reduces toxicity in humans and has excellent growth in fertilized eggs. Use In addition, B / Yamagata / 16/88 virus and B / Lee / 40 virus are used as the type B flu strains.

In general, low-temperature passaging reduces toxicity, but growth occurs. Therefore, in order to solve this problem, when subcultured at low temperature with a high-growth virus in fertilized eggs, the toxicity is further reduced and productivity is excellent. The strain is isolated.

In the present invention, influenza virus which is actively grown in fertilized eggs is injected into the fertilized eggs, cultured for several days at low temperature, the virus is recovered from the fertilized urea and passaged in such a manner as to inject them into the fertilized eggs to obtain cold-adapted flu virus. In this case, infecting the fertilized egg with too much of the virus recovered from the urine fluid generates defective interfering particles, which can degrade the growth of the virus, so use the minimum amount possible.

In this way, the mutations necessary for cold adaptation of the genes of the parent strain continue to accumulate during cold passaging, and thus the cold adaptation virus obtained has a lower temperature of 30 ° C or lower than the parent strain before the low temperature adaptation. It shows good growth at, but hardly grows at about 37 ℃. Therefore, such a cold-adapted virus can be immunized when infected, but because it does not grow at a body temperature of 37 ℃, the pathogenicity is very reduced and is suitable for use as an attenuated vaccine.

Specifically, in the present invention, A / X-31 virus is injected into the fertilized egg and passaged 19 times at 30 ℃, 40 times at 27 ℃ and 33 times at 24 ℃ to obtain a type A cold-acting influenza virus called HTCA-A101 It was named and deposited on November 11, 1997 to Gene Bank of Korea Institute of Science and Technology, Biotechnology Research Institute (Accession Number: KCTC 0400 BP).

In the present invention, B / Yamagata / 16/88 virus is injected into the fertilized egg and passaged 8 times at 30 ° C., 11 times at 27 ° C. and 21 times at 24 ° C. to obtain a type B cold-acting influenza virus called HTCA-B102. It was named and deposited on November 11, 1997 to Gene Bank of Korea Institute of Science and Technology, Biotechnology Research Institute (Accession Number: KCTC 0401 BP).

In the present invention, the B / Lee / 40 virus is injected into the fertilized egg and passaged 7 times at 30 ℃, 36 times at 27 ℃ and 32 times at 24 ℃ to obtain a type B cold-acting influenza virus and named it HTCA-B104 On November 11, 1997, it was deposited with Gene Bank of Korea Institute of Science and Technology, Biotechnology Research Institute (Accession Number: KCTC 0402 BP).

In order to confirm the mutation of the low temperature adaptation virus gene obtained by the above method, the low temperature adaptation influenza virus was cultured in MDCK (Madin Darby Canine Kidney) cell line, RNA was isolated and then reverse transcriptase polymerase chain reaction was used as a template. cDNA is synthesized by performing a transcription polymerase chain reaction (hereinafter abbreviated as "RT-PCR").

Specifically, in the present invention, the primers are designed inside the PB2, PB1, PA, NP, M, NS protein genes of HTCA-A101 virus RNA to perform RT-PCR to isolate cDNA of each gene. The cDNA genes of the PB2, PB1, and PA proteins encoding the polymerase have nucleotide sequences of SEQ ID NOs: 1, 2, and 3, respectively, and the NP protein cDNA encoding the nucleoprotein represents the nucleotide sequence of SEQ ID NO: 4, M, NS protein cDNA gene has the nucleotide sequence of SEQ ID NO: 5, 6. The eight genomes of the flu virus originally had unique numbers from 1 to 8, but the sequence numbers are added for convenience in the order shown in the following sequence listing in the present invention.

In order to confirm the genetic stability of the low-temperature adaptation virus prepared in the present invention, the nucleotide sequence of the HTCA-A101 virus gene and the amino acid sequence inferred therefrom of the A / X-31 virus, A / X-31 virus Comparison with parent strain A / PR / 8/34 virus and other flu viruses registered in Genbank. As a result, the HTCA-A101 virus of the present invention was found to be a novel strain different from the existing vaccine virus in which a new gene mutation related to low temperature adaptation occurred.

II. Characterization of cold-acting flu virus.

In order to confirm that the cold-acting influenza virus prepared in the present invention is an attenuated strain, plaque formation ability is investigated while culturing at different temperatures in MDCK cells. As a result, it was confirmed that the flu virus of the present invention had a cold adaptive phenotype and a temperature sensitive phenotype.

In addition, to determine the degree of attenuation of the cold-adapted virus prepared in the present invention, after the infection of the virus of the present invention in the rat nasal cavity of the experimental animal, the mortality and weight change of the rat over time is investigated. As a result, it was confirmed that the flu virus of the present invention is greatly reduced in toxicity and can be usefully used as a live vaccine.

In addition, in order to determine the growth capacity of the cold-adapted influenza virus prepared in the present invention, the fertilized egg is infected with the virus and cultured at different temperatures. As a result, the influenza virus of the present invention is excellent in its growth at low temperatures, so that the production cost can be lowered when producing a flu vaccine, and thus industrially useful.

III. Preparation of Recombinant Flu Virus.

In another aspect, the present invention provides a recombinant flu virus obtained by simultaneously infecting the low-temperature adaptation virus to wild-type flu virus and fertilized egg.

Recombinant virus between the low temperature adaptation virus and the pathogenic virus is infected with the higher cell line at the same time and grow for a sufficient time, during which a number of recombinant viruses are made by exchanging each other's viral genes. The low temperature adaptation recombinant virus is selected by using antibodies against the low temperature adaptation strain from several kinds of recombinant viruses, and the process is performed by infecting the virus solution obtained by co-infecting the pathogenic virus and the low temperature adaptation strain to the high temperature cell line. The culture is selected by culturing in an antibody-containing medium, and this is confirmed by a plaque inhibition assay again to determine whether the virus is a recombinant virus.

Specifically, the present invention co-infects HTCA-A101 cold-adapted virus with H1N1 and H3N2 type virulence viruses and fertilized eggs, and cultures the recombinant flu virus by plaque inhibition assay.

Ⅳ. Characterization of Recombinant Flu Virus.

In order to determine the characteristics of the recombinant influenza virus, it was confirmed that the cultivation at different temperatures in the MDCK cells and fertilized eggs, strains with reduced toxicity to maintain low temperature adaptability or temperature sensitivity.

In addition, in order to confirm the degree of attenuation of the recombinant flu virus, the state of the animal is examined over time after infection with the recombinant virus of the present invention in the nasal cavity of rats and rabbits as experimental animals. As a result, the recombinant flu virus of the present invention was found to be a strain with greatly reduced toxicity and confirmed that it can be usefully used as a live vaccine.

Hereinafter, the present invention will be described in detail with reference to Examples. The following examples illustrate the invention in detail and are not intended to limit the scope of the invention.

Example 1 Preparation of Type A Low-Temperature Flu Virus HTCA-A101

Fertilized eggs purchased from Spapas (SPAFAS, USA) were incubated in a 37 ° C. incubator for 10 days and then hatched eggs were selected to have good growth of embryos and used for virus infection.

First, the area to be injected is wiped with 70% alcohol, and then punched slightly into the egg shell with a punch, in which 0.1 ml of A / X-31 virus diluted with phosphate buffer solution (PBS) is added. Injected. The amount of virus injected is about 0.01 ~ 0.001 HAU.

After injecting the virus, the inlet is sealed with a candle, and then transferred to a thermostat controlled at 30 ° C., 27 ° C. or 24 ° C. and incubated. After 3 or 4 days of incubation, the eggs were treated at 4 ° C. for at least 5 hours to inactivate embryos. Cut the air sac of the inactivated egg with scissors, take an allantoic fluid, measure the amount of virus through HA analysis (HAemagglutination assay), filter it with a 0.2 μm syringe filter, and then use PBS. By diluting and injecting into a new egg, it was passaged 19 times at 30 ° C. and passaged 40 times at 27 ° C. and then passaged 33 times at 24 ° C.

