KR102671456B1 - Pharmaceutical composition for preventing or treating tumors comprising miR-16-5p and somatostatin analogs - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating tumors, comprising a somatostatin analog and miR-16-5p that regulates somatostatin receptor (SSTR) expression, and its use.
The miR-16-5P induces the expression of the somatostatin receptor, and the somatostatin analog binds to the somatostatin receptor to inhibit tumor growth, thereby greatly improving tumor prevention and treatment effects and strengthening resistance.

Description

Pharmaceutical composition for preventing or treating tumors comprising miR-16-5p and somatostatin analogs}

The present invention relates to a pharmaceutical composition for preventing or treating tumors comprising miR-16-5p and a somatostatin analog, and more specifically, to a pharmaceutical composition for the prevention or treatment of tumors comprising miR-16-5p and a somatostatin analog, which enhances the anti-tumor activity of the somatostatin analog through increasing the expression of somatostatin receptor 2. It relates to a pharmaceutical composition for preventing or treating tumors containing -5p as an active ingredient.

Somatostatin (SST), a growth hormone release-inhibiting hormone produced in the hypothalamus, is a small polypeptide hormone that mainly regulates endocrine function by suppressing the secretion of hormones and neurotransmitters and inhibits tumor cell growth. Inhibits tumor growth by regulating survival and angiogenesis. Somatostatin binds with high affinity to somatostatin receptors (SSTR1-5), which are specific G protein-coupled receptors present on the cell surface.

Meanwhile, in relation to tumors (e.g., neuroendocrine tumors, NETs) that secrete hormones that cause specific clinical syndromes, causing serious disability and reducing quality of life, somatostatin receptor mRNA and protein expression patterns are The somatostatin receptor has been extensively studied and used as a potential tumor diagnostic and therapeutic target.

Somatostatin analogs (SSA), such as octreotide and lanreotide, are analogs with a significantly increased half-life compared to natural somatostatin and are suitable for clinical application. Similar to natural somatostatin, somatostatin analogs bind to the somatostatin receptor, but have different binding affinities for various receptors. For example, octreotide and lanreotide bind to somatostatin receptor 2 (SSTR2) with high affinity and then bind to somatostatin receptor 5 (SSTR5) to activate inhibitory signals.

Therefore, a positive correlation exists between the antitumor efficacy of somatostatin analogs and somatostatin receptor 2 expression. However, limited studies have investigated the mechanisms that enhance antitumor effects by enhancing somatostatin receptor expression.

Acute administration of somatostatin induces activation of various inhibitory signals but reduces the initial response to somatostatin analogues. Continued exposure to somatostatin analogs reduces the initial drug effect through processes such as degradation, internalization, and phosphorylation of somatostatin analogs. (J Biol Chem. 1997; 272(39):24448-54.)

MicroRNA (miRNA) is a type of non-coding RNA consisting of 21 to 25 nucleotides. MiRNAs are closely related to the regulation of various signaling pathways and several biological functions, including cell proliferation, differentiation, survival, and metabolism. MiRNAs function by binding to complementary target mRNAs, resulting in mRNA translation inhibition or degradation.

Recently, differentially expressed miRNAs were identified between somatostatin analog responders and non-responders in pituitary adenomas that secrete growth hormone. (Diagn Pathol. 2010; 5:79.)

However, further studies are currently needed to determine the effectiveness of miRNA-mediated control of somatostatin receptor 2 expression and the subsequent effects on somatostatin drug sensitivity in tumors.

For example, octreotide, a conventional treatment for neuroendocrine tumors (NET), inhibits tumor growth by binding to the somatotropin receptor, but the expression of the somatostatin receptor is reduced in some patients, so it is not suitable for treatment. There was a problem of reduced effectiveness.

Therefore, the present inventors made diligent efforts to develop a novel tumor treatment that can effectively act even in patients with reduced therapeutic effects on somatostatin analogs. As a result, we found that miR-16-5p increases the expression of somatostatin receptors and increases the responsiveness of somatostatin analogs. The present invention was completed by confirming that improvements can be made.

Hofland LJ, Lamberts SW. The pathophysiological consequences of somatostatin receptor internalization and resistance. Endocr Rev. 2003; 24(1):28-47. Epub 2003/02/18. https://doi.org/10.1210/er. 2000-0001 PMID: 12588807. Mao ZG, He DS, Zhou J, Yao B, Xiao WW, Chen CH, et al. Differential expression of microRNAs in GHsecreting pituitary adenomas. Diagn Pathol. 2010; 5:79. Epub 2010/12/09. https://doi.org/10.1186/1746-1596-5-79 PMID: 21138567; PubMed Central PMCID: PMC3017030.

The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating new tumors containing miR-16-5p and a somatostatin analog, and a method for providing information for preventing or treating tumors.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating tumors, comprising miR-16-5p and somatostatin analogs (SST analogs, SSA) or pharmaceutically acceptable salts thereof as active ingredients. .

In the present invention, the somatostatin analog may be selected from the group consisting of octreotide, lanreotide, and pasireotide.

In the present invention, the tumor is cancer expressing somatostatin receptor 2, neuroendocrine tumor, small cell lung cancer, breast cancer, prostate cancer, prostate cancer, or cancer. It may be characterized as colorectal carcinoma.

In the present invention, the miR-16-5p may be selected from the group consisting of pri-miRNA, precursor miRNA, plasmid-type miRNA, and mature miRNA.

In the present invention, the miR-16-5p may be characterized as being a miR-16-5p derivative.

In the present invention, the miR-16-5p can be isolated and injected naturally, or the production of the miR-16-5p can be induced within cells, or it can be artificially synthesized and injected in vivo. There will be.

In the present invention, the miR-16-5p derivative (i) partially has a phosphorothioate structure in which the RNA phosphate backbone structure is replaced with another element (e.g., sulfur, etc.) (ii) the RNA is fully or partially replaced by DNA, petide nucleic acids (PNAs), and/or locked nucleic acid (LNA) molecules, or the 2' hydroxyl group of the sugar in the RNA is functionally structural (e.g., methylated, methoxylated, or methylated). It can be characterized as being substituted with (orhwa).

In the present invention, the miR-16-5p may be characterized as increasing the expression of somatostatin receptor 2.

In the present invention, the composition may be characterized as exhibiting anti-tumor activity in octreotide-non-responsive patients with tumors.

In the present invention, the composition may be characterized as exhibiting anti-tumor activity in patients with (i) resistance to octreotide and/or (ii) reduced somatostatin receptor expression.

The invention also provides a method for measuring octreotide reactivity in a sample isolated from a patient, (b) comparing the reactivity to octreotide in a normal control, and (c) determining the reactivity of the patient to octreotide. Information for the prevention or treatment of tumors, including the step of evaluating patients as suitable for administration of the composition of any one of claims 1 to 6 when the reactivity is reduced compared to the reactivity to octreotide in the normal control group. Provides a method to provide .

