KR102651224B1 - PCR Method for Detecting Multiple Nucleic Acids Targets Using a Single Signal - Google Patents

Abstract

The present invention discloses a PCR method for real-time detection of two target nucleic acids with a single signal. The method of the present invention detects signals for each target nucleic acid in the annealing step and the extension step among the three steps of PCR: denaturation, annealing, and extension. That is, among the two target nucleic acids, the signal for the first target nucleic acid is detected in the annealing step, and the signal for the second target nucleic acid is detected in the extension step. Each detected signal provides qualitative and/or quantitative information about each of the two target nucleic acids. At this time, the detection signal is the same single signal for both target nucleic acids, and can be detected in one detection channel.

Description

PCR method for detecting two or more multiple target nucleic acids with a single signal {PCR Method for Detecting Multiple Nucleic Acids Targets Using a Single Signal}

The present invention relates to a multiplex detection PCR method for detecting two or more target nucleic acids with a single signal.

Polymerase chain reaction (PCR) is a molecular biological technology that amplifies target nucleic acid (DNA) 10 ⁶ to 10 ¹⁰ times by DNA polymerase. It was developed by Mullis et al. in 1983 and is widely used in all fields of life sciences, including medicine. It is essentially used for gene detection, gene isolation, and acquisition.

Real-time polymerase chain reaction (real-time PCR or quantitative PCR) is a technology that detects the target nucleic acid simultaneously with amplification, unlike the existing PCR amplification technology and then analyzing the amplification product by electrophoresis. It accurately determines the initial concentration of the target nucleic acid. This enables more accurate quantitative analysis, and since amplification and detection are performed in a sealed reaction tube, the possibility of contamination is low and the accuracy and reliability of detection are high.

Real-time polymerase chain reaction uses an intercalator such as ethidium bromide, SYBR Green I, or EvaGreen to detect amplification products simultaneously with PCR amplification, or uses a TaqMan probe ( Using hydrolyzable probes such as TaqMan probe (US Patent Nos. 5,210,015 and 5,538,848), Molecular beacon (Tyagi et al, Nature Biotechnology v14 MARCH 1996), HyBeacon (French DJ et al. al, Mol Cell Probes, 15(6):363-374, 2001), and two hybridization probes labeled as donor and acceptor, respectively (Bernad et al, 147-148 Clin Chem 2000; 46). probes) or labeled primers such as Sunrise primer (US Patent No. 6,117,635), Scorpion primer (US Patent No. 6,326,145), or TSG primer (WO 2011/078441). Use . Since the intercalator has the property of inserting into all DNA double strands, melting curve analysis is required after PCR amplification to increase specificity or multiplex detection of target nucleic acids, but in the case of probe or labeled primer methods, Since the probe generates a signal by sequence-specific binding to the target nucleic acid, not only is specificity high, but melting curve analysis for multiple detection of the target nucleic acid is not necessarily required.

Multiple detection of target nucleic acids using probe-based real-time polymerase chain reaction can simultaneously detect various genes in one sample with high accuracy, but complex probes labeled with different signal molecules corresponding to the number of target nucleic acids must be used. It must be possible to distinguish and detect signals generated from such complex probes.

Generally, fluorescent molecules are used as signal molecules in real-time polymerase chain reaction, but because the types of fluorescent molecules that can be used are limited by the overlap of wavelengths, that is, only one single fluorescent signal can be detected in one fluorescence detection channel. The number of target nucleic acids that can be simultaneously detected in a reaction tube is limited to 4 to 7.

To overcome these limitations, attempts have been made to detect two or more target nucleic acids in one detection channel.

Melting curve analysis is an analysis method that detects two or more target nucleic acids by measuring changes in fluorescence while increasing or decreasing the temperature after a PCR reaction using primers or hybridization probes labeled with a single fluorescent molecule. . Primers or probes are designed to have a unique melting temperature with the target nucleic acid by controlling the GC content or length, so that a unique melting curve profile is obtained depending on the target nucleic acid.