The type A cold-acting influenza virus obtained by the above process was named HTCA-A101 and was deposited on November 11, 1997 to the Korea Institute of Science and Technology Biotechnology Research Institute Gene Bank (Accession Number: KCTC 0400 BP).

Example 2 Preparation of Type B Low Temperature Adaptive Flu Virus HTCA-B102

It was performed in the same manner as in Example 1 and used B / Yamagata / 16/88 virus as the influenza B virus, which was passaged 8 times at 30 ° C., 11 times at 27 ° C., and 21 times at 24 ° C. to form B. Cold adaptation flu virus was obtained.

The cold-adapted virus was named HTCA-B102 and was deposited on November 11, 1997 to the Genetic Bank of Korea Research Institute of Science and Technology (KCTC 0401 BP).

Example 3 Preparation of Type B Cold-Adaptive Flu Virus HTCA-B104

In the same manner as in Example 1, using the B / Lee / 40 virus as a type B virus, cold adaptation virus obtained by passage 7 times at 30 ℃, 36 times at 27 ℃, 32 times at 24 ℃ It was named HTCA-B104 and it was deposited on November 11, 1997 to Gene Bank of Korea Institute of Biotechnology, Korea Institute of Science and Technology (Accession No .: KCTC 0402 BP).

Example 4 Cloning of the Cold-Acting Flu Virus HTCA-A101 Gene.

The nucleotide sequence of each gene was determined and compared to examine the molecular level of HTCA-A101 that would have accumulated during cold adaptation.

In addition, considering the frequent occurrence of non-specific nucleotide substitution due to the characteristics of the replication mechanism of the flu virus, the nucleotide sequences of the parent strains A / X-31 and HTCA-A101 were simultaneously determined in order to identify mutations caused by low temperature adaptation. Compared.

Cloning of the genes of A / X-31 virus and HTCA-A101 virus was performed as follows. After infecting the two types of viruses with 5 moi of MDCK cell monolayers derived from the kidneys of dogs, HTCA-A101 virus was incubated at 30 ° C. and X-31 virus at 37 ° C. for 6 hours. RNA was isolated using QIAGEN's RNeasy Total RNA Kit. For each of the PB2, PB1, and PA protein genes, primers were devised inside each gene to perform PCR to obtain PCR products containing the entire influenza virus gene.

The concentration of the generated RNA was determined based on the absorbance at 260 nm, followed by 5 μg of RNA for the PB2, PB1, and PA protein genes, and 2 μg of RNA for the remaining NP, M, and NS protein genes. RT-PCR was performed using the Superscript Preamplification System. Primer sequences used for RT-PCR are shown in Table 1 below.

Primer sequence used for RT-PCR Primer Sequence PB2 + 5 'CCGGATCCGACGCAGCAGAGCGAAAGCAGGTCAATTATATTCAATATG 3' PB2- 5 'CCGGATCCTAATACGACTCACTATAAGTAGAAACAAGGTCGTTTTTAAACTATTCGACA 3' PB2I + 5 'ATCAGCGACTGAATCCTATG 3' PB2I- 5 'GCATAGGATTCAGTCGCTGAT 3' PB2S + 5 'AGCGAAAGCAGGTCAATTATATTCAATATG 3' PB2S- 5 'AGTAGAAACAAGGTCGTTTTTAAACTATTC 3' PB1F + 5 'AAGCTTGAAGCTTGAATGCGAGCGAAAGCAGGCAAACCATTTGAATGGATGTC 3' PB1F- 5 'TTCATGATTGGGTGCGTTCACAATCAGAGCA 3' PB1L + 5 'TGCTCTGATTGTGAACGCACCCAATCATGAA 3' PB1L- 5 'AAGCTTGAAGCTTAATACGACTCACTATAAGTAGGAACAAGGCATTTTTTCATGAAGGACAAG 3' PB1S + 5 'AGCGAAAGCAGGCAAACCATTTGAATGGAT 3' PB1S- 5 'AGTAGGAACAAGGCATTTTTTCATGAAGGA 3' PA + 5 'CCGAATTCGAATGCGAGCGAAAGCAGGTACTGATCCAAAATGGAAGAT 3' PA- 5 'CCGAATTCTAATACGACTCACTATAAGTAGAAACAAGGTACTTTTTTGGACAGTATGGA 3' PAI + 5 'GCAGAACTGCAGGACATTGA 3' PAI- 5 'TCAATGTCCTGCAGTTCT 3' PAS + 5 'AGCGAAAGCAGGTACTGATCCAAAATGGAA 3' PAS- 5 'AGTAGAAACAAGGTACTTTTTTGGACAGTA 3' NP + 5 'CCGAATTCCTCTTCGAGCAAAAGCAGGGTAGATAATCACTCACTGAGT 3' NP- 5 'CCGAATTCTAATACGACTCACTATAAGTAGAAACAAGGGTATTTTTCTTTAATTGTCGT 3' Mat + 5 'CCGAATTCTCTTCGAGCGAAAGCAGGTAGATATTGAAAGATGAGTCT 3' Mat- 5 'CCGAATTCTAATACGACTCACTATAAGTAGAAACAAGGTAGTTTTTTACTCCAGCTCTA 3' NS + 5 'CCGAATTCGAATGCGAGCAAAAGCAGGGTGACAAAGACATAATGGATC 3' NS- 5 'CCGAATTCTAATACGACTCACTATAAGTAGAAACAAGGGTGTTTTTTATTATTAAATAA 3'

The PCR product amplified by the above procedure was purified using Qiagen's Qiaquick PCR Purification Kit, and then phosphorylated with N4's T4 polynucleotide kinase to phosphorylate 1%. Electrophoresis was performed on an agarose gel. The portion corresponding to the desired size on the agarose gel was separated and purified using a JetSorb Gel Extraction Kit from GENOMED. Each gene constructed in the above manner was used as a template for sequencing.

To prepare the vector for cloning, the pUC18 plasmid was digested with HincII restriction enzyme from NEB, isolated by electrophoresis on a 1% agarose gel, and used with a GENOMED's Jetsorb gel extraction kit. After purification and linkage with the isolated gene, E. coli was transformed to produce a recombinant plasmid containing the viral gene.

Base sequencing was performed using an automated sequencer of Applied Biosystem, and the primers were prepared by using DNA / RNA synthesizers of the same company.

The sequence of the primers was designed at every 300 nucleotide intervals from the reported A / PR / 8/34 gene base sequence and is shown in Table 2 below.

Primer for sequencing gene location Sequence PB1 +578 TTCAGAGAAAGAGACGGG PB1 +880 GTAAGGAAGATGATGACC PB1 +1200 CCGACCGATCTTAATAGA PB1 -1786 CAGCTTTGGAACGGGTTT PB1 -2035 TTCTTTTGGGGATCCAGG PB1 +2018 CCTGGATCCCCAAAAGAA PB1 -2290 GCCGTCTGAGCTCTTCAA PB2 +569 CGCAACTAACACAGCACA PB2 +871 GAGATGTGCCACAGCACA PB2 +1174 CAGCTGATAGTGAGTGGG PA +560 GACAAGAAATGGCCAGCA PA +871 CTGCTGATGGATGCCTTA PA -1464 GAAATCATCCATTGCTGC NP +279 CCTTGAAGAACATCCCAG NP -330 AGGTCCTCCAGTTTTCTT NP +585 TGCTGCAGTCAAAGGAGT NS +275 TGTACCTGCGTCGCGTTA NS +574 GGGGACTTGAATGGAATG PB1 +271 GCCCAAACAGATTGTGT PB1 -329 ATACCAGGATGGGATTCC PB2 +271 AATGATGCCGGATCAGAC PB2 -330 CCTATTCCACCATGTCAC PB2 -1778 GGCCTTAGGTAGTAAAG PB2 -2083 CTCCAGCTGTGCCTTCAT PB2 +2066 ATGAAGGCACAGCTGGAG PA +270 AGATCGCACAATGGCCTG PA -330 TTTCTCAGCCCCTGTAGT PA +1447 GCAGCAATGGATGATTTC

gene location Sequence PA +1773 TTGTCTCCTCCAGTCACT PA +2019 GCTTCTTATCGTTCAGGC NP +871 CTGCCTGCCTGTGTGTAT NP -1358 GATGTTCTCCCCTCTGT M +270 ATGCCCTTAATGGGAACG M -341 CCCTCTTGAGCTTCCTAT M +572 AGCACTACAGCTAAGGCT M -898 CCTCCTTTCAGTCCGTAT

About 15 to 20 nucleotide sequences at the 3 'and 5' termini were replaced by the primer sequences used for PCR, and ambiguous sequences were solved by using primers for other parts, especially complementary strands. . The determined base sequence of each gene is shown in the sequence listing.

