KR19990030510A - Mass production method of antibiotics using redox-cycling reagent - Google Patents

Abstract

The present invention relates to a method of mass-producing clavalonic acid in culture by activating the transcription of genes involved in the biosynthesis of clavalulanic acid by adding redox-cycling reagents to generate microorganisms during microbial culture. will be.

Streptomyces clavuligerus produces clavalonic acid (CA), a clinically important β-lactamase inhibitor. The production of this acid is increased by treatment with several selected redox-cycling reagents. Stimulating effects are seen with the addition of menadione (MD), plumbagin (PLM), and phenazine methosulfate (PMS), but negative effects with the addition of methyl biorogen (MV). PMS increases the accumulation of this acid by about 150% and the induction of superoxide dismutase (SOD) on PMS addition suggests that free radicals are involved in the process. The stimulatory effect of PMS is offset by the addition of butyrated hydroxyanisole (BHA), which supports the involvement of free radicals. The increased production of this acid by free radicals is due to the transcriptional activation of the gene cas2, which encodes the key enzyme, in CA biosynthesis.

In the present invention, the active oxygen was confirmed to increase the biosynthesis of several antibiotics in addition to CA as a secondary metabolite through transcriptional activation of the biosynthetic gene.

Description

Mass production method of antibiotics using redox-cycling reagent

The present invention relates to a method for mass production of several antibiotics, including clavalulanic acid (hereinafter referred to as "CA"). More specifically, the present invention provides a method for mass biosynthesis from microorganisms by supplying active oxygen to a secondary metabolite, such as CA, using a redox-cycling reagent.

Streptomyces clavuligerus (ATCC27064) is a strain that produces clavam and cephamycin, including CA. CA is a clinically important β-lactamase inhibitor with a carbocyclic ring system whose structure is related to β-lactam.

The biosynthetic pathway of CA is clearly different from sephamycin, which is well known biosynthetically (Weil et al, 1995). The reaction of the clavaminic acid synthase (hereinafter referred to as "CAS"), an α-ketoglutarate-linked dioxygenase whose cofactor is Fe (ll), is a well-defined enzyme in the biosynthesis of CA (Salowe et al. 1990; Salowe et al. 1991). The gene cas, which encodes the synthesis of CA, is isolated and two genes belonging to the cas family, cas1 and cas2, have been identified. cas2 is transcribed into monocistronic and polycistronic transcripts in starch-asparagin (SA) and soy media and cas1 is transcribed only as monocistronic transcript in soy media (paradkar and jensen 1995).

Other enzymatic activities on CA biosynthesis have been reported, among which the gene encoding proclavaminate amidino hydrolase has been isolated and characterized (Aidoo et al. 1994; WU et al. 1995). Recently, the regulatory gene ccaR, which is required for the production of cephamycin and CA, was isolated from S. clavuligerus (Perez-Liarena et al. 1997). Meanwhile, research on oxidative stress respones so far has focused mainly on defense systems composed of small antioxidant molecules and antioxidant enzyme systems. The organism's response to oxidative stress extends beyond this primary defense system to secondary metabolism.

Microbial responses to oxidative stimuli induced by several redox-cycling reagents are primarily reported in E. Coli and Salmonella typhimurium (Farr and Kogoma 1991) and in their genetic bases, Oxy R and Sox RS regulators. (Demple and Amabile-Cuevas, 1991). However, the results of secondary metabolism in response to oxidative stress in the microbial system have not been studied.

On the other hand, there is much evidence that environmental stresses, inanimate or biological stresses, can cause the explosive release of activated oxygen species in cells (Apostol et al. 1989; Epperlein et al. 1986; Keppler et al. 1989; Low and Dwyer 1994), they report that the oxidative explosion in plants is mainly accompanied by the biosynthesis of the second metabolite, Phytoalexin. It is an attractive proposal that the effects of active oxygen species on secondary metabolism can be extended to a much more common phenomenon for microorganisms. The inventors thus investigated the oxidative explosion by adding redox-cycling reagents known to produce superoxide, which is rapidly degraded to hydrogen peroxide (H ₂ O ₂ ) by Superoxide dismutase (SOD) and CA in S.clavuligerus strains. Experiments on biosynthesis were performed. As a result, it was confirmed that redox-cycling reagent increased the CA accumulation in the medium through the production of free radicals in the culture of S.clavuligerus, accompanied by an increase in SOD activity.