However, this melting curve analysis requires designing a probe to have a unique melting temperature depending on the target nucleic acid, and detection of multiple target nucleic acids is possible through temperature changes only after the PCR reaction is completed.

In contrast, International Publication WO 2018/050824, titled “Method for Performing Multiplex PCR,” states that one single fluorescent signal is generated at different intensities depending on the target nucleic acid to be detected in each of the three steps of PCR: denaturation, hybridization, and/or extension. We are disclosing a PCR method that allows real-time detection of up to three target nucleic acids with a single signal by constructing a hydrolyzable probe to do so. However, this method requires data processing, such as adding or subtracting signal intensity for each step, to accurately quantify the target nucleic acid.

The present invention also discloses a multiplex detection PCR method that allows real-time detection of two or more target nucleic acids even in a single detection channel without requiring data processing such as adding or subtracting signal intensity.

The purpose of the present invention is to provide a PCR method for real-time detection of two or more target nucleic acids in a single detection channel.

Other or specific purposes of the present invention will be presented below.

The PCR method for real-time detection of two or more target nucleic acids in a single detection channel of the present invention includes three steps of PCR: denaturation, annealing, and extension. Detect the signal for the target nucleic acid. That is, among the two target nucleic acids, the signal for the first target nucleic acid is detected in the annealing step, and the signal for the second target nucleic acid is detected in the extension step. Each detected signal provides qualitative and/or quantitative information about each of the two target nucleic acids. At this time, the detection signal is the same single signal for both target nucleic acids, and can be detected in one detection channel.

The method of the present invention uses first and second hybridization probes and one quencher probe, which have a structure in which a signal is generated by separating the signal material and the quencher when binding to the target nucleic acid. possible. The first and second hybridization probes have a melting temperature with their target nucleic acid, the first hybridization probe has a melting temperature between the temperature of the annealing step and the temperature of the extension step, and the second hybridization probe has a melting temperature between the temperature of the extension step and the other second hybridization probe. It is between the temperatures of the denaturation stage. The quenching probe may quench a second hybridization probe having a melting temperature between the temperature of the extension step and the temperature of the denaturation step. The melting temperature of the quenching probe with the second hybridization probe is between the temperature of the annealing step and the temperature of the extension step. As a result, in the annealing step, a signal is generated only by the first hybridization probe, and in the extension step, the quenching probe is separated and a signal is generated only by the second hybridization probe.

The PCR method of the present invention, which enables real-time detection of two target nucleic acids in a single detection channel using a single signal during the PCR process, specifically includes the following steps (a) to (c):

(a) Preparing a mixture for PCR reaction containing (i) to (iv) below in the sample to be analyzed (or to be detected)

(i) one set of forward and reverse primers to amplify each of the two target nucleic acids;

(ii) (ii-a) a first artificial target nucleic acid that has a specific complementary sequence to the first target nucleic acid among the two target nucleic acids, or (ii-b) is produced depending on the first target nucleic acid. A first hybridization probe having a specific complementary sequence, this hybridization probe has a structure in which the signal substance and the quencher are adjacent to each other and no signal is generated when the target nucleic acid does not bind to the probe, The melting temperature at which it (the first hybridization probe) dissociates from its complementary target nucleic acid or artificial target nucleic acid is the annealing step among the relatively high-temperature denaturation step, relatively low-temperature annealing step, and relatively medium-temperature extension step of the PCR reaction. Between the temperature and the temperature of the extension step, in the annealing step, the signal material and the quenching material are separated by binding to the sequence complementary to it (the first hybridization probe), thereby generating a signal, but in the extension step, the signal material and the quenching material are separated. hybridization probe), a probe having a structure in which a signal substance and a quencher are adjacent and the signal is quenched by dissociating from its complementary sequence;