Example 5 Analysis of Base and Amino Acid Sequences of Cold-Acting Flu Virus HTCA-A101

The nucleotide sequence of the HTCA-A101 virus gene determined in Example 4 was confirmed by comparing the nucleotide sequence of the A / X-31 virus using a pasta program (FASTA program, PNAS 85, 2444-2448, 1988). . To compare amino acid sequences, amino acid sequences were inferred from the base sequences using the DNASIS program.

Specifically, A / X-31 virus is a recombinant virus that inherits six internal genes from A / PR / 8/34 and surface genes HA and NA from A / HK / 68, and has been adapted to fertilized eggs for a long time. Since it is a virus that appears to have accumulated a large number of mutations and eventually lost pathogenicity to humans, the gene of A / PR / 8/34, the first parent strain, to track base and amino acid variations that would have accumulated by adapting to fertilized eggs. Were compared with the A / X-31 virus gene (Table 3a, Table 4a, Table 5a, Table 6a, Table 7a, Table 8a).

We also compared the mutations presumed to be caused by the HTCA-A101 virus in the low temperature adaptation process with the A / X-31 virus and also the Genbank database (Clustal V program; Gene 73, 237-244, 1988). It was compared with amino acid sequences of other influenza viruses (Table 3b, Table 4b, Table 5b, Table 6b, Table 7b, Table 8b) registered in the Genbank Database (Table 3c, Table 4c, Table 5c, Table 6c, Table 7c). ).

First, when comparing the nucleotide sequences of the A / PR / 8/34 virus and the A / X-31 virus genes, a total of 71 mutations were observed, of which only 24 showed amino acid substitutions. As compared with flu viruses, nine were found to be unique or rare mutations (two in PB2, two in PB1, one in PA, two in M1, and two in M2). Although, to date, there has been no consensus on variations reported to be involved in host specificity or attenuation, considering the limited research data on gene mutations associated with expression traits, each case is involved in superior growth in attenuated or fertilized eggs. I think it will.

Next, when the A / X-31 virus was cold-adapted with HTCA-A101 virus, a total of 30 base mutations were observed, of which 16 were amino acid substitutions. This case is compared with other genes from GenBank and shows 9 unique or rare amino acid mutations (2 in PB2, 2 in PB1, 2 in NP, 2 in M1, and 1 in M2). , One mutation related to host specificity (M1) and one mutation related to attenuation (M2). Thus, it was found that the attenuated gene was very different from the known low temperature adaptation virus.

For each gene, the meaning of base and amino acid substitution during cold adaptation was examined.

(5-1) Review of PB2 protein gene.

Comparison of A / X-31 Virus PB2 Protein Gene with A / PR / 8/34 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains PB2 (2341nt) 759 a.a 49 A-> C - - PB2 342 G-> A 105 M-> I PB2 Met, Thr, Val, Ala 779 A-> G 251 K-> R PB2 Arg, Lys 852 C-> T - - PB2 923 A-> G 299 K-> R PB2 Arg, Lys 930 G-> T - - PB2 953 T-> A 309 G-> D PB2 Glu, Asp, Gly 1269 G-> C - - PB2 1527 C-> T - - PB2 1530 G-> T - - PB2 1537 G-> A 504 V-> I PB2 Val 1815 G-> A - - PB2 2001 C-> T - - PB2 2055 C-> T - - PB2 2132 G-> A 702 R-> K PB2 Arg, Lys 2149 T-> C - - PB2 2238 A-> G - - PB2

Other influenza viruses registered in the Genbank Database extracted to compare amino acid sequences of PB2 proteins. Strain Registration Number Author Name A / Ann Arbor / 6/60 (H2N2) M23970 J04349M23971 Cox & Maassab et al., 1988 A / budgerrigar / Hokkaido / 1/77 (H4N7) m73523 M36046 Gorman & Webster et al., 1990 A / Dunedin / 4/73 M74899 Herlocher & Maassab 1991 A / equine / Kentucky / 2/86 (H3N8) M73526 M36049 Gorman & Webster et al., 1990 A / equine / London / 1416/73 (H7N7) M73520 M36043 Gorman & Webster et al., 1990 A / equine / Prague / 1/56 (H7N7) M73519 M36042 Gorman & Webster et al., 1990 A / FPV / Weybridge M38291 Petrov & Golovin et al., 1988 A / gull / Astrakhan / 227/84 (H13N6) M73516 M36039 Gorman & Webster et al., 1990 A / gull / Maryland / 704/77 (H13N6) M73525 M36048 Gorman & Webster et al., 1990 A / Kiev / 59/79 (H1N1) M38277 Petrov & Golovin et al., 1988 A / Korea / 426/68 (H2N2) M73524 M36047 Gorman & Webster et al., 1990 A / Leningrad / 134/17/57 (H2N2) M81581 Klimov & Kendal et., 1992 A / Leningrad / 134/47/57 (H2N2) M81587 Klimov & Kendal et., 1992 A / Leningrad / 134/57 (H2N2) M81575 Klimov & Kendal et., 1992 A / Los Angeles / 2/87 (H3N2) U62543 Parkin et al., 1996 A / Memphis / 8/88 (H3N2) M73517 M36040 Gorman & Webster et al., 1990 A / PR / 8/34 (H1N1) J02153 Winter & Fields et al., 1990 A / ruddyturnstone / NewJersey (H4N6) M73518 M36041 Gorman & Webster et al., 1990 A / seal / Massachusetts / 133/82 (H4N5) M73522 M36045 Gorman & Webster et al., 1990 A / Singapore / 1/57 (H2N2) M73521 M36044 Gorman & Webster et al., 1990 A / swine / 1976/31 (H1N1) M55470 Schultz & Scholtissek et A / swine / 1976/31 (H1N1) M55469 Schultz & Scholtissek et A / swine / Germany / 2/81 (H1N1) M55471 Schultz & Scholtissek et A / swine / Iowa / 15/30 (H1N1) M73515 M36038 Gorman & Webster et al., 1990 A / swine / Tennessee / 24/27 (H1N1) M75515 M36036 Gorman & Webster et al., 1990 A / turkey / Minnesota / 833/80 (H4N2) M73514 M36037 Gorman & Webster et al., 1990

Comparison of HTCA-A101 Virus PB2 Protein Gene with A / X-31 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains PB2 (2341nt) 759 a.a 300 A-> T 91 - 357 T-> G 110 H-> Q PB2 His 930 T-> C 301 - 1068 C-> A 347 - 1309 C-> T 428 - 1790 T-> G 588 I-> S PB2 Ala, lle, Thr, Val 2311 C-> T -

PB2 protein is part of the polymerase complex, which specifically binds to the 5'-cap of host mRNA (PANS 78, 7355-7359, 1981; NAR 10, 4803-4812, 1982). It is known that short RNAs cut by endonucleolytic cleavage can act as primers for mRNA (J. Virol. 69, 3995-3999, 1995; J. Gen. Virol. 76, 603, 1995 ).

