KR102657354B1 - Composition for treating or preventing colorectal cancer in combination, comprising SYK inhibitor - Google Patents

Abstract

The present invention is intended to predict or overcome resistance to MEK inhibitors in colon cancer. More specifically, SYK levels are expressed at high levels in CMS4 colon cancer cell lines resistant to MEK inhibitors, and SYK inhibitors are induced in CMS4 colon cancer. As it has been confirmed that the therapeutic effect of MEK inhibitors can be increased by overcoming resistance to MEK inhibitors, it can be used as a new treatment strategy to effectively treat colon cancer through combined treatment with SYK inhibitors and MEK. It can also be useful in predicting the possibility of resistance occurring.

Description

Composition for treating or preventing colorectal cancer in combination, comprising SYK inhibitor}

The present invention is a combination treatment to overcome resistance to MEK inhibitors in colon cancer and a novel use of spleen tyrosine kinase (SYK) and SYK inhibitors as a biomarker to predict that resistance to MEK inhibitors may be induced. It's about.

Cancer is a representative prevalent and incurable disease and is becoming a major problem worldwide. Among them, colon cancer ranks second among the main causes of cancer death, according to the "Global cancer statistics 2020" report published by the International Agency for Research on Cancer (IARC) in 2020. In order to build an effective strategy to treat colorectal cancer, it was necessary to understand colorectal cancer in more detail, and to this end, the consensus molecular subtype (CMS), which classified colorectal cancer into four subtypes at the molecular level, was developed. presented. Among the four CMSs, CMS4 is a type that occurs at an advanced stage of cancer and has the characteristics of TGF-β activation, stromal infiltration, epithelial-mesenchymal transition, and angiogenesis, and its clinical characteristics indicate that it is an advanced cancer compared to other types. ), and is the type with the lowest overall survival rate, so effective treatment strategies are needed. Currently, the main treatment strategy for cancer is a targeted treatment strategy that kills only cancer cells by targeting specific molecules, and is evolving into a treatment tailored to each patient. More than 40% of colorectal cancers have KRAS and BRAF mutations, which is a characteristic that occurs in more than 30-40% of each type of CMS. In this case, activation of the MAPK pathway is triggered, which leads to the survival and proliferation of cancer cells. To inhibit the activity of this pathway, the application of MEK inhibitors, a targeted treatment targeting MEK1/2 of the MAPK pathway, has been studied as a treatment strategy. However, MEK inhibitor single drug therapy has the problem of not having sufficient therapeutic effect as resistance often develops.

Therefore, there is a need to develop methods that can overcome resistance to MEK inhibitors and increase their therapeutic effects.

Accordingly, while the inventor of the present invention was conducting research to overcome the resistance to MEK inhibitors in CMS4 colon cancer, the consensus molecular subtype of colon cancer with the lowest survival rate, it was confirmed that the therapeutic effect of MEK inhibitors was increased when combined with SYK inhibitors. Thus, the present invention was completed.

Therefore, the purpose of the present invention is to provide a pharmaceutical composition for suppressing or improving anticancer drug resistance.

Another object of the present invention is to provide an anti-cancer adjuvant.

Another object of the present invention is to provide a pharmaceutical composition for combined administration for the prevention or treatment of cancer.

Another object of the present invention is to provide a food composition for preventing or treating cancer.

Another object of the present invention is to provide a screening method for agents for suppressing or improving resistance to anticancer drugs.

Another object of the present invention is to provide a composition for predicting resistance to anticancer drugs.

In order to achieve the above object, the present invention provides a pharmaceutical composition for suppressing or improving anticancer drug resistance containing a spleen tyrosine kinase (SYK) inhibitor.

In order to achieve the above other objects, the present invention provides an anti-cancer adjuvant comprising the composition according to the present invention.

In order to achieve the above other object, the present invention provides a pharmaceutical composition for combined administration for the prevention or treatment of cancer, including a SYK inhibitor and a MAPK (mitogen-activated protein kinase) signaling pathway inhibitor.

In order to achieve the above other object, the present invention provides a food composition for preventing or improving cancer containing a SYK inhibitor and a MAPK (mitogen-activated protein kinase) signaling pathway inhibitor.

In order to achieve the above further object, the present invention includes the steps of treating a sample containing a SYK protein or a gene encoding a SYK protein with a candidate material; And if the activity or expression level of the SYK protein or gene decreases compared to before treatment with the candidate material, determining that the candidate material has the activity of suppressing or improving resistance to anticancer drugs; Provided is a screening method for an agent for suppressing or improving resistance to anticancer drugs, including a.