(iii) a second hybridization probe having a specific complementary sequence to a second artificial target nucleic acid produced depending on the second target nucleic acid among two or more target nucleic acids, wherein the hybridization probe corresponds to the target nucleic acid When not bound to a probe, the signal material and the quencher are adjacent to each other and have a structure in which no signal is generated, and have a single-stranded sequence extending terminally from the sequence to which the signal material is bound, and it (second The melting temperature at which the hybridization probe dissociates from the second artificial target nucleic acid complementary thereto is the temperature of the extension step and the denaturation step among the relatively high-temperature denaturation step, the relatively low-temperature annealing step, and the relatively medium-temperature extension step of the PCR reaction. A probe capable of maintaining a binding state between the second hybridization probe and a second artificial target nucleic acid complementary thereto during the annealing step and the extension step between temperatures; and

(iv) a quenching probe having a quenching material capable of quenching the signal material of the second hybridization probe by binding complementary to the extended single-stranded sequence of the second hybridization probe, wherein the quenching probe When complementary to the second hybridization probe and a single-stranded sequence extending toward its end (second hybridization probe), the quencher of this probe is combined with the signal material of the second hybridization probe. It has a structure capable of quenching the signal material of the second hybridization probe adjacent to it, and the melting temperature at which this quenching probe dissociates from its complementary sequence is the relatively high temperature denaturation step of the PCR reaction and the relatively low temperature annealing step. During the extension step and the relative medium temperature, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe in the annealing step between the temperature of the annealing step and the temperature of the extension step, but in the extension step, the signal of the second hybridization probe can be quenched. a probe capable of causing the quenching probe to dissociate from its complementary sequence, thereby generating a signal in a second hybridization probe;

(b) placing the mixture of step (a) in a single reaction vessel and performing two or more cycles of PCR reaction comprising denaturation at relatively high temperature, hybridization at relatively low temperature, and extension step at relatively medium temperature; and

(c) Simultaneously with performing the PCR reaction, the first target nucleic acid is detected by measuring the signal generated from the first hybridization probe in the annealing step, and the second hybridization probe is detected in the extension step. Detecting the second target nucleic acid by measuring the signal generated from the chemical probe.

In this specification, the target nucleic acid refers to the actual target nucleic acid in the sample or an artificial target nucleic acid produced depending on the actual target nucleic acid, depending on the context. However, unless specifically stated, the target nucleic acid refers to the actual target nucleic acid in the sample. do.

In the PCR method of the present invention, three probes as shown in Figure 1 are used, namely first and second hybridization probes and one quencher probe.

The first and second hybridization probes both have a signal substance (R) and a quencher (Q), and the signal substance and the quencher substance are used when the hybridization probe does not bind to the target nucleic acid. No signal is generated when they are adjacent to each other, but when the hybridization probe binds to the target nucleic acid, the signal material and the quencher are spaced apart to generate a signal. The structure may include a random coil structure or a stem-loop structure. Among them, hybridization probes with a stem-loop structure have a complementary sequence in the loop region that specifically binds to the target nucleic acid.

Among the hybridization probes, the second hybridization probe has a single strand sequence (Extended single strand, ESS) extending from the position where the signal substance binds toward the end (i.e., in the opposite direction of the loop structure from the stem-loop structure).

The quenching probe is a probe with a quenching material to quench the signal of the second hybridization probe, and has a sequence complementary to the extended single-stranded sequence (ESS) of the second hybridization probe and binds specifically to it. It has a configuration that can be done. In a quenching probe, the quenching material is adjacent to the signal material of the second hybridization probe when the quenching probe binds complementary to the extended single-stranded sequence (ESS) of the second hybridization probe. As a result, it exists in a position where the signal material can be quenched. The quencher of the second hybridization probe is located closer to the 5' end than the 3' end of the second hybridization probe (in this case, the quencher of the second hybridization probe is closer to the 3' end or the 3' end). located close to the quenching probe), it will be located close to the 3' end or the 3' end of the quenching probe. If the signal material in the second hybridization probe is located closer to the 3' end than the 5' end, it will be located closer to the 3' end of the quenching probe. It will be located close to the 5' end. Here, the fact that the signal or quencher is located close to the 5' or 3' end means that the signal or quencher is present in an intra-sequence near the 5' or 3' end.