Referring to Tables 3a, b, and c, only two of the seven base substitutions showed amino acid substitutions. In the case of amino acid number 110, all other viruses of Ginbank have histidine (His), whereas glutamine (Gln) is a unique amino acid. Is substituted with). Amino acid 588 was replaced with isoleucine (Ile) by a different character of serine. Most human infections are isoleucine, alanine in pigs and birds, and alaine in horses, and threonine in horses. Observed as (Thr) and seems to have properties similar to those of horses. Although not reported to date, the above comparison has the potential that amino acid 588 of PB2 may be involved in host specificity.

(5-2) Review of PB1 Protein.

Comparison of A / X-31 Virus PB1 Protein Gene with A / PR / 8/34 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains PB1 (2341nt) 757 a.a 99 C-> T - - PB1 182 C-> G 53 A-> G PB1 Gly, Ala 294 A-> G - - PB1 296 C-> T 91 A-> V PB1 Ala 297 A-> G - - PB1 421 T-> C - - PB1 435 G-> A - - PB1 549 A-> C 175 K-> M PB1 Asp, Asn.Glu, Lys 639 A-> G 205 I-> M PB1 lle 647 G-> A 208 R-> K PB1 Lys, Arg 651 A-> G - - PB1 924 G-> C 300 L-> F PB1 Phe, Leu 1152 T-> C - - PB1 1269 A-> G - - PB1 1380 T-> C - - PB1 1442 A-> T 473 H-> L PB1 Val, Leu, His 1563 T-> G - - PB1 1574 G-> T 517 S-> I PB1 lle, Ser 2075 A-> G 684 E-> G PB1 Glu 2076 A-> G - - PB1

Other flu virus extracted to compare amino acid sequences of PB1 protein Strain Registration Number Author Name A / Ann Arbor / 6/60 (H2N2) M23972 J04349M23973 Cox & Maassab 1988 A / Bijing / 11/56 (H1N1) M25932 Kawaoka & Webster et al., 1989 A / chicken / FPV / Rostock / 34 M21851 Roditi & robertson 1984 A / Dunedin / 4/73 M74899 Herlocher & Maassab et al., 1991 A / equine / London / 1416/73 (H7N7) M25928 Kawaoka & Webster et al., 1989 A / equine / Tennessee / 5/86 (H3N8) M25929 Kawaoka & Webster et al., 1989 A / gull / Maryland / 704/77 (H13N6) M25933 Kawaoka & Webster et al., 1989 A / Kiev / 59/79 M38376 Petrov & Vasilenko et al., 1987 A / Korea / 426/68 (H2N2) M25935 Kawaoka & Webster et al., 1989 A / Leningrad / 134/17/57 (H2N2) M81580 Klimov & Kendal et al., Al 1992 A / Leningrad / 134/47/57 (H2N2) M81586 Klimov & Kendal et al., Al 1992 A / Leningrad / 134/57 (H2N2) M81574 Klimov & Kendal et al., Al 1992 A / mallard / New York / 6750/78 (H2N2) M25926 Kawaoka & Webster et al., 1989 A / Memphis / 8/88 (H3N2) M25936 Kawaoka & Webster et al., 1989 A / PR / 8/34 (H1N1) J022151 Winter & Fields 1982 A / Singapore / 1/57 (H2N2) M25924 Kawaoka & Webster et al., 1989 A / swine / 1976/31 M55472 Schultz & Scholtissik et A / swine / Hong Kong / 126/82 (H3N2) M25927 Kawaoka & Webster et al., 1989 A / swine / Ontario / 2/81 M25930 Kawaoka & Webster et al., 1989 A / swine / Tennessee / 26/77 (H1N1) M25931 Kawaoka & Webster et al., 1989 A / turkey / Minnesota / 833/80 (H4N2) M25925 Kawaoka & Webster et al., 1989 A / Wisconsin / 3523/88 (H1N1) M25934 Kawaoka & Webster et al., 1989

Comparison of HTCA-A101 Virus PB1 Protein Gene with A / X-31 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains PB1 (2341nt) 757 a.a 296 T-> C 91 V-> A PB1 Ala 385 A-> G 121 K-> E PB1 Lys, Arg 742 G-> A 240 A-> T PB1 Ala, Lys 1299 T-> C 425 - 1380 C-> T 452 - 2075 G-> a 684 G-> E PB1 Glu 2184 C-> T 720 -

PB1 is also known to be responsible for the initiation and progression of RNA chain synthesis during transcription as part of the polymerase complex (Cell 34, 609, 1983; J. Virol. 70, 6390-6394, 1996). Among the four amino acid substitutions, the mutations in the A / X-31 virus in the case of V91A and G684E revert back to the original A / PR / 8/34 case. The relationship between is thought to be weak. However, most of the flu strains were changed to amino acids 121 and 240, which are preserved as lysine and alanine, to amino acids such as glutamic acid and threonine, respectively. It is suggested to be given.

(5-3) Review of PA Protein.

Comparison of A / X-31 Virus PA Protein Gene with A / PR / 8/34 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains PA (2233nt) 716 a.a 177 C-> T - - PA 228 T-> A - - PA 230 A-> G 69 N-> S PA Asn 366 A-> G - - PA 501 C-> A - - PA 546 G-> A - - PA 1107 A-> G - - PA 1257 C-> T - - PA 1299 T-> C - - PA 1410 G-> A - - PA 1431 A-> G - - PA 1629 C-> T - - PA 1672 C-> A 550 L-> I PA Leu 1722 G-> A - - PA 1776 T-> C - - PA 1896 T-> C - - PA 1962 T-> C - - PA 2049 T-> C - - PA 2106 A-> G - - PA

Other influenza viruses extracted to compare amino acid sequences of PA proteins Strain Registration Number Author Name A / Ann Arbor / 6/60 (H2N2) M23974 J04369M23975 Cox & Maassab et al., 1988 A / chiken / FPV / Rostock / 34 M21850 Robertson & Roditi et al., 1984 A / duck / Hokkaido / 8/80 (H3N8) M26083 J04369 Okazaki & Webster et al., 1989 A / equine / London / 1416/73 (H7N7) M26087 J04369 Okazaki & Webster et al., 1989 A / equine / Tennessee / 5/86 (H3N8) M26082 J04369 Okazaki & Webster et al., 1989 A / gull / Maryland / 704/77 (H13N6) M26088 J04369 Okazaki & Webster et al., 1989 A / Koera / 426/68 (H2N2) M26079 J04369 Okazaki & Webster et al., 1989 A / Leningrad / 134/17/57 (H2N2) M81579 Klimov & Kendal et al., 1992 A / Leningrad / 134/47/57 (H2N2) M81585 Klimov & Kendal et al., 1992 A / Leningrad / 134/57 (H2N2) M81573 Klimov & Kendal et al., 1992 A / pintsil / Alberta / 119/79 (H4N6) M26085 J04369 Okazaki & Webster et al., 1989 A / PR / 8/34 (H1N1) J02152 Winter & Fields 1982 A / ruddy turnstone / New Jersey / 47/85 (H4 N6) M26086 J04369 Okazaki & Webster et al., 1989 A / Singapore / 1/57 (H2N2) M26078 J04369 Okazaki & Webster et al., 1989 A / swine / Hong Kong / 126/82 (H3N2) M26081 J04369 Okazaki & Webster et al., 1989 A / swine / Hong Kong / 81/78 (H3N2) M26080 J04369 Okazaki & Webster et al., 1989 A / swine / Iowa / 15/30 (H1N1) M26076 J04369 Okazaki & Webster et al., 1989 A / swine / Tennessee / 26/77 (H1N1) M26077 J04369 Okazaki & Webster et al., 1989 A / Turkey / Minnesota / 833/80 (H4N2) M26084 J04369 Okazaki & Webster et al., 1989

Comparison of HTCA-A101 Virus PA Protein Gene with A / X-31 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains PA (2233nt) 716 a, a 69 G-> A 15 - 230 G-> A 69 S-> N PA Asn 606 C-> T 194 - 1230 G-> A 402 - 2026 A-> G 668 I-> V PA lle, Val 2206 C-> T -

In the PA protein gene, two of the six base mutations resulted in amino acid mutations, both of which are amino acid mutations that most viruses generally have, and by themselves are unlikely to significantly affect attenuation. Replication may express a single trait on its own, but it cannot rule out the effect on the attenuation of the base mutation given that it may express a completely different trait by interaction with another gene.

