KR19980701536A - How to improve screen effect in fused cells - Google Patents

Abstract

It relates to a method of improving the screen effect of fused cells in the presence of a desired gene. This method involves providing a marker of genes with a marker that overcomes the sensitivity of the persistent cell fusion partner to specific media conditions. It is illustrated to include a marker in an immunoglobulin gene in B cells.

Description

How to improve screen effect in fused cells

Because of the pioneering work of kohler and Milstein, it is known that it is possible to perpetuate unmodified B cells by fusing them in the presence of polyethylene glycol in a persistent cell line. Permanent cell lines are generally transformed or on-demand cell lines. In fused cells, whatever persists the transformed cell is retained in the fusion product.

The fusion process proceeds so that only the fused cells can survive in the culture medium and thus automatically select only colonies of successfully fused products. This is generally to use cells of tumor cell lines having phenotypic characteristics as persistent cells to be sensitive under specific media conditions.

Unfused cells that are not fused cannot survive because they are not persistent. However, the medium should be selected to have the advantage of the sensitivity of the transformed cell line to the relevant conditions to prevent colony growth of the unfused, transformed cells. The most commonly used sensitivity is a medium that requires the presence of hypoxanthine phosphoribosyl transferase (HPRT) to grow cells with the ability not to grow in hypoxantane-aminopterin-thymidine (HAT) medium. Due to the inherent genetic characteristics, the production of this enzyme lacks a persistent cell line. When the fusion mixture is cultured in HAT medium, the persistent cells are unable to grow because they lack HPRT.

Only fused cells can grow because these cells produce HPRT due to the ability of the cells to be persistent and untransformed.

The fusion technique of kohler and Milstein is to adopt a cell fusion process to obtain persistent B cells capable of secreting monoclonal antibodies with the characteristics required. It is immunized with the desired antibody to the antigen-bearing animal, obtains B cells from the spleen or peripheral blood lymphocytes (PBLs), fuses the persistent cell line with B cells, selects the fused cells, and secretes the required antibodies. Can be utilized by screening individual colonies of fused cells.

In this classical process, only a small number of fused cells can secrete antibodies characterized by the disturbances for two reasons. First, all B cells cannot secrete the antibodies in the first place. Secondly, of course, HPRT is responsible for X-chromosomes in all B cells because, although they are present, the antibody-encoded gene cannot enter the genome of the fused cell in a stable manner for delivery to the offspring of the original fused cell. Because it is coded, the relevant immunoglobulin position delivered to the offspring is not necessarily necessary for the cell to survive.

The present invention provides a method for minimizing a second reason for obtaining a large number of successful colonies that do not contain genes for the desired antibody or other genetic component.

This application is a continuation of US application 08 / 234,145, filed April 28, 1994, which is a continuation of US application 08 / 112,848, filed August 27, 1993, which was filed on March 15, 1993. Application Serial No. 08 / 031,801, which is a serial application of US Application 07 / 610,515, filed July 24, 1992, which is a serial application of US Patent Application 07 / 466,008, filed January 12, 1990. The contents of these applications are incorporated herein by reference.

The present invention relates to a method of increasing the proportion of fused cell colonies comprising the genetic features of the trait. In particular, the present invention provides a marker close to the required genetic characteristics to allow for the growth of persistent cells in conditions that become sensitive.

1A is a photograph of the results of a sudden block analysis for characterizing yHPRT and yeast genomic DNA contained in an ES clone as detailed in Example 2. FIG. A is human repeatability, Alu sequence. B and C are the pBR-specific sequences of the YAC cancers on the right and left, respectively. P is the East Ty repeat sequence. E is the yeast single-copy gene LYS2.

2A-D are photographs of the resultant hybrid cross-beams to detect the insertion of yHPRT and yeast genomic sequences in ES cell chromosomes as described above in Example 2. FIG. A and B are mid-term spreads in ESY8-7 cells hybridized to biotinylated human genome sequences. C and D represent mid-term spreads or mid-term nuclei from ESY8-6 cells hybridized to biotinylated yeast repeated DNA sequences.

3A-C illustrate the stable retention of yHPRTs during in vitro ES cell differentiation and metastasis through the murine bacterial lines detailed in Example 2. FIG.

4A-B are photographs of electrophoretic gels showing expression of human HPRT genes in various rat tissues as detailed in Example 2. FIG.

Figure 5 shows the rat rearing process as detailed in Example 3.

The present invention relates to modifying the kohler / milstein fusion technique to increase the successful fusion rate that includes the desired genomic components. This is particularly useful when the genomic component is in the position required to produce immunoglobulins. DNA in the desired genomic component can be modified by itself to include a marker that can overcome the sensitivity of the persistent cells to be used as a fusion partner. In this way, background markers, such as HPRT, inherent in untransformed cells containing the desired genomic components are not required to allow the persistent cell line to grow in sensitive media conditions. In an ideal case, the marker may not be present in the complementary background genome of the untransformed cell.

Thus, on the one hand, the present invention relates to a method for improving the colony ratio of fused cells that do not contain the desired genomic component, wherein the fused cells are traits that are sensitive to non-transformed animals, in particular, predetermined media conditions. Obtainable by fusion of a mammalian or avian cell comprising the desired genomic component of the converted cell line, the method providing the desired genomic component with markers that overcome the cell sensitivity of the transformed cell line to medium conditions; Mixing the cells of the transformed cell line with the untransformed animal cells under conditions that promote fusion to obtain a fusion mixture; Selecting fused cell colonies by culturing the fusion mixture under predetermined medium conditions; It consists of screening successful colonies in the presence of the desired genomic component.

On the other hand, the present invention relates to a persistent cell line produced by the method of the present invention and a method of producing a desired product by culturing such cells.

Implementation of the Invention

In general, the present invention is similar to that commonly used to obtain persistent cells capable of secreting antibodies, except that the genomic component, eg, the position encoding the light and heavy chains of the antibody, is HPRT or neomycin gene in the DNA sequence. There is a difference in approaching genes that encode markers such as Such harmless modifications significantly increase the proportion of permanently fused cell colonies that can produce products of selected genomic components.

