KR102669316B1 - Composition for diagnosing or prognosising Philadelphia chromosome-like acute lymphoblastic leukemia - Google Patents

Abstract

The composition for diagnosing or predicting prognosis of Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like ALL) of the present invention is directed to ETV6-ABL1, NUP214-ABL1, EBF1-PDGFRB, and P2RY8-CRLF2 in a group of patients administered induction or subsequent chemotherapy. , the expression level of fusion transcripts consisting of EBF1-JAK2, ETV6-JAK2 , and BCR-JAK2 can be effectively measured. Accordingly, by comparing the expression patterns of each patient group, Ph-like ALL, Ph-positive ALL, B-other non-risk ALL, and B-other standard risk ALL, the differences in expression with subtypes showing expression patterns similar to Ph-like ALL were determined. Since it can accurately diagnose, it has been confirmed that it is effective in diagnosing and predicting prognosis of Ph-like ALL for patient groups, and can be usefully used in related industries.

Description

Composition for diagnosing or prognosing Philadelphia chromosome-like acute lymphoblastic leukemia}

The present invention relates to a composition for diagnosing or predicting prognosis of Philadelphia chromosome-like acute lymphoblastic leukemia.

B-cell precursor acute lymphoblastic leukemia (BCP-ALL) is a blood cancer that mainly occurs in children, adolescents, and young adults. Compared to pediatric BCP-ALL, the long-term disease-free survival (DFS) of adult BCP-ALL is 40% to 50%, resulting in a poorer overall treatment prognosis. The reason for the negative treatment prognosis in adults compared to children is, in part, the higher frequency of unfavorable genetic abnormalities such as BCR-ABL1 translocation, KMT2A rearrangement, or complex karyotypes, and the poorer resistance to chemotherapy in adults. It turned out that Based on genome-wide analysis, there are various types of BCP-ALL, one of which is a new type called BCR-ABL1-like or Philadelphia chromosome-like ALL (Ph-like ALL). . Ph-like ALL is more common in the B-cell lineage than in the T-cell lineage and has a gene expression profile similar to Philadelphia chromosome positive ALL (Ph-positive ALL), but BCP lacks the BCR-ABL1 fusion protein. -It was identified as a high-risk type of ALL. Ph-like ALL has genetic variants including CRLF2 rearrangements and mutations, ETV6-RUNX1, TCF3-PBX1 and ABL-class rearrangements, JAK2 or EPOR rearrangements, JAK-STAT signaling and RAS signaling activating mutations, and uncommon kinase variants. The above was disclosed, and it was confirmed that adolescents and adults have a low expression level of genetic characteristics favorable for treatment such as ETV6-RUNX1 and hyperdiploidy, and a high frequency of BCR-ABL1, resulting in an inferior treatment prognosis. Some genetic abnormalities can be targets for treatment with tyrosine kinase inhibitors (TKIs), but research on Ph-like ALL is still insufficient, and research on Asians in particular is lacking.

Ph-like ALL has a negative treatment prognosis at all ages, and studies of patients with Ph-like ALL have shown an increased incidence of minimal residual disease (MRD) after induction chemotherapy compared with other types of BCP-ALL. The level was confirmed to be higher, which can be interpreted as having a negative prognosis with conventional chemotherapy.

This raises the question of whether allogeneic hematopoietic cell transplantation (allogeneic HCT) contributes to improving the negative prognosis of adult Ph-like ALL with chemotherapy, but studies in adult Ph-like ALL have not yet been conducted. Due to the lack of , the role of allogeneic HCT is unclear. Therefore, genetic research is needed to accurately predict treatment responsiveness and prognosis of Ph-like ALL.

The object of the present invention is to diagnose and diagnose Ph-like ALL disease, including an agent for measuring the expression level of genes or proteins related to Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like ALL). The purpose is to provide a composition for predicting prognosis.

Another object of the present invention is to provide a kit for diagnosing and predicting prognosis of Ph-like ALL, comprising the above composition.

Another object of the present invention is to separate a biological sample;

Measuring the expression level of Ph-like ALL-related gene transcripts, or peptides or proteins expressed therefrom, from the sample; and

The present invention provides a method of providing information for diagnosis and prognosis of Ph-like ALL, including the step of confirming the expression pattern of the fusion transcript in the expressed gene transcript.

In order to achieve the above object, the present invention includes an agent for measuring the expression level of genes or proteins related to Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like ALL), Ph- Provides a composition for diagnosing and predicting prognosis of like ALL diseases.

The present invention provides a kit for diagnosing and predicting prognosis of Ph-like ALL, comprising the composition described above.

The present invention includes the steps of separating a biological sample;

Measuring the expression level of Ph-like ALL-related gene transcripts, or peptides or proteins expressed therefrom, from the sample; and

Confirming the expression pattern of the fusion transcript in the expressed gene transcript; Provides an information provision method for diagnosis and prognosis prediction of Ph-like ALL, including.

The composition for diagnosing or predicting prognosis of Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like ALL) of the present invention is directed to ETV6-ABL1 , NUP214-ABL1 , EBF1-PDGFRB , and P2RY8-CRLF2 in a group of patients administered induction or subsequent chemotherapy. , EBF1-JAK2 , ETV6-JAK2 , and BCR-JAK2 can effectively measure the expression level of fusion transcripts. Accordingly, by comparing the expression pattern for each patient group, Ph-like ALL, Ph-positive ALL, B-other high risk ALL, and B-other standard risk ALL, the differences in expression with subtypes showing similar expression patterns to Ph-like ALL were accurately identified. Since it can be diagnosed, it has been confirmed that it is effective in diagnosing and predicting prognosis of Ph-like ALL for patient groups, so it can be usefully used in related industries.