On the other hand, the direct hydrogen peroxide (H ₂ O ₂ ) addition effect is not as obvious as the redox-cycling reagent. The reason is thought to be due to the combination of low permeability and the fast disappearing effect of hydrogen peroxide by catalase. The continuous production of active oxygen species by the redox-cycling reagent is intended to have a lasting effect, which may explain the superiority of the redox-cycling reagent rather than hydrogen peroxide. However, it is not clear which activated oxygen species or NAD ⁺ formed through the non-enzymatic activity of PMS contributes to this effect.

It is therefore an object of the present invention to provide a S. clavuligerus response to oxidative stress by Redox-Cycling reagents in relation to the biosynthesis of secondary metabolism, especially CA in the microbial system. Another object of the present invention is to activate the transcription of genes involved in secondary metabolism, in particular the biosynthesis of CA, by stimulating oxidative explosion by adding redox-cycling reagents known to produce superoxides that are rapidly degraded to hydrogen peroxide by SOD. The aim is to find the optimal conditions for maximizing the production of CA in the medium.

Another object of the present invention is to provide an effect of the reagent on the production of antibiotics other than CA.

Hereinafter, the specific configuration and operation of the present invention will be described in detail.

Figures 1a and 1b is a diagram showing the effect of redox-cycling reagent and hydrogen peroxide on the CA production and S.claruligerus strain growth of the present invention.

Figure 2a and 2b is a diagram showing the effect of redox-cycling reagent and hydrogen peroxide on CA production and growth of copper strains of the present invention.

Figure 3 shows the effect of PMS on SOD activity.

Figures 4a and 4b shows the effect of BHA on PMS-Promoted CA production and cell growth.

Figure 5 shows the effect of the redox-cycling reagent affecting CAS activity.

6A-C are photographs showing electropherograms of cas2 transcription and typical RNA isolation over time.

Figure 7 shows the effect of redox cycling reagent on cephalosphyrin production of the present invention.

Figure 8 shows the effect of the redox cycling reagent on the antibiotic ACT, PRD production and cell growth of the present invention.

The present invention relates to an oxidative stress for maximizing CA production using S.clavuligerus strains and to investigate the effect of supplying redox-cycling reagents and HP; It consists of maximizing the production of cephalosporin, actinordin and prodigionin as cells and other antibiotics in CA medium. Hereinafter, the specific configuration and operation of the present invention.

Culture of S.clavuligerus (ATCC 27064) Strains

5 ml of spore suspension was taken from the seed medium (Salowe et al., 1990) and inoculated in a 20 ml test tube and incubated for 5 days, followed by vomiting at 100 ml of SA medium (Jensen et al., 1982) and 250 rpm. Each was taken and placed in a 50 ml culture tube. The solution with the reagent added to dimethyl sulfoxide (DMSO) was then added to the tube until DMSO was 1%. Menadione (MD), Plumbagin (PLM), Phenazine methosulfate (PMS), methyl viologen (MV), and H ₂ O ₂ (HP) used Sigma's products. Mycelial suspension was homogenized by the method of Brana (1985) and the absorbance (OD) of homogenate was measured at 600nm on UV-Vis Spectrophotometa (Hewlette Packard 8452A). As needed, mycelial cell paste was dried at 70 ° C. to measure dry cell weight (DW).

CA quantity

Cultures were placed in microfuge and centrifuged at 10,000 rpm to quantify CA through HPLC in supernatant (Salowe et al., 1990). For general analysis, the imidazole derivatives were diluted with 1 ml and the absorbance was measured at 312 nm on a spectrophotometer (Hewlette packard 8452A).

Enzyme Analysis

CA activity in the supernatant was measured using ras-proclavaminate, a substrate synthesized by the method developed by Salowe et al. (1991). Superoxide dismutase (SOD) was analyzed by the agar-diffusion method developed by Archibald (1990), and protein concentration was determined using Bio-Rad Protein Assay using bovine serum albumin as the standard reagent. On the other hand, cephalosporin activity was measured by the agar diffusion method using E. coli Ess as a standard strain by the Fang and Demain (1995) method.

