KR102655519B1 - Composition for Prophylaxis and Treatment of Osteoporosis Comprising Sparganium Rhizoma Extract - Google Patents

Abstract

The present invention relates to the effect of the Samneung extract on preventing or treating osteoporosis and the effect of inhibiting bone loss, bone resorption and osteoclast differentiation. The Samneung extract is non-cytotoxic and inhibits osteoclast differentiation, bone resorption and actin ring formation. , it suppresses the expression of osteoclast differentiation transcription factors, osteoclast differentiation-related genes, bone resorption-related genes, and osteoclast fusion-related genes, so it can be usefully used to suppress bone loss or prevent or treat bone diseases. .

Description

Composition for preventing and treating osteoporosis comprising Samneung extract {Composition for Prophylaxis and Treatment of Osteoporosis Comprising Sparganium Rhizoma Extract}

The present invention relates to the effects of Samneung extract on preventing or treating osteoporosis and its effects on inhibiting bone loss, bone resorption, and osteoclast differentiation.

Bone is a dynamic tissue, and high-quality bone is continuously remodeled through the balance between osteoclasts, which absorb bone, and osteoblasts, which form bone. However, in postmenopausal women, the number and activity of osteoclasts rapidly increase due to estrogen deficiency, which reduces bone mass and increases the risk of developing bone-related diseases such as osteoporosis and rheumatoid arthritis. Osteoporosis is a disease that weakens bones, increasing the risk of fracture, and is closely related to age. Therefore, as average life expectancy has recently increased, interest in osteoporosis is increasing.

Osteoclasts are multinucleated cells derived from hematopoietic stem cells. Differentiation into osteoclasts is a very important process for bone resorption, and the main factor responsible for differentiation into osteoclasts is RANKL (receptor activator of NF-κB ligand). It has been reported that RANKL binds to the receptor RANK and activates several intracellular signaling substances, such as NF-κB, c-Fos, and NFATc1 (nuclear factor of activated T cell c1), which are important in the formation of osteoclasts. Activated c-Fos is induced by RANKL and induces NFATc1, another transcription factor. NFATc1 is an important transcription factor essential for osteoclast differentiation. It also contains osteoclast indicators TRAP (tartrate-resistant acid phosphatase), OSCAR (osteoclast-associated receptor), CtsK (cathepsin K), MMP-9 (matrix methalloproteinase 9), and DC- It promotes the expression of STAMP (dendritic cell-specific transmembrane protein), etc. to activate the differentiation and function of osteoclasts, thereby regulating bone resorption, activation, survival and differentiation.

Currently, the most commonly used treatment for osteoporosis is bisphosphonates. However, it is known that treating osteoporosis with bisphosphonate agents can cause side effects such as osteonecrosis and atypical fractures. Therefore, there is a need to develop treatments derived from natural products without side effects.

Meanwhile, Sparganium Rhizoma (SR) is a medicinal herb made from the dried tuber root of Sparganium stoloniferum Buchanan-Hamilton of the Sparganiaceae family, and the roots and stem parts are used medicinally. Samneung has pharmacological effects on platelet coagulation, blood clot removal, and blood stagnation, and is known to have antibacterial and antioxidant effects, but nothing is known about its bone metabolism treatment effects.

Accordingly, the present inventors confirmed the effect of Samneung on osteoclast differentiation-related factors and confirmed that Samneung extract has the effect of effectively suppressing the differentiation of osteoclasts, which are known to be the main cause of postmenopausal osteoporosis. The present invention was completed by confirming that it can be used to improve various bone diseases, including osteoporosis.

Korean Patent Publication No. 10-2019-0117153

An object of the present invention is to provide a composition for inhibiting bone loss.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating bone diseases.

Another object of the present invention is to provide a food composition for preventing or improving bone disease.

Another object of the present invention is to provide a composition for inhibiting osteoclast differentiation or bone resorption.

In order to achieve the above purpose,

The present invention provides a composition for inhibiting bone loss containing Sparganium Rhizoma extract as an active ingredient.

Additionally, the present invention provides a pharmaceutical composition for preventing or treating bone diseases containing Samneung extract as an active ingredient.

Furthermore, the present invention provides a food composition for preventing or improving bone disease containing Samneung extract as an active ingredient.

Furthermore, the present invention provides a composition for inhibiting osteoclast differentiation or bone resorption containing Samneung extract as an active ingredient.