(5-4) Review of NP protein.

Comparison of A / X-31 Virus NP Protein Gene with A / PR / 8/34 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains NP (1565nt) 498 a.a 306 G-> A - - NP 528 T-> C - - NP

Other flu viruses extracted to compare amino acid sequences of NP proteins Strain Registration Number Author Name A / anasacuta / Primorje / 695/76 (H2N3) M36812 Mandler J. 1990 A / ANN Arbor / 6/60 (H2N2) M23976 J04349M23977 Cox & Maassab et al., 1988 A / chicken'n '/ Germany / 49 (H10N7) M24453 Reinhardt & Scholtissek 1988 A / FPV / Rostock / 34 M21937 Tomly & Roditi 1984 A / gull / Maryland / 704/77 (H13N6) M27521 M30754 Gormam & Webster et al., 1990 A / Leningrad / 134/17/57 (H2N2) M81577 Klimov & Kendal et al., 1992 A / Leningrad / 134/47/57 (H2N2) M81583 Klimov & Kendal et al., 1992 A / Leningrad / 134/57 (H2N2) M81571 Klimov & Kendal et al., 1992 A / Loygang / 4/57 (H1N1) M76604 Altmueller & Scholtissek., 1992 A / mallard / NY / 6750/78 (H2N2) D00050 N00050 Buckler-White & Murphy 1986 A / MD / 12/91 (H1N1) L24394 Wentworth & Hinshaw et al., 1993 A / mink / Sweden / 84 (H10N4) M24454 Reinhardt & Scholtissek., 1988 A / New Jersey / 4/76 (H1N1) M76605 Altmueller & Scholtissek., 1992 A / New Jersey / 8/76 (H1N1) M76606 Altmueller & Scholtissek., 1992 A / Ohio / 3523/88 (H1N1) M76602 Altmueller & Scholtissek., 1992 A / PR / 8/34 (H1N1) M38279 Belemishev & Frolov et al., 1985 A / PR / 8/34 (H1N1) J02147 Winter & Fields 1981 A / swine / Beijing / 94/91 (H1N1) U49091 Guan & Webster et al., 1996 A / swine / Wisconsin / 1/67 (H1N1) M76607 Altmueller & Scholtissek., 1992 A / swine / Wisconsin / 1915/88 (H1N1) M76608 Altmueller & Scholtissek., 1992 A / turkey / England / 647/77 (H1N1) M76603 Altmueller & Scholtissek., 1992 A / turkey / NorthCarolina / 1790/88 (H1N1) M76609 Altmueller & Scholtissek., 1992 A / Udorn / 307/72 (H3N2) D00051 N00051 Buckler-White & Murphy 1986 A / whale / Maine / 328/84 (H13N2) M27520 M30759 Gormam & Webster et al., 1990 A / Wisconsin / 3623/88 M76610 Altmueller & Scholtissek., 1992

Comparison of HTCA-A101 Virus NP Protein Gene with A / X-31 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains NP (1565nt) 498 a, a 98 A-> G 18 E-> G NP Glu, Asp 434 C-> T 130 T-> M NP Thr 1314 A-> C 423 -

NP protein is a multifunctional protein that forms the main axis of the RNP complex and is known to mainly bind to template RNA and to inhibit transcription termination in the transcription process. In the case of amino acid variation, most flu strains are conserved with glutamic acid and threonine at positions 18 and 130, respectively, whereas HTCA-A101 is attenuated by changing to glycine (Gly) and methionine (Met) with different personalities. Implies the possibility of In particular, the association with gastric amino acid mutations is thought to be important, based on reports that NP proteins are involved in host specificity (Virology 147, 287-294, 1985).

(5-5) Review of Mat protein.

Comparison of A / X-31 Virus M Protein Gene with A / PR / 8/34 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains M (1027nt) M1 = 252 a.aM2 = 97 a.a 32 C-> T 3 L-> F M1, M2 Leu 58 T-> A - - M1 655 G-> A - - M1 675 G-> T 217 R-> I M1 Arg 792 G-> A 27 A-> T M2 Val, lle, Thr, Ala 829 T-> C 39 I-> T M2 lle, Thr, Met

Other flu virus extracted to compare amino acid sequences of M proteins Strain Registration Number Author Name A / Ann Arbor / 6/60 (H2N2) M23978 J04349M23979 Cox & Maassab et al., 1988 A / chicken / Brescia / 1092 (H7N7) L37795 Klimov & Bucher et al., 1992 A / chicken / FPV / Weybridge (H7B7) M23921 M21846 Markushin & Nayak et al., 1988 A / chicken / Hong Kong / 14/76 (H1N1) U49119 Guan & Webster et al., 1996 A / duck / Bavaria / 2/77 (H1N1) M55476 Schultz & Scholtissek., 1991 A / duck / Hong Kong / 193/77 (H1N2) U49118 Guan & Webster et al., 1996 A / duck / Nanchang / 1749/92 (H11N2) U49117 Guan & Webster et al., 1996 A / Fort Monmouth / 1 / 47-MA (H1N1) M02463 Smeenk & brown 1994 A / Fort Monmouth / 1/47 (H1N1) U02084 Smeenk & brown 1994 A / FPV / Dobson (H7N7) L37796 Klimov & Bucher et al., 1992 A / FPV / Rostock / 34 M55475 Schultz & Scholtissek., 1991 A / FPV / Rostock / 34 M55474 Schultz & Scholtissek., 1991 A / FPV / Weybridge (H7N7) L37797 Klimov & Bucher et al., 1992 A / FPV / Weybridge (H7N7) M38299 Karginov & Bukrinskaya., 1994 A / Guangdong / 39/89 (H3N2) L18999 Xu & Cox et al., 1994 A / Guangdong / 39/89 (H3N2) L18995 Xu & Cox et al., 1994 A / NWS / 33 (H1N1) L25814 Ward A.C. 1995 A / Phil82 / BS (H3N2) U08863 Hartley & Anderes et al., 1994 A / PR / 8/34 (H1N1) J02145 Winter & fields 1994 A / Shearwater / Australia / 1/72 L25831 Ward & Harley 1994 A / swine / 1976/31 (H1N1) M55481 Schultz & Scholtissek., 1991 A / swine / England / 191973/92 (H1N7) U85985 Brown & Mccauley et al., 1997 A / swine / Germany / 2/81 (H1N1) M55478 Schultz & Scholtissek., 1991 A / swine / Hong Kong / 126/82 (H1N1) M55477 Schultz & Scholtissek., 1991 A / swine / Hong Kong / 168/93 (H1N1) U49116 Guan & Webster et al., 1996 A / swine / Hong Kong / 273/94 (H1N1) U49115 Guan & Webster et al., 1996 A / turkey / NorthCarolina / 1780/88 (H1N1) M55479 Schultz & Scholtissek., 1991 A / turkey / NorthCarolina / 1780/88 (H1N1) M55480 Schultz & Scholtissek., 1991 A / USSR / 90/70 (H1N1) M54941 M38615 Samokhvalov & Zhdanov et A / WSN / 33 (H1N1) L25818 Markushin & Nayak et al., 1988 A / WSN / 33 (H1N1) M23922 M21846 Markushin & Nayak et al., 1988

Comparison of HTCA-A101 Virus M Protein Gene with A / X-31 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains M (1027nt) M1 = 252a, aM2 = 97a.a 82 C-> A 19 - 185 C-> T 54 P-> S M1 Pro 307 C-> A 94 D-> E M1 Asp 434 G-> A 137 A-> T M1 Thr, Ala 675 T-> G 217 I-> R M1 Arg 969 G-> A 86 A-> T M2 Val, Ala