Figure 1 is a schematic diagram of the classification of the patient group of the present invention.
Figure 2 schematically illustrates the treatment schedule for the patient group of the present invention.
Figure 3 compares the treatment prognosis according to disease subtype in overall survival (OS), complete remission (CR), and long-term disease-free survival (DFS) in the present invention. It is also a degree.
A: OS for all patient groups
B: OS of patients who received allogeneic hematopoietic cell transplantation (HCT) in CR
C: DFS for all patient groups;
D: DFS for patients receiving allogeneic HCT in CR
E: Cumulative incidence of recurrence for all patients
F: Cumulative incidence of relapse for patients receiving allogeneic HCT in CR.
Figure 4 shows the expression pattern of the fusion transcript in Ph-like ALL patients confirmed by multiplex RT-PCR using the primer set of the present invention.
Figure 5 is a schematic diagram of the genetic alterations identified in Ph-like ALL patients of the present invention.
Figures 6 to 11 are diagrams confirming the kinase fusion targeted by multiplex RT-PCR in Ph-like ALL and identified by next-generation sequencing.
Figure 12 is a diagram comparing the treatment prognosis according to the Ph-like ALL subtype of the present invention in terms of overall survival (OS), complete remission (CR), and disease-free survival (DFS).
A: OS for all patient groups
B: OS in patients receiving allogeneic HCT in CR
C: Cumulative incidence of recurrence for all patients
D: Cumulative incidence of relapse for patients receiving allogeneic HCT in CR.
Figure 13 is a diagram comparing the gene expression levels of B-other ALL and Ph-like ALL groups without genetic abnormalities in the present invention.
A: Differences between Ph-like ALL patient group and other B-other ALL patient group
B: Differences in subtypes of Ph-like ALL patient groups

The present invention provides diagnosis and prognosis of Ph-like ALL disease, comprising an agent for measuring the expression level of genes or proteins related to Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like ALL). Provides a composition for

According to one embodiment of the present invention, the measurement may be made from a biological sample isolated from a patient, and the biological sample may be tissue, cells, whole blood, serum, plasma, saliva, sputum, spinal fluid, or urine isolated from the patient. It may be selected from the group consisting of, and is preferably spinal fluid or blood.

According to one embodiment of the present invention, the patient receives induction chemotherapy from the group selected from hyper-fractionated cyclophosphamide, vincristine, daunorubicin, and dexamethasone. The patient may have received one or more selected anticancer drugs.

According to one embodiment of the present invention, the patient receives high-dose cytarabine, mitoxantrone, imatinib, dasatinib, and methotrexate as subsequent chemotherapy. , the patient may have received one or more anticancer drugs selected from the group selected from cytarabine and hydrocortisone.

According to one embodiment of the present invention, the Ph-like ALL related gene may be a fusion transcript.

According to one embodiment of the present invention, the fusion transcript may be selected from the group consisting of ETV6-ABL1 , NUP214-ABL1 , EBF1-PDGFRB , P2RY8-CRLF2 , EBF1-JAK2 , ETV6-JAK2 , and BCR-JAK2. .

According to one embodiment of the present invention, the agent for measuring the expression level of the gene or protein includes antibodies, interacting proteins, ligands, nanoparticles, or aptamers that specifically bind to the protein or peptide fragment. It may be an aptamer).

According to one embodiment of the present invention, the agent for measuring the expression level is a nucleic acid primer that binds to the nucleic acid sequence of the Ph-like ALL disease-related gene or the corresponding sequence, or is expressed by the Ph-like ALL-related gene. It may contain an antibody, aptamer, or probe that specifically binds to a transcript or protein, and is preferably a primer or probe.

According to one embodiment of the present invention, the agent for measuring the expression level consists of a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. A primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, a primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, and a primer consisting of SEQ ID NO: 13 and SEQ ID NO: 14. It may be one or more primer pairs selected from the group consisting of primer pairs consisting of SEQ ID NO: 15 and SEQ ID NO: 16.

According to one embodiment of the present invention, the agent for measuring the expression level includes a probe consisting of SEQ ID NO: 17, a probe consisting of SEQ ID NO: 18, a probe consisting of SEQ ID NO: 19, a probe consisting of SEQ ID NO: 20, and SEQ ID NO: 21. It may further include one or more probes selected from the group consisting of a probe consisting of, a probe consisting of SEQ ID NO: 22, a probe consisting of SEQ ID NO: 23, and a probe consisting of SEQ ID NO: 24.

The agent for measuring the expression level of the present invention is a primer or probe that specifically binds to the fusion transcripts ETV6-ABL1 , NUP214-ABL1 , EBF1-PDGFRB , P2RY8-CRLF2 , EBF1-JAK2 , ETV6-JAK2 and BCR-JAK2. may include. In addition, the composition may further include a reaction amplification mixture, wherein the reaction amplification mixture contains reagents necessary for performing the amplification reaction, a thermostable DNA polymerase, deoxynucleotides, nuclease-free sterile water, and a divalent metal cation. refers to a solution, etc., and may preferably include a reaction buffer, deoxynucleotide, and DNA polymerase.

The end of the probe may be labeled with a reporter such as a fluorescent substance.

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a template of a complementary nucleic acid and copies the strand of the nucleic acid template. refers to a short nucleic acid sequence that serves as a starting point for Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature.

When designing the primers, there are various restrictions, such as the A, G, C, and T content ratio of the primers, prevention of primer complex (dimer) formation, and prohibition of repeating the same base sequence more than three times. In addition, in the single PCR reaction conditions, the template (template) Conditions such as the amount of DNA, concentration of primers, concentration of dNTP, concentration of Mg2+, reaction temperature, and reaction time must be appropriate.

The above primers may incorporate additional features without changing the basic properties. That is, the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications include methylation, capping, substitution of a nucleotide with one or more homologs, and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates, or carbamates, or phosphorothioates or phosphorodithioates. Modification of nucleotides into charged linkages such as In addition, nucleic acids may contain one or more nucleases, toxins, antibodies, signal peptides, proteins such as poly L lysine, intercalating agents such as acridine or psoralen, chelating agents such as metals, radioactive metals, and iron oxidizing metals, and alkylating agents. May have additional covalently linked residues.