The Samneung extract according to the present invention is non-cytotoxic and inhibits osteoclast differentiation and bone resorption, inhibits actin ring formation in osteoclasts, and regulates osteoclast differentiation transcription factors, osteoclast differentiation-related genes, and bone resorption-related factors. Since it suppresses the expression of genes related to fusion of osteoclasts and osteoclasts, it can be usefully used to suppress bone loss or prevent or treat bone diseases.

Figure 1 is a graph showing the results of confirming the cytotoxicity of Samneung ethanol extract (SR).
Figure 2 is a diagram confirming osteoclast differentiation ability by treatment with Samneung ethanol extract (SR).
Figure 3 is a diagram confirming the bone resorption inhibition effect by Samneung ethanol extract (SR).
Figure 4 is a diagram confirming the inhibitory effect of Samneung ethanol extract (SR) on osteoclast actin ring formation.
Figure 5 is a diagram confirming the effect of suppressing protein expression of NFATc1 and c-Fos, which are osteoclast differentiation transcription factors, by treatment with Samneung ethanol extract (SR).
Figure 6 shows osteoclast differentiation-related TRAP, NFATc1, c-Fos, and RANK, bone resorption-related CTK, MMP-9, and CA2, and osteoclast fusion-related ATP6v0d2, OSCAR, and DC-STAMP by treatment with Samneung ethanol extract (SR). This is a diagram confirming the effect of suppressing gene expression.

Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings. In the following description, detailed descriptions of techniques well known to those skilled in the art may be omitted. Additionally, when describing the present invention, if it is determined that a detailed description of a related known function or configuration may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. In addition, the terminology used in this specification is a term used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator or the customs of the field to which the present invention belongs.

Therefore, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part is said to “include” a certain element, this means that it may further include other elements rather than excluding other elements, unless specifically stated to the contrary.

The present invention relates to a composition for inhibiting bone loss containing Sparganium Rhizoma extract as an active ingredient.

The term "extract" used in the present invention refers to a preparation obtained by squeezing a herbal medicine into an appropriate leachate and evaporating the leachate to concentrate. It is not limited thereto, but is not limited to the extract, dilution or concentrate of the extract obtained by extraction treatment, It may be a dried product obtained by drying the extract, a crude product thereof, or a purified product. The above-mentioned Argentine extract or Wangbulryuhaeng extract can be prepared using general extraction, separation and purification methods known in the art. The extraction method is not limited thereto, but preferably includes boiling water extraction, hot water extraction, cold needle extraction, reflux cooling extraction, or ultrasonic extraction.

In the present invention, the extract can be prepared by extracting with an extraction solvent or fractionating the extract by adding a fractionating solvent to the extract prepared by extraction with an extraction solvent. The extraction solvent is not limited to this, but water, an organic solvent, or a mixed solvent thereof may be used. The organic solvent may be an alcohol having 1 to 4 carbon atoms, a polar solvent such as ethyl acetate or acetone, hexane, or dichloromethane. A non-polar solvent of methane or a mixed solvent thereof can be used. Additionally, water, alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof can be preferably used, and more preferably, a mixed solvent of water and ethanol can be used. In one example of the present invention, 'Samneung Ethanol Extract (SR)' was prepared by extraction using an 80% (v/v) ethanol aqueous solution as the solvent and then freeze-drying.

In one embodiment, the extract of the present invention is extracted with at least one extraction solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol, and butylene glycol. It can be extracted, and it is more preferable that it is extracted with an extraction solvent that is a mixture of water and ethanol.

In one embodiment, the composition of the present invention can inhibit osteoclast differentiation or bone resorption.

In one embodiment, the composition of the present invention may include Wangbulryuhaeng thermal water extract at a concentration of 1 to 2000 μg/ml, preferably 125 to 1000 μg/ml, but is not limited thereto. .

Additionally, the present invention relates to a pharmaceutical composition for preventing or treating bone diseases containing Sparganium Rhizoma extract as an active ingredient.

In one embodiment, the bone disease is selected from the group consisting of osteoporosis, osteopenia, osteolytic metastasis, senile kyphosis, and Paget disease. There may be more than one, preferably osteoporosis or osteopenia, and more preferably osteoporosis.

In one embodiment, the composition of the present invention can inhibit the RANK signaling pathway.