As used herein, an untransformed cell refers to a cell that is not able to grow indefinitely in culture and therefore is not persistent. These cells are not cell lines and, for example, they cannot be passaged repeatedly. Examples of untransformed cells include already differentiated but not malignant animals, particularly mammalian or avian cells. The most commonly used is B cells, or other untransformed cells, to the extent that it can be a desirable process for proprietary proteins. Thus, appropriately untransformed cells may include T-lymphocytes, muscle cells, pituitary cells, pancreatic cells and others.

As used herein, a transformed cell refers to a cell that can be made with a cell line by obtaining the ability to pass on indefinitely. HeLa cells, CHO cells, COS cells and a number of murine myeloma cell lines are known in the art. In order to be useful in the methods of the present invention, transformed cells must have characteristics to confer sensitivity to specific growth conditions, where sensitivity is understood in the production of one or more gene products available from untransformed fusion pairs. Reversed.

A fused cell line refers to a successful fusion product, such as a persistent or transformed cell that has been successfully fused with an untransformed cell comprising the desired genomic compound. The most commonly used technique that affects cell fusion is the treatment with polyethylene glycol. However, other techniques can be used, including electroporation and confluent viral treatment.

A useful genomic component refers to the DNA portion in the genomic complement of an untransformed cell that wishes to transfer to the offspring of a fused cell line. Genomic components become expression systems for a single gene, such as a gene that encodes a growth factor or hormone. In an important embodiment of the invention, the genomic component is associated with one or more expression systems for one or more genes. In an important use of the present technology, the relevant genomic component consists of an expression system for an immunoglobulin heavy chain and an expression system for an immunoglobulin light chain or an appropriate portion thereof) wherein the antibody produced is immunoreactive with a particular target antigen. have. It should be clarified that the expression system does not necessarily refer to a claw protein-encoded DNA that is adapted to be linked to a heterologous promoter, even if the structure is involved. Also within the scope of the expression system of the present invention is a genomic DNA portion comprising both an expression control sequence and a protein encoded sequence. In particular, the expression system for immunoglobulins within the present invention includes both rearranged coding sequences and unrearranged genomic positions for a particular immunoglobulin.

In order to understand the advantages of the method of the present invention, it is important to understand that colonies resulting from the successful fusion of untransformed and transformed cells do not need to transfer paired complete genomic components to offspring.

Here, in the parent application, a method for obtaining transgenic mice capable of forming human antibodies in response to antigen administration is detailed. The vector or yeast spheroplasts can be used to insert unrebalanced human heavy and light chain immunoglobulin positions into rat embryonic stem cells (ES cells), wherein the human chromosomal loci are obtained from yeast artificial chromosomes (YACs). ) And indicated by a selection marker. As a marker, neomycin resistance gene (neo gene) and HPRT gene are used. The resulting ES cells can be isolated by selection of the appropriate YAC by the label used. The use of YAC-comprising ES cells to obtain continuous mating with chimeric mice can yield mice comprising human heavy and light chain loci unrearranged in their genomic components. In such mice, markers are included in close proximity to the immunoglobulin locus. After immunizing transgenic mice with the desired antigens, the cells are fused with the persistent cells to obtain B cells and to obtain colonies that produce the required antibodies. In this process, the desired genomic component (eg, immunoglobulin heavy chain and oblique chamber locus) already contains a marker in close proximity to the relevant component in the same DNA sequence.

When the above-mentioned fusion is carried out when the standard method using HAT as the selection medium is used, the effect of obtaining a successful fusion colony containing the required genomic components is improved when HPRT is used as a marker or associated with an immunoglobulin gene. Can be. Such results may include progeny that contain only the desired genomic components in the total colony numbers obtained and do not include the X-chlomosome of B cells comprising the background HPRT gene. On the other hand, when different markers, such as neo, are used as the selection for transformation of ES cells, but when used as the selection medium for the fusion of transformed cells with B cells, successful colonies are found in X in these progeny. The chromosome will only contain fusions with a background HPRT. Thus, those fusions that do not contain one or two immunoglobulin loci, but fusions that contain a background HPRT gene, are not removed from the population; The population will include X-linked HPRT fusions but will not include fusions with one Ig locus.

In addition, since the transformed cells are also sensitive to neomycin antibiotics (or G418-containing media), media containing G418 can be used as the selection medium for B cell / myeloma fusion when neo genes are provided as markers. Otherwise it may contain an inserted genome for ES cell fertilization.

It is clear that the content of the marker proximate the immunoglobulin locus does not need to be an ancillary result used as a marker for transformation of ES cells in selecting a successful transformant. In addition to another marker for ES cell transformation, a marker may be provided adjacent to the desired locus or simply included when the locus is inserted into the fertilized egg by microinjection. In this process, no selection is necessary; Progeny are only properly tested to see if the required feature is successfully included in the genome. Nevertheless, the locus representing the required characteristics can provide a required marker using standard recombination techniques.

The method can be further refined using multiple markers when multiple genes are composed of the desired genomic components to be transferred to the fused cell offspring. By way of example, in connection with the transfer of immunoglobulin genes, the light chain has a neo label and the heavy chain is provided with an HPRT label. In fusion, G418-containing HAT medium should be used for selection and surviving progeny should include at least an immunoglobulin light chain and an immunoglobulin heavy chain or an X-chromosome-based HPRT marker.

Alternatively, hygromycin resistance genes can also be used as markers in the methods of the invention.

A more direct description of the invention is the use of untransformed cells with sufficient survival characteristics to be selected for successful homologous recombination. It is not appropriate to use B cells in this description because their survival time in culture is quite short. However, some T-cell clones and some other cells that display useful properties or produce useful products or are not persistent can survive sufficient passage in culture, making them a useful recommendation for homologous recombination to insert markers. The transfected primary cells are tested under conditions affecting the DNA and vector containing the neo-resistant genes bound by sequences similar to those immediately visible upstream or downstream of the desired genomic component. Successful transformants including neo genes in DNA sequences containing genomic components by homologous recombination can be selected by growth in G418-containing media. The resulting untransformed primary cell contains G418 resistance encoded in close proximity to the portion containing the desired genomic component.

In standard fusion protocols, persistent cell lines sensitive to G418 require successful fusion to survive in G418-containing medium. Successful fusion cells that can survive in medium containing G418 must obtain this ability from untransformed cells. The neo-resistance genes migrate with the genomic components of the disturbance, suggesting that they will be transferred to offspring.