In the present invention, the patient has (i) resistance to octreotide; and/or (ii) the patient may have reduced somatostatin receptor expression.

The pharmaceutical composition comprising miR-16-5p and a somatostatin analog (e.g., octreotide) according to the present invention improves sensitivity to somatostatin analogs by upregulating the expression of somatostatin receptor 2, somatostatin analog treatment. Tumors with reduced responsiveness to It has the advantage of improving the anti-tumor effect in patients or patients with tumors with reduced somatostatin receptor expression, and can be applied to patients who do not respond to somatostatin analogs in which conventional treatment effects are not effective.

Figure 1 shows the results showing the expression of somatostatin receptor 2 (SSTR2) after treatment with octreotide in INS-1 cells. Figure 1A shows INS-1 cells incubated with 1 μmol/L octreotide and somatostatin receptor 2 and β-actin levels analyzed by Western blotting after the indicated times. Figure 1B shows INS-1 cells were plated on coverslips in 24-well plates, and the next day, the cells were cultured with 1 μmol/L octreotide for the indicated times, and then the cells were fixed. and immunofluorescence staining of somatostatin receptor 2 protein. (Scale bar: 20μm)
Figure 2 shows the results of analyzing miRNA expression using microarray. Figure 2A shows the number of differentially expressed miRNAs through miRNA profiling, and Figure 2B shows the profile of differentially expressed miRNAs through miRNA profiling. Red indicates significantly up-regulated miRNAs, and green indicates down-regulated miRNAs. Figure 2C shows the results of measuring the level of miR-16-5p by qRT-PCR after isolating total RNA from INS-1 cells cultured with 1μmol/L octreotide after the indicated culture time, and Figure 2D shows the results of measuring the level of miR-16-5p with 1μmol/L octreotide. The results show the results of measuring the level of miR-16-5p by qRT-PCR after isolating total RNA from GH3 cells cultured with /L octreotide after the indicated incubation time. Control miRNA (U87) was used to normalize to input RNA using the 2 ^-△△Ct method, and each data represents the mean ± SD of three independent experiments. (*p <0.05, **p <0.01)
Figure 3 shows the results showing the expression of somatostatin receptor 2 (SSTR2) after treatment with miR-16-5p mimic or inhibitor in INS-1 cells. INS-1 cells were transfected with 50 or 100 pmol of mimic miR-16-5p or control miRNA. Figure 3A shows the results of measuring miR-16-5p levels by RT-qPCR at 48 hours after transfection. The miRNA expression of target genes was calculated by the 2 ^-△△Ct method using the endogenous control miRNA (U87) and normalized to the input RNA. Figure 3B shows the results of analyzing the levels of somatostatin receptor 2, phospho-ERK (Thr202 / Tyr204), ERK, and β-actin by Western blotting. Figure 3C shows INS-1 cells were plated on coverslips in 24-well plates, transfected with 100 pmol of mimic miR-16-5p or control miRNA, and the cells were fixed 48 hours later. The results of immunofluorescence staining of somatostatin receptor 2 protein are shown. (Scale bar: 20 μm) Figure 3D shows the fluorescence intensity of somatostatin receptor 2 measured using IMT i-Solution Industrial Image Analysis Software. Figure 3E shows the results of treating INS-1 cells with 1 or 10 nmol/L of a miR-16-5p inhibitor or a negative control, and measuring the level of miR-16-5p by qRT-PCR 24 hours later. Figure 3F shows the results of analyzing the levels of somatostatin receptor 2, phospho-ERK (Thr202 / Tyr204), ERK, and β-actin by Western blotting.
Figure 4 shows the results confirming the upregulation of somatostatin receptor 2 expression in INS-1 cells after treatment with octreotide along with mimic miR-16-5p. Figure 4A shows INS-1 cells were transfected with 100 pmol of mimic miR-16-5p or control miRNA for 24 h and then treated with 1 μmol/L octreotide for the indicated periods, after which the cells were fixed and incubated for somatostatin receptor 2 protein. The results of immunofluorescence staining are shown. (Scale bar: 20 μm) Figure 4B shows the fluorescence intensity of somatostatin receptor 2 measured with IMT i-Solution Industrial Image Analysis Software.
Figure 5 shows the results of confirming the sensitivity of INS-1 cells to octreotide after treatment with octreotide along with mimic miR-16-5p. Figure 5A shows the results of INS-1 cells transfected with 2.5 pmol of mimic miR-16-5p or control miRNA for 24 hours and treated with the indicated concentrations of octreotide for 24 hours. Cell proliferation was measured by CCK-8 assay. Figure 5B shows the results of treating spheroids of mimic miR-16-5p or control transfected INS-1 cells with octreotide for 48 hours. The proliferation of six spheroids was measured by CellTiter-Glo13D Cell Viability Assay. Each data represents the mean ± SD of three independent experiments. (*p <0.05, **p <0.01)
Figure 6 is a result showing the expression of somatostatin receptor 2 in INS1 and GH3 cells. Figure 6A shows the results of immunofluorescence staining of somatostatin receptor 2 protein after INS1 and GH3 cells were plated on coverslips and the cells were fixed 24 hours later, and Figure 6B shows the results of counterstaining with DAPI.
Figure 7 shows the results confirming the expression of somatostatin receptor 2 after treatment with has-miR-16-5p inhibitor in HeLa cells transfected with human somatostatin receptor 2 (hSSTR2). HeLa cells were transfected with 1 μg of hSSTR2 or control plasmid for 24 h and then treated with the indicated concentrations of has-miR16-5p inhibitor. Figure 7A shows the results of fixing cells and immunofluorescence staining of somatostatin receptor 2 protein (scale bar: 50 μm). Figure 7B shows the expression level of has-miR-16-5p measured by qRT-PCR after 24 hours of treatment. Each data represents the mean ± SD of three independent experiments.
Figure 8 shows the results confirming the expression of ARRB1 after treatment with miR-16-5p in INS1 cells. Figure 8A shows ARRB1 expression levels measured by qRT-PCR after transfection of Ins1 cells with mimic miR-16-5p or control and treatment for 24 hours. Figure 8B shows the ARRB1 expression level measured by qRT-PCR 24 hours after treating the Ins1 cells in Figure 8A with the miR16-5p inhibitor or control. Each data represents the mean ± SD of three independent experiments.
Figure 9 shows the results of cell death analysis by Annexin V-APC/propidium iodide (PI) double staining of INS1 cells after treatment with octreotide and mimic miR-16-5p under the indicated conditions. Two-color flow cytometry dot plots show the percentage of viable cells that are both negative for annexin V and PI. Early apoptotic cells were Annexin V-positive and PI-negative, and late apoptotic/necrotic cells were double positive cells.
Figure 10 shows the results of INS-1 cells transfected with 100 pmol of mimic miR-16-5p or control miRNA for 24 hours and treated with 10 nmol/L octreotide for 24 hours. Spheroids were fixed with 4% PFA overnight at 4°C and then subjected to immunofluorescence staining for somatostatin receptor 2 protein. (Scale bar: 100μm)

Hereinafter, the present invention will be described in detail.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

Somatostatin analogs (SST analogs, SSA) are used to treat tumors, inhibit hormone secretion, or promote tumor shrinkage.