In one embodiment, the composition of the present invention can inhibit the expression of proteins or genes related to osteoclast differentiation. The protein or gene related to osteoclast differentiation may be any one selected from the group consisting of NFATc1 (nuclear factor of activated T cell c1), c-Fos, TRAP (tartrate-resistant acid phosphatase), and OSCAR (osteoclast-associated receptor). there is.

In one embodiment, the composition of the present invention can inhibit the expression of genes related to bone resorption. The gene related to bone resorption may be any one selected from the group consisting of matrix methalloproteinase 9 (MMP-9), Cathepsin K (CTK), and carbonic anhydrase II (CA2).

In one embodiment, the composition of the present invention can inhibit the expression of genes associated with osteoclast fusion. The gene related to osteoclast fusion may be any one selected from the group consisting of ATP6v0d2 (d2isoform of vacuolar H+-ATPase V0 domain) and DC-STAMP (dendritic cell-specific transmembrane protein).

In one embodiment, the bone disease of the present invention may be caused by hyper-differentiation or hyper-activation of osteoclasts. The differentiation or activation of osteoclasts may be induced by RANKL.

In one embodiment, the bone disease of the present invention may exhibit increased activity or increased expression of proteins or genes related to osteoclast differentiation, and the proteins or genes related to osteoclast differentiation include TRAP, NFATc1, c-Fos, It may be selected from the group consisting of RANK and OSCAR.

In one embodiment, the bone disease of the present invention may exhibit increased activity or increased expression of a protein or gene related to bone resorption, and the protein or gene related to osteoclast differentiation consists of CTK, MMP-9, and CA2. It may be selected from a group.

In one embodiment, the bone disease of the present invention may exhibit increased activity or increased expression of a protein or gene related to osteoclast fusion, and the protein or gene related to osteoclast differentiation is a group consisting of ATP6v0d2 and DC-STAMP. It may be selected from .

The pharmaceutical composition of the present invention may additionally include adjuvants. Any adjuvant known in the art may be used without limitation, but, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase immunity.

As used herein, the term "treatment", unless otherwise stated, means reversing, alleviating, inhibiting the progression of, or It means prevention, and the term treatment as used herein refers to the act of treating. Accordingly, treatment or therapy for bone disease in mammals may include one or more of the following:

(1) Inhibits the growth, i.e., arrests the development, of bone diseases;

(2) prevent the spread of bone disease, i.e. prevent metastasis;

(3) alleviating bone disease;

(4) preventing recurrence of bone disease; and

(5) Alleviating symptoms of bone disease (palliating)

As used herein, the term “mammal” refers to a mammal, preferably a human, that is the subject of treatment, observation or experiment.

A composition is indicated as “pharmaceutically or physiologically acceptable” if the recipient animal can tolerate administration of the composition or if administration of the composition to the animal is suitable. If the amount administered is physiologically significant, the agent may be said to have been administered in a “therapeutically effective amount.” An agent is physiologically significant if its presence causes a detectable change in the physiology of the recipient patient.

The therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as administration method, target site, patient condition, etc. Therefore, when used in the human body, the dosage must be determined as appropriate by considering both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal testing. These considerations in determining an effective amount include, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used in the present invention, the term "pharmaceutically effective amount" refers to an amount that is sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level is determined by the patient's Factors including health status, type and severity of disease, activity of drug, sensitivity to drug, method of administration, time of administration, route of administration and excretion rate, duration of treatment, drugs combined or used simultaneously, and other factors well known in the field of medicine. It can be decided depending on The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

The composition of the present invention may also include carriers, diluents, excipients, or combinations of two or more commonly used in biological products. Pharmaceutically acceptable carriers are not particularly limited as long as they are suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. The compounds described in, saline solution, sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these ingredients can be mixed and used, and if necessary, other ingredients such as antioxidants, buffers, and bacteriostatic agents. Normal additives can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate dosage forms such as aqueous solutions, suspensions, emulsions, etc., into pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or ingredient using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions according to conventional methods. .

As used in the present invention, the term “pharmaceutically acceptable” means that the composition exhibits non-toxic properties to cells or humans exposed to the composition.

The pharmaceutical composition of the present invention may further include pharmaceutically acceptable additives. In this case, the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, stearic acid. Calcium, white sugar, dextrose, sorbitol, and talc may be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

As used in the present invention, the term "administration" means providing a predetermined substance to a patient by any suitable method, and is administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) depending on the desired method. It can be applied as an injection formulation) or orally administered, and the dosage range varies depending on the patient's weight, age, gender, health status, diet, administration time, administration method, excretion rate, and severity of the disease.