The melting temperature of the first hybridization probe with its target nucleic acid is the temperature of the annealing step and the temperature of the extension step among the three steps of the PCR reaction: a denaturation step at a relatively high temperature, an annealing step at a relatively low temperature, and an extension step at a relatively medium temperature. It has a temperature between For example, if the denaturation step is performed at 92 to 98°C, the annealing step is performed at 50 to 60°C, and the extension step is performed at 70 to 80°C, the melting temperature will be around 65°C.

When the first hybridization probe has this melting temperature, in the annealing step, the first hybridization probe binds to the target nucleic acid, thereby separating the signal material and the quenching material, thereby generating a signal, but in the extension step, the first hybridization probe binds to the target nucleic acid and a signal is generated. As the probe dissociates from the target nucleic acid and assumes its original stem-loop structure, the signal material and the quencher become adjacent to each other, causing the signal to disappear.

On the other hand, in the second hybridization probe, the melting temperature with the target nucleic acid is the temperature of the extension step and the denaturation step among the three steps of the PCR reaction: a denaturation step at a relatively high temperature, an annealing step at a relatively low temperature, and an extension step at a relatively medium temperature. It has a temperature between temperatures. Therefore, in both the annealing step and the extension step, the second hybridization probe remains bound to the target nucleic acid, but due to the action of the quenching probe, no signal is generated in the annealing step and a signal is generated only in the extension step.

The quenching probe has a melting temperature with its second hybridization probe that is between the temperature of the annealing step and the temperature of the extension step during the three steps of the PCR reaction: a relatively high temperature denaturation step, a relatively low temperature annealing step, and a relatively medium temperature extension step. Therefore, as described above, the quenching probe remains bound to the second hybridization probe in the annealing step and quenches the signal of the second hybridization probe, but dissociates in the extension step, thereby forming the second hybridization probe. Let the probe generate a signal.

A conceptual diagram of the PCR method of the present invention as described above is shown in Figure 2.

In this way, in the present invention, by using three probes, even if a single signal is used during the PCR process, the two target nucleic acids can be detected by detecting the signals for the two target nucleic acids in the annealing step and the extension step, respectively. In this case, the annealing step and the detection signals of the extension step are obtained without interference with each other. That is, the detection signal obtained in the annealing step is a detection signal only for the first target nucleic acid among the two target nucleic acids, and the detection signal obtained in the extension step is a detection signal only for the second target nucleic acid among the two target nucleic acids. Therefore, these detection signals are obtained using the same single signal, and there is no need for data processing such as addition or subtraction, so in the PCR result graph consisting of signal intensity and number of PCR cycles, it is possible to determine whether two target nucleic acids are detected (qualitative information) and whether they are detected. The degree (quantitative information) can be easily confirmed. This is not only very convenient as it allows the operator of the method of the present invention to immediately check whether the target nucleic acid has been detected in the PCR result graph, but also allows simultaneous detection in one reaction tube in the case of multiple real-time PCR methods using different types of fluorescent substances. The type of nucleic acid can be increased by up to two times. For example, when five types of fluorescent substances are used in a multiplex real-time PCR method, two target nucleic acids can be detected with one fluorescent substance, making simultaneous detection of ten target nucleic acids possible.

In the present invention, the sequences of the three probes must be designed in consideration of the melting temperature with their complementary target nucleic acid (the quenching probe is the second hybridization probe), and the design of the sequence considering this melting temperature is GC. This can be achieved by controlling the content, sequence length, or both together. For the design of probe sequences considering this melting temperature, refer to literature known in the art [Unit Evol. Genet. 2005; 5:1-9]; Literature [Afr. Jo. Biotechnology. 2003; 2:91-95], Methods Mol. Biol. 1993; 15:31-40], PCR Methods Appl. 1993; 3:S30-S37], Nucleic Acids Res. 1994; 22:2760-2768], Visual OMP™ software (DNA Software, Inc, Ann Arbor, Mich), Oli2go™ software (Nucleic Acids Res. 2018 Jul 2; 46 (Web Server issue): W252- It may be desirable to use commercially available programs such as W256).