Meanwhile, the absence or low expression of somatostatin receptors in neuroendocrine tumors is a major cause of neuroendocrine tumor resistance to somatostatin analogs. However, the expression patterns of miRNAs related to somatostatin analogs and dysregulation of miRNAs during the initial response to somatostatin analogs are unclear. Little is known so far.

Accordingly, in the present invention, we identified miRNAs related to the initial response to treatment with octreotide, a somatostatin analog, through miRNA profiling. As a result, regulation of the level of miR-16-5p was found to affect somatostatin receptor 2 expression and cell sensitivity to somatostatin analogs. was found to have an impact.

Specifically, an in vitro experiment was performed to determine whether the expression of miR-16-5p is related to the regulation of somatostatin receptor 2 expression and whether the expression of miR-16-5p affects octreotide sensitivity in INS-1 cells. proceeded. Overexpression of miR-16-5p by transfected somatostatin analogs induced upregulation of somatostatin receptor 2 expression. Additionally, expression of miR-16-5p improved octreotide unresponsiveness, which induced cell proliferation in both 2D and 3D cultures of INS-1 cells.

After treating cells with somatostatin analogs for a short period of time, we confirmed the expression pattern of miRNAs, and after a short incubation with octreotide, we confirmed the upregulation of miRNAs related to antitumor effects through KEGG analysis.

We were able to identify 30 differentially expressed miRNAs related to 9 pathways. Among them, “cancer-related microRNA” and “MAPK signaling pathway” were the most prominent. Inhibition of cell proliferation by somatostatin analogs through the somatostatin receptor involved multiple signaling pathways, including control of the ERK/MAPK pathway. Induction of ERK/MAPK pathway activation by upregulation of somatostatin receptor 2 by miR-16-5p suggests that regulation of somatostatin receptor 2 by miR-16-5p affects downstream signaling. suggests.

Therefore, the present inventors were able to identify miRNAs involved in both the early regulation of somatostatin receptor 2 expression and the antitumor effect of octreotide.

Internalization and intracellular exchange of somatostatin receptor 2 are involved in somatostatin receptor desensitization. As a result of immunostaining, overexpression of miR-16-5p was able to induce not only an increase in basal somatostatin receptor 2 expression but also internalization of somatostatin receptor 2 under octreotide exposure compared to the control group. In fact, miR-16-5p regulation in INS-1 cells also affected the level of Arrb1 mRNA, suggesting that miR-16-5p is involved in SSTR2 internalization and desensitization (Figure 8).

In the present invention, we identified a novel role of miR-16-5p in regulating the expression of somatostatin receptor 2 in tumor cells and found that upregulation of miR-16-5p improved the sensitivity of somatostatin analogs in INS-1 cells for tumor treatment. The possibility of using miR-16-5p and somatostatin analogs as a new combination therapy was confirmed. In addition, desensitization and downregulation of somatostatin receptor 2 after somatostatin analogue treatment are clinically important, and the ability to regulate somatostatin receptor expression through miR-16-5p in tumor patients is clinically useful for tumor prevention and treatment. It could be.

Accordingly, in one aspect, the present invention relates to a pharmaceutical composition for preventing or treating tumors, which includes miR-16-5p and a somatostatin analog or a pharmaceutically acceptable salt thereof as active ingredients.

The present invention may additionally include a pharmaceutically acceptable carrier and may be formulated together with the enclosure.

In the present invention, the somatostatin analog may be selected from the group consisting of octreotide, lanreotide, and pasireotide, but is not limited thereto.

In the present invention, the tumor is cancer expressing somatostatin receptor 2, neuroendocrine tumor, small cell lung cancer, breast cancer, prostate cancer, prostate cancer, or colorectal cancer. It may be characterized as (colorectal carcinoma), but is not limited thereto.

In the present invention, the miR-16-5p may be selected from the group consisting of pri-miRNA, precursor miRNA, plasmid-type miRNA, and mature miRNA, but is not limited thereto.

In the present invention, the miR-16-5p may be characterized as being a miR-16-5p derivative, but is not limited thereto.

The miR-16-5p can be isolated and injected naturally, or the production of the miR-16-5p can be induced within cells, or it can be artificially synthesized and injected into the body.

In the present invention, the miR-16-5p derivative (i) partially has a phosphorothioate structure in which the RNA phosphate backbone structure is replaced with another element (e.g., sulfur, etc.) Contains; (ii) the RNA is completely or partially replaced by DNA, petide nucleic acids (PNA) and/or locked nucleic acid (LNA) molecules; The 2' hydroxyl group of the sugar in the RNA may be characterized as being replaced with a functional structure (e.g., methylation, methoxylation, fluorination), but is not limited thereto.

In the present invention, the miR-16-5p may be characterized as increasing the expression of somatostatin receptor 2, but is not limited thereto.

In the present invention, the composition may be characterized as exhibiting anti-tumor activity in octreotide-non-responsive patients with neuroendocrine tumors, but is not limited thereto.

In the present invention, “anti-tumor activity” can be used interchangeably with “enhancement of anti-tumor effect”, and in one embodiment, the enhancement of anti-tumor effect by use of miRNA according to the present invention is compared to the use of octreotide alone. This may mean that anti-tumor activity is increased, and especially in patients who are non-responsive to octreotide, it may mean that the therapeutic effect of octreotide can be exerted or the low therapeutic effect can be further improved. In the present invention, the enhancement of the anti-tumor effect is achieved by increasing the anti-tumor effect by 10 to 500%, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, compared to the use of octreotide alone. , may mean enhanced by more than 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, or 500%, but is not limited thereto.

In the present invention, the composition has (i) resistance to octreotide; and/or (ii) showing anti-tumor activity in patients with reduced somatostatin receptor expression, but is not limited thereto.

In the present invention, “reduced somatostatin receptor expression” means that the somatostatin receptor is not expressed at all or that the amount of somatostatin receptor expression is reduced compared to patients who responded to octreotide.