The composition of the present invention can be administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) or orally depending on the desired method, and the dosage is determined by the subject's age, weight, gender, physical condition, etc. is selected taking into account. It is obvious that the concentration of the active ingredient included in the pharmaceutical composition can be selected in various ways depending on the subject, and it is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 μg/ml. If the concentration is less than 0.01 ㎍/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 ㎍/ml, it may be toxic to the human body.

The pharmaceutical composition of the present invention may be formulated in various oral or parenteral dosage forms. Dosage forms for oral administration include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsifiers, syrups, granules, etc. These dosage forms contain diluents (e.g. lactose, dextrose, water) in addition to the active ingredient. crose, mannitol, sorbitol, cellulose and/or glycine), lubricants (e.g. silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). Additionally, the tablets may contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and in some cases starch, agar, alginic acid. or disintegrants such as sodium salts thereof or effervescent mixtures and/or absorbents, colorants, flavoring and sweetening agents. The formulation can be prepared by conventional mixing, granulating or coating methods. In addition, representative formulations for parenteral administration are injectable formulations, and solvents for injectable formulations include water, Ringer's solution, isotonic saline solution, or suspension. The sterile fixed oil of the injectable preparation can be used as a solvent or suspending medium, and any non-irritating fixed oil, including mono- and di-glycerides, can be used for this purpose. Additionally, the injectable preparation may use fatty acids such as oleic acid.

In the present invention, the term “prevention” refers to all actions that inhibit or delay the occurrence, spread, and recurrence of bone disease or osteoporosis by administering the pharmaceutical composition according to the present invention.

Furthermore, the present invention relates to a food composition for preventing or improving bone disease containing Sparganium Rhizoma extract as an active ingredient.

In one embodiment, the bone disease is selected from the group consisting of osteoporosis, osteopenia, osteolytic metastasis, senile kyphosis, and Paget disease. There may be more than one, preferably osteoporosis or osteopenia, and more preferably osteoporosis.

When using the composition of the present invention as a food composition, the composition can be added as is or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. In addition to the active ingredients, the composition may contain food additives acceptable to the food industry, and the mixing amount of the active ingredients can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment).

The term "food supplement" used in the present invention refers to a component that can be added as an auxiliary food additive, and can be appropriately selected and used by a person skilled in the art as it is added to manufacture each type of health functional food. Examples of food supplements include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, and protective colloidal thickeners. , pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., but the types of food supplements of the present invention are not limited to the above examples.

The food composition of the present invention may include health functional foods. The term "health functional food" used in the present invention refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and pills using raw materials or ingredients with functional properties useful to the human body. Here, ‘functionality’ means controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes, such as physiological effects. The health functional food of the present invention can be manufactured by methods commonly used in the field of technology, and can be manufactured by adding raw materials and components commonly added in the field of technology. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a health functional food. The food composition of the present invention can be manufactured in various forms, and unlike general drugs, it is made from food as a raw material and has the advantage of not having side effects that may occur when taking the drug for a long period of time. It is also excellent in portability, and the present invention Health functional foods can be consumed as supplements to enhance the effectiveness of arthritis or osteoporosis treatments.

Additionally, there is no limitation to the types of health foods in which the composition of the present invention can be used. In addition, a composition containing the extract of the present invention or a fraction thereof as an active ingredient can be prepared by mixing known additives with other appropriate auxiliary ingredients that may be contained in health functional foods according to the selection of a person skilled in the art. Examples of foods that can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and There are vitamin complexes, etc., and they can be manufactured by adding them to juices, teas, jellies, juices, etc. prepared using the extract according to the present invention as a main ingredient.

Furthermore, the present invention relates to the use of Sparganium Rhizoma extract as an active ingredient for inhibiting osteoclast differentiation or bone resorption.

In one embodiment, the osteoclast differentiation or bone resorption may be induced by RANKL.

Since the composition of the present invention is made from natural ingredients, it may have fewer side effects compared to common synthetic compounds even when used as a pharmaceutical composition or food composition, so it can be safely included in pharmaceutical compositions and health functional foods.

The present invention will be described in more detail through the following examples. However, the following examples are only for illustrating the content of the present invention and are not intended to limit the present invention.