Additionally, the primer sequence of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The primer may contain a label that can be detected using spectroscopy, photochemistry, biochemistry, immunochemistry or chemical means. Useful labels include 32P, fluorescent dyes, electron dense reagents, enzymes (commonly used in ELISA), biotin or haptens, and proteins for which antisera or monoclonal antibodies are available.

The primers of the present invention are prepared by cloning of appropriate sequences, restriction enzyme digestion, phosphotriester method by Narang et al. (1979, Meth, Enzymol. 68:90-99), and diethylphosphoramidase method by Beaucage et al. Tetrahedron Lett. 22: 1859-1862 (1981, Tetrahedron Lett. 22: 1859-1862), and any other well-known method, including direct chemical synthesis methods such as the solid support method of U.S. Pat. No. 4,458,066.

The method for diagnosing the prognosis of Ph-like ALL patients of the present invention includes a primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair consisting of SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: A primer pair consisting of 6, a primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, a primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, a primer pair consisting of SEQ ID NO: 13 and SEQ ID NO: 14. A primer pair consisting of a primer pair containing the base sequences of SEQ ID NO: 15 and SEQ ID NO: 16, including ETV6-ABL1 , NUP214-ABL1 , EBF1-PDGFRB , P2RY8-CRLF2 , EBF1-JAK2 , ETV6-JAK2 , and BCR-JAK2. This refers to a method of predicting the diagnosis and prognosis of Ph-like ALL patients by confirming the presence of fusion transcripts. More specifically, an amplification reaction using primers to predict the diagnosis and prognosis of Ph-like ALL patients of the present invention was performed to identify ETV6-ABL1 , NUP214-ABL1 , EBF1-PDGFRB , P2RY8-CRLF2 , EBF1-JAK2 , and ETV6-JAK2. and BCR-JAK2.

The “amplification reaction” refers to a reaction that amplifies a nucleic acid molecule, including polymerase chain reaction (PCR) and multiplex real time-polymerase chain reaction (multiplex RT-PCR). , reverse transcription polymerase chain reaction (RT-PCR), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP) 439,182), transcription-mediated amplification (TMA) (WO88/10315), self sustained sequence replication (WO90/06995), selective amplification of target polynucleotide sequence polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), nucleotide sequence-based amplification (nucleic acid) Amplification methods may include, but are not limited to, sequence based amplification (NASBA), strand displacement amplification, and loop-mediated isothermal amplification (LAMP).

In the above amplification method, PCR can be performed using a PCR reaction mixture containing various components known in the art required for the PCR reaction. The PCR reaction mixture may include an appropriate amount of DNA polymerase, dNTPs, PCR buffer, and water (dH2O) in addition to the genomic DNA isolated from the biological sample isolated from the patient to be analyzed and the primer pair provided in the present invention. there is.

The PCR buffer is not limited thereto, but may include one or more of Tris-HCl, MgCl2, and KCl. At this time, MgCl2 concentration greatly affects the specificity and quantity of amplification, and can preferably be used in the range of 1.5 to 2.5 mM. In general, when Mg ²⁺ is excessive, the number of non-specific PCR amplification products increases, and when Mg ²⁺ is insufficient, the yield of PCR products decreases. The PCR buffer may additionally contain an appropriate amount of Triton X-100.

Additionally, in performing the PCR, the PCR reaction may be performed according to a known method. Although not limited thereto, pre-denaturation of the template DNA at 94 to 95° C. followed by denaturation; annealing; And after going through a cycle of extension, it can be performed under general PCR reaction conditions, with final elongation at 70 to 75°C, for example, 72°C. In the above, denaturation may be performed at 90 to 99°C, 92 to 97°C, or 94 to 95°C, and amplification may be performed at 70 to 75°C, 71 to 74°C, or 72°C. The temperature at the time of binding may vary depending on the type of primer, for example, 50 to 59°C, 52 to 57°C, or 55°C. The time and number of cycles of each step can be determined according to conditions generally used in the art. The optimal reaction conditions when performing PCR using the SSR primer pair according to an embodiment of the present invention are as follows: pre-denaturation of the template DNA at 95°C for 5 minutes, then 30 seconds at 95°C; 30 seconds at 55°C; And after repeating 30 cycles of 1 minute at 72°C, the reaction was finally performed at 72°C for 30 minutes.

In the “expression level measurement”, the DNA of the PCR product can be separated by size according to a method well known in the art. For example, the amplified target sequence can be labeled with a detectable label. In one embodiment, the labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling agent is 6-FAM, NEN, VIC or PET. When amplifying a target sequence, if the 5'-end of the primer is labeled with 6-FAM, NEN, VIC, or PET and PCR is performed, the target sequence can be labeled with a detectable fluorescent label. Additionally, the labeling material may include Cy-5 or Cy-3. Additionally, when labeling using a radioactive material is performed by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radioactively labeled. The primer sets used to amplify the target sequence were as described above.

According to one embodiment of the present invention, the biological sample isolated from the patient may be selected from the group consisting of tissue, cells, whole blood, serum, plasma, saliva, sputum, spinal fluid, or urine isolated from the patient.

Additionally, the present invention provides a kit for diagnosing and predicting prognosis of Ph-like ALL, comprising the composition described above.

Additionally, the present invention includes the steps of separating a biological sample;

Measuring the expression level of Ph-like ALL-related gene transcripts, or peptides or proteins expressed therefrom, from the sample;

Confirming the expression pattern of the fusion transcript in the expressed gene transcript; and

It provides a method of providing information for diagnosis and prognosis prediction of Ph-like ALL, including the step of confirming the expression pattern of the fusion transcript.

According to one embodiment of the present invention, the method for confirming the expression pattern of the fusion transcript is multiplex real time-polymerase chain reaction (multiplex RT-PCR), reverse transcriptase polymerization reaction (RT- PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time quantitative RT-PCR, quantitative RT-PCR, RNase protection method , may be measured using Northern blotting or DNA chip technology, preferably multiplex real time-polymerase chain reaction (multiplex RT-PCR). am.