In the present invention, the second hybridization probe has a melting temperature with the target nucleic acid between the extension step at a relatively medium temperature and the denaturation step at a relatively high temperature, so that it is bound to the target nucleic acid in the extension step, thereby carrying out an extension reaction. When the (polymerization reaction) proceeds, it may be hydrolyzed by polymerase (i.e., by nuclease activity such as Taq polymerase) like a hydrolyzable probe such as a TaqMan probe. When the second hybridization probe is hydrolyzed after being bound to the target nucleic acid in the extension step, a signal is generated like a hydrolyzable probe due to the hydrolysis, and the generated signal is transmitted in the annealing step of the next cycle of the PCR reaction. Since it is detected together with the signal of the first hybridization probe, a problem arises in that the signal of the first hybridization probe does not accurately reflect detection information (i.e., qualitative and quantitative information) about the first target nucleic acid.

Therefore, in the present invention, the target nucleic acid that the second hybridization probe recognizes complementary and specifically binds to is the target nucleic acid to be detected in the sample to be actually detected (i.e., the actual target nucleic acid or the second actual target nucleic acid). No, it must be an artificial target nucleic acid produced depending on the actual target nucleic acid.

It is desirable that such artificial target nucleic acid is produced in quantitative dependence on the actual target nucleic acid to enable qualitative as well as quantitative analysis of the actual target nucleic acid. The technology for producing artificial target nucleic acid that depends on the actual target nucleic acid is Various technologies are known in the industry. As a technology for producing such artificial target nucleic acids, for example, an international published patent entitled "METHOD FOR DETECTING TARGET NUCLEIC ACID SEQUENCE USING CLEAVED COMPLEMENTARY TAG FRAGMENT AND COMPOSITION THEREOF" C-TAG (Cleavable Tag) technology disclosed by WO 2017188669, named "DETECTION OF TARGET NUCLEIC ACID SEQUENCE BY PTO CLEAVAGE AND EXTENSION-DEPENDENT SIGNALING OLIGONUCLEOTIDE Examples include the PCE-SH (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) technology disclosed by International Publication Patent WO 2013115442, “HYBRIDIZATION ASSAY”.

C-TAG technology amplifies a target nucleic acid using a primer introduced with a sequence consisting of an artificial random sequence and a sequence that can be cut with a restriction enzyme, and amplifies the target nucleic acid and the artificial This is a technology that detects the target nucleic acid by detecting the tag (C-TAG) complementary to a certain sequence with a hybridization probe. At this time, if the target nucleic acid is not present, the restriction enzyme does not work, so the tag is not generated. If the target nucleic acid is present, the tag is generated in quantitative proportion to the target nucleic acid, so qualitative and quantitative detection of the target nucleic acid is possible through tag detection. It becomes. The tag itself can be detected as a hybridization probe, or if the tag's sequence length is shorter than the hybridization probe, it can act as a primer for the hybridization probe and be extended by an extension reaction like a target nucleic acid, thereby increasing the signal of the hybridization probe. It can be detected by switching from loud (signal-off) to on (signal-on). For the specific operation method of the above-described C-TAG technology, refer to International Publication Patent WO 2017188669. This document, together with all documents cited herein, is considered a part of this specification. A conceptual diagram of how these C-TAG technologies work is shown in Figure 3.

When amplifying a target nucleic acid, the PCE-SH technology uses an artificial random tag sequence along with a probe sequence complementary to the target nucleic acid while the 3' end is blocked with HEG (hexaethylene glycol), a phosphate group, etc. Taq polymerase that amplifies the target nucleic acid using PTO (Probing and Tagging Oligonucleotide) and generates a single-stranded 5' tag through endonuclease activity when there is a bifurcated duplex. By the action of (Proc Natl Acad Sci U S A. 1999 May 25; 96(11): 6143-6148), a PTO fragment consisting of only an artificial random sequence (i.e., a 5' tag of an artificial random sequence) is generated, and this PTO This is a technology in which the fragment acts as a primer for CTO (Capturing and Templating Oligonucleotide) and extends together during the extension reaction of the target nucleic acid, so that when a new extended sequence is created, the new extended sequence is detected with a hybridization probe, etc. to detect the target nucleic acid. Here too, if the target nucleic acid is not present, no PTO fragment is generated and no new extended sequence is generated. If the target nucleic acid is present, a new extended sequence is generated in proportion to the amount of the target nucleic acid, so when the new extended sequence is detected, Qualitative and quantitative detection of target nucleic acids becomes possible. Also, in this case, the PTO fragment acts as a primer for the hybridization probe and is extended by an extension reaction like the target nucleic acid, thereby switching the signal of the hybridization probe from signal-off to signal-on. It can be detected. For details on how this PCE-SH technology works, refer to International Publication Patent WO 2013115442.