<Example 1> Preparation of Samneung extract

Samreung (三稜, China) was purchased through OmniHerb. 1500 ml of 80% (v/v) ethanol aqueous solution was added to 150 g of Samneung and soaked and extracted for 2 weeks. The extract was filtered through filter paper (Whatman, No 2). Afterwards, it was concentrated using a vacuum concentrator, then freeze-dried and powdered. The final dried ethanol extract of Sparganium Rhizoma (SR) obtained was 5.5 g, and the yield was 3.7%. The Samneung ethanol extract (SR) was kept refrigerated until use.

<Example 2> Confirmation of cytotoxicity

RAW 264.7 cells were cultured in a 100° dish using DMEM medium mixed with 10% FBS and 1% P/S in an incubator with 95% humidity, a temperature of 37°C, and 5% CO ₂ environmental conditions. RAW 264.7 cells were distributed in a 96-well plate and cultured for 24 hours. After stabilization, the medium was removed and new medium was added, while the SR powder prepared in Example 1 was filtered through a sterile filter (pore size 0.22 μm) and added to each culture medium at a concentration of 125, 250, 500, or 1000 μg/ml. Then, it was cultured for 24 hours. Afterwards, the cell viability was confirmed by treating the cells with the MTS assay solution and measuring the absorbance at 405 nm. Cytotoxicity was expressed as a percentage relative to the untreated control.

As a result, Samneung ethanol extract (SR) did not show cytotoxicity at any concentration (Figure 1).

<Example 3> Confirmation of osteoclast differentiation inhibition ability

In order to evaluate the osteoclast differentiation inhibitory ability of the Samneung ethanol extract (SR of Example 1) according to the present invention, TRAP (tartrateresistant acid phosphatase) staining and TRAP activity measurement were performed.

In order to induce differentiation of osteoclasts, as in the above example, RAW 264.7 cells were seeded in a 96-well plate and cultured for 24 hours, then replaced with medium containing RANKL (100 ng/ml). At this time, the Samneung experimental group added SR to the above medium at a concentration of 125, 250, 500, or 1000 μg/ml, and cultured for 5 days, replacing the same medium every 2 days. Differentiated osteoclasts were stained using a TRAP assay kit. Afterwards, the stained cells were observed using an inverted microscope, and cells with three or more nuclei were counted as multinucleated osteoclasts. Here, cells that were not treated with RANKL were confirmed as the normal group.

Afterwards, to measure TRAP activity, a reagent prepared by mixing 4.93 mg of 4-Nitrophenyl phosphate disodium salt hexahydrate (Sigma aldrich, MO, USA), 850 μL of 0.5 M acetate, and 150 μL of tartrate acid solution was mixed with the culture medium (culture medium) of the cultured cells. ) 50μ of each was dispensed into a new 96-well plate and reacted at 37°C for 60 minutes. Afterwards, the reaction was terminated by treatment with 50 μL of 0.5M NaOH, and TRAP activity was confirmed by measuring absorbance at 405 nm using an ELISA device.

As a result, the control group (group treated only with RANKL) had more TRAP-positive cells, i.e., multinucleated osteoclasts, formed than the normal group (untreated group with RANKL), but in the experimental group treated with SR, osteoclast formation was reduced. confirmed. In particular, as a result of measuring TRAP enzyme activity, the control group showed an increase in TRAP enzyme activity compared to the normal group, while the SR-treated group showed a decrease in TRAP enzyme activity compared to the control group (Figure 2).

<Example 4> Confirmation of bone resorption inhibition effect

In order to evaluate the bone resorption inhibitory effect of the Samneung ethanol extract (SR of Example 1) according to the present invention, pit formation inhibition ability analysis was performed.

Cultured as in the above example, but 24 hours after dispensing RAW 264.7 cells on an osteo assay surface multiple well plate, RANKL (100 ng/ml) and SR 125, 250, 500, or 1000 μg/ml were added to the culture medium. and cultured for 5 days. It was stabilized by replacing it with the added culture medium. After differentiation was completed, cells were removed by treatment with 4% NaCIO. The plate was washed with distilled water, and the pits formed by osteoclasts were observed using an inverted microscope to analyze the absorbed pit area. Pit area was measured using Image J software Ver. It was measured using 1.46 (National Institutes of Health, Washington D.C., USA), and the pit area was expressed as a percentage of the total area.