According to one embodiment of the present invention, the step of measuring the expression level of the peptide or protein includes Western blot, ELISA (enzyme linked immunosorbent assay), immunoprecipitation assay, and complement fixation assay. It may be measured using a method selected from the group consisting of flow cytometry (Fluorecence Activated Cell Sorter, FACS), or protein chip.

Hereinafter, the present invention will be described in more detail through examples. These examples are merely for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

<Example 1> Target patient group

Between December 2008 and March 2016, a cohort of 344 adult patients (median age 43 years, 15 to 65 years) with newly diagnosed BCP-ALL who received the same front-line chemotherapy and had material suitable for genomic analysis were seen. was recruited for the diagnostic analysis of the invention. Among these, subjects who did not receive front-line chemotherapy or did not have analyzable RNA were excluded from the analysis. According to the WHO classification, bone marrow examination findings, immunophenotyping, cytogenetics, and molecular genetic diagnosis were used for analysis, and the patient groups were (1) Ph-like ALL, (2) Ph-positive ALL, (3) B-other. They were classified into (4) non-risk ALL ( KMT2A rearrangement, hypodiploidy and complex karyotype [five chromosome abnormalities]) and (4) B-other standard risk ALL. All patients provided written informed consent approved by the institutional review board of the Catholic University of Korea (KC17SESI0717), and the study was conducted in accordance with the Declaration of Helsinki. Additionally, blood or bone marrow was collected from patients and used for subsequent RNA analysis. Ph-like ALL was classified by performing AMP-based targeted next-generation sequencing (NGS) on archived RNA.

As a result, 57 of 344 patients had Ph-like ALL (16.6%), 197 patients had Ph-positive ALL (57.3%), and 90 patients had B-other ALL (26.1%, 63 patients: B). -other standard risk ALL, 27 patients were confirmed to have B-other non-risk ALL (Figure 1). Baseline characteristics of patients are shown in Table 1 below.

Patients with Ph-like ALL had a younger median age and lower leukocyte count at diagnosis than Ph-positive ALL and B-other high-risk ALL patients, but this was not significantly different from B-other standard risk ALL. didn't In chemotherapy for Ph-like ALL, after the second cycle, the overall complete remission (CR) rate was 96.5%, similar to Ph-positive ALL (95.9%) and B-other ALL (92.1%). B-other high-risk ALL showed the lowest rate of 81.5%. Excluding the B-other high-risk ALL patient group, the patient group with Ph-like ALL had a relatively low rate of initial CR after the first induction cycle. The actual allogeneic HCT progression rate in CR was confirmed to be 87.7% for Ph-like ALL, 84.3% for Ph-positive ALL, 71.4% for B-other standard risk ALL, and 70.4% for B-other high risk ALL ( p=0.031).

<Example 2> Confirmation of chemotherapy regimen and treatment prognosis

The treatment schedule is shown in Figure 2. In the patient group of Example 1, induction chemotherapy was hyperfractionated cyclophosphamide (300 mg/m2, 12 hours, 1 to 3 days) and vincristine (1.4 mg/m2, maximum dose 2). mg/day, days 4 to 11), daunorubicin (45 mg/m2/day, days 4 to 11), and dexamethasone (40 mg/day, days 1 to 4 and 11 to 14). received therapy. After the induction chemotherapy (every even cycle), high-dose cytarabine (2 g/m2, every 12 hours, days 1 to 5) and mitoxantrone (12 mg/m2/day, days 1 to 2). days) and received subsequent chemotherapy (every odd cycle). In the Ph-positive ALL patient group, TKIs (imatinib or dasatinib) were added to the chemotherapy. Central nervous system prophylaxis was performed by intrathecal administration of a triple agent (methorexate 12 mg, cytarabine 40 mg, and hydrocortisone 50 mg; total of 6 doses). The patient group received a total of 4 cycles of chemotherapy, which was administered based on donor availability if a donor was available, and based on patient tolerance if a donor was not available. Patients with available donors underwent hematopoietic cell transplantation (HCT) as quickly as possible under the same strategy for conditioning and graft-versus-host disease prevention. Patients without suitable donors, especially those in high-risk groups, were encouraged to undergo umbilical cord blood transplantation.

As a result, after a median follow-up of 74.6 months, 169 of 344 patients (35 of 57 Ph-like ALL patients, 94 of 197 Ph-positive ALL patients, and 32 of 63 B-other standard risk ALL patients) (8 out of 27 B-other risk ALL patients) survived, and 165 out of 169 patients remained in sustained CR. At the time of analysis, 175 patients had died (71 due to disease progression and 104 non-relapse deaths). As a result, the 5-year DFS (53.6%) of Ph-like ALL patients was not significantly different from that of Ph-positive ALL (39.9%) and B-other standard risk ALL (46.8%) patients, but for B-other high-risk ALL patients (46.8%). 25.9%, P=0.022), there was a significant difference. The difference in OS was that patients with Ph-like ALL (60.6%) had a higher 5-year OS than B-other non-risk ALL patients (27.1%), and the P value was 0.012, and it was confirmed that patients with Ph-positive ALL (49.2%) %) and there was no significant difference from the B-other standard risk ALL patient group (53.1%). The 5-year cumulative recurrence rate was 21.4% for Ph-like ALL, 36.5% for Ph-positive ALL, 32.2% for B-other standard risk ALL, and 40.7% for B-other high risk ALL, where the P value was It was 0.104. When treatment outcomes were analyzed individually for patients who received allogeneic HCT in CR, similar results for DFS, OS, and relapse rates were seen (Figure 3).

Additionally, in multivariate analysis (Table 2), patients who did not receive allogeneic HCT in complete remission (CR) had a lower long-term disease-free survival (DFS) (hazard ratio [HR], 6.540; 95 There was a higher risk of treatment failure in % confidence interval [CI], 2.586-16.540; P < 0.001) and overall survival (OS) (HR, 4.123; 95 % CI, 1.452-11.710; P = 0.007). Delayed CR was also associated with inferior DFS, (HR, 2.120; 95% CI, 1.160-3.873; P = 0.014) and OS (HR, 2.088; 95% CI, 1.129-3.861; P = 0.019). Compared with the Ph-like ALL patient group, patients with B-other high-risk ALL had lower DFS (HR, 2.101; 95% CI, 1.020-4.325; P=0.044) and OS (HR, 2.454; 95% CI, 1.168-5.158). ; P = 0.018), and there was no significant difference between Ph-like ALL and Ph-positive ALL or B-other standard risk ALL patients.