In a more general example, HPRT is introduced to approximate the desired genomic component when traditional selection media are used for the fused product. In this case, direct selection after homologous recombination in many primary cells is not conveniently available because such cells generally contain the HPRT gene in the X-chromosome. However, as described above, transgenic animals were prepared by inserting immunoglobulin cells into fertilized eggs or ES cells. In this way, HPRTs can be introduced directly with proprietary genes. In this embodiment, the genes encoding the light and heavy chains will ensure close proximity to the HPRT encoding site.

The following examples are intended to illustrate the present invention but are not limited thereto.

Example 1

A. Production of yeast artificial chromosomes (YAC) containing human heavy chain

Spe I fragments leading to the human heavy chain VH6-D-J-Cμ-Cδ region (Berman et al. (1988). EMBO J. 7: 727-738; see Figure 4) are described in Berman et al. (1980) can be isolated from human YAC libraries (Burke et al., Supra; Brownstein et al., Science, 244: 1348-1351) using the DNA probes described above in EMBO J. 7: 727-738. . One clone of about 100 kb is obtained. Radiolabeled probes for human heavy chains (Berman et al., Supra) are used to characterize YAC clones separated by pulse-field gel electrophoresis (Berman et al., Supra).

B. Influx of YAC clones into embryo or ES cells

High molecular weight DNA is prepared in an agarose plug from yeast cells containing the YAC of interest (eg, the YAC comprising the Spe I fragment described above from the IgH locus). DNA is size-sorted in a CHEF gel apparatus and YAC bands are cleaved from low melting agarose gels. Gel fragments are equalized with polyamines and then melted and treated with agarose to cleave agarose. The polyamine-coated DNA is injected into the male pronucleus of the fertilized embryonic embryo in which the virtual pregnant female is surgically introduced into the uterus as described above. Neonatal gene transfer characteristics are analyzed by DNA slot-blots isolated from the tail and human heavy chain production is analyzed by obtaining a small amount of serum and testing in the presence of Ig chains with rabbit anti-human antibodies.

Other examples of microinjection include YAC DNA in ES cells; Rat ES by East Globular Cell Fusion (Traver et al ,. (1988) Proc. Natl, Acad, Sci., USA, 86-5898-5902; Pachnis et al., (1990), ibid 87: 5109-5113) Metastasize to cells; First, the neomycin-resistance gene from pMC1Neo or HPRT or other mammalian selectivity and yeast selectivity markers is inserted into the non-essential YAC vector sequence in the plasmid. This structure is used to transform yeast strains comprising IgH YAC and pMC1 Neo (or other selective marker) is inserted into the vector sequence of IgH YAC by homologous recombination. Modified YACs are expressed in globular cell fusion (Traver et al., (1988) Proc. Natl, Acad, Sci., USA, 86: 5898-5902; Pachnis et al., (1990), ibid 87; 5109-5113). The resulting G418-resistant ES cells (or exhibiting other selective phenotypes), which are transferred into ES cells and contain native human IgH sequences, can be used to make chimeric mice. Or purified YACs are transfected into ES cells by lipofectin or calcium phosphate-mediated DNA transfer.

Example 2

Influx of Human Ig Genes in Mice

A. Cloning of the Human Ig Gene in East

1. Identification and Characterization of Human IgH YAC Clones Including VH, D, JH, mu and Delta Sequences

Screening DNA populations obtained from the Washington University Human YAC Library (Washington University, St. Louis, Mo.), the human VH6 gene (V6A = 5 'GCA GAG CCT GCT GAA TTC TGG CTG 3' and GTA ATA CAC AGC CGT GTC CTG G) PCR primers for 3 ′) were used. Positive populations were screened by colony hybrids and one positive microtiter plate well, A287-C10, was identified. Two different sizes (205 kb and 215 kb) VH6 including YACs were separated from microtiter wells. In addition to VH6, the smaller of the two IgH YACs, A287-C10 (205 kb) hybridizes to probes for the following sequences delta, mu, JH, D, VH1, VH2 and VH4. Two larger IgH VACs, A287-C10 (215 kb), hybridize to the probes for delta, JH, D, VH1, VH2 and VH4 (except mu). YACs comprise sequences from at least five VH genes, including two VH1 genes, one VH2, one VH4 and one VH6 gene. Restriction enzyme cleavage analysis revealed that while the 205 kb YAC was somewhat eliminated, not all D gene populations included deletions (approximately 20 kb in size) and the remaining YACs were unique and had embryonic cells. The 205 kb YAC and PCR and detailed restriction enzyme cleavage assays illustrate the presence of several different D gene populations. The 215 kb YAC contains the complete major D gene population but has a deletion (approximately 10 kb) with mu gene removed. This deletion does not appear to affect the hens or JH population located between the JH and mu genes.

A virtual progenitor (Shin et al., 1991, supra) (see FIG. 4) of approximately 225-230 kb YACs and two related IgH YACs containing the entire genome portion between the VH2 and delta genes is shown in A287-C10 microtiter wells. Was not confirmed. Here, an initial few drops of A287-C10 microtiter plate wells were examined to investigate progenitor YAC, assuming that it was lost during the passage of the library. A287-C10 microtiter wells were plated (Washington University, st. Louis, Mo.) and two of the 10 colonies analyzed included 230 kb IgH-YAC with others not actually associated with YAC. IgH YACs include mu, complete D profile (based on Bam HI cleavage below) and JH. In clone 1, IgH YAC was physically separated from YAC independent of meiosis separation at the intersection between A287-C10 / AB 1380 and YPH857 (genotype = MAT α ade2 lve2 ura3 trp1 HIS5 CAN1 hie3 leu2 chy2, A287-C10 ( 230 kb) / to produce MP313) (host genotype = MAT α ade2 leu2 lys2 his3 ura3 trp1 can1 cyh2).

2. Targeting A287-C10 kb YAC with Mammalian Selection Mark HPRT

The YAC right cancer target vector, called pLUTO (15.5 kb), is a human HPRT minigene (Reid et al., Proc, Natl, Acad, Sci. USA 87: 4943-4938 (1991), which is included in the 6.1 kb BamHI fragment. It can be made by subcloning the BamHI site in the polylinker (Hermanson et al., Nucleic Acids Resarch 19: 4943-4938 (1991). A287-C10 / AB1380 cultures containing both YAC independent of 230 kb IgH YAC Transform with linearized pLUTO and select Lys + transformants.