As a result, the pit area in the control group treated only with RANKL increased compared to the normal group, but in the experimental group treated with SR, the pit area decreased in a concentration-dependent manner, confirming that SR inhibits the formation of pits that indicate bone resorption. (Figure 3).

<Example 5> Confirmation of osteoclast actin ring inhibition effect

To evaluate the ability of the Samneung ethanol extract (SR of Example 1) according to the present invention to inhibit osteoclast actin ring, immunofluorescence analysis was performed.

As in the above example, RAW 264.7 cells were distributed in a 96-well plate, and after 24 hours, the medium was replaced with RANKL (100 ng/ml) and SR 125, 250, 500, or 1000 μg/ml, and cultured for 5 days. did. Afterwards, the same medium was replaced every two days and cultured until mature osteoclasts were formed and stabilized. Afterwards, the medium was removed, fixed with 4% formaldehyde, and treated with 0.1% Triton X-100 (in PBS) for 1 minute to increase cell permeability. Then, to visualize the actin rings, the F-actin rings were stained with Acti-stain™ 488 Fluorescent Phalloidin, and then the actin rings and DAPI staining were observed using an immunofluorescence microscope.

As a result, in the control group (RANKL-treated group), mature actin rings were formed compared to the normal group (RANKL-untreated group), whereas in the experimental group treated with SR, actin ring formation was inhibited (Figure 4).

<Example 6> Confirmation of the effect of suppressing the expression of osteoclast differentiation transcription factors

The effect of the Samneung ethanol extract (SR of Example 1) according to the present invention on the protein expression of NFATc1 and c-Fos, which are key mechanisms of osteoclast differentiation, was confirmed by the following method.

As in the above example, RAW 264.7 cells were distributed in a 96-well plate, and after 24 hours, the medium was replaced with RANKL (100 ng/ml) and SR 125, 250, 500, or 1000 μg/ml, and cultured for 1 day. did. Afterwards, the cultured cells were washed with PBS and then added to RIPA buffer (50 mM Tris.Cl, 150 mM NaCl, 1% NP-40) containing protease inhibitor and phosphatase inhibitor. , 0.5% Na.deoxycholate and 0.1% SDS) were used to dissolve the protein and extract the protein from the cells.

The extracted protein was quantified using the BCA protein assay, and then electrophoresed on a 10% polyacrylamide/SDS gel for detection by primary and secondary antibody reactions through western blot assay, and then transferred to a nitrocellulose transfer membrane. Afterwards, the membrane was blocked with 5% skim milk dissolved in TBST (0.05% Tween-20 in Tris-buffered saline, pH 7.4), reacted with anti-NFATc1 antibody and anti-c-Fos antibody, and then reacted with secondary antibody. I ordered it. Next, the ECL solution (Santacruz, California USA) was mixed well at a ratio of 1:1, applied on the membrane to emit light (color development), and developed on an X-ray film to confirm the level of protein expression. Protein expression levels of NFATc1 and c-Fos were quantified through Actin.

As a result, the expression of NFATc1 and c-Fos proteins in the control group treated with RANKL increased compared to the normal group, and the expression of NFATc1 and c-Fos in the experimental group treated with SR was confirmed to be significantly decreased compared to the control group ( Figure 5). When quantified using Actin, the expression of NFATc1/c-Fos in the SR-treated experimental group was found to be significantly suppressed at concentrations of 500 and 1000 μg/ml (p<0.05, p<0.01).

<Example 7> Confirmation of osteoclast differentiation and bone resorption-related gene expression

The effect of the Samneung ethanol extract (SR of Example 1) according to the present invention on the expression of genes (mRNA) related to the core mechanism of osteoclasts was confirmed by the following method.

As in the above example, RAW 264.7 cells were distributed in a 96-well plate, and after 24 hours, the medium was replaced with RANKL (100 ng/ml) and SR 125, 250, 500, or 1000 μg/ml, and cultured for 4 days. did. Total RNA was extracted by treating the cultured cells with Trizol solution (Invitrogen, USA). The extracted RNA was then quantified to 2 μg using a nanodrop device and then synthesized into cDNA (complementary DNA) using reverse transcriptase. The synthesized cDNA was amplified by PCR using Taq polymerase, and real-time PCR was performed using the primers shown in Table 1 below. Afterwards, the resulting product was electrophoresed on a 1.2% agarose gel and stained with SYBR Green. The expression level of each gene was normalized to the mRNA concentration using GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), and the band density of each band was analyzed using Image J software (Ver. 1.46, National Institutes of Health). .