In order to achieve the above other object, the present invention provides a composition for predicting resistance to anticancer drugs, including an agent for measuring the expression or activity of spleen tyrosine kinase (SYK).

According to the present invention, SYK levels are expressed at high levels in CMS4 colon cancer cell lines resistant to MEK inhibitors, and SYK inhibitors can increase the therapeutic effect of MEK inhibitors by overcoming resistance to MEK inhibitors induced in CMS4 colon cancer. As confirmed, it can be usefully used as a new treatment strategy that can effectively treat colon cancer through combined treatment of SYK inhibitors and MEK, in addition to predicting the possibility of resistance to MEK inhibitors in colon cancer patients.

Figure 1 shows the results of screening colon cancer cell lines showing resistance to MEK inhibitors.
Figures 2a to 2e show the results of identifying combination targets to enhance the effect of MEK inhibitors.
Figures 3a to 3e are results confirming the effect of combined treatment with MEK inhibitor and SYK inhibitor in colon cancer cell lines resistant to MEK inhibitor (SYKi: SYK inhibitor, HSA: Highest single agent, shScr: shscramble, Tra: trametinib, Sel: selumetinib.)
Figure 4 shows the results confirming the effect of combined treatment with MEK inhibitor and SYK inhibitor in colon cancer cell lines sensitive to MEK inhibitor.
Figure 5 shows the results confirming the mechanism of combined treatment with a MEK inhibitor and a SYK inhibitor.
Figure 6 is an image showing the signal transduction network status according to each inhibitor treatment condition in the combined treatment of MEK inhibitor and SYK inhibitor.

Hereinafter, the present invention will be described in detail.

The present invention relates to an effective treatment method for colon cancer of CMS4 that is resistant to anticancer drugs, and provides a pharmaceutical composition for suppressing or improving anticancer drug resistance containing a SYK (spleen tyrosine kinase) inhibitor.

According to one embodiment of the present invention, it was confirmed that when a MEK inhibitor and a SYK inhibitor are administered in combination to the CMS4 colon cancer cell line, resistance to the MEK inhibitor can be overcome and the therapeutic effect of the MEK inhibitor can be increased.

In the present invention, the “MEK (mitogen-activated protein kinase kinase)” is composed of MEK1 and MEK2 and is activated by various growth factors, cytokines, membrane depolarization, or calcium influx. activated by influx. Additionally, ERK (extracellular signal-regulated kinase) is activated by phosphorylation of MEK.

Therefore, the anticancer drugs are not limited thereto, but include Trametinib, Selumetinib, Binimetinib, Pimasertib, Refametinib, Cobimetinib ( It may be one or more MEK inhibitors selected from the group consisting of cobimetinib), U0126-EtOH, PD184352, PD98059, BIX02189, SL-327, BIX02188, AZD8330, TAK-733, and PD318088, and more preferably trametinib. Or it may be selumetinib.

In the present invention, the "SYK (spleen tyrosine kinase)" is a protein expressed in various inflammation-related cells such as macrophages, mast cells, and B cells. When SYK is activated, the phagocytosis reaction of immune cells that cause inflammation is triggered. SYK plays an important role in the proliferation of inflammation caused by antibodies.

In the present invention, the “SYK inhibitor (SYKi)” may be an inhibitor of SYK gene or SYK protein expression or an inhibitor of SYK protein activity.

The SYK gene or SYK protein expression inhibitor may be one or more selected from the group consisting of antisense nucleotides, short interfering RNA (siRNA), short hairpin RNA (shRNA), and ribozymes that bind complementary to the mRNA of the gene, but is not limited thereto. No. In addition, the SYK protein activity inhibitor may be one or more selected from the group consisting of compounds that specifically bind to the protein, peptides, peptide minetics, aptamers, antibodies, and natural products, but is not limited thereto. . The antibodies include monoclonal antibodies, polyclonal antibodies, or recombinant antibodies that can specifically bind to the SYK protein, and can be produced by methods known to those skilled in the art or purchased commercially.

In the present invention, the SYK inhibitor is not limited thereto, but may be one or more selected from the group consisting of fostamatinib and cevidoplenib, and preferably may be fostamatinib.

In one example of the present invention, an experiment was conducted using fostamatinib disodium as the SYK inhibitor.