In another aspect, the present invention provides the steps of (a) measuring octreotide reactivity from a sample isolated from a patient, (b) comparing the reactivity to octreotide reactivity of a normal control, and (c) the octreotide reactivity of the patient. Prevention of a tumor comprising evaluating a patient suitable for administration of the composition of any one of claims 1 to 6 when the reactivity to octreotide is reduced compared to the reactivity to octreotide of a normal control group; or It is about how to provide information for treatment.

In the present invention, the patient may be characterized as having (i) resistance to octreotide and/or (ii) reduced somatostatin receptor expression.

In the present invention, the term “prevention” relates to averting, delaying, impeding or hindering the disease.

As used herein, the term “treatment” relates to caring for a subject suffering from a disease in order to improve, cure or reduce the symptoms of the disease or to reduce or stop the progression of the disease.

In the present invention, the term “pharmaceutical composition” refers to a mixture comprising miR-16-5p and/or octreotide or an acceptable salt thereof according to the present invention and a pharmaceutically acceptable excipient such as a diluent or carrier. means. Pharmaceutical compositions include cosmetic compositions as well as compositions for therapeutic use. According to some embodiments, a method of administering a pharmaceutical composition comprising the composition of the present invention to a subject as needed is provided. In some embodiments, compositions of the present invention can be administered to humans.

In the present invention, the description of pharmaceutical compositions principally relates to pharmaceutical compositions for administration to humans, but those skilled in the art will understand that such compositions are generally suitable for administration to all types of animals. A skilled veterinary pharmacologist who has a good understanding of the modifications of pharmaceutical compositions for administration to various animals can design and/or perform such modifications, if necessary, simply by routine experimentation.

In the present invention, the pharmaceutical composition may be prepared by any method known in the field of pharmacology or as discussed later in the text. Generally, these methods for tableting involve the steps of associating the active ingredient with excipients and/or one or more other auxiliary ingredients, followed by shaping and/or packaging the product into the desired single- or multi-dose units, if necessary or desired. Includes steps.

In the present invention, the pharmaceutical composition may be manufactured, packaged, and/or sold unpackaged as a single unit dose and/or multiple single unit doses. As used herein, a “unit dose” is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of active ingredient is generally equal to the dose of active ingredient administered to the subject and/or a convenient fraction of such dose, such as one-half or one-third of the dose.

In the present invention, the relative amounts of the active ingredient, pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical composition will vary depending on the identity, size, and/or disorder of the subject being treated and depending on the route by which the composition is administered. will be. By way of example, the composition may include 0.1% to 100% (w/w) active ingredient.

In the present invention, a pharmaceutically acceptable excipient is any solvent, dispersion medium, diluent, or other liquid vehicle, dispersion or suspension aid, surface active agent, isotonic agent, thickener or emulsifier, preservative, solid binder suitable for the purpose of the particular dosage form. , lubricants, etc. Remington's (The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, (Lippincott, Williams & Wilkins, Baltimore, MD, 2006) describes various excipients used in the preparation of pharmaceutical compositions and known methods for their preparation. The technology discloses that any conventional carrier medium is incompatible with the substance or derivative thereof, such as by imparting any undesirable biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition. and the pharmaceutically acceptable excipients are considered to be within the scope of the present invention and are at least 95%, 96%, 97%, 98%, 99%, or 100% pure.

The excipients are approved for human and veterinary use. In some embodiments, the excipient is approved by the Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia (EP).

In some embodiments, excipients are approved for human and veterinary use. In some embodiments, the excipient is approved by the Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia (EP).

Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersants and/or granulating agents, surface active agents and/or emulsifiers, disintegrants, binders, preservatives, buffers, lubricants, and/or oils. Not limited.

Such excipients may optionally be included in the formulations of the present invention. Excipients such as cocoa butter and suppository waxes, colorants, coating agents, sweeteners, flavors, and perfumers may be present in the composition at the discretion of the formulator.

Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dried starch, Including, but not limited to, corn starch, powdered sugar, and combinations thereof.

Exemplary granulating and/or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponges, cation-exchange resins. , Calcium Carbonate, Silicate, Sodium Carbonate, Cross-Linked Poly(vinyl-pyrrolidone) (Crospovidone), Sodium Carboxymethyl Starch (Sodium Starch Glycolate), Carboxymethyl Cellulose, Cross-Linked Sodium Carboxymethyl Cellulose ( croscarmellose), methylcellulose, pregelatinized starch (Starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (vegeum), sodium lauryl sulfate, quaternary ammonium compounds, and these. Including, but not limited to, combinations of.

Exemplary surface active agents and/or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and veegum [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol) , triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxyvinyl polymers), carrageenans, cellulose derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxymethylcellulose) Ethylene Sorbitan Monolaurate [Tween 20], Polyoxyethylene Sorbitan [Tween 60], Polyoxyethylene Sorbitan Monooleate [Tween 80], Sorbitan Monopalmitate [Span 40], Sorbitan Monostearate [ span 60], sorbitan tristearate [span 65], glyceryl monooleate, sorbitan monooleate [span 80]), polyoxyethylene ester (e.g. polyoxyethylene monostearate [mirz 45]) , polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor), polyoxyethylene ethers, ( For example, polyoxyethylene lauryl ether [Brise 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl. Including, but not limited to, lauray, sodium lauryl sulfate, pluronic F 68, poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and/or combinations thereof. No.

Exemplary binders include starches (e.g. corn starch and starch paste); gelatin; sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); Natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, Farnwer gum, Shatty gum, Isapol Husk's slime, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl) cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (bigum), and lachi arabogalactan); alginate; polyethylene oxide; polyethylene glycol; inorganic calcium salt; silicic acid; polymethacrylate; wax; water; Alcohol; and combinations thereof.

Exemplary preservatives may include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, bisulfite. Including, but not limited to, sodium sulfate, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, disodium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate. . Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, Includes, but is not limited to, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include, but are not limited to, butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxyme mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluende (BHT), ethylenediamine, sodium lauryl sulfate (SLS), Sodium Lauryl Ether Sulfate (SLES), Sodium Bisulfite, Sodium Metabisulfite, Potassium Sulfite, Potassium Metabisulfite, Glydant Plus, Fenonib, Methylparaben, Low Mol 115, Germaben II, Neolon, Katon, and E Including, but not limited to, Uxil. In certain embodiments, the preservative is an antioxidant. In another embodiment, the preservative is a chelating agent.

Exemplary buffering agents include citrate buffer solution, acetate buffer solution, phosphate buffer solution, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium gluvionate, calcium gluceptate, calcium gluconate, D-gluconic acid, glyceroside. Calcium phosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dibasic potassium phosphate, monobasic Basic potassium phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixture, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen -Includes, but is not limited to, free water, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof.

Exemplary lubricants include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium. Including, but not limited to, lauryl sulfate, and combinations thereof.