Gene name Sequence Annealing Cycle TRAP F: ACT TCC CCA GCC CTT ACT ACC
GR: TCA GCA CAT AGC CCA CAC CG 58℃ 30 NFATc1 F: TGC TCC TCC TCC TGC TGC TC
R: CGT CTT CCA CCT CCA CGT CG 58℃ 32 c-Fos F: ATG GGC TCT CCT GTC AAC AC
R: GGC TGC CAA AAT AAA CTC CA 58℃ 40 RANK F: AAA CCT TGG ACC AAC TGC AC
R: ACC ATC TTC TCC TCC CHA GT 53℃ 35 CTK F: AGG CGG CTA TAT GAC CAC TG
R: CCG AGC CAA GAG AGC ATA TC 58℃ 26 MMP-9 F: CGA CTT TTG TGG TCT TCC CC
R: TGA AGG TTT GGA ATC GAC CC 58℃ 30 CA2 F: CTC TCA GGA CAA TGC AGT GCT GA
R: ATC CAG GTC ACA CAT TCC AGC A 58℃ 32 OSCAR F: CTG CTG GTA ACG GAT CAG CTC CCC AGA
R: CCA AGG AGC CAG AAC CTT CGA AAC T 53℃ 35 ATP6v0d2 F: ATG GGGCCTTGCAAAAGAAATCTG
R: CGA CAG CGT CAA ACA AAG GCT TGT A 58℃ 30 DC-STAMP F: TGG AAG TTC ACT TGA AAC TAC GTG
R: CTC GGT TTC CCG TCA GCC TCT CTC 63℃ 40 GAPDH F: ACT TTG TCA AGC TCA TTT CC
R: TGC AGC GAA CTT TAT TGA TG 58℃ 30

SR has TRAP, NFATc1, c-Fos, RANK, and OSCAR, indicators of the main mechanism of osteoclast differentiation, CTK, MMP-9, and CA2, indicators of bone resorption-related mechanisms, and ATP6v0d2 and DC-, indicators of osteoclast fusion-related mechanisms. As a result of analyzing the effect on the mRNA expression of STAMP, in the control group treated only with RANKL, the mRNA expression of TRAP, NFATc1, c-Fos, RANK, MMP-9, CA2, OSCAR, ATPv06d2, and DC-STAMP was significant compared to the normal group. On the other hand, in the SR-treated group, the expression of TRAP, NFATc1, c-Fos, RANK, MMP-9, CA2, OSCAR, ATPv06d2, and DC-STAMP was suppressed in a concentration-dependent manner (Figure 6).

Claims (12)

A pharmaceutical composition for preventing or treating osteoporosis containing Sparganium Rhizoma extract as an active ingredient. According to clause 1,
The composition is that the extract is extracted with a solvent selected from the group consisting of water, anhydrous or hydrous alcohol having 1 to 4 carbon atoms, ethyl acetate, acetone, glycerin, ethylene glycol, propylene glycol, and butylene glycol. According to clause 1,
The composition is a composition that inhibits osteoclast differentiation or bone resorption. According to clause 1,
The composition inhibits the RANK signaling pathway. According to clause 1,
The composition is a composition that inhibits the expression of proteins or genes related to osteoclast differentiation. According to clause 5,
The composition wherein the protein or gene related to osteoclast differentiation is selected from the group consisting of nuclear factor of activated T cell c1 (NFATc1), c-Fos, tartrate-resistant acid phosphatase (TRAP), and osteoclast-associated receptor (OSCAR). . According to clause 1,
The composition is a composition that inhibits the expression of genes related to bone resorption. According to clause 7,
A composition, wherein the gene related to bone resorption is selected from the group consisting of MMP-9 (matrix methalloproteinase 9), CTK (Cathepsin K), and CA2 (carbonic anhydrase II). According to clause 1,
The composition is a composition that inhibits the expression of genes related to osteoclast fusion. According to clause 9,
The composition, wherein the gene related to osteoclast fusion is selected from the group consisting of ATP6v0d2 (d2isoform of vacuolar H+-ATPase V0 domain) and DC-STAMP (dendritic cell-specific transmembrane protein). According to clause 1,
The composition, wherein the osteoporosis is caused by hyper-differentiation or hyper-activation of osteoclasts. A food composition for preventing or improving osteoporosis containing Sparganium Rhizoma extract as an active ingredient.