RNA isolation and Nothern blot analysis

Total RNA isolation and glyoxal-modification of nucleic acids were performed by Hopwood et al. (1985). Nothern blot analysis was performed with DNA oligomer probes labeled with [a- ³² P] αATP and deoxynucleotide transferase (Promega). Probe for mRNA detection was a synthetic oligomer (TCAGCGGCGCGGCGAGAACGAG) 22MERS complementary to the +957 to +978 regions of the pC2 and cas2 genes (Marsh et al., 1992).

Example 1. Investigation of the effects of redox-cycling reagent and HP addition

To determine if oxidative stress influences the regulation of CA production in S. clavuligerus, we investigated the effects on redox-cycling reagents and HP. CA production began in the early stages of nutrition in SA medium in relation to cell growth. The results are shown in Figures 1a-1b. Figure 1a shows the CA production, Figure 1b shows the cell growth curve.

Reagents and the like were added at the end of logarithmic growth 38 hours after the start of incubation at 27 ° C. 1% DMSO was added to the culture to allow the hydrophilic material to cross the microbial cell membrane. HP only worked when DMSO was added. Except for one of the tested redox-cycling reagents, the other showed an effective effect on CA accumulation when added at a concentration of 10 μM. MV had a deleterious effect on CA accumulation. PMS increased CA accumulation by 50% compared to DMSO-control. HP also increased CA production to a similar extent as PLM and MD.

Example 2 Effect of Culture Temperature on CA Production

The effects of low temperature culture on the production of CA were investigated. In low temperature culture, CA accumulation was increased by further sustaining redox-cycling reagent and active oxygen. As can be seen in FIGS. 2a and 2b, the Lag time of the cells increased by 10 hours but the growth of the cells was not decreased at the incubation temperature of 20 ° C. lower than that of Example 1 (FIG. 2b). Increased (FIG. 2A). PMS showed a 150% CA transpiration effect. By varying the concentration of PMS to 0.1 μM, 10 μM, and 100 μM through Examples 1 to 2, the CA accumulation and cell growth were investigated. The concentration that does not affect cell growth at the same time as maximizing CA accumulation is appropriate. It was. Cell growth was inhibited when the concentration of PMS exceeded 100 μM.

Example 3 Effect of PMS Addition on SOD Activity

S. clavuligerus cells were incubated at 20 ° C. and after 48 hours 10 μM PMS was added. 200 μg of soluble protein was taken, 1% agar gel was used to measure the diameter of the achromatic zone, and SOD activity was calculated. As shown in Figure 3 specific activity increased about 40% (180 to 250μ / mg) at 5 hours of incubation after addition of 1% DMSO. However, the addition of PMS increased the SOD activity by 370 μg / mg for 1 hour of incubation. Experimental results showed that PMS was effective for SOD activity induction.

Example 4 Effect of BHA on PMS-promoted CA Production and Cell Growth

To investigate the effect of BHA on PMS enhanced CA accumulation and cell growth, S. clavuligerus was incubated at 20 ° C and 10 μM BHA and PMS were added after 48 hours.

BHA is widely used as a food preservative and its function is to act as an antioxidant by efficient removal of free radicals such as intracellular peroxy groups. Experimental results showed that BHA alone did not show much effect on the accumulation of CA, and CA accumulation enhancement effect of PMS was canceled by adding BHA (FIGS. 4A-4B). 4a shows the effect of BHA on CA accumulation enhanced with PMS, and FIG. 4b shows cell growth.

Example 5 Investigation of the Effect of Redox-cycling Reagents on CAS Activity

In order to investigate the effect of redox-cycling reagent on cas activity, S. clavuligerus was incubated at 20 ° C., and 48 hours later, 10 μM of PMS was added, and the cells were obtained and sonicated in lysis buffer. The insoluble portion was removed by centrifugation, and the assay was performed with 200 µl containing 100 nmole of ras-proclavaminate.