The significance of the present invention is that it has shown that when a SYK inhibitor and an anticancer agent are administered in combination, resistance or drug resistance induced to the anticancer agent can be overcome and the anticancer effect of the existing anticancer agent can be significantly improved. Therefore, the SYK inhibitor of the present invention It will be obvious to those skilled in the art that anything used in the technical field or found to have SYK inhibitory activity can be applied to the present invention regardless of its type, and is not limited to a specific type.

In the pharmaceutical composition of the present invention, the SYK inhibitor may be administered simultaneously or sequentially with the anticancer agent.

Additionally, the present invention provides an anti-cancer adjuvant comprising the composition according to the present invention.

In the present invention, the “anticancer adjuvant” refers to an agent that can improve, enhance, or increase the anticancer effect of an anticancer agent.

In the present invention, the anticancer adjuvant can be used as an anticancer agent or an anticancer adjuvant depending on the treatment concentration, and can improve sensitivity to the anticancer agent.

In the present invention, the anti-cancer adjuvant can be administered in combination with a known compound that has the effect of preventing, improving, or treating cancer.

In addition, the present invention provides a pharmaceutical composition for combined administration for the prevention or treatment of cancer, including a SYK inhibitor and a MAPK (mitogen-activated protein kinase) signaling pathway inhibitor.

In the present invention, the “MAPK signaling pathway” is a signaling pathway consisting of the RAS-RAF-MEK-ERK cascade and is known to be a very important signaling system that is common to many intracellular signaling pathways. In particular, abnormal activation of the MAPK signaling pathway is observed in approximately 30% of human cancer tissues, and aberrations in the MAPK signaling pathway play an important role in cancer cytology.

In the present invention, the MAPK signaling pathway inhibitor (MAPK inhibitor) may refer to a MEK inhibitor that can inhibit MEK among the signaling pathways, and is not limited to any substance that inhibits the activation of the MEK signaling pathway. Included.

In the present invention, the cancer may be selected from the group consisting of colon cancer, breast cancer, lung cancer, stomach cancer, prostate cancer, thyroid cancer, colorectal cancer, melanoma, head and neck cancer, skin cancer, pancreas cancer, ovarian cancer, bladder cancer, liver cancer, and kidney cancer. However, it is not limited to this. Preferably, it may be colon cancer, and more preferably, it may be colon cancer of molecular subtype 4 (consensus molecular subtype 4, CMS4), which has the lowest overall survival rate.

In the present invention, the pharmaceutical composition may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be intended for human subjects. The pharmaceutical composition is not limited to these, but can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. .

The pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration, and buffers, preservatives, and analgesics for injections. Topics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used. The dosage form of the pharmaceutical composition according to the present invention can be prepared in various ways by mixing it with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. there is.

Meanwhile, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used. In addition, fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.

The route of administration of the pharmaceutical composition according to the present invention is not limited to these, but is oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, and topical. , sublingual or rectal. The term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition according to the invention can also be administered in the form of suppositories for rectal administration.

The pharmaceutical composition according to the present invention is influenced by various factors, including the activity of the specific active ingredient used, age, body weight, general health, gender, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route and period, but may be appropriately selected by a person skilled in the art. Preferably, considering all of the above factors, the amount that can achieve the maximum effect with the minimum amount without side effects can be administered, more preferably 1 to 10,000 ㎍/kg of body weight/day, and even more preferably 10 to 1,000 mg. The effective dose is /kg body weight/day and can be administered repeatedly several times a day. The above dosage does not limit the scope of the present invention in any way.

In addition, the present invention provides a food composition for preventing or improving cancer containing a SYK inhibitor and a MAPK (mitogen-activated protein kinase) signaling pathway inhibitor.

As described above, the MAPK signaling pathway inhibitor may be a MEK inhibitor.

The food composition according to the present invention includes all forms such as functional food, nutritional supplement, health food, health functional food, and food additives. .

In the present invention, the term "health functional food" refers to a food manufactured or processed using specific ingredients as raw materials or by extracting, concentrating, refining, or mixing specific ingredients contained in food raw materials for the purpose of health supplementation, It refers to a food designed and processed so that the above ingredients can fully exert bioregulatory functions on the living body, such as biological defense, regulation of biological rhythm, prevention and recovery of disease, etc., and performs functions related to prevention of disease or recovery of health. Say what you can do.

The food composition according to the present invention can be manufactured in various forms according to conventional methods known in the art.

For example, as a health food, the mixture of SYK inhibitor and MAPK signaling pathway inhibitor according to the present invention can be granulated, encapsulated, and powdered and consumed, or manufactured in the form of tea, juice, and drink. In addition, the combination of the SYK inhibitor and the MAPK signaling pathway inhibitor of the present invention can be prepared in the form of a composition by mixing it with a known substance or active ingredient known to be effective in treating colon cancer or overcoming MEK inhibitor resistance.