Exemplary oils include almond, apricot kernel, avocado, babassu palm, bergamot, black currant seed, borage, cayenne, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee. , corn, cotton seed, emu, eucalyptus, evening primrose, fish, flax seed, geraniol, pumpkin, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litthea cucumber. beba, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange-orange rappi, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower. Including, but not limited to, sandalwood, sasquana, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oil. Exemplary oils include butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil. , and combinations thereof.

Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, liquid dosage forms may contain inert diluents such as, for example, water or other solvents, solubilizers and emulsifiers commonly used in the art such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl. Alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, sprout, olive, castor, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, It may also include polyethylene glycol and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. In certain embodiments for parenteral administration, miR-16-5p and/or octreotide or an acceptable salt thereof according to the invention may be dissolved in a solubilizing agent such as cremophor, alcohol, oil, denatured oil, glycol, polysorbate. , cyclodextrins, polymers, and combinations thereof.

Injectable preparations, for example sterile injectable aqueous or oily suspensions, may be prepared according to the art using dispersing or wetting agents and suspending agents. The sterile injectable preparation may be a sterile injectable solution, suspension or emulsion in a non-toxic parenterally acceptable diluent or solvent, such as solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. Additionally, sterile, fixed oils are commonly employed as solvents or suspending media. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. Additionally, fatty acids such as oleic acid have been used in the preparation of injectables.

Injectable preparations may be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. .

To prolong the effect of a drug, it is often desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This is achieved by using liquid suspensions of crystalline or amorphous substances with low water solubility. The absorption rate of the drug then depends on the dissolution rate, which may ultimately depend on the crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug is achieved by dissolving or suspending the drug in an oil vehicle.

Dosage forms for topical and/or transdermal administration of miR-16-5p and/or octreotide or acceptable salts thereof according to the present invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and/ Alternatively, it may include patches. Generally, the active ingredient is admixed under conditions of sterility with a pharmaceutically acceptable carrier and/or any necessary preservatives and/or buffering agents that may be required. Additionally, the present invention contemplates the use of transdermal patches, which often have the additional advantage of providing controlled delivery of the active ingredient to the body. Such dosage forms can be prepared, for example, by dissolving and/or dispersing the active ingredient in a suitable medium. Alternatively or additionally, the rate may be controlled by providing a rate controlling membrane and/or dispersing the active ingredient in a polymer matrix and/or gel.

Formulations for topical administration include, but are not limited to, liquid and/or semi-liquid preparations such as liniments, lotions, oil-in-water and/or water-in-oil emulsions such as creams, ointments/or pastes, and/or solutions and/or suspensions. Although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent, topically-administrable formulations may also comprise, for example, from about 1% to about 10% (w/w) of the active ingredient. Formulations for topical administration may further comprise one or more additional ingredients described herein.

The miR-16-5p and/or octreotide or acceptable salts thereof according to the present invention are typically prepared in dosage unit form for easy administration and uniform administration. However, it will be understood that the total daily usage of the composition of the present invention will be determined by the attending physician within the scope of sound medical judgment. The particular therapeutically effective dose level for any particular subject will depend on a variety of factors, including the disease, disorder, or disorder being treated and the severity of the disorder; the activity of the specific active ingredient employed; the specific composition employed; The subject's age, weight, general health, gender, and diet; the time of administration, route of administration, and rate of excretion of the particular active ingredient employed; duration of treatment; Drugs used in combination or simultaneously with the specific active ingredients employed; and factors well known in the medical field.

miR-16-5p and/or octreotide or an acceptable salt thereof according to the present invention may be administered by any route. In some embodiments, miR-16-5p and/or octreotide or an acceptable salt thereof may be administered orally, intravenously, intramuscularly, intraarterially, intramedullarily, intrathecally, subcutaneously, intracerebroventricularly, transdermally, intradermally, rectally, intravaginally, intraperitoneally, topically (by powder, ointment, cream, and/or drop), mucosal, nasal, oral, enteral, sublingual; endotracheal instillation, bronchial instillation, and/or inhalation; and/or administered by various routes, including oral spray, nasal spray, and/or aerosol. Particularly contemplated routes are permeable intravenous injection, local administration via the blood and/or lymphatic supply, and/or direct administration to the affected area. In general, the most appropriate route of administration will depend on a variety of factors, including the properties of the agent (e.g., stability in the environment of the gastrointestinal tract), and the disorder of the subject (e.g., whether the subject can tolerate oral administration). will be. Currently, oral and/or nasal spray and/or aerosol routes are most commonly used to deliver therapeutic agents directly to the lungs and/or respiratory system. However, the present invention encompasses the delivery of the pharmaceutical composition according to the invention by any suitable route taking into account advances in the field of drug delivery.

In certain embodiments, miR-16-5p and/or octreotide or an acceptable salt thereof according to the present invention is administered in an amount of about 0.001 mg/kg to about 100 mg/kg, about 0.01 mg/kg to about 50 mg/kg of body weight of the subject daily. mg/kg, about 0.1 mg/kg to about 40 mg/kg, about 0.5 mg/kg to about 30 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 10 mg/kg kg, or about 1 mg/kg to about 25 mg/kg, may be administered at a dosage level sufficient to deliver once or more per day to achieve the desired therapeutic effect. The intended dosage may be delivered three times a day, twice a day, daily, every two days, every three days, weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered via multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more administrations). .

In the present invention, it will be understood that the dosage ranges provide guidance for administration of provided pharmaceutical compositions to adults. For example, the amount administered to a child or adolescent may be determined by a physician or person skilled in the art, and may be less or the same as that administered to an adult. The exact amount of a peptide according to the invention required to achieve an effective amount will vary from subject to subject, depending, for example, on the subject's species, age, and overall disorder, severity of side effects or disorders, identity of the specific compound, mode of administration, etc.

It will be understood that miR-16-5p and/or octreotide or an acceptable salt thereof according to the present invention may be used in combination therapy. The particular combination of treatments (treatments or procedures) for use in combination therapy will take into account the desired therapeutic effect to be achieved and the suitability of the desired treatments and/or procedures.

In the present invention, the pharmaceutical composition can be administered alone or in combination with one or more therapeutically active agents. As for "combination", it is not intended to imply that the agents must be administered at the same time and/or be formulated for delivery together, although the following delivery methods are within the scope of the present invention. The composition may be administered concurrently with, prior to, or subsequent to one or more other therapeutic agents or medical procedures. Generally, each agent will be administered at a dose and/or time schedule established for that agent. Additionally, the present invention provides a pharmaceutical form of the present invention in combination with agents capable of improving its bioavailability, reducing and/or modifying its metabolism, inhibiting its secretion, and/or modifying its distribution within the body. It encompasses delivering the composition. It will be further understood that the miR-16-5p and/or octreotide or an acceptable salt thereof and the therapeutically active agent according to the invention used in this combination may be administered together in a single composition or administered separately in different compositions.