The specific cas activity of PMS-treated cells did not change until 96 hours after incubation, whereas the cas activity increased with addition of redox-cycling reagent. The result is shown in FIG. cas activity increased by 50% for PMS and 30% for MD and PLM. Specific cas activity was decreased by the addition of MV. Increased CA accumulation for some redox-cycling reagents, especially for the addition of PMS, was apparently due to increased specitic cas activity.

Example 6. Time-varying changes in cas2 transcription and electrophoretic experiments of RNA

Cells were cultured in a medium at 20 ° C. and 10 μM PMS was added 48 hours later to carry out changes over time and RNA electrophoresis of cas2 gene transcription of S. clavuligerus strains. 20 μg of total RNA extracted from the cells incubated for 58 hours was subjected to electrophoresis to the experiment. Figure 6a was used for pC ₂ Figure 6b was performed blot with a synthetic oligomer complementary to pC ₂ .

Northern blot analysis was performed using the cells treated with 10 μM PMS showing the greatest increase in CA accumulation and incubated at 20 ° C. Cas2 message level in total RNA was analyzed by slot blot analysis. Cas2 expression peaked 48 hours after fermentation, just before the onset of CA biosynthesis. And in the control group it appeared at 58 hours. On the other hand, transient cas2 expression showed a peak even when about 20 hours after the start of fermentation (FIG. 6A).

As a result, the transcription of cas2 was induced 48 hours after the addition of PMS, and peaked after 10 hours (Fig. 6a). The intensity of the blot at the peak moment was 100% higher than that of the control group (Fig. After 48 hours, it was about 30% higher than the peak of the control group (Fig. 6b). Electrophoretic seperation of total RNA showed both mono- and ploycistronic properties of cas2 between 1.2 and 5.3 kb (FIG. 6C). After 40 hours of PMS, the message level decreased to the background level. That is, the maximum message level of PMS-treated cells was higher than that of DMSO-treated control and the messages lasted longer.

Example 7. Production of the antibiotic Cephalosporin

In order to investigate the effect of oxidative stress on cephalosporin biosynthesis in S. clavuligerus, the experiments as in Example 1 showed almost the same as the CA biosynthesis effect, confirming that PMS is the most effective reagent (FIG. 7).

Example 8 Production of Antibiotic Actinordin and Prodigionin

The microorganism strain was changed to S. coelicolor A3 (2), and the experiment was similar to that of Example 5 except that the incubation temperature was 28 ° C. S. coelicolor A3 (2) cells maintained in R5 medium (Hopwood et al. 1987) were inoculated in SA medium and shaken at 300 rpm at 28 ° C. in 250 ml of baffle flask. Cells were obtained by centrifugation, followed by actirorodin by Liao et al. (1995) and prodigioin by Narva and Feitelson (1990). As can be seen from the experimental results of Figure 8 ACT and PRD production increased with the growth of the cells, PMS1-10μM treatment group, especially 3μM PMS treatment group was the most effective.

As can be seen in Examples 5, 7 and 8, it can be concluded that the antibiotic, the secondary product of Streptomyces spp., Is mediated by PMS and closely related to cell growth.

As described above, the present invention provides a superoxide in which redox-cycling reagents are rapidly decomposed into hydrogen peroxide (H ₂ O ₂ ) by SOD in a microbial culture, causing an oxidative challenge, It is a very useful invention for the pharmaceutical industry because it can dramatically increase the production of antibiotics, secondary metabolites such as clavalonic acid (CA) on the medium by activating transcription.

Claims (5)

In culturing microorganisms, superoxide-producing redox-cycling reagents are added to induce an oxidative explosion, thereby activating the transcription of genes involved in the biosynthesis of secondary metabolites and increasing their accumulation. Mass production method. The method of claim 1, wherein the microorganism is selected from S. clavuligerus or S. coelicolor A3 (2). The method of claim 1, wherein the redox-cycling reagent is selected from PMS, HP PLM, and MD. The method for mass production of antibiotic CA or cephalosporin according to claim 1 or 3, wherein the redox-cycling reagent is 0.1-100 μM, preferably 10 μM, of PMS. The method for mass production of antibiotic actinorodin or prodigioinin according to claim 1 or 3, wherein the redox-cycling reagent is 1-30 μM, preferably 3 μM, of PMS.