In addition, functional foods include beverages (including alcoholic beverages), fruits and their processed foods (e.g. canned fruit, bottled foods, jam, marmalade, etc.), fish, meat and their processed foods (e.g. ham, sausage corn beef, etc.) , bread and noodles (e.g. udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein, retort. It can be manufactured by adding a mixture of the SYK inhibitor and MAPK signaling pathway inhibitor of the present invention to food, frozen food, various seasonings (e.g., soybean paste, soy sauce, sauce, etc.).

The preferred content of the mixture of the SYK inhibitor and MAPK signaling pathway inhibitor of the present invention in the food composition of the present invention is not limited thereto, but may be, for example, 0.01 to 80% by weight of the final manufactured food, and is preferably the final amount. It may be 0.01 to 50% by weight of the food manufactured.

The food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients. The above-mentioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. . The ratio of the natural carbohydrate may be generally about 0.01 to 0.4 g, preferably about 0.02 to 0.03 g, per 100 ml of the composition of the present invention.

In addition to the above, the food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, and alcohol. , may contain carbonating agents used in carbonated drinks, etc. In addition, the food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages. These ingredients can be used independently or in combination. The ratio of these additives is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention, but is not limited thereto.

In addition, the present invention includes the steps of treating a candidate material to a sample containing a SYK protein or a gene encoding the SYK protein; And if the activity or expression level of the SYK protein or gene decreases compared to before treatment with the candidate material, determining that the candidate material has the activity of suppressing or improving resistance to anticancer drugs; Provided is a screening method for an agent for suppressing or improving resistance to anticancer drugs, including a.

In the present invention, the method of measuring the expression level of a gene or the amount of protein can be performed including a known process of isolating mRNA or protein from a biological sample using a known technique. The biological sample refers to a sample collected from a living body whose expression level of the gene or protein level is different from that of the normal control. The sample includes, for example, tissue, cells, blood, serum, plasma, saliva, urine, etc. This may include, but is not limited to.

The expression level of the gene is preferably measured by measuring the level of mRNA, and methods for measuring the level of mRNA include reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcription polymerase chain reaction, RNase protection assay, and Northern PCR. These include, but are not limited to, blots and DNA chips.

The protein level can be measured using an antibody. In this case, the marker protein in the biological sample and the antibody specific for it form a complex, that is, an antigen-antibody complex, and the amount of the antigen-antibody complex formed is determined by the detection label ( It can be measured quantitatively through the size of the signal of the detection label. These detection labels may be selected from the group consisting of, but are not limited to, enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioisotopes. Analytical methods for measuring protein levels include Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein. Chips, etc., but are not limited thereto.

In the present invention, the candidate material is an individual nucleic acid or protein that is estimated to have the potential as a drug that inhibits the activity or expression level of the SYK protein or the gene encoding the SYK protein according to a conventional selection method, or is randomly selected. , other extracts, natural products, compounds, etc.

In one embodiment of the present invention, it was confirmed that when a SYK inhibitor is administered in combination with a MEK inhibitor, anticancer drug resistance can be overcome and the anticancer effect can be increased through a synergistic effect, reducing the activity or expression level of the SYK protein or gene. The substance can be used as an agent for suppressing or improving resistance to anticancer drugs.

Additionally, the present invention provides a composition for predicting resistance to an anticancer drug, including an agent for measuring the expression or activity of spleen tyrosine kinase (SYK).

According to one embodiment of the present invention, it was confirmed that SYK was expressed at a high level in the CMS4 colon cancer cell line resistant to MEK inhibitors.

Therefore, when the expression or activity level of the SYK gene or protein is highly expressed or activated compared to the control group, it can be determined to be resistant to an anticancer agent. In this case, the control group is characterized in that it is a sample derived from an individual that is not resistant to MEK inhibitors. In the present invention, “sample” refers to any sample obtained from a subject in which expression of the gene or protein of the present invention can be detected. The samples include whole blood, plasma, serum, sputum, tears, mucus, nasal washes, nasal aspirate, and breath. (breath, urine, semen, saliva, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid) , leukocytes, peripheral blood mononuclear cells, buffy coat, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple absorption. Nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extract and cerebrospinal fluid. It may be one or more selected from the group consisting of fluid, but is not limited thereto.