<Example 3> AMP (Anchored Multiplex PCR)-based targeted next-generation sequencing

Using AMP-based targeted next-generation sequencing (NGS), we screened Ph-like ALL and identified various fusions or mutations and expression levels in 81 key genes related to ALL. Specifically, to synthesize cDNA, reverse transcription was performed using random primers, followed by end repair and adenylation. Purification of cDNA and ligation of molecular barcode adapter and universal primer sites were performed using Agencourt® AMPure® XP beads. The MBC-adapter-attached cDNA was amplified with gene-specific primer 1 (GSP1) and a primer complementary to the universal primer site, and a second PCR was performed using gene-specific primer 2 (GSP2). Libraries were quantified using the KAPA Universal Library Quantification Kit (KAPA Biosystems, Woburn, MA), normalized, and loaded into NextSeq (Illumina, San Diego, CA) according to the manufacturer's guide. Data were analyzed with Archer® Analysis version 5.1.7 (ArcherDX). Normalized RNA expression values were calculated by dividing the unique RNA reads for each GSP2 by the arithmetic mean of the unique RNA reads for all control GSP2s included in the panel. Relative RNA expression values were reported in RNA_expression_visualization.tsv and visualized using heat maps, each heat map showing samples in columns and GSP2 RNA expression values (0-9) in rows.

<Example 4> Cytogenetic analysis and fluorescence in situ hybridization (FISH)

Cytogenetic G-diagnosis analysis was performed and genetic abnormalities were identified according to the 2016 International System for Human Cytogenetic Nomenclature guidelines. FISH was performed using appropriate probes ( BCR-ABL1 double fusion probe, PDGFRB break-apart probe, PDGFRA break-apart probe, JAK2 break-apart probe, IGH break-apart probe, and P2RY8 deletion probe) according to the manufacturer's guidelines. Performed (Cytocell, Cambridge, UK).

<Example 5> Reverse transcription (RT) PCR analysis

To confirm the fusion genes detected by AMP-based NGS, Multiplex RT-PCR, RT-PCR, and FISH were performed. First, the present inventors used two Multiplex RT-PCR primer sets to simultaneously screen four and three fusion transcripts, respectively: 1) ETV6-ABL1, NUP214-ABL1, EBF1-PDGFRB, P2RY8-CRLF2 and 2) EBF1-JAK2, ETV6-JAK2 and BCR-JAK2 primers were designed, and the ABL1 gene was used as an internal control. Multiplex RT-PCR was performed using CFX96 (Bio-Rad, Hercules, Canada). Primer sequences and probe sequences used in Multiplex RT-PCR are shown in Tables 3 and 4 below. Amplification conditions were initial denaturation at 95°C for 5 minutes, followed by 25 PCR cycles, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and 90°C at 72°C. It was extended for seconds and maintained and stabilized at 4°C.

Target (tube 1) Probes and Primers Sequence (5‘-3’) sequence number ETV6-ABL1 Forward primer CATGGTCTCTGTCTCCCCGC SEQ ID NO: 1 probe FAM-CTTTGAGCCTCAGGGTCTGAGTGAAGC-BHQ1 SEQ ID NO: 17 Reverse primer CTCCAAGGAAAACCTTCTCGC SEQ ID NO: 2 EBF1-PDGFRB(β) Forward primer CAACATGGTCTCAGCCGTGAAAAC SEQ ID NO: 3 probe Texas Red-CAGCACCAACGGGAACAGCCTGC-BHQ2 SEQ ID NO: 18 Reverse primer AGGAGTTTGAGGTGGTGAGCAC SEQ ID NO: 4 NUP214-ABL1 Forward primer GGTTTTGGATCAGGCACAGGAG SEQ ID NO: 5 probe HEX-TGGGGAATGGTGTGAAGCCCAAACC-BHQ1 SEQ ID NO: 19 Reverse primer GCGCCTGAGTATTCTGCTGAG SEQ ID NO: 6 P2RY78-CRLF2 Forward primer CTGTTACCTGGAGACCCTCTGAG SEQ ID NO: 7 probe Cy5-CGATGGTGACCTCTGCTTATGAGTCATG-BHQ2 SEQ ID NO: 20 Reverse primer GAGGACCTCACTCTCCACTCCTG SEQ ID NO: 8

target(tube2) Probes and Primers Sequence (5‘-3’) sequence number EBF1-JAK2 Forward primer GCAACTCAAGCAGGCGTATCACC SEQ ID NO: 9 probe FAM-CGGCTCCCCCACCTTCCTCAACGG-BHQ1 SEQ ID NO: 21 Reverse primer GTGGGAAAATCTGCAGTGGAGG SEQ ID NO: 10 BCR-JAK2 Forward primer CACCTACCGCATGTTCCGGG SEQ ID NO: 11 probe Texas Red-TGCCCTRGGGTTTTCTGGTGCCTTTG-BHQ2 SEQ ID NO: 22 Reverse primer CAACTTGGCAAGGGTAATTTTGGGA SEQ ID NO: 12 ETV6-JAK2 Forward primer GTCATACTGCATCAGAACCATGAAG SEQ ID NO: 13 probe HEX-CTTCAGGAGAGAATACCATGGGTACC-BHQ1 SEQ ID NO: 23 Reverse primer CATCAGCTTCCTGCACCAAAGTG SEQ ID NO: 14 IC: ABL1 Forward primer GAAGATGAGCGCCTTCTCCCCC SEQ ID NO: 15 probe Cy5-GGGCACTGGCTTTCACCCCTTGGAC-BHQ2 SEQ ID NO: 24 Reverse primer CCAATGGAGCCCTCCGGGAG SEQ ID NO: 16