The M protein gene produces M1 and M2 proteins from a transcribed mRNA. The M1 protein is a peripheral lipid protein that connects the envelope and the RNP complex. The M1 protein is composed of an amino terminal lipid affinity and a carboxy terminal RNP complex interacting domain. M2 protein, produced by detoxification after splicing, regulates the concentration of hydrogen ions inside the virus as an ion channel. Looking at the amino acid variation of the total five shows the highest mutation rate. Amino acids 54 and 94 of the M1 protein are both conserved as proline (Pro) and asparagine (Asp), and can be important for attenuation by being converted to serine and glutamic acid, respectively. In particular, 137 of M1 protein and 86 of M2 protein are known to be involved in host specificity (J. Virol. 57, 697-700, 1986). For A137T, humanoid is alanine (Ala), and pig and bird are threonine. As preserved as (Thr), it can be thought of as a human-type non-human variation in host specificity. In the case of A86T of M2 protein, human type is preserved as alanine and pig and algae are Valin, whereas the changed threonine is an amino acid of a different nature than any other species. The A / Ann Arbor / 6/60 / ca virus and A / Leningrad / 57 / ca virus, which are currently used as live flu donor viruses, are similar to the amino acid characteristics of HTCA-A101 virus as serine and threonine, respectively. That is, the above mutations are not translated to specific host specificities, but may be involved in attenuating the virus in different ways (A / Ann Arbor / 6/60 / ca and A / Leningrad / 57 / ca).

(5-6) Review of NS Proteins.

Comparison of A / X-31 Virus NS Protein Gene with A / PR / 8/34 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains NS (890nt) NS1 = 230a.aNS2 = 124a.a 170 C-> T - - NS1 176 T-> C - - NS1 189 G-> A 55 E-> K NS1 Glu, Arg, Asp 299 C-> T - - NS1 404 A-> G - - NS1 763 G-> A 92 V-> I NS2 Lys, lle, Thr, Val 849 A-> G - - NS2

Other flu virus extracted to compare amino acid sequences of NS proteins Strain Registration Number Author Name A / Aichi2 / 68 D10571 D90526 Odagiri & Tobiea et al., 1990 A / Alaska / 6/77 (H3N2) K01332 Buonagurio & Maassab et al., 1984 A / anasacuta / primorje / 695/76 (H3N2) M60800 Ludwig & Scholtissek et al., 1991 A / chicken / Brescia / 1902 (H7N7) L37798 Klimov & Bucher 1992 A / chicken / Germany`N` / 49 (H10N7) M55464 M5465 Ludwig & Scholtissek et al., 1996 A / duck / Hong Kong / 193/77 (H1N2) U49494 Guan & Webster et al., 1996 A / duck / Nanchang / 1944/93 (H7N4) U49493 Guan & Webster et al., 1996 A / FM / 1 / 47-MA (H1N1) U02087 Smeenk & brown 1994 A / FPV / Dobson (H7N1) L37799 Klimov & Bucher 1992 A / FPV / Rostock / 34 M29617 Buerger & Maassab et al., 1984 A / FPV / Rostock / 34 (H7N1) M60799 Ludwig & Scholtissek et al., 1996 A / FPV / Weybridge (H7N7) L37800 Klimov & Bucher 1992 A / Goose / Hong Kong / 8/76 (H1N1) U49495 Guan & Webster et al., 1996 A / mallard / Alberta / 827/78 M25372 J04362M27204 Treanor 1989 A / mallard / Alberta / 827/78 M25373 J04362M27203 Treanor 1989 A / mallard / NY / 6750/78 M25376 J04362M27200 Treanor 1989 A / NWS / 33 (H1N1) L25720 Ward & Mckimmm-Breschkin et al., 1995 A / pintail / Alberta / 119/79 M25374 J04362M27202 Treanor 1989 A / pintail / Alberta / 121/79 M25371 J04362M27205 Treanor & Murphy et al., 1989 A / pintail / Alberta / 268/78 M25369 J04362M27199 Treanor & Murphy et al., 1989 A / pintail / Alberta / 358/79 M25370 J04362M27206 Treanor & Murphy et al., 1989 A / PR / 8/34 (H1N1) J02150 Baez & Skalka et al., 1980 A / PR / 8/34 (H1N1) V01104 Baez & Skalka et al., 1980 A / PR / 8/34 (H1N1) J02150 Baez & Skalka et al., 1980 A / tern / turkmenia / 18/72 (H3N3) M55466 Ludwig & Scholtissek et al., 1996 A / turkey / Bethlehem-glilit / 1942-b / 82 (H1N1) M55467 Ludwig & Scholtissek et al., 1996 A / turkey / Canada / 63 (H6N8) M55468 Ludwig & Scholtissek et al., 1996 A / WI / 4755/94 U53170 Wentworth & Hinshaw et al., 1996 A / WI / 4755/94 U53191 Wentworth & Hinshaw et al., 1996

Comparison of HTCA-A101 Virus NS Protein Gene with X-31 Virus gene Base number Base mutation Amino acid number Amino acid mutations Protein name Other strains NS (890nt) NS1 = 230a.aNS2 = 124a.a 318 A-> T 98 M-> L NS1 Met, lle, leu

NS protein, like the M protein gene, creates two kinds of proteins by splicing (splicing). The NS1 protein firstly disrupts migration out of the nucleus of poly A RNA (Genes Dev. 6, 255-267, 1992; EMBO. J. 13, 704-712, 1994; J. Virol. 68, 2425-2432, 1994), inhibiting splicing of a second pre-mRNA (EMBO. J. 13, 704-712, 1994; Genes Dev. 8, 1817-1828, 1994; RNA. 1, 304-316, 1995), while known to act as a translational enhancer of third viral mRNAs, little is known about the function of the NS2 protein. However, it has been reported that it serves as an auxiliary element to allow the normal replication of short length RNA (J. Gen. Virol. 75, 43-53, 1994). In the HTCA-A101 virus, only one amino acid variation of 98 occurred, but the other flu virus was interspersed with methionine (Met) and isoleucine (Ile) without any host specificity. In the case of leucine (Leu), it is rare in other strains, and this rare amino acid variation was induced in NS protein by continuous low temperature adaptation.

As a result of analyzing the six A / X-31 virus genomes except HA and NA, a considerable number of mutations were found compared to the original A / PR / 8/34 virus gene. This seems to be the result of long passages in fertilized eggs and adaptation to the fertilized eggs, and it is believed that many of these mutations contributed to the attenuated and hard growing characteristics of the fertilized eggs. Also, when comparing A / X-31 virus and HTCA-A101 virus, mutations were found in all six genomes due to low temperature adaptation. These mutations found one common mutation in the M protein gene compared to other low temperature adaptation viruses. Except for that, it had a completely different genetic variation. The nature of this variation is that HTCA-A101 virus is another form of novel cold-adapted strain that is significantly different from other vaccine viruses known to date.

<Test Example 1> Comparison of the plaque formation ability of the cold-acting influenza virus HTCA-A101 and its parent strain A / X-31 virus in MDCK cells.

In order to observe the attenuated extent of the HTCA-A101 virus prepared in the present invention, Plaque Assay was performed at different temperatures on MDCK cells. MDCK cells were densely grown to about 90% in a 6 well plate, and then the medium was removed, and the virus corresponding to 2 HAU was diluted by 1/10 of 10000 times and infected with 200 μl volume for 30 minutes. After removing the virus solution, cover the cell layer with DMEM medium containing 0.5% Seakem Agarose, 0.2% Bovine serum albumin, and 15μg / μl trypsin, respectively, at 25 ° C, 30 ° C, After culturing for 3 days at 37 ℃, 39 ℃ to observe the size of the plaques are shown in Table 9. However, when raised at 25 ℃ was able to observe the plaque after 8 days.