Lys + clones can be screened by colony hybrids in the presence of mu. One colon was found to contain a single YAC of about 245 kb that hybridized to probes for mu, HPRT and LYS 2.

Southern analysis of 230kb A287-C10 YAC targeted with pLUTO was performed using various probes to account for the unique, unrearranged characteristics of cloned human IgH sequences. In most cases, the BamHI, Hind III and EcoRI cleavage results are compared with the limit data for WI38 (human embryonic fetal lung-induced cell line), 205 kb and 215 KB deletion-derived of A287-C10, and with published values. The diversity (D) gene profile determined by hybridization with the D-part probe (D. 45 NcoI / PstI fragment; Berman et al., 1988) yielded the expected four D gene fragments (D1-D4) (Siebenilist et al., 1981). Nature 294: 631-635). For example, in A287-C10 and WI38, four restriction enzyme-treated fragments, 3.8 kb, 4.5 kb, 6.9 kb and 7.8 kb, were observed when BamHI restriction enzyme treatment. There is one more larger band in WI38, presumably due to the chromosome 16D5 site (Matsuda et al., 1988, EMBO 7: 1047-1051). Sudden analysis using PCR and D-group specific primers and probes revealed the following D gene group in 215 kb deletion-induced YAC (which appears to have a native D portion in the same restriction enzyme manner as 230 kb YAC); It describes the presence of two to four components each of DM, DN, DK, DA, DXP and DLP. J-mu sequenced from the PCR product cloned from A287-C10 230kb YAC (primer EnA = 5 'TTC CGG CCC CGA TGC GGG ACT GC 3, and EnB1 = CCT CTC CCT AAG ACT 3') and determined to be unique Intronic enhancers generate a single restriction enzyme fragment of expected size with BamHI, EcoRI and HindIII when probed with a 480bp PCR product. The JH moiety is about 6 kb BamHI / HindIII fragment extending to DHQ 52 and the entire JH moiety (Ravetch et al., 1981, Cell 27: 583-591). Also hybridize to about 18 kb BamHI JH fragment mu probe sequence detected in A287-C10 and WI38 (Ravetch et al., Supra; Shin et al., 1991, supra). 0.9 kb EcoRI fragment muprobe (Ravetch et al., Supra) 21 kb BamHI (expected about 17 kb); Restriction enzyme fragments of 0.9 kb EcoRI (expected 0.9 kb) and 12 kb HindIII (expected about 11 kb) were shown. WI38 provided a BamHI fragment of the same size as A287-C10. The JH and DHQ 52 moieties were sequenced in all of the missing derivative YACs, which are all embryonic cells. Delda was analyzed with exon 1 PCR product (containing about 160 bp portion between primers DIB = 5 'CAA AGG ATA ACA GCC CTG 3' and DID = 5 'AGC TGG CTG CTT GTC ATC 3') and A287-C10 Restriction enzyme fragments are similar to those determined in the literature (Shin et al., Supra) and for WI38. The 3 'cloning site of YAC may be the first EcoRI site of Delta (Shin et al., Supra; Matsuda et al., Supra) or another 3' EcoRI site. To assess the various gene contents of YAC, VH gene probes for VH1, VH4 and VH6 (Berman et al., Supra) and VH2 (Takahashi et al., 1984, Proc, Nat, Acad, Sci, USA 81: 5194- Gene probe for 5198). A287-C10 contains two VH1 genes (Shin et al., Supra; Matsuda et al., Supra) close to the expected size; Restriction assays with three enzymes showed close to the expected fragment size; For example, the bands observed at EcoRI were 3.4 and 7.8 kb (estimated 3.4 and 7.2 kb). Expected size EcoRI fragments (Shin et al., Supra; Matsuda et al., 1993, supra) for VH4 (observation 5.3 kb, expected 5.1 kb) and VH6 (observation 0.8 kb; expected 0.9 kb) were found in A287-C10. there was. The expected size fragments were seen in VH2 (5.5 kb observation, 5.4 kb expected), but the BamHI and HindIII fragments were different than expected. Matched hybridization of the BamHI and HindIII fragments with the pBR 322 probe showed that the EcoRI site (Shin et al., supra; Matsuda et al., supra) at the 5 'end of the VH2 gene was a 5' cloning site and thus a natural 5 'HindIII site and BamHI site can be removed. The overall size of the YAC insert (approximately 220 kb) fits the expected size for the unique unrearranged fragments starting at the 5 'end of the 3'-most VH2 gene and extending to the EcoRI 3' site of the delta locus.

3. Identification and Characterization of IgK YACs Including CK and VK Sequences

From the human kappa constant region (CK) gene (2.5 kb EcoRI fragment ATCC No 59173, Parklawn Dr., Rockwille, MD) probes and two YACs were screened by a screen of pulsefield gels (PFGs) in the WY human YAC library. Confirmed. YACs designated A80-C7 (170 kb) and A276-F2 (320 kb) include kappa-deficient elements kde, CK, JK and C-J intron enhancers and 3 'extensions past kde. YACs in the 5 'extension from JK also include the B1, B2 and B3 VK genes and possibly other sequences determined by hybrid or PCR. The A80-C7 / AB1380 strain contains unrelated YACs of similar size in addition to IgK YAC. Thus, mitosis is used to separate these YACs; A80-C7 is crossed with YHP857 and the mitotic product contains only IgK YAC (MP8-2; host genotype = α ade2 leu2 his3 his5 lys2 ra3 trp1 can1 chy2). A80-C7 and A276-F2 YACs are targeted with pLUTO to bind the human HPRT mini gene with YAC right vector guidance.

The conclusion that two YACs were not rearranged (embryocells) is supported by restriction enzyme analysis of IgK YACs A80-C7 and A276-F2 using multiple enzymes. For example, BamHI cleavage followed by hybridization with a CK probe describes the expected 13 kb restriction enzyme fragment (klobeck et al., Nucl. Acids, Res. 14: 4591-4603 (1986). (klobeck and Zachau, Nucl, Acids, Res. 13: 6515-6529 (1985)) hybridize to JK probe (1.2 kb PCR product using primer set to amplify the JK1-5 moiety). The class IV gene (probe is a 123 bp PCR product from the B3 gene) gives 4.9 kb BamHI and 2.2 kb Bg1II fragments, which are close to the known values of 4.6 kb and 2.3 kb, respectively (Lorenz et al. Molec. Immunol. 25 : 479-484 (1988)) PCR analysis of human genomic DNA for IgK YACs and the following kappa locus sequence showed the expected band sizes: (Kde (120 bp), CK (304 bp), CJ intron enhancer ( 455 bp), JK1-5 (1204 bp), B3 VK (123 bp) and VK pseudogenes) for the CK, JK and CJ enhancers The sequences used to design the PCR primers were from Whitehurst et al., Nucl, Acids, Res, 20: 4929-4930 (1992); Kde, B3 from Klobeck; B3 from Klobeck et al., Nucl, Acids, Res, 13: 6515-6529 (1985), and B1 from Lorenz et al., Supra.