In addition, technologies for generating artificial target nucleic acids include, in addition to the C-TAG technology and PCE-SH technology described above, PTOCE (Probing & Tagging Oligonucleotide Cleavage and Extension) technology (International Patent Publication WO 2012096523) and PCE-NH (PTO Cleavage and Extension). -Dependent Non-Hybridization) technology (international application no. PCT/KR2013/012312), etc., and similar to the PCE-SH technology, these PTOCE technologies and PCE-NH all have complementary probe sequences for the target nucleic acid. Using PTO (Probing and Tagging Oligonucleotide) with an artificial random tag sequence, a PTO fragment (i.e., 5' tag of artificial random sequence) with only an artificial random sequence is generated, and this fragment is a CTO (Capturing and Templating Oligonucleotide). It includes the step of extending to a template to generate a new sequence and detecting the new sequence. A new sequence extended from a PTO fragment composed of only artificial random sequences becomes an artificial target nucleic acid, and this artificial target nucleic acid is generated qualitatively and quantitatively depending on the actual target nucleic acid of the sample.

In the present invention, the artificial target nucleic acid is a nucleic acid of a newly synthesized sequence that is produced only when the target nucleic acid is present in the sample or in proportion to the amount of the target nucleic acid only when the target nucleic acid is present in the sample. In the C-TAG technology, When the tag or the tag acts as a primer for a hybridization probe, it refers to a newly created sequence extended from the tag using the hybridization probe as a template. In the PCE-SH technology, a CTO or a hybridization probe is used as a template. This refers to a newly synthesized sequence that is extended from the PTO fragment that acts as a primer.

In the present invention, the second hybridization probe must detect the artificial target nucleic acid produced depending on the actual target nucleic acid as described above, but the first hybridization probe has a melting temperature with the target nucleic acid at a relatively low temperature. Between the annealing step and the extension step at relatively medium temperature, the nucleic acid is in a dissociated state from the target nucleic acid during the extension step and there is no risk of decomposition during the extension reaction, so the nucleic acid detected by the first hybridization probe is the actual target nucleic acid in the sample. It may be an artificial target nucleic acid produced depending on the actual target nucleic acid.

In the present invention, a probe is an oligonucleotide for detecting a target nucleic acid (actual target nucleic acid or artificial target nucleic acid in a sample), and contains a base sequence complementary to the target nucleic acid, thereby binding specifically to the target nucleic acid. It refers to a nucleic acid or nucleic acid analogue that has the ability. The probe may be RNA as well as DNA as long as it has a specific binding ability with the target nucleic acid (if the probe of the present invention is RNA, "T" is read as "U" in the base sequence of the above sequence number), and may also be a nuclease or RNA. It may be a nucleic acid analogue such as heat-stable PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), or MNA (Mannitol Nucleic Acids). Probes may also contain natural nucleotides as well as modified nucleotides as long as they have the ability to specifically bind to the target nucleic acid. These modified nucleotides may be modified in their sugars, phosphates and/or bases. Nucleotides modified from such sugars, phosphates and/or bases are specifically known in the art, including methods for their preparation. For example, a nucleotide modified from a sugar is one in which the hydroxyl group (OH group) of the sugar is modified with a halogen group, aliphatic group, ether group, amine group, etc., and the sugar ribose or deoxyribose itself is a sugar analogue that can replace it. α-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanos Examples include those substituted with furanose sugars, etc. Also, for example, modifications in phosphate can cause phosphate to form P(O)S(thioate), P(S)S(dithioate), P(O)NR2(amidate), P(O)R, P(O)OR', CO Or transformation into CH2 (formacetal), etc. Here, R or R' is H or substituted or unsubstituted alkyl, etc., and when modified from phosphate, the linking group becomes -O-, -N-, -S- or -C-, and the linking group becomes -O-, -N-, -S- or -C-, and the linking group is used to connect adjacent nucleotides. are combined with each other.