The particular combination used in combination therapy will take into account the desired therapeutic effect to be achieved and/or the suitability of the therapeutically active agents. The combination used may achieve the desired effect for the same disorder (e.g., miR-16-5p and/or octreotide or an acceptable salt thereof according to the invention may be used to treat the same disorder) may be administered in combination with other therapeutically active agents), and/or they may achieve different effects (e.g., control of any side effects).

In the present invention, “therapeutically active agent” refers to any substance used as a medicine to treat, prevent, delay, reduce or ameliorate a disorder, and refers to substances used in treatment, including prophylactic and curative treatments.

In some embodiments, the pharmaceutical compositions of the present invention treat, alleviate, ameliorate, alleviate, delay the onset, inhibit the progression of, reduce the severity of, and/or one or more symptoms or features of cancer. It can be administered in combination with any therapeutically active agent or procedure (e.g., surgery, radiation therapy) useful for reducing the incidence.

In the present invention, the term “pharmaceutically acceptable salt” refers to a salt of a compound that has the desired pharmacological activity of the parent compound, and although it is described as “pharmaceutically,” it is used in food. Possible salts are also included. These are physiologically acceptable and generally do not cause allergic reactions such as gastrointestinal disorders, dizziness, etc. or similar reactions when administered to humans. Salts widely known in the art may be used as the salts, with specially limited salts. That is not the case.

In the present invention, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not irritate living organisms and does not inhibit the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers in compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

The composition for preventing or treating neuroendocrine tumors containing the above-mentioned miR-16-5p and a pharmaceutically acceptable carrier of the present invention can be applied in any formulation containing it as an active ingredient, and can be manufactured as an oral or parenteral formulation. can do. The pharmaceutical formulation of the present invention can be administered orally, rectally, nasally, topically (including cheeks and under the tongue), subcutaneously, vaginally, or parenterally (intramuscularly, subcutaneously). and forms suitable for administration (including intravenous) or forms suitable for administration by inhalation or insufflation.

Formulations for oral administration containing the composition of the present invention as an active ingredient include, for example, tablets, troches, lozenges, water-soluble or oily suspensions, powders or granules, emulsions, hard or soft capsules, syrups or elixirs. can do. To formulate tablets and capsules, lactose, saccharose, sorbitol, mannitol, starch, amylose, etc.

May contain binders such as pectin, cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, and lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax. In the case of a capsule formulation, in addition to the above-mentioned substances, it may further contain a liquid carrier such as fatty oil.

Formulations for parenteral administration containing the composition of the present invention as an active ingredient include injection forms such as subcutaneous injection, intravenous injection, or intramuscular injection, suppository injection, or sprays such as aerosols that allow inhalation through the respiratory tract. It can be formulated as: In order to formulate a formulation for injection, the composition of the present invention can be mixed in water with a stabilizer or buffer to prepare a solution or suspension, and the composition can be formulated for unit administration in ampoules or vials. For injection as a suppository, it can be formulated into a composition for rectal administration such as a suppository or enema containing a common suppository base such as cocoa butter or other glycerides. When formulating for spraying, such as an aerosol, a propellant, etc. may be mixed with additives to disperse the water-dispersed concentrate or wet powder.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it is obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples.

[Example]

Materials and Methods

1-1 Cell culture

INS-1 rat insulinoma cell line and GH3 rat pituitary GH and PRL producing cell line were purchased from Addexbio (San Diego, CA, USA) and Korean Cell Line Bank, respectively. Both cell lines express somatostatin receptor 2 (SSTR2) (Figure 6). INS-1 cells and GH3 cells were incubated with 10% fetal bovine serum, 0.05 mmol/L 2-mercaptoethanol, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cultured in RPMI-1640 (Gibco, Grand Island, NY, USA) and DMEM (Gibco, Grand Island, NY, USA) supplemented with 5% CO ₂ and maintained at 37°. HeLa cells were purchased from the Korean Cell Line Bank and grown in DMEM supplemented with 10% (v/v) fetal bovine serum and 1% (v/v) penicillin-streptomycin. Octreotide was purchased from TOCRIS Bioscience (Bristol, UK) and dissolved in deionized water to prepare a 1mM stock solution. For 3D culture, Costar® Ultra-Low attachment multi-well plates were purchased from Sigma-Aldrich Korea (St. Louis, MO, USA).

1-2 RNA extraction and miRNA synthesis

Total RNA was extracted using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA concentration was measured using a NanoDrop spectrophotometer (DeNovix, Wilmington, DE, USA). MiRNAs were synthesized from 500 ng of total RNA using the miScript II RT Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.

1-3 Library preparation, sequencing and data analysis

For control and test RNA, libraries were constructed using the NEBNext Multiplex Small RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's instructions. 1 μg of total RNA from each sample was used to link adapters, and then cDNA was synthesized using reverse transcriptase with adapter-specific primers. PCR was performed to amplify the library, and then the library was purified using the QIAquick PCR Purification Kit (Qiagen) and AMPure XP beads (Beckman Coulter, Brea, CA, USA). The yield and size distribution of the small RNA library were evaluated by high-sensitivity DNA analysis on an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). High-throughput sequences were generated by single-end 75 sequencing using the NextSeq 500 system (Illumina, San Diego, CA, USA). Sequence reads were mapped using the Bowtie 2 software tool to obtain BAM files (alignment files). The mature miRNA sequence was used as a reference for mapping. Read counts mapped to mature miRNA sequences were extracted from alignment files using bedtools (v2.25.0) and Bioconductor (R development Core Team, 2011) using the R (version 3.2.2) statistical programming language. Afterwards, the expression level of miRNA was determined using the read count. Quantile normalization method was used to compare samples. miRWalk 2.0 was used for miRNA target analysis. DAVID (http://david.abcc.ncifcrf.gov/) was used for functional gene classification.

1-4 Transfection and treatment

HeLa cells (1 x 10 ⁵ cells/well) were plated in 6-well plates. Twenty-four hours later, 1 μg hSSTR2 or control plasmid (Sino Biological, Inc., Eschborn, Germany) was transfected using RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After an additional 24 hours of culture, HeLa cells were treated with miRNA inhibitors. INS1 cells (1 x 10 ⁵ cells/well) were cultured in 6-well plates. Commercial mimic miR-16-5p (synthesized by Genolution, Seoul, Korea) sense (S, sense) 5'-UAGCAGCACGUAAAUUGGCG-3' and antisense (A, antisense), 5'-CGCCAAUAUUUACGUGCUGCUA-3' or negative control siRNA (Genolution) were transfected into INS1 cells. Transfections were performed using RNAiMAX transfection reagent (Invitrogen) according to the manufacturer's instructions. Further analysis was performed after 24-48 hours of incubation.