B. Introduction of 680 kb yHPRT YAC into ES Cells

1. Culture of yHPRT Yeast Strain and Preparation of Yeast Globules

680 kb yHPRT is reported by Hexley, et al. (1991) YAC containing a functional copy of the human hypoxanthine phosphorylsiltransferase (HPRT) gene cloned from the YAC-library as detailed in Genomics 9: 742-750. Yeast strains comprising yHPRT are described in Huxley, et al. (1991) It was grown in uracil and tryptophan-deficient liquid media as detailed in supra.

To prepare yeast globules, spin 400 ml of yeast culture containing yHPRT and yeast pellets are washed once with water and once with 1M sorbitol. Yeast pellets are resuspended in SPEM (1M sorbitol, 10 mM sodium phosphate pH 7.5, 10 mM EDTA pH 8.0, 30 mM β-mercaptoethanol) at a concentration of 5 × 10 ⁸ yeast cells / ml. Zymolase 20T is added at a concentration of 150 μg per ml of yeast cells and the culture is incubated at 30 ° C. until 90% of the cells are globular (usually 15-20 minutes). Cells are washed twice with STC (1M Sorbitol, 10 mM Tris pH7.5, 10 mM CaC1 ₂ ) and resuspended with STC at a concentration of 2.5 × 10 ⁸ / ml.

2. Culture of E14TG2a ES Cells

HPRT-negative ES cell line E14TG2a is described in Koller, et al. Incubation is in a mitomycin C-treated embryo fibrous assemblage feed layer as detailed in PNAS (1989) 86: 8932-8935.

3. Fusion of ES Cells and Yeast Globules

Exponentially grown E14TG2a cells grown in gelatin-coated petri dishes were trypsinized and washed three times with serum-free DMEM. 2.5 × 10 ⁸ yeast cell pellets are carefully covered with 5 × 10 ⁶ ES cell blisters spinned on the yeast pellet. The combined pellets are resuspended in 0.5 ml of 50% polyethylene glycol (PEG) 1500 or 50% PEG 4000 (Boeringer Mannheim) containing 10 mM CaCl ₂ . After incubation for 1.5 min at room temperature or 37 ° C., 5 ml serum-free medium is slowly added and the cells are left at room temperature for 30 min. The cells are then pelleted and resuspended in 10 ml ES cell complete medium (as described above) and plated on one 100 mm plate coated with feeder cells. 48 hours after fusion, HAT (ES medium comprising 1 × 10 ⁻⁴ M hypoxanthine, 4 × 10 ⁻⁷ M aminopterin, 1.6 × 10 ⁻⁵ thymidine) is added. HAT-resistant ES colonies were observed 7-10 days post-fusion on plates of all of the different fusion conditions used. The yHPRT-ES (ESY) fusion colonies are selected and plated in supplier-coated wells and extended for further analysis.

4. Analysis of YAC DNA Inserted into yHPRT-ES Fusion Colony

DNA extracted from 23 yHPRT-ES fusion colonies was transferred to HindIII and subjected to Southern blot analysis using a probe (FIG. 1); Human repeat Alu sequence (A); PBR 322-specific sequences for YAC vector right arm (B) and left arm (C); Yeast Ty repeat sequence (D); Yeast single copy gene LYS 2 (E). Human HPRT probe, 1.6 kb full length cDNA (Jolly et al., Proc, Natl, Acad, Sci, USA 80: 477-481 (1983)) is used to confirm the presence of the human HPRT gene in ESY clones. The Alu probe is a 300 bp BamHI fragment (Pavan et al., Pro, Natl, Acad, Sci, USA 78: 1300-1304 (1990)) from the BLUR8 Alu fragment in pBP63A. The right and left vector cancer probes are pBR322-derived BamHI-PvuII 1.7 and 2.7 kb fragments, respectively, corresponding to the vectors in pYAC4 (Scheme a, b (Burke et al., In: Guide to Yeast Genetis and Molecular Biology, Methods in Enzymology, Guthrie and Fink, eds, Academic Press, 194: 251-270 (1990)) The 4.5 kb fragment detected by the right cancer probe was expressed in the HindIII region of the terminal small (telomere 5 'end) and in the human insert. 1 stretched between the HindIII site (process a) The 3 kb and 4.1 kb fragments detected by the left end probe correspond to the region between the HindIII site and the 5'HindIII site of the yeast sequence in the terminal granules From the 3'HindIII site of to the human insert (procedure b), the hybrid intensity difference between these two bands is associated with a difference in the amount of similarity between these fragments and the probes. al., in Gene E xpression in Yeast, Proceedings of the Alko Yeast Symposium, Helsinki, Korhola and Vasanen, eds., Foundation for Biotechnical and Industrial Fermentation Research, 1: 189-200 (1983)), Ty1-fohama is 5.6kb isolated from pJEF742 fh. XhoI fragment, which can also detect the 3'HindIII fragment of Ty2 due to the similarity between these two elements The LYS2 gene probe is a 1.7 BamHI fragment from pLUS (Hermanson et al., Nuc, Acids, Res, 19: 4943-4948 (1991).

This hybridization with a human HPRT probe (full length 1.6 kb cDNA probe) demonstrates that all clones analyzed contain the same 15.7 and 5 kb exon containing fragments of the human HPRT gene as yHPRT YAC. Reloving the same blot with the human repeat Alu sequence 300 bp probe indicated that not all clones analyzed had Alu-containing fragments, mostly but not in yHPRT (FIG. 1A). In most clones analyzed in these data, 600kb human inserts showed no detectable rearrangement or deletion upon insertion into the ES cell genome. Insertion of the YAC vector sequence can be examined using probes specific for vector cancers. Rehybridization of the same blot as the probe for the right YACvector arm detecting the 4.5 kb HindIII fragment showed that the right YAC arm was native and not rearranged from 10 out of 23 clones analyzed to human insert (FIG. 1B). ) Provide a further increase in the integrity of YAC in these clones. The left cancer probe detects 3 kb HindIII yHPRT and fragments in 18 of the 20 clones analyzed (FIG. 1), suggesting that the left cancer identity is quite high.