In addition, the agent includes oligopeptides, monoclonal antibodies, polyclonal antibodies, chimeric antibodies, ligands, PNA (Peptide nucleic acid), aptamers, and anti-sense that specifically bind to SYK. sense) may be nucleotides, primers, or probes, but are not limited thereto.

Using the above agent, the activity or expression of the gene encoding the SYK protein in the sample can be confirmed, and the confirmation can be performed using any known method. For this purpose, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time polymerase reaction (real time RT-PCR), real time quantitative RT- It may be performed with one or more types selected from the group consisting of PCR), RNase protection method, Northern blotting, and DNA chip, but is not limited thereto.

Additionally, the activity or expression of SYK protein in a sample can be confirmed using the above agent, and the confirmation can be performed using any known method. For this purpose, Western blotting, ELISA (enzyme linked immunosorbent assay), ELLA (enzyme-linked lectin assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion method, and rocket (rocket) It can be performed with one or more types selected from the group consisting of immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip. , but is not limited to this.

The contents of the present invention described above are applied equally to each other unless they contradict each other, and implementation by a person skilled in the art with appropriate changes is also included in the scope of the present invention.

Hereinafter, the present invention will be described in detail through examples, but the scope of the present invention is not limited to the following examples.

Example 1. Selection of colon cancer cell lines showing resistance to MEK inhibitors

HCT116, SW620, and SW480 cells, which correspond to the CMS4 cell line among colorectal cancers and have KRAS mutations, were treated with MEK inhibitors trametinib and selumetinib. HCT116 cell line was purchased from the Korean Cell Line Bank, and SW480 and SW620 were purchased from ATCC. All cell lines were incubated with 10% fetal bovine serum (FBS), WelGENE) and antibiotics (100U/ml penicillin, 100μg/ml streptomycin, and 0.25μg/ml Fungizone). Life Technologies)) was cultured in DMEM (WelGENE) at 37°C and 5% CO ₂ . Additionally, trametinib (GSK1120212, MEK1/2 inhibitor) and selumetinib (AZD6244, MEK1/2 inhibitor) were purchased from APExBIO (Boston, USA). Fostamatinib (R788) disodium, a SYK inhibitor, was purchased from Chemscene (New Jersey, USA). Each cell line prepared as above was treated with trametinib at a concentration of 10 nM or 100 nM, and selumetinib at a concentration of 0.1 μM or 1.0 μM. MEK inhibitor was treated and monitored through cell growth assay for up to 141 hours, and cell staining was performed using crystal violet. First, cells were seeded in a 96 well plate at a density of 3-10×10³. Afterwards, the cells were treated with drugs for 18-20 hours, and 7 days later, they were stained with 1% (w/v) crystal violet (Sigma-Aldrich) for 30 minutes at room temperature. Afterwards, the cells were washed with distilled water and dried, and the morphology of cells in each experimental group was confirmed.

As a result, as shown in Figure 1, it was confirmed that SW620 and SW480 cells had higher cell viability when treated with MEK inhibitor compared to HCT116 cells (A and B in Figure 1). In addition, in photographs of cells treated with 10 nM and 100 nM of trametinib, it was confirmed that SW620 and SW480 showed a higher survival rate than HCT116 compared to cells not treated with trametinib, showing resistance to MEK inhibitors (Figure C of 1). Therefore, HCT116 cells were classified as CMS4 cell lines sensitive to MEK inhibitors, and SW620 and SW480 were classified as CMS4 cell lines resistant to MEK inhibitors.

Example 2. Identification of combination targets to enhance the effect of MEK inhibitors

Based on the results confirmed in Example 1, HCT116, SW620, and SW480 cell lines corresponding to CMS4 were classified into MEK inhibitor sensitive and resistant groups, and then the differences in proteomic data and gene expression data were analyzed. Among them, among the CD (Characteristic Direction) values and DEG (Differentially expressed gene) results, the log2 fold change values greater than 0 were visualized as 3D plots and shown in Figures 2A to 2E. As a result, it was confirmed that the level of SYK (spleen tyrosine kinase) was high in the cell line group resistant to MEK inhibitors (Figure 2a). In addition, as a result of constructing a gene co-expression network based on single-cell gene expression data of HCT116 (sensitive) and SW480 (resistant), SYK and MEK were more closely related to each other in SW480 than in HCT116, and SYK and MEK were more closely related to each other than in HCT116. It was confirmed that there are many other nodes involved (Figure 2b). In addition, cell experiments were conducted to confirm whether the analyzed biological data results showed the same trend in actual experiments. More specifically, the level of SYK was confirmed through real-time quantitative polymerase chain reaction (qRT-PCR) and Western blot analysis. First, HCT116, SW620, and SW480 cell lines were seeded at 3×10 ⁵ each, and then 48 hours later, cells were recovered and RNA was extracted. RNA was extracted using an RNA-spin kit (INTRON), and cDNA was synthesized using the DiaStar RT kit (Solgent) and 2X Taq premix (Solgent) according to the manufacturer's instructions. Quantitative RT-PCR was performed using QuantStudio5 (Applied Biosystem) using SYBR (GeNet Bio). In addition, SYK primers [forward: GGAGGAAGGCACACCACTAC, reverse: CAGACCAGGCCATCAGACTC] were used. Normalization was performed using the housekeeping gene GAPDH (Glyceraldehyde 3-phosphate dehydrogenase).