As a result, the results of multiplex RT-PCR using the primers and probes in Tables 3 and 4 are shown in Figure 4, and the fusion transcripts and mutations identified in all patients are shown in Figure 5. Among 57 Ph-like ALL patients, fusion transcripts were detected in 24 patients, and CRLF2 rearrangements were confirmed in 13 patients, including 7 for P2RY8-CRLF2 , 4 for IGH-CRLF2 , 1 for CLDN7-CRLF2 , and 1 for HFM1-CRLF2 . One CRLF2 patient was confirmed (two of these patients had CRLF2 mutations, and four patients had mutations in JAK2 and CRLF2 ). Additionally, there were a total of 7 patients with JAK2 rearrangements, and the fusion transcripts included PAX5 (2 patients), BICD2 (1 patient), SMU1 (1 patient), ROCK (1 patient), ZCCHC7 (1 patient), and ZFP14 (1 patient). It was confirmed that it was. ABL-class rearrangements were confirmed in 5 patients, including NUP214-ABL1 (2 patients), EBF1-PDGFRB (2 patients), and R CSD1-ABL2 (1 patient) (Figures 6 to 11). In 15 patients without CRLF2 rearrangement or other kinase fusions, sequence mutations were identified in genes that activate JAK-STAT signaling, including IL7R (4 patients), FLT3 (7 patients), TYK2 (2 patients), JAK2 (1 person) and EPOR (1 person) were included. In addition, in 17 patients, only RAS pathway-related genetic mutations were observed, and sequence mutations in NRAS (7 patients), KRAS (5 patients), PTPN11 (4 patients), and NRAS/KRAS/PTPN11 (1 patient) were identified.

Based on the above results, patients with Ph-like ALL were classified into five subgroups. 1) CRLF2 abnormalities (13 patients, 22.8%), 2) JAK2 rearrangement (7 patients, 12.3%), 3) ABL-class rearrangement (5 patients, 8.8%), 4) Other JAK-STAT pathway mutations (15 patients) , 26.3%) and 5) RAS pathway mutation (17 patients, 29.8%). Among the subgroups, patients with CRLF2 abnormalities or ABL-class rearrangements had a lower overall survival rate than patients with other genetic alterations. OS) was low, and in contrast, patients with RAS pathway mutations had a low cumulative incidence of recurrence and superior OS (Figure 12).

<Example 6> CRLF2 Expression measurements

CRLF2 gene expression was measured by quantitative RT-PCR (RT-qPCR) using TaqMan® Gene Expression Assays Hs00913509_s1 (Applied Biosystems, Foster City, CA) and relative quantification was performed by the expression of the internal control gene GUSB , and the control was TaqMan® Measurements were made using Gene Expression Assays Hs00939627_m1 (Applied Biosystems). Primers and probes used for RT-PCR are shown in Table 5 below. 4 μg cDNA from each sample was confirmed using a 7500 Real Time PCR System instrument (Applied Biosystems). PCR amplification conditions were 50 cycles of 95°C for 10 minutes, 95°C for 15 seconds, and 60°C for 1 minute, and relative expression levels were estimated using the 2 ^-ΔΔCt method and gene expression in AMP-based NGS. compared with the data.

Fusion/Gene Forward sequence Reverse sequence P2RY8-CRLF2 gcggccgcctttgcaaggttgc ¹ gtctaggaggcaccccgaagtgtga ¹ EBF1-PDGRFB ccaccatcgattatggtttccagaggt ¹ tttcatcgtggcctgagaatggctc ¹ NUP214-ABL2 cagtggccttggaggaaaacccagt ¹ gccaccgtcaggctgtatttcttcc ¹ PAX5-JAK2 acaatgacaccgtgcctagcgtcag ¹ tgttgtcatgctgtagggatttcagga ¹ SSBP2-CHD1 ggagctgctctcggcacaagcat ¹ catcatccgactggcttgattctcca ¹ TCF3-ZNF384 cagctcaggtgaggactac ^* ctgtgtccatactgatgcct ^* PAX5-ZCCH7 acaatgacaccgtgcctagcgtcag ¹ gtaccgctgggtccatcttccaggt ¹ BICD2-JAK2 ttacacagctggatgagatgc ^* tgttgtcatgctgtagggatttcagga ¹ SMU1-JAK2 gggattgcttcctcctggta ^* tgttgtcatgctgtagggatttcagga ¹ ZFP14-JAK2 gggattgcttcctcctggta ^* tgttgtcatgctgtagggatttcagga ¹ KRAS exon 2 cgatacacgtctgcagtcaac ² accctgacatactcccaagg ² NRAS exon 2 gatgtggctcgccaattaac ² tccgacaagtgagagacagg ² NRAS exon 3 gataggcagaaatgggcttg ² ttccaagtcattcccagtagc ² PTPN11 exon 12 ttgagtctgaaacccccatg ³ tgttttcgtgagcactttcc ³ tcttcatgatgtttccttcgta ³ gcctagcaagagaatgagaatc ³ PTPN11 exon 13 ^1-3 previously reported primers ^1-3 ; ^* designedprimerusingPrimer3 Abbreviations: RT-PCR, Reverse transcription PCR

As a result, the gene expression levels between Ph-like ALL (57 patients) and B-other ALL (40 patients) without known repeat gene abnormalities were TLX1, TLX3, CRLF2, FBXW7, and DNTT in patients with Ph-like ALL. and SEMA6A expression was higher (Figure 13A). Among Ph-like ALL patients, the expression of CRLF2, P2RY8 , and FBXW7 was high in patients with abnormalities in CRLF2 , and the expression of the SYNE1 gene was high in patients with JAK2 rearrangement (Figure 13B). Additionally, KRF2 expression was increased in patients with JAK-STAT mutations. CRLF2 expression measured by RT-qPCR was confirmed to be correlated with AMP-based NGS data (r=0.476, P<0.001)

<Example 7> Sanger sequencing

Identified mutations were sequenced by Sanger sequencing. Primers were designed using primer 3, and the genome washed after the first PCR was subjected to a second PCR using the BigDye terminator. Subsequently, the base sequence was analyzed using a capillary electrophoresis sequencer ABI Prism 3130xl genetic analyzer.