Structural completeness of yHPR in ESY clones was evaluated for two clones (ESY 5.2 and 8.7) using pulse-field gel restriction enzyme analysis. In yeast with yHPRT, five Sfi fragments with the following sizes are designated with different probes; 315 kb (Alu, left arm), 145 kb (Alu, HPRT); 95 kb (Alu, right arm), 70 and 50 kb (Alu only). The internal HPRT and Alu-specific fragments in ES clones are similar in size to the yHPRT fragments. The end fragment that detects both clones is larger than that of yHPRT; As expected for YACs inserted into murine chromosomes; These data, along with 185 and 200 kb in the right end fragment and 800 kb or more in the left end fragment for both clones, along with Alu profiles, provide additional evidence for the retention of structural integrity of YAC in these frameworks. These studies are complementary by fluorescence speciation hybridization performed on ESY 8-7 (FIGS. 2A-B) and ESY 8-6 mesophase chromosomal spreads where a single insertion site can be detected by human sequences. Micrographs of mesenchymal nuclei (FIG. 2D) or representative mesophase spreads (FIGS. 2A, B, C) from ESY 8-7 cells (FIGS. 2A, B) hybridize with biotinylated human genomic sequences and ESY 8-6 cells (C, D) hybridize with biotinylated yeast repeated sequences. Human probes originate from human genomic placenta DNA (Clontech, Palo Alto, CA). Yeast probes consist of a mixture of DNA fragments that encode yeast repeat elements; Delta (1.08 kb Sau3A fragment of pdelta 6 (Gafner et al., EMBOJ. 2: 583.591 (1983)) and Ty fragment (1.35 kb EcoRI.SaII fragment of p29 (Hermanson et al., Nuc. Acide Res. 19) (4943-4948 (1991)) rDNA (4.6 kb BgIIIK-A L90 and 4.4 kb BgIII-B L92 fragment (Keil and Roeder, Cell 39: 377-386 (1984)) and the Y 'malean element element (2.0 of p198 and 1.5 kb BgIII-HindIII fragment (Chan and Tye, Cell 33: 563-573 (1983)) using a Zeiss Axiophot microscope according to the method described in Trask and Pinkel, Methods Cell Biol 30: 383-400 (1990). Hybridization of sequences and detection by avidin-FITC and biotin-anti-avidin and avidin-FITC amplification are performed on the tinylated probe and the chromosome mesophase spread.The chromosomes are anti-pigmented with propidium iodide. In three independent experiments with human or yeast probes, 95% of the midphase spread or Served single insertion site is observed for men sequences.

A duck blot is probed with an East Ty repeat sequence to detect the presence of a yeast genomic DNA sequence in an ESY clone (FIG. 1D). Some of the clones contain most of the fragments containing Ty in the parent yeast strain, while some of the clones are known to have very small but not all of the fragments containing Ty. These results indicated that even though YAC DNA was originally inserted, few or yeast genomic DNAs were inserted in some ES clones. Fluorescence specific hybrids are run on ESY clone 8-6 with a complete Ty profile to determine whether yeast chromosomal DNA is inserted at a single or multiple sites within the ES cell genome. A single insertion site was detected using a combined yeast repeat probe (FIGS. 2, C, D), indicating that all yeast DNA fragments were inserted in one block within the resolution range.

Using the ability of ES cells to perform in vitro differentiation, the effect of the inserted DNA and the YAC stability on the omnipotence of the ES cells was investigated. Four ES clones containing different amounts of yeast DNA (ESY 5-2, 3-6, 8-6 and 8-7) represent a differentiation indistinguishable from that of unfused ES cells and various differentiated cell types. To form a embryo (Figure 3A). Southern blot analysis includes a) human Alu probe; b) Run on DNA extracted from ESY 5-2, 3-6, 8-5 and 8-6 (20 μg) differentiated from yHPRT at AB1380 (40 ng) using the East Ty sequence. ES clones are induced to form embryonic bodies by incubating them as aggregates in suspension for 10-14 days as described in Martin and Evans, Cell 6: 467-474 (1975). Following their reattachment to tissue culture, the ESY-derived embryonic bodies become differentiated cell types. YAC and yeast DNA sequences are stably retained by ES clones differentiated during 40 days of culture in non-selective medium, demonstrating that stably inserted foreign DNA does not impair the cell power of ES cells (FIG. 3B). . Differentiated cultures retain human HPRT genes that function as exhibited by their normal growth and differentiation when transferred to HAT-selective media.

5. Generation of Camera Rats from the yHPRT-ES Cell Line

The ability of ESY cells to live in mice containing bacterial lines is illustrated by microinjection of ES cells into mouse undifferentiated embryonic cells and the development of chimeric mice. ESY cells are microinjected into C57BL / 6J murine undifferentiated embryonic cells and chimeric mice are generated as previously described. Chimeric males mate with C57BL / 6J females and bacterial strains are determined by the presence of agouti offspring. Genomic DNA prepared from chimeric rat tails is analyzed for the presence of yHPRT DNA in the rat genome by PCR analysis. The presence of YAC left cancer is analyzed using two prime oligonucleotides 5 'TTCTCGGAGCACTGTC CGACC and 5' CTTGCGCCTTAAACCAACTTGGTACCG, each of which is derived from the pBR322 sequence and the SUP4 gene in the YAC left vector cancer, respectively. 259 bp PCR products were obtained from yeast assays containing yHPRT and ESY cell lines. PCR analysis of tail DNA prepared from 18 chimeric mice generated from the ESY cell lines ESY3-1, ESY3-6 and ESY5-2 generates the expected PCR product and thus indicates the presence of YAC left vector cancer in the genome of chimeric mice. .