For Western blot analysis, HCT116, SW620, and SW480 cell lines were seeded at 3×10 ⁵ each, and the cells were recovered 48 hours later. Accordingly, lysis buffer (20mM HEPES (pH7.2), 150mM NaCl, 0.5% Triton Protein was obtained by treatment with 100, 10% glycerol, 0.1% SDS). Western blot was performed using anti-SYK (Santa cruz biotechnology, sc-1240) and anti-GAPDH antibodies (provided by Korea Research Institute of Bioscience and Biotechnology) to confirm the activity of the obtained protein.

As a result, consistent with the previous results, high SYK levels were confirmed in CMS4 cell lines showing resistance to MEK inhibitors (Figure 2c). In addition, using the proteome data of CMS4 patients, Kaplan-Meier survival analysis results based on high and low SYK levels confirmed that patients with high SYK levels had a low survival rate, and the SYK level was found to be related to the patient survival rate. It was confirmed that it had a significant effect (Figure 2d). In particular, as a result of checking the significance of the SYK level in other types of patient data other than CMS4, it was confirmed that no significance was shown in other types (Figure 2e).

Example 3. Confirmation of the effect of inhibiting SYK levels in cell lines resistant to MEK inhibitors

A SYK inhibitor (SYKi (fostamatinib disodium)) and two types of MEK inhibitors, Trametinib (Tra) and Selumetinib (Sel), were administered to the SW480 and SW620 cell lines resistant to the MEK inhibitors identified in the above examples. Cell growth was confirmed after treatment alone and in combination. More specifically, the cells were seeded in a 96 well plate at a density of 3-10×10³. 20 hours after cell seeding, each experimental group was treated with the corresponding drug, and the cells were photographed using an IncuCyte device for 6-7 days. At this time, trametinib was treated at 10nM and 100nM, respectively, and selumetinib was treated at 0.1uM and 1.0uM, respectively. To evaluate cell growth, the average area of cells was set using Incucyte ZOOM software, and cell photos were taken at 3-hour intervals. As a result, as shown in Figures 3a and 3b, it was confirmed that when SYK inhibitor and MEK inhibitor were treated in combination at low concentration, the effect of the inhibitor was greater than when treated alone at high concentration or showed the same effect as treatment alone at high concentration. In addition, to confirm whether the combined drug treatment of MEK inhibitor and SYK inhibitor produces a synergy effect, synergy score was calculated using SynergyFinder. As a result, as shown in Figure 3c, when the SW480 cell line was treated with a MEK inhibitor and a SYK inhibitor in combination, the synergy score was 8.33, and when they were treated together with SW620, the synergy score was 16.17, confirming that the combined administration had a high synergy score. . In addition, in addition to using drugs, we lowered the gene expression of SYK using shRNA and treated it with two types of MEK inhibitors to see if resistance to MEK inhibitors was overcome. First, shRNA targeting the SYK gene (shSYK; SHCLNG-NM_003177, Sigma), scrambled (shScrambled), and a mixture for gene packaging (pLP1, Lentivirus was produced by transfection with pLP2, pLP/VSVG). In addition, 4 μg/ml polybrene (Sigma-Aldrich) was added to SW620 cells and SW480 cells for transduction. Infected cells were selected using 1 μg/ml puromycin (Sigma-Aldrich). As a result, as shown in Figures 3d and 3e, by shRNA When SW620 and SW480, which had reduced SYK gene expression levels, were treated with a MEK inhibitor, cell growth was confirmed to be lower compared to cells in which the SYK gene expression level was not reduced. Crystal violet assay experiments also confirmed that cells resistant to MEK inhibitors with reduced SYK levels became sensitive to MEK inhibitors.