1-5 Real-time quantitative PCR (RT-qPCR)

To analyze miRNA expression, RT-qPCR was performed on a C1000 ™ Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) using the miScript SYBR Green PCR Kit with miScript miRNA PCR Arrays (Qiagen). Gene expression levels were normalized to the miRTC expression level for the corresponding miRNA sample. The following target miRNAs were quantified using the miScript Primer assay (Qiagen), rno-miR-16-5p (cat no. MS00033229, mature miRNA with UAGCAGCACGUAAAUAUUGGCG sequence and miRTC (MS00000001)). cDNA was synthesized from 500 ng of total RNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). Quantitative RT-PCR was performed using SYBG Green Real-time PCR Master Mix (Toyobo). Gene expression levels were normalized to the beta-2 microglobulin (B2M) mRNA expression level of the corresponding cDNA sample. All PCR primers were purchased from Bioneer (Daejeon, Korea), rARRB1 (forward 5'-ACCTGGATGTCTTGGGTCTG-3' -reverse3'-TAGCCGAGTCAGTG GCTTCT-5', hSSTR2 (forward 5'-TGAGAAGAAGGTCACCCGAAT-3', reverse 3'-AGGACC ACCACAAAGTCAAAC -') and hB2M (forward '-TTACTCACGTCATCCAGCAGA-3', reverse 3'-AGAAAGACCAGTCCTTGCTGA-' primers were used.

1-6 Cell viability assay and flow cytometry

Cell viability was assessed using the CCK8 assay. INS1 cells were seeded in a 96-well plate at 1 x 10 ⁵ cells/ml, cultured for 24 hours, and then treated under various conditions. To measure cell viability, 10 μL/well of CCK8 reagent (Dojindo Laboratories, Kumamoto, Japan) was added to each well, and the plate was incubated at 37 °C for 30 min in a humidified incubator. Absorbance at 440 and 640 nm was measured with a Spectra Max190 microplate reader (Molecular Devices, Sunnyvale, CA, USA). Cell viability on 3D spheroids was assessed by CellTiter-Glo13D cell viability assay (Promega, Madison, WI, USA). To quantify apoptosis, double staining was performed according to the protocol described in the Annexin V-FITC Apoptosis Detection Kit (BD Pharmingen™ Franklin Lakes, NJ, USA). INS1 cells were collected and analyzed after incubation with miR-15-5p analog and octreotide.

1-7 Immunocytochemistry

Cells fixed in 4% paraformaldehyde were blocked with 3% bovine serum albumin for 30 min at room temperature (25–27 °C) and incubated with SSTR2 primary antibody (clone UMBI; 1:500; Abcam, Cambridge, UK) at 4 °C. was cultured overnight. Cells were washed, incubated with appropriate fluorescently conjugated secondary antibodies (1:200; Invitrogen) for 1 h at room temperature, and counterstained with Hoechst (Invitrogen). Afterwards, a cover slip was mounted and the cells were observed under an optical microscope. Images were recorded using an Olympus BX53 microscope with Olympus Cell Sens software (Tokyo, Japan).

1-8 Western blotting

SSTR2 (clone UMBI; 1:500; Abcam) and β-actin (C4; 1:5000; Santa Cruz Biotechnology, Dallas, TX, USA) primary antibodies were used. As secondary antibodies, horseradish peroxidase-labeled rabbit IgG and mouse IgG antibodies were used (GeneTex, Irvine, CA, USA). Protein levels were semiquantified by densitometry by analyzing blots with Image Lab software (Bio-Rad Laboratories).

1-9 Statistical analysis

Paired two-tailed Student's t-test was used to detect significant differences between the two data sets. Differences are considered statistically significant when the p value is <0.05.

Identification of differentially expressed miRNAs in INS-1 cells during early response to octreotide treatment.

The present inventors treated INS-1 cells with 1 μM octreotide for various culture times to identify the miRNAs involved in the initial response of somatostatin receptor 2 (SSTR 2) to octreotide treatment.

As a result, as shown in Figure 1A, somatostatin receptor 2 expression was downregulated after 5 minutes of treatment with 1 μM octreotide.

As confirmed by immunocytochemistry, membranous somatostatin receptor 2 expression was decreased, and perinuclear staining of somatostatin receptor 2 was observed in the cytoplasm, and 5 minutes of incubation was required to identify the miRNA associated with the initial drug response of somatostatin receptor 2. It was confirmed that the time was sufficient (Figure 1B).

Therefore, the present inventors analyzed changes in miRNA after 5 minutes of octreotide treatment. miRNA array analysis showed that 21 miRNAs were downregulated and 9 were upregulated in INS-1 cells treated with octreotide for 5 min compared to 0 min treatment. (absolute fold change > 1.5; Figures 2A and 2B).

Furthermore, KEGG pathway enrichment analysis confirmed that the targets of these miRNAs are associated with cancer, mitogen-activated protein kinase (MAPK) signaling pathway, endocrine, and other factors regulating calcium reabsorption (Table 1).

As confirmed by qPCR, among the 30 differentially expressed miRNAs, miR-16-5p was the most abundant target gene. Similar to the miRNA array results, miR-16-5p was upregulated after 5 min of octriotide treatment in INS-1 cells. (Figure 2C) Using other neuroendocrine cells (GH3 cells) to confirm these results, as shown in Figure 3D, miR-16-5p was also upregulated in GH3 cells after 5 minutes of incubation with octreotide. was able to confirm. These results indicate that octreotide affects the expression of miR-16-5p.

Afterwards, the present inventors investigated the function of miR-16-5p on somatostatin receptor 2 expression after treatment with octreotide.

KEGG pathway p-value #genes #miRNAs MicroRNAs in cancer 1.28E-06 46 19 MAPK signaling pathway 3.38E-05 69 23 FoxO signaling pathway 0.000114 39 18 Endocrine and other factors-regulated calcium reabsorption 0.000366 12 9 Vasopressin-regulated water reabsorption 0.000413 15 10 Gap junction 0.000413 25 11 Proteoglycans in cancer 0.000498 50 20 Transcriptional misregulation in cancer 0.000795 44 19 Wnt signaling pathway 0.001226 39 17 Pathways in cancer 0.001711 83 23 Mucin type O-Glycan biosynthesis 0.004161 6 6 Sphingolipid metabolism 0.004161 15 11

Confirmation of the regulatory effect of miR-16-5p on somatostatin receptor 2 expression

To investigate the effect of miR-16-5p on SSTR2 expression, the present inventors transfected INS-1 cells with mimic miR-16-5p and confirmed the upregulation of miR-16-5p expression by RT-qPCR. (Figure 3A).