6. Bacterial Transfer of yHPRT

Chimeric males with 30-60% hair-colored chimerism derived from the ESY cell lines ESY3-1 and ESY5-2 are evaluated for bacterial line metastasis, eg whether genetic modification is passed through the embryonic cells (sperm or egg cell) to animal offspring. Prepare the mating to determine. Three of the chimeric ESY3-1 induced males, 394 / 95-1, 394 / 95-2 and 411-1 transferred the ES cell genome to their descendants at 20% 30% and 30% rates, respectively. Southern blot analysis of the tail DNA of agouti puppies shows the presence of yHPRT in the genomes of three rats 4-2, 4-3 and 5-1 derived from the 394 / 395-2 chimera. The Alu profile obtained from this assay is indistinguishable from that of the parental ES3-1 cell line (FIG. 3C), which 680 kb human inserts are sincerely transferred through the mouse embryonic cell line.

The expression of human HPRT gene was detected in all tissues tested using human HPRT-specific PCR in mRNA-derived cDNA from descendants containing yHPRT (FIGS. 4A, B) and thus metastasized YACs were responsible for their function. Indicates that it has In such experiments, human HPRT mRNA was expressed in ES, from control rats (C) or 4-3 Agoti offspring (derived from 394 / 95-2 chimeras) and from samples without template DNA (represented by-in FIG. 4A). It is detected by reverse transcription (RT) -PCR in ESY 3-1 and Hut 78 (human) cells, spleen and liver. Poly (A ⁺ ) RNA reverse transcription and PCR amplification of specific cDNA sequences were performed using the cDNA Cycle Kit (Invitrogen). Specific amplification of 626 bp fragments from human HPRT cDNA is performed in the presence of murine HPRT cDNA as shown in Huxley et al, supra. Integrity of all RNA samples is illustrated by PCR amplification of cDNAs against murine γ-interferon receptors. Primers used to amplify 359 bp fragments are GTATGTGGAGCATAACCGGAG and CAGGTTTTGTCTCTAACGTGG. Human HPRT and γ-interferon receptor primers are designed to eliminate the possibility of obtaining PCR products from genomic DNA contaminants. PCR products can be analyzed by electrophoresis and viewed as ethidium bromide. The size marker is 1 kb ladder (BRL). The results of detection of murine γ-interferon receptor mRNA by RT-PCR in the sample described above are shown in FIG. 4B. It was also detected in certain human HPRT mRNA or other tested tissues derived from 4-3 mice (brain, kidney and heart). Comparable constant levels of rat and human HPRT mRNA were detected in the livers of descendants containing yHPRTs. These results demonstrate that a significant amount of receipt, such as 13 megabases of yeast genomic DNA, is not critical for proper development, embryonic transfer or gene expression.

In the above results, yeast globules are an effective carrier for the transport of single copying macromolecular DNA fragments into ES cells and demonstrate that such molecules are stably and functionally transferred through mouse embryonic cells. Complementary Alu profiles complemented by PFGE analysis and specific hybridization for some of the ES clones, with humans in unrearranged form (e.g. embryonic cell shape), with a large number of clones (40%), the majority of which carry YAC cancer. It includes an insert. Significant uptake of yeast genomic DNA is not critical to the proper differentiation of ES cells in vitro and in vivo and does not prevent embryonic cell transfer or gene expression. Using these methods, large fragments of genomic DNA can be transferred into the non-human animal genome as an insert and the insert can be natively transferred by embryonic cell metastasis. Thus, a wide variety of heterologous DNA is introduced into non-human hosts such as mammals, particularly small laboratory animals, which can give new phenotypes or new genotypes. For example, human genes provide responses to various reagents to study the cause of disease in small laboratory animal genes in mammals such as humans. Or a large locus may be derived into a mammalian host to produce products of other species to provide human protein sequences of proteins such as immunoglobulins, T-cell receptors, host histocompatibility gene complex antigens.

Influx of heavy chain YAC A287-C10 and kappa chain YAC A80-C into ES cells and embryos

Yeast comprising the chain YAC A287-C10 (yA287-C10) among the people targeted to pLUTO is spheroidized and fused with the HPRT-deficient ES cell line E14.1TG3B1 as described above. Ten HAT-resistant ES (ESY) clones (2B, 2C, 2D, 3A, 3B, 5C, 1125A, 1125E, 100/1500 and 100/4000) are selected and extended for DNA analysis. Sudden blot analysis of HindIII-cleaved DNA from these clones was performed using chains in humans for the D, J _H , μ and VH2 moieties as described above. All ESY clones were found to contain the expected 10 kb J _H and μ fragments. All ESY clones except 2D and 5C clones were found to contain a 4.8 kb VH2 kb fragment. All ESY clones except 2D and 3B were found to contain the expected 10 and 7.6 kb D gene fragments. Yeast genomic sequences can be detected by hybridization to yeast repeating Ty elements in all ESY clones except 2B, 2D, 100/500 and 5C. ESY clones 2B, 3A and 5C were microinjected into C57B / 6 undifferentiated embryonic cells as described above, resulting in chimeric mice (10 in 2B clone, 1 in 3A clone and 1 in 5C clone). Southern blot analysis of tail DNA from 10 of these chimeric animals detected the presence of 10 Alu fragments in yA287-C10 in most but not all of the yeasts, indicating the presence of VH2 and D gene fragments. The generated chimeric mice are cultured with C57BL16J mice for embryonic cell metastasis assessment. Chimeric male 78K-3 derived from 2B clone transferred ES cell genome to 100% of its offspring. Sudden analysis of tail DNA in four of the six Aguti rat puppies revealed the presence of the human heavy chain.

Fusion experiments of E14.1TG3B1 ES cells with yeast comprising human carpa chain YAC A80-C7 targeted with pLUTO (yA80-C7) resulted in 2HAT-resistant ESY clones: M4.4.1 and M5.2.1. Southern blot analysis of HindIII-cleaved DNAs from these clones revealed that all 10Alu fragments detected in yeast were present. In these two clones the yeast genomic sequence was inserted. ESY clones are microinjected into C57B1 / 6J undifferentiated embryonic cells and made chimeric mice.

Example 3

Gene Transfer in Mice

A. Production of Mice Producing Human Monoclonal Antibodies

Mice containing the human immunoglobulin loci were paired with mice carrying the inactivated murine immunoglobulin gene to produce mice that produced only human antibodies. Starting with four heterozygous strains, three generations of parenting are required to create homozygotes for inactive rat kappa and heavy chain immunoglobulins, and heterozygotes for human heavy and kappachain immunoglobulin loci. The rearing process is shown in FIG. 5.