<Example 8> Statistical analysis

The end points of the present invention included complete remission (CR), long-term disease-free survival (DFS), overall survival (OS), and cumulative incidence of recurrence. Patient characteristics were plotted for the four patient groups using Fisher's exact test and test for categorical variables and the Kruskal-Wallis test for continuous variables, and subgroups were compared using the log-rank test. Recurrence was calculated using cumulative incidence estimates to accommodate competing mortality events, and subgroups were compared using Gray's test. The prognostic significance of covariates affecting response rate was analyzed using multiple logistic regression analysis, and covariates affecting OS were determined using Cox proportional hazards regression model. The prognostic significance of covariates affecting the cumulative incidence of recurrence was determined by Fine-Gray proportional hazards regression analysis of competing events. Multivariate analysis was performed using variables with a p-value of 0.10 or higher in the previous univariate analysis. , All statistical analyzes were performed using ‘R’ software version 2.15.1 (R Foundation for Statistical Computing, 2012). Statistical significance was set when the p value was 0.05 or less.

Based on the above study, rearrangements found in Ph-like ALL patients were confirmed, and even within Ph-like ALL patients, genetic characteristics and prognosis were confirmed to be different depending on subgroups. Therefore, the composition for Ph-like ALL diagnosis of the present invention is used to quickly and accurately diagnose rearrangements frequently found in the Ph-like ALL patient group and predict prognosis. By using RT-PCR consisting of primers of EBF1-JAK2, ETV6-JAK2 , and BCR-JAK2 , it can be effectively used to classify Ph-like ALL according to the expression pattern of the fusion transcript and predict treatment prognosis. was confirmed.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Composition for diagnosing or prognosing Philadelphia chromosome-like acute lymphoblastic leukemia <130> PN2003-112 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Unknown <220> <223> ETV6-ABL1 F <400> 1 catggtctct gtctccccgc 20 <210> 2 <211> 21 <212> DNA <213> Unknown <220> <223> ETV6-ABL1 R <400> 2 ctccaaggaa aaccttctcg c 21 <210> 3 <211> 23 <212> DNA <213> Unknown <220> <223> EBF1-PDGFRB-beta F <400> 3 caacatggtc tcagccgtga aac 23 <210> 4 <211> 22 <212> DNA <213> Unknown <220> <223> EBF1-PDGFRB-beta R <400> 4 aggagtttga ggtggtgagc ac 22 <210> 5 <211> 22 <212> DNA <213> Unknown <220> <223> NUP214-ABL1 F <400> 5 ggttttggat caggcacagg ag 22 <210> 6 <211> 20 <212> DNA <213> Unknown <220> <223> NUP214-ABL1 R <400> 6 gccgctgagt atctgctgag 20 <210> 7 <211> 23 <212> DNA <213> Unknown <220> <223>P2RY78-CRLF2 F <400> 7 ctgttacctg gagaccctct gag 23 <210> 8 <211> 23 <212> DNA <213> Unknown <220> <223>P2RY78-CRLF2 R <400> 8 gaggacctca ctctccactc ctg 23 <210> 9 <211> 22 <212> DNA <213> Unknown <220> <223> EBF1-JAK2 F <400> 9 gcaactcaag cagcgtatca cc 22 <210> 10 <211> 21 <212> DNA <213> Unknown <220> <223> EBF1-JAK2 R <400> 10 gtgggaaaatc tgcagtggag g 21 <210> 11 <211> 20 <212> DNA <213> Unknown <220> <223> BCR-JAK2 F <400> 11 cacctaccgc atgttccggg 20 <210> 12 <211> 25 <212> DNA <213> Unknown <220> <223> BCR-JAK2 R <400> 12 caacttggca agggtaattt tggga 25 <210> 13 <211> 25 <212> DNA <213> Unknown <220> <223> ETV6-JAK2 F <400> 13 gtcatactgc atcagaacca tgaag 25 <210> 14 <211> 23 <212> DNA <213> Unknown <220> <223> ETV6-JAK2 R <400> 14 catcagcttc ctgcaccaaa gtg 23 <210> 15 <211> 21 <212> DNA <213> Unknown <220> <223> IC: ABL1 F <400> 15 gaagatgagc gccttctccc c 21 <210> 16 <211> 20 <212> DNA <213> Unknown <220> <223> IC: ABL1 R <400> 16 ccaatggagc cctccgggag 20 <210> 17 <211> 29 <212> DNA <213> Unknown <220> <223> ETV6-ABL1 probe <400> 17 ctttgagcct cagggtctga gtgaagcbh 29 <210> 18 <211> 25 <212> DNA <213> Unknown <220> <223> EBF1-PDGFRB-beta probe <400> 18 cagcaccaac gggaacagcc tgcbh 25 <210> 19 <211> 25 <212> DNA <213> Unknown <220> <223> NUP214-ABL1 probe <400> 19 tggggaatgg tgtgaagccc aaacc 25 <210> 20 <211> 28 <212> DNA <213> Unknown <220> <223> P2RY78-CRLF2 probe <400> 20 cgatggtgac ctctgcttat gagtcatg 28 <210> 21 <211> 24 <212> DNA <213> Unknown <220> <223> EBF1-JAK2 probe <400> 21 cggctccccc accttcctca acgg 24 <210> 22 <211> 26 <212> DNA <213> Unknown <220> <223> BCR-JAK2 probe <400> 22 tgccctrggg ttttctggtg cctttg 26 <210> 23 <211> 26 <212> DNA <213> Unknown <220> <223> ETV6-JAK2 probe <400> 23 cttcaggaga gaataccatg ggtacc 26 <210> 24 <211> 26 <212> DNA <213> Unknown <220> <223> IC: ABL1 probe <400> 24 gggcactggc tttcaccccc ttggac 26

Claims (22)