Example 4. Confirmation of the effect of increasing SYK levels in cell lines sensitive to MEK inhibitors

In addition, to confirm whether high levels of SYK result in resistance to MEK inhibitors, the SYK gene in the HCT116 cell line, which is a cell sensitive to MEK inhibitors, was overexpressed and cell growth was performed to see if the cells acquired resistance to MEK inhibitors. This was confirmed through experiment (A) and crystal violet analysis (B) using the same method as in Example 1 . First, HCT116 cells overexpressing the SYK gene and HCT116 cells not overexpressing SYK (negative control) were seeded in a 96-well plate at a density of 3 × 10³. 20 hours after cell seeding, cells were treated with 2nM or 4nM of trametinib, cultured for 6-7 days, and cells were photographed using an IncuCyte device. To evaluate cell growth, the average area of cells was set using Incucyte ZOOM software, and cell photos were taken at 3-hour intervals. As a result, as shown in Figure 4, when negative control (NC) and SYK overexpressed HCT116 cells were treated with trametinib at 2nM and 4nM, cell growth increased in SYK overexpressed cells compared to the negative control, and cell survival rate increased. It was confirmed that this was increasing.

Example 5. Confirmation of mechanism according to combined treatment of MEK inhibitor and SYK

To analyze the mechanism of combined processing of the previously identified MEK inhibitor and SYK inhibitor, cRaf, MEK, and ERK (extracellular signal-regulated kinase), proteins involved in the MAPK pathway, and cleaved caspase-3 (apoptosis marker) were used. Western blot for cleaved caspase-3) was performed. Among the resistant cell lines, SW620 cells, which had a higher synergy score, were treated with no drug, treated with 10 nM of the MEK inhibitor trametinib alone, and treated with 5 μM of the SYK inhibitor alone. MEK inhibitor and SYK inhibitor were used as described above. Cells treated with the combined concentration were obtained 48 hours later, and Western blotting was performed in the same manner as in Example 2 above to confirm protein activity.

At this time, anti-SYK (Santa cruz biotechnology, sc-1240), anti-phosphoSYK (Cell signaling technology, #2710), anti-ERK1/2 (Cell signaling technology, #9102), anti-phosphoERK1/2 (Cell signaling technology, #4370), anti-phosphoMEK (Cell signaling technology, #9121), anti-phosphocRaf (Cell signaling technology, #9427), anti-caspase3 (Santa cruz biotechnology, sc-7272) antibodies and rabbit polyclonal Anti-GAPDH antibody (provided by Korea Research Institute of Bioscience and Biotechnology) was used.

As a result, as shown in Figure 5, it was confirmed that when treated with the MEK inhibitor alone, the activity of cRaf increased while the activities of MEK and ERK were not completely inhibited. These results are consistent with the previously known phenomenon of cancer cells with KRAS mutations showing resistance due to the negative feedback loop of ERK when treated with MEK inhibitors. On the other hand, when treated with SYK inhibitor alone, ERK activity increased sharply. Interestingly, when the MEK inhibitor and SYK inhibitor were treated together, the activities of MEK and ERK were inhibited more strongly than when the MEK inhibitor was treated alone. In addition, cleaved caspase3, a cell death marker, was found to be significantly higher only when the two inhibitors were combined. This shows that treatment with a single inhibitor did not significantly induce cell death, but combined treatment with the two inhibitors significantly increased cell death. It was confirmed that this was possible (Figure 5A). In addition, the protein activity of ERK was confirmed by Western blot 48 hours after treatment with 10 nM of trametinib while the expression level of the SYK gene was reduced using shRNA. As a result, the protein activity of ERK was confirmed when the expression of SYK was only reduced. However, when the expression of SYK was reduced and treated with trametinib, it was confirmed that the activity of ERK protein was decreased. Therefore, it was confirmed that the results showed the same trend as the results of the combined treatment with the MEK inhibitor and SYK inhibitor previously confirmed (Figure 5B). Furthermore, to explore the mutual regulatory relationship between the SYK and MAPK pathways, SW620 cells were treated with low or high concentrations of SYK inhibitor and MEK inhibitor, respectively, and then obtained 48 hours later and Western blot was performed.

That is, as a result of confirming the activity against MEK and ERK 48 hours after treatment of SW620 cells with increasing concentrations of SYK inhibitor to 0 μM, 0.5 μM, 1 μM, 5 μM, and 10 μM, the activity of SYK increased as the concentration of SYK inhibitor increased. It was confirmed that the activity of ERK decreased and the activity of ERK increased (Figure 5C). Through this, it was confirmed that SYK is involved in suppressing ERK.