Example 4

Production of Human Monoclonal Antibodies

A. Immunization of Rats

Embryonic chimeric mice containing human DNA inserted from immunoglobulin gene sin by immunization with an adjuvant are immunized. Mice were added with antigen 14 days after the first immunization and repeated 35 and 36 days later. Breed in immunized animals to test the titer of serum antibodies against the antigen to be immunized. Rats with maximum titers were killed and spleens removed.

B. Fusion of Splenocytes

Myeloma cells used as a fusion partner of spleen cells are thawed 6 days prior to fusion and grown in tissue culture. One day before fusion, cells are placed in fresh medium containing 10% fetal calf serum at a concentration of 5 × 10 ⁵ cells / ml. In the morning of fusion, cells are diluted with the same amount of medium supplemented with 20% fetal calf serum and 2 × OPI (3 mg / ml oxaloacetate, 0.1 mg / ml pyruvate sodium and 0.4 IU / ml insulin) solution.

After killing the mice, the spleen is removed aseptically and placed in a culture dish. The cells will be difficulty until the spleen is torn into particulates and most cells are removed. The cells are washed with fresh sterile medium and the mass is allowed to settle.

Splenocytes are washed two more times by centrifugation in serum free medium. During the second wash, myeloma cells are washed in a separate tube. After the final wash, the two cell pellets are combined and centrifuged once again.

Slowly join 50% polyethylene glycol (PEG) solution into the cell pellet while resuspending the cells for a total of 2 minutes. Add 10 ml preheating medium to the cell solution and stir slowly for 3 minutes. Cells are centrifuged and supernatant removed. Cells are resuspended in 10 ml medium supplemented with 20% fetal calf serum, 1 × OPI solution and 1 × AH solution (58 μM azaserine, 0.1 mM hyposporine). The fused cells are added dropwise into 96-well plates and incubated at 37 ° C. for 1 week.

Supernatants from each well are taken aseptically and collected. This pooled solution is tested for responsiveness to the immunized antigen. When positive wells are identified, cells are transferred from 96 well plates to 0.5 ml medium 24-well plates supplemented with 20% fetal calf serum, 1 × OPI and 1 × AH. At this stage the cells are subcloned so that the single antibody producing cells are in culture.

According to the above process, chimeric non-human hosts, particularly rat hosts, are produced so that they can be immunized to produce human antibodies or analogs specific for immunogens. In this way the problems associated with obtaining human monoclonal antibodies are avoided because the gene transfer host is immunized with immunogens that are not available in human hosts. In addition, enhancer injections and adjuvants may be provided that are not acceptable in human hosts. Fish B-cells can be used for permanence for the continuous production of the desired antibodies. Permanent cells can be used for isolation of genes encoding immunoglobulins or analogs and are subject to further molecular modification by methods such as in vitro mutations or other techniques to modify the properties of the antibody. Such modified genes may be returned to the persistent cells by metastatic infection to provide a continuous mammalian cell source of the required antibody. The present invention provides a convenient source of human antibodies wherein the human antibodies are produced in a similar manner to produce antibodies in human hosts. Animal host cells provide for rearrangement and activation of human DNA in host cells for the production of human antibodies.

According to the present invention, human antibodies can be immunized to host mammals with human immunogens to produce proteins as human immunogens, for example. The resulting anti-serum is specific for human immunogens and can be obtained from host serum. Immunized host B cells are used for permanence, such as myeloma cell fusion, metastasis, and the like, providing perpetual cells such as hybridomas to produce monoclonal antibodies. Antibodies, antisera and monoclonal antibodies may be glycosylated depending on the cell species producing the antibody. Rarely different portions of the Ig locus are pooled again to produce the antibody and rarely antibodies having various portions are obtained.

Claims (14)

A method of increasing the colony ratio of fused cells comprising a desired genomic component, wherein the fusion of an untransformed animal cell comprising the desired genomic component with a cell line of a transformed cell line that is sensitive to predetermined media conditions Fusion cells are generated by this method, Providing a marker for overcoming the cell sensitivity of the cell line transformed with medium conditions to the genomic component of the litter; Mixing the cells of the transformed cell line with the untransformed animal cells under conditions that promote fusion to obtain a fusion mixture; Selecting fused cell colonies by culturing the fusion mixture at the predetermined medium conditions; -Screening for successful colonies for the presence of desired genomic components. The method of claim 1, wherein the label is HPRT and the medium condition comprises HAT medium. The method of claim 1, wherein the marker is a neomycin resistance gene and the medium condition consists of the presence of G418. The method of claim 1, wherein the desired genomic component is a pair of immunoglobulin loci, one heavy chain and one light chain, and the untransformed cells are B cells. The method of claim 4, wherein the pair of immunoglobulin loci are expressed to produce an antibody that is immunoreactive with the target antigen. The method of claim 1, wherein the transformed cells are myeloma cell lines. The method of claim 1 wherein the conditions that promote fusion consist of the presence of polyethylene glycol. In an improvement of a method of increasing the clonal ratio of fused cells comprising a desired genomic component, wherein the non-transformed animal cell comprising the desired genomic component and a cell line of a transformed cell line sensitive to predetermined media conditions Fusion cells are produced by fusion with, Mixing the cells of the transformed cell line with the untransformed animal cells under conditions that promote fusion to obtain a fusion mixture; Selecting fused cell colonies by culturing the fusion mixture at the predetermined medium conditions; -A method of improvement characterized in that successful colonies are selected for the presence of the desired genomic component, wherein the improvement consists in providing the desired genomic component with a marker that cells of the cell line transformed with the medium conditions can overcome sensitivity. 9. The method of claim 8, wherein the label is HPRT and the medium condition consists of HAT medium. The method of claim 8, wherein the marker is a neomycin resistance gene and the medium condition consists of the presence of G418. 9. The method of claim 8 wherein the desired genomic component is a pair of immunoglobulin loci, one heavy chain and one light chain, and the untransformed cells are B cells. The method of claim 11, wherein the pair of immunoglobulin loci are expressed to produce an antibody that is immunoreactive with the target antigen. The method of claim 8, wherein the transformed cells are myeloma cell lines. 9. The method of claim 8, wherein the conditions that promote fusion consist of the presence of polyethylene glycol.