Strain name Plaque size (mm) 25 ℃ 30 ℃ 37 ℃ 39 ℃ X-31 - 0.5 3 2 HTCA-A101 One 4 2 -

As shown in Table 9, in the case of A / X-31 virus, normal plaque formation of about 3 mm and 2 mm was observed at 37 ° C. and 39 ° C., respectively, but less than 0.5 mm at 30 ° C. and no plaque at 25 ° C. Cold formation traits could not be seen because they did not form. On the other hand, in case of HTCA-A101 virus, it was found that low temperature adaptive trait was retained by forming plaque of 4mm at 30 ℃ and 1mm at 25 ℃ even though it was only 8 days. Sensitive traits have also been demonstrated. However, at 37 ° C, plaques of about 2 mm in size did not show any difference from A / X-31 virus. However, when observed under a microscope, necrosis was concentrated only in the center, and the necrosis spread partially. By forming an asterisk, it was found that even at 37 ° C., temperature sensitivity was different from that of wild type.

In conclusion, the HTCA-A101 strain, which has been subjected to low temperature adaptation of the A / X-31 virus, has the characteristics as a virulence reducing strain that inhibits growth at the temperature of biomass and grows well at low temperature. .

<Test Example 2> Comparison of the growth ability of the low-temperature adaptation flu virus HTCA-A101 and its parent strain A / X-31 virus in fertilized eggs.

In the same manner as in Test Example 1, the attenuated degree of HTCA-A101 virus was observed by comparing the degree of growth in fertilized eggs. The method was similar to Test Example 1 except that the initial infection amount was changed to 10 HAU and the part where the culture conditions were changed to 25 ° C, 30 ° C, and 37 ° C, respectively. The results are shown in Table 10 below.

Strain name Virus titer (HAU / ml) 25 ℃ ^b 25 ℃ 30 ℃ 37 ℃ X-31 0 0 3 × 10 ⁴ 3 × 10 ⁴ HTCA-A101 1 × 10 ³ 5 × 10 ² 3 × 10 ⁴ 3 × 10 ³ b; Infected with 100 HAU

The results showed that the A / X-31 virus showed a significantly higher growth rate compared to other flu strains at 3 × 10 ⁴ HAU / ml at 37 ° C, and this characteristic was 3 × 10 ⁴ HAU / ml at 30 ° C. It is maintained. However, when looking at the case of 25 ℃ it can be seen that it does not grow at all, this phenomenon was found to be the same when the infection amount is increased to 10 times (100HAU). On the other hand, the HTCA-A101 virus shows the same growth rate as the wild type at 30 ° C, but the temperature decreases to 1/10 at 37 ° C. Even at 25 ° C., low-temperature adaptation traits were shown with a high growth rate of 1 × 10 ^{3 ′} HAU / ml.

As such, the low-temperature adaptation strain HTCA-A101 shows excellent growth even at low temperatures below 30 ° C., thus lowering the production cost during vaccine production.

Test Example 3 Toxicity Test against Low Temperature Adaptive Flu Virus HTCA-A101 in Rats.

Since HTCA-A101 showed low temperature adaptability and temperature sensitivity in MDCK cells and fertilized eggs in Test Example 1 and Test Example 2, in this example, the degree of attenuation of HTCA-A101 in rats as experimental animals was investigated.

Six weeks old mice (Balb / c) from Charles River (Japan) were bundled and used in a toxicity test in groups of 5 mice per group. Inhalation of mice with isoflurane followed by HTCA-A101 with concentrations of 10 ⁷ pfu / ml, 10 ⁶ pfu / ml, 10 ⁵ pfu / ml, 10 ⁴ pfu / ml, 10 ³ pfu / ml 50 μl of each virus or A / X-31 virus was inhaled into the nose of the mice, and mortality and body weight were observed over time (see FIG. 1).

As a result, in the group infected with 10 ⁷ pfu / ml and 10 ⁶ pfu / ml, A / X-31 virus wild type showed a temporary weight loss effect until 3 days after infection and then increased again. HTCA-A101 Showed no difference when compared to the control group administered with PBS.

The results of A / PR / 8/34 wild-type virus in the same way as compared to the results of lethality and weight loss effect (see Figure 2) A / PR / 8/34 virus was more than half of the mice at 10 ⁷ pfu While A / X-31 virus only observed temporary weight loss while dying, it indicates that A / X-31 virus itself is more attenuated than A / PR / 8/34. Subcultures in fertilized eggs already show some degree of reduced toxicity. In addition, the HTCA-A101 virus prepared in the present invention shows that even more reduced toxicity due to low temperature adaptation.

Example 6 Preparation of Recombinant Trivalent Vaccine.

Influenza viruses that have been in vogue every year for more than 10 years are H1N1 and H3N2. In the present invention, a trivalent vaccine was prepared by preparing a recombinant virus of the low temperature adaptation virus HTCA-A101 obtained in Example 1 and the recently toxic virus.

(6-1) Production of H1N1 recombinant flu virus.

H1N1 type was prepared using A / Singapore / 6/86 virus. HTCA-A101 virus and A / Singapore / 6/86 virus were simultaneously infected with eggs and incubated at 30 ° C. for 2 days. The urine solution was taken and a plaque assay was performed at 27 ° C with an MDCK cell line. At this time, a polyclonal antibody (1.5 μl / ml) of 1.5 times the minimum concentration at which plaque formation of HTCA-A101 virus was inhibited was added to the medium. The plaques formed after 3 days were taken and each was again infected with eggs and incubated at 27 ° C. for 3 days. Urinary fluid was taken to check for virus propagation, and if there were propagated viruses, each of them was subjected to plaque inhibition assay to determine whether recombinant virus was produced. Plaque inhibition assays were determined by varying antibody concentrations when plaque analysis was performed with MDCK cell lines, namely, 3 μl / ml, 1 μl / ml, 0.7 μl / ml, 0.5 μl / ml, 0.3 μl / ml, and 0.1 μl / ml, respectively. Look for concentrations that inhibit formation.

As a result of the plaque inhibition assay, HTCA-A101 virus had a small plaque up to 0.3 μl / ml, whereas a large amount of plaque was formed up to 1 μl / ml.

(6-2) Preparation of H3N2 Recombinant Flu Virus.

H3N2-type virus infected the A / Shangdong / 9/93 virus with the eggs, incubated at 30 ° C., took the urine, and then infected the eggs again. At this time, 10 μl, 2 μl, 0.5 μl of antibody was injected into each egg. After incubation at 30 ° C. for 3 days, urine was taken to confirm virus proliferation. It was confirmed that the virus was propagated only in 0.5 μl eggs. The virus was again infected with eggs injected with 2 μl or 1 μl of antibody and incubated at 27 ° C. for 3 days. After confirming that the virus was propagated in the egg with 2μl antibody, it was confirmed whether the eggs were grown in the egg injected with 10μl antibody again. Plaque inhibition assay was performed on the eggs grown in eggs containing 10 μl of antibody in the MDCK cell line in the same manner as above, and it was confirmed that plaques were formed on the antibody of 0.7 μl / ml. When these recombinant viruses were cultured in eggs without the antibody injected, they grew almost similar to the HTCA-A101 virus, indicating that their growth characteristics did not change.

As a result of the test procedures 1 and 2, these recombinant viruses retained their characteristics as low-temperature adaptation or temperature-sensitive mutant strains. As a result, they were not different from the parent strain HTCA-A101 virus. Showed a genetically stable characteristic that retained characteristics.

Test Example 4 Preclinical Acute and Subacute Toxicity of Trivalent Vaccine

Recombinant trivalent vaccine was commissioned to the College of Veterinary Medicine, Seoul National University. The acute toxicity test using mice and rabbits and the subacute toxicity test for 4 weeks of continuous administration were performed as follows.