Assess or determine whether patients with B-cell precursor acute lymphoblastic leukemia (BCP-ALL) have Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like ALL) As a set of primers and probes for multiplex real time-polymerase chain reaction (multiplex RT-PCR),
The primer and probe set includes a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 1 and a reverse primer containing the base sequence shown in SEQ ID NO: 2, and a probe containing the base sequence shown in SEQ ID NO: 17. A set consisting of; A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 3 and a reverse primer containing the base sequence shown in SEQ ID NO: 4, and a probe containing the base sequence shown in SEQ ID NO: 18; A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 5 and a reverse primer containing the base sequence shown in SEQ ID NO: 6, and a probe containing the base sequence shown in SEQ ID NO: 19; A primer consisting of a set of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 7 and a reverse primer containing the base sequence shown in SEQ ID NO: 8, and a probe containing the base sequence shown in SEQ ID NO: 20. and probe set A;
A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 9 and a reverse primer containing the base sequence shown in SEQ ID NO: 10, and a probe containing the base sequence shown in SEQ ID NO: 21; A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 11 and a reverse primer containing the base sequence shown in SEQ ID NO: 12, and a probe containing the base sequence shown in SEQ ID NO: 22; A primer consisting of a set of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 13 and a reverse primer containing the base sequence shown in SEQ ID NO: 14, and a probe containing the base sequence shown in SEQ ID NO: 23 and probe set B; and
A primer consisting of a set of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 15 and a reverse primer containing the base sequence shown in SEQ ID NO: 16, and a probe containing the base sequence shown in SEQ ID NO: 24 A primer and probe set for evaluating or confirming whether a BCP-ALL patient has a Ph-like ALL type, consisting of probe set C. According to clause 1,
The patient received one or more anticancer drugs selected from the group consisting of hyper-fractionated cyclophosphamide, vincristine, daunorubicin, and dexamethasone as induction chemotherapy. A primer and probe set, characterized in that. According to clause 1,
The patient received subsequent chemotherapy with high-dose cytarabine, mitoxantrone, imatinib, dasatinib, methotrexate, cytarabine, and hydrocortisone. A primer and probe set, characterized in that the patient has received one or more anticancer drugs selected from the group consisting of (hydrocortisone). According to clause 1,
The primer and probe set A binds to the fusion transcripts of ETV6-ABL1, NUP214-ABL1, EBF1-PDGFRB and P2RY8-CRLF2 ,
The primer and probe set B binds to the fusion transcripts of EBF1-JAK2, ETV6-JAK2 and BCR-JAK2 ,
The primer and probe set C is a primer and probe set, characterized in that it binds to the ABL1 gene. A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 1 and a reverse primer containing the base sequence shown in SEQ ID NO: 2, and a probe containing the base sequence shown in SEQ ID NO: 17; A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 3 and a reverse primer containing the base sequence shown in SEQ ID NO: 4, and a probe containing the base sequence shown in SEQ ID NO: 18; A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 5 and a reverse primer containing the base sequence shown in SEQ ID NO: 6, and a probe containing the base sequence shown in SEQ ID NO: 19; A primer consisting of a set of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 7 and a reverse primer containing the base sequence shown in SEQ ID NO: 8, and a probe containing the base sequence shown in SEQ ID NO: 20. and probe set A;
A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 9 and a reverse primer containing the base sequence shown in SEQ ID NO: 10, and a probe containing the base sequence shown in SEQ ID NO: 21; A set consisting of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 11 and a reverse primer containing the base sequence shown in SEQ ID NO: 12, and a probe containing the base sequence shown in SEQ ID NO: 22; A primer consisting of a set of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 13 and a reverse primer containing the base sequence shown in SEQ ID NO: 14, and a probe containing the base sequence shown in SEQ ID NO: 23 and probe set B; and
A primer consisting of a set of a primer pair consisting of a forward primer containing the base sequence shown in SEQ ID NO: 15 and a reverse primer containing the base sequence shown in SEQ ID NO: 16, and a probe containing the base sequence shown in SEQ ID NO: 24 and Philadelphia chromosome-like acute lymphoblastic leukemia (Ph-like) in a patient with B-cell precursor acute lymphoblastic leukemia (BCP-ALL), including probe set C. ALL) Compositions for evaluating or confirming type. delete delete delete delete delete A kit for evaluating or confirming whether a BCP-ALL patient has a Ph-like ALL type, comprising the primer and probe set according to claim 1 or the composition according to claim 5. (a) isolating RNA from a biological sample isolated from a test subject;
(b) synthesizing cDNA from isolated RNA;
(c) performing a multiplex real time-polymerase chain reaction (multiplex RT-PCR) using the primer and probe set of claim 1; and
(d) A method of providing information for evaluating or confirming whether a BCP-ALL patient has Ph-like ALL type, including the step of confirming the presence or absence of amplification product and the amount of amplification product. According to clause 12,
In the above primer and probe set, primer and probe set A binds to the fusion transcripts of ETV6-ABL1, NUP214-ABL1, EBF1-PDGFRB and P2RY8-CRLF2 ,
Primer and probe set B binds to fusion transcripts of EBF1-JAK2, ETV6-JAK2 , and BCR-JAK2 ;
A method of providing information, wherein primer and probe set C binds to the ABL1 gene. delete According to clause 12,
An information provision method wherein the biological sample is one or more selected from the group consisting of tissue, cells, whole blood, serum, plasma, saliva, sputum, spinal fluid, and urine isolated from the test subject. According to clause 12,
The test subject received one or more anticancer drugs selected from the group consisting of hyper-fractionated cyclophosphamide, vincristine, daunorubicin, and dexamethasone as induction chemotherapy. A method of providing information characterized by being a patient. According to clause 12,
The test subject received subsequent chemotherapy with high-dose cytarabine, mitoxantrone, imatinib, dasatinib, methotrexate, cytarabine, and hydrotherapy. A method of providing information, characterized in that the patient has received one or more anticancer drugs selected from the group consisting of cortisone (hydrocortisone). delete delete delete delete delete