Interestingly, the results showed that total SSTR2 expression was significantly upregulated with increasing levels of miR-16-5p (Figure 3B), and the pERK/ERK ratio was upregulated in miR-16-5p-overexpressing INS-1 cells (Figure 3B). 3B). Phosphorylation of ERK1/2 is mainly associated with SSTR2 activation.

Increased localization of somatostatin receptor 2 was examined using immunocytochemistry. As a result, both membrane and cytoplasmic expression of somatostatin receptor 2 were upregulated in mimic miR-16-5p-transfected cells (Figure 3C and Figure 3D).

The present inventors additionally used a miR-16-5p inhibitor to downregulate miR-16-5p expression in INS-1 cells (Figure 3E), and as a result, we confirmed that SSTR2 expression was downregulated (Figure 3F).

In addition, SSTR2-overexpressing HeLa cells were treated with the has-miR16-5p inhibitor and immunostaining was performed to confirm that SSTR2 was downregulated (Figure 7). As a result, it was confirmed that SSTR2 activation was reduced by decreasing the pERK/ERK ratio after treatment with the inhibitor (Figure 3F). These results indicate that miR-16-5p is involved in the regulation of somatostatin receptor 2 expression.

Determination of the effect of miR-16-5p on somatostatin receptor 2 expression after octreotide treatment

In Example 3, it was confirmed that the expression of somatostatin receptor 2 was regulated by miR-16-5p. Therefore, we sought to evaluate the effect of miR-16-5p on the expression of somatostatin receptor 2 after octreotide treatment. Therefore, INS-1 cells transfected with mimic miR-16-5p or control miRNA were treated with octreotide for 5 to 30 minutes.

The results showed higher somatostatin receptor 2 levels in INS-1 cells transfected with miR-16-5p both before and after octreotide treatment, compared to INS-1 cells transfected with control miRNA (Figures 4A and 4B). .

Next, the present invention evaluated whether the increased level of SSTR2 by mimic miR-16-5 actually affects the anti-tumor properties of octreotide.

As a result, it was confirmed that INS-1 cells transfected with Mimic miR-16-5p had reduced cell proliferation after octreotide treatment. (Figure 4 5A).

Additionally, to confirm the anti-tumor synergistic effect of the combination treatment, Annexin V-PI staining was performed. As a result of Annexin V-PI staining, it was confirmed that the treatment combining mimic miR-16-5p and octreotide increased early and late cell death (Figure 9).

To evaluate drug sensitivity, spheroids in a three-dimensional (3D) culture system were used. In the present invention, the role of miR-16-5p in octeriotide sensitivity was investigated using the spheroids.

As a result, compared to the spheroids of control miRNA-transfected INS-1 cells, the spheroids of mimic miR-16-5p-transfected INS-1 cells were significantly reduced after 48 hours of octreotide treatment, and the mimic miR-16 It was demonstrated that -5p increases the sensitivity of octreotide to somatostatin receptor 2, thereby enhancing the antitumor effect (Figure 5B).

As a result of parallel immunostaining for somatostatin receptor 2, the present inventors confirmed that somatostatin receptor 2 expression was upregulated and maintained in the spheroids of mimic miR-16-5p transfected INS-1 cells. (Figure 10).

From these results, it was confirmed that miR-16-5p effectively exerts the antiproliferative effect of octreotide in relation to neuroendocrine tumors.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

SEQUENCE LISTING <110> INCHEON NATIONAL UNIVERSITY RESEARCH ＆ BUSINESS FOUNDATION <120> Pharmaceutical composition for preventing or treating tumors comprising miR-16-5p and somatostatin analogs <130> 1069477 <160> 9 <170> PatentIn version 3.2 <210> 1 <211> 20 <212> DNA <213> Artificial <220> <223> mimic miR-16-5p S <400> 1 uagcagcacg uaaauuggcg 20 <210> 2 <211> 22 <212> DNA <213> Artificial <220> <223> mimic miR-16-5p A <400> 2 cgccaauauu uacgugcugc ua 22 <210> 3 <211> 22 <212> DNA <213> Artificial <220> <223>rno-miR-16-5p <400> 3 uagcagcacg uaaauauugg cg 22 <210> 4 <211> 20 <212> DNA <213> Artificial <220> <223> rARRB1 F <400> 4 acctggatgt cttgggtctg 20 <210> 5 <211> 20 <212> DNA <213> Artificial <220> <223> rARRB1 R <400> 5 tagccgagtc agtggcttct 20 <210> 6 <211> 21 <212> DNA <213> Artificial <220> <223> hSSTR2 F <400> 6 tgagaagaag gtcacccgaa t 21 <210> 7 <211> 21 <212> DNA <213> Artificial <220> <223> hSSTR2 R <400> 7 aggaccaca caaagtcaaa c 21 <210> 8 <211> 21 <212> DNA <213> Artificial <220> <223> hB2M F <400> 8 ttactcacgt catccagcag a 21 <210> 9 <211> 21 <212> DNA <213> Artificial <220> <223> hB2M R <400> 9 agaaagacca gtccttgctg a 21

Claims (11)

A pharmaceutical composition for preventing or treating neuroendocrine tumor, comprising as active ingredients miR-16-5p and octreotide or a pharmaceutically acceptable salt thereof.
delete delete The pharmaceutical composition for preventing or treating tumors according to claim 1, wherein the miR-16-5p is selected from the group consisting of pri-miRNA, precursor miRNA, plasmid-type miRNA, and mature miRNA.
delete delete The pharmaceutical composition for preventing or treating tumors according to claim 1, wherein the miR-16-5p increases the expression of somatostatin receptor 2.
The pharmaceutical composition for preventing or treating tumors according to claim 1, wherein the composition exhibits anti-tumor activity in octreotide-non-responsive patients with neuroendocrine tumors.
The composition of claim 1, wherein the composition has (i) resistance to octreotide; and/or (ii) a pharmaceutical composition for preventing or treating tumors, characterized in that it exhibits anti-tumor activity in patients with reduced somatostatin receptor expression.
A method of providing information for the prevention or treatment of neuroendocrine tumors, including the following steps:
(a) measuring octreotide reactivity from a sample isolated from a patient;
(b) comparing the reactivity to the octreotide reactivity of a normal control; and
(c) If the patient's reactivity to octreotide is reduced compared to the reactivity to octreotide of a normal control group, any one of claims 1, 4, and 7 to 9 Step of evaluating patients as suitable for administration of the composition.
11. The method of claim 10, wherein the patient has (i) resistance to octreotide; and/or (ii) a method of providing information for the prevention or treatment of a tumor, characterized in that the patient has reduced somatostatin receptor expression.