(4-1) One-dose acute toxicity test in mice

Acute toxicity of intranasal instillation of flu vaccine in ICR mice was investigated. At the maximum dose of 8.3 × 10 ⁴ TCID ₅₀ (50% tissue culture infectious dose) / g / BW and at azeotropic × 0.5, 4.15 × 10 ⁴ TCID ₅₀ / g / BW, 2.08 × 10 ⁴ TCID ₅₀ / g / BW, The acute toxicity test was performed with the group administered 1.04 × 10 ⁴ TCID ₅₀ / g / BW and 0.52 × 10 ⁴ TCID ₅₀ / g / BW.

As a result of the intranasal instillation, the highest dose of 8.3 × 10 ⁴ TCID ₅₀ / g / BW was used to observe changes in the mortality, clinical symptoms, and anatomical pathology of all living animals. It wasn't.

(4-2) Single drip acute toxicity test in rabbits

The acute toxicity of intravenous drip influenza vaccine was investigated in New Zealand White rabbits. 8.3 × 10 ⁴ TCID ₅₀ / g / BW at maximum capacity and azeotropic × 0.5 4.15 × 10 ⁴ TCID ₅₀ / g / BW, 2.075 × 10 ⁴ TCID ₅₀ / g / BW, 1.0375 × 10 ⁴ TCID ₅₀ / g / BW and 0.51875 × 10 ⁴ TCID ₅₀ / g / BW.

As a result of the intranasal instillation, the highest dose of 8.3 × 10 ⁴ TCID ₅₀ / g / BW was used to observe changes in the mortality, clinical symptoms, and anatomical pathology of all living animals. It wasn't.

(4-3) 4 weeks repeated repeated dose toxicity test in mice

In order to investigate the toxicity of 4 weeks drip repeated doses of the flu vaccine in mice, a low dose of approximately 8.3 × 10 ¹ TCID ₅₀ / g / days according to the Food and Drug Safety Headquarters notice 96-8, “Toxicity Testing Standards for Drugs, etc.” Medium dose 8.3 × 10 ² TCID ₅₀ / g / days, high dose 8.3 × 10 ³ TCID ₅₀ / g / days were administered once daily, 7 times a week, for 4 weeks.

The results showed that no animals died during the trial and did not show any specific clinical symptoms including changes in body weight, drinking water and feed intake. Hematology and serum biochemistry showed no significant changes in the flu vaccine-treated group, and no significant changes were found in the urine and eye tests. In addition, no histological examination revealed any changes other than basal lesions that were thought to be dose dependent or drug administration. Therefore, repeated intranasal drip administration of the flu vaccine for 4 weeks in mice does not appear to be toxic up to 8.3 × 10 ³ TCID ₅₀ / g / days.

(4-4) 1 month repeated repeated dose toxicity test in rabbits

To investigate the toxicity of 1-month repeated doses of the flu vaccine in rabbits, a low dose of approximately 8.3 × 10 ¹ TCID ₅₀ / g / days, in accordance with Notice No. 96-8, “Standards for Toxicity of Drugs, etc.” Medium dose 8.3 × 10 ² TCID ₅₀ / g / days, high dose 8.3 × 10 ³ TCID ₅₀ / g / days were administered once daily, 7 times a week, for 1 month.

The results showed that no animals died during the trial and did not show any specific clinical symptoms including changes in body weight, drinking water and feed intake. Hematology and serum biochemistry showed no significant changes in the flu vaccine-treated group, and no significant changes were found in the urine and eye tests. In addition, pathological histological findings showed that the basal lesions commonly found in rabbits were observed in both test and control groups, and pathological changes determined by influenza vaccine administration could not be observed. Therefore, repeated oral administration of the flu vaccine for 1 month in rabbits does not appear to be toxic up to 8.3 × 10 ³ TCID ₅₀ / g / days.

As a result, the trivalent recombinant vaccine was subjected to a single acute toxicity test and a subacute test of daily repeated administration for 4 weeks, and no special change was observed due to the vaccine administration. These results show the possibility that the live vaccine made in the present invention can be used without side effects.

As described above, the cold-adapted influenza virus produced in the present invention is a genetically stable strain having a mutation in all six genes, which greatly reduces the possibility of returning to the parent strain, and has a cold-adapted trait and a temperature-sensitive trait. When infected by the human body, the proliferation is suppressed and the toxicity is greatly alleviated, and it can be used as a flu vaccine to prevent diseases caused by the flu virus because it can be multiplied in large quantities in fertilized eggs. In particular, the low-temperature adaptation virus of the present invention can be widely used effectively as a live vaccine having superior advantages over four vaccines, its utility is further increased.

In addition, the recombinant influenza virus combined with the low temperature adaptation virus and the wild type influenza virus of the present invention can be useful as a trivalent influenza vaccine as a strain that maintains low temperature adaptability and temperature sensitivity and greatly reduces toxicity.

(Sequence list)

SEQ ID NO: 1

Sequence length: 2341

Type of sequence: nucleic acid

Number of chains: 1 chain

Form: Straight

Type of sequence: PB2 gene

(Sequence list)

SEQ ID NO: 2

Sequence length: 2341

Type of sequence: nucleic acid

Number of chains: 1 chain

Form: Straight

Type of sequence: PB1 gene

(Sequence list)

SEQ ID NO: 3

Length of sequence: 2233

Type of sequence: nucleic acid

Number of chains: 1 chain

Form: Straight

Type of sequence: PA gene

(Sequence list)

SEQ ID NO: 4

Length of sequence: 1565

Type of sequence: nucleic acid

Number of chains: 1 chain

Form: Straight

Type of sequence: NP gene

(Sequence list)

SEQ ID NO: 5

Sequence length: 1027

Type of sequence: nucleic acid

Number of chains: 1 chain

Form: Straight

Type of sequence: M gene

(Sequence list)

SEQ ID NO: 6

Sequence length: 890

Type of sequence: nucleic acid

Number of chains: 1 chain

Form: Straight

Type of sequence: NS gene

Claims (12)

A novel cold adapted influenza virus obtained by passage of A / X-31 virus at low temperature. The method of claim 1, wherein the cold-acting influenza virus is HTCA-A101 virus (Accession Number: KCTC 0400 BP). The cDNA gene of the cold-acting influenza virus HTCA-A101 of claim 2. According to claim 3, PB2 protein gene having a base sequence of SEQ ID NO: 1, PB1 protein gene having a base sequence of SEQ ID NO: 2, PA protein gene having a base sequence of SEQ ID NO: 3, NP protein gene having a base sequence of SEQ ID NO: 4, CDNA gene, characterized in that it comprises one or more M protein gene having a nucleotide sequence of SEQ ID NO: 5 or NS protein gene having a nucleotide sequence of SEQ ID NO: 6. Flu virus is injected into fertilized eggs and cultivated at low temperatures up to 24 ° C for several days in a sequential manner at 30 ° C, 27 ° C, and 24 ° C. Method for producing the cold-acting influenza virus of claim 1 obtained repeatedly. The method of claim 5, wherein the first influenza virus injected into the fertilized egg comprises A / X-31, B / Yamagata / 16/88 or B / Lee / 40. Type B cold-acting influenza virus HTCA-B102 (accession number: KCTC 0401 BP) obtained by passage of B / Yamagata / 16/88 virus at low temperature. Type B cold-flu virus HTCA-B104 (Accession No .: KCTC 0402 BP) obtained by passage of B / Lee / 40 virus at low temperature. A flu vaccine comprising the cold-acting flu virus of claim 1, 7, or 8 as an active ingredient. Recombinant H1N1 influenza virus obtained by co-infection with a low-temperature adaptive flu virus HTCA-A101 and A / Singapore / 6/86 in a host cell. Recombinant H3N2 influenza virus obtained by co-infection of the host cells with the low temperature adaptive flu viruses HTCA-A101 and A / Shangdong / 9/93. A flu vaccine comprising the recombinant H1N1-type flu virus of claim 10 or the recombinant H3N2-type flu virus of claim 11.