In addition, as a result of checking the activity of SYK 48 hours after treatment with trametinib at 0 nM, 1 nM, 5 nM, 10 nM, and 50 nM, it was confirmed that as MEK activity was inhibited, SYK activity was also inhibited (Figure 5D). Through this, it was confirmed that MEK is in a relationship to activate SYK. By combining the results of the mutual regulatory relationship confirmed above and the protein activation results, the state of the signaling network according to each inhibitor treatment condition was estimated and shown in Figure 6.

Overall, it was confirmed that SYK levels are expressed at a high level in the CMS4 colon cancer cell line that is resistant to MEK inhibitors, and that when colon cancer cells are treated with SYK inhibitors and MEK inhibitors in combination, the effect is significantly increased compared to treatment with MEK inhibitors alone. It can be useful in the treatment of colon cancer, especially colon cancer that is resistant to MEK inhibitors, and can also be useful in predicting the possibility of resistance to MEK inhibitors in colon cancer patients.

Claims (15)

A pharmaceutical composition for preventing or treating MEK (mitogen-activated protein kinase) inhibitor-resistant colorectal cancer, the pharmaceutical composition comprising (i) one or more SYK inhibitors selected from the group consisting of fostamatinib and sebidoplenib and (ii) Effective at least one MEK inhibitor selected from the group consisting of trametinib, selumetinib, binimetinib, pimasertib, repametinib, cobimetinib, U0126 EtOH, PD184352, PD98059, BIX02188, AZD8330, TAK733 and PD318088. Includes people; A pharmaceutical composition, wherein the MEK inhibitor-resistant colon cancer is CMS4 colon cancer.
delete delete According to paragraph 1,
A pharmaceutical composition for preventing or treating MEK (mitogen-activated protein kinase) inhibitor-resistant colon cancer, wherein the active ingredient (ii) is tramethinyl or selumethinyl.
According to paragraph 1,
A pharmaceutical composition for preventing or treating MEK (mitogen-activated protein kinase) inhibitor-resistant colon cancer, wherein the active ingredient (i) is fostamatinib.
delete delete delete delete A food composition for preventing or improving MEK (mitogen-activated protein kinase) inhibitor-resistant colorectal cancer, the food composition comprising (i) “one or more SYK inhibitors selected from the group consisting of fostamatinib and sebidoplenib and (ii) ) “One or more MEK inhibitors selected from the group consisting of trametinib, selumetinib, binimetinib, pimasertib, repametinib, cobimetinib, U0126 EtOH, PD184352, PD98059, BIX02188, AZD8330, TAK733 and PD318088 Contains as active ingredients; A food composition, wherein the MEK inhibitor-resistant colon cancer is CMS4 colon cancer.
(a) processing a candidate material on a sample containing a SYK protein or a gene encoding the SYK protein; and
(b) If the activity or expression level of the SYK protein or gene decreases compared to before treatment with the candidate material, the candidate material is trametinib, selumetinib, binimetinib, pimasertib, lepametinib, cobimetinib, U0126 Inhibition of resistance to an anticancer drug MEK inhibitor, comprising the step of determining that there is resistance inhibition or improvement activity to one or more MEK inhibitors selected from the group consisting of EtOH, PD184352, PD98059, BIX02188, AZD8330, TAK733, and PD318088. or a method of screening for improvement agents.
Oligopeptides that specifically bind to SYK, monoclonal antibodies, polyclonal antibodies, chimeric antibodies, ligands, PNA (Peptide nucleic acid), aptamers, anti-sense nucleotides, Anticancer agents trametinib, selumetinib, binimetinib, pimasertib, repametinib, cobimetinib, U0126 EtOH, PD184352, PD98059, BIX02188, AZD8330, TAK733 and PD318088, characterized in that they contain primers or probes. A composition for predicting resistance to one or more MEK inhibitors selected from the group consisting of.
delete According to clause 12,
When the expression or activity level of the SYK gene or protein is highly expressed or highly activated compared to the control group, the anticancer drugs trametinib, selumetinib, binimetinib, pimasertib, lepametinib, cobimetinib, U0126 A composition for predicting resistance to MEK inhibitors, characterized in that it is determined to have resistance to one or more MEK inhibitors selected from the group consisting of EtOH, PD184352, PD98059, BIX02188, AZD8330, TAK733 and PD318088.
According to clause 14,
A composition for predicting resistance to MEK inhibitors, wherein the control group is a sample derived from an individual that is not resistant to MEK inhibitors.