The complementary sequence to the target nucleic acid in the probe need not be 100% complementary, as long as it confers specific binding ability to the target nucleic acid, but is at least about 80% complementary, preferably at least about 85%, and more preferably at least about 90% complementary. It may be %, 95% or 99%.

In the present invention, a hybridization probe refers to a probe that has a complementary sequence to the target nucleic acid and has a structure in which a signal substance and a quencher are adjacent to each other and no signal is generated when the target nucleic acid does not bind to the probe. The hybridization probe may have a stem-loop structure. In this case, a sequence complementary to the target nucleic acid is located in the loop region, and a signal substance and a quencher are located within the stem region (intra-stem) or at its end. A hybridization probe generates a signal by separating the signal substance and the quencher when it binds to the target nucleic acid. Since fluorescent substances are generally used as signal substances, these signals are fluorescent signals. Methods for labeling signal substances and quenching substances on oligonucleotide probes, and methods for producing such probes include direct chemical labeling via solid-phase synthesis and two-step solid-phase chemical labeling. Various methods, including chemical labeling via solid-phase synthesis, are known in the art, and are also known in the literature [Chem. Soc. Rev., 2020, 49, 8749-8773], ACS Cent. Sci., 2017, 3, 701-707], Curr. Opin. Biotechnol., 2015, 31, 42-49], Annual Review of Physiology, ed. D. Julius, 2017, vol. 79, pp. 93-117] and other various documents are known. For specific information regarding labeling methods, please refer to these documents.

In the present invention, the first hybridization probe may be a molecular beacon.

In the present invention, the sample to be analyzed may be any mixture or solution for which detection is necessary because it contains or is suspected of containing the target nucleic acid to be detected. The sample may be a biological sample obtained from the human body or an animal, as well as a processed sample in which the concentration of the target nucleic acid is increased by processing such a biological sample, and furthermore, environmental pollution such as water, food, industrial wastewater, etc. that contains or is believed to contain the target nucleic acid. These may be samples that require testing, such as factors, toxic factors, or organic matter samples obtained from food processing equipment. These samples may contain appropriate diluents and buffer solutions, and when trying to detect the presence of bacteria or viruses, they may be bacterial cultures or viral cultures containing media or media components.

Additionally, in the present invention, the sample to be analyzed may preferably be a biological sample obtained from a human body or an animal or a processed sample thereof. Biological samples include whole blood, serum, plasma, umbilical cord blood, urine, feces, saliva, nasal mucus, semen, amniotic fluid, lavage fluid (bronchoalveolar, stomach, abdominal cavity, ear, etc.), lymphatic fluid, sputum, tissues, cells, etc. Target nucleic acid to be detected It may be obtained from a human body or animal that contains or is suspected of containing , making detection necessary. Processed samples include, for example, plasma, serum, biological samples with increased nucleic acid (DNA and/or RNA) concentration using a nucleic acid extraction kit, tissue extracts, cells obtained from tissues, cell lysates, cell cultures, bacterial cultures, It may be a virus culture, etc.

In addition, in the present invention, the target nucleic acid is a nucleic acid to be detected, and its presence and/or abundance can be detected or measured to provide some usefulness, such as use in the diagnosis or prognosis of a disease, confirmation of biological indicators, as well as research on its function or properties. It refers to any nucleic acid that can be imported. The target nucleic acid refers to a single-stranded DNA containing a sequence to which a probe (i.e., a first or second hybridization probe) binds, that is, a sequence complementary to the probe, or a double-stranded DNA to which the single-stranded DNA is bound. This single-stranded or double-stranded DNA is genomic DNA in a sample, especially a biological sample, cDNA generated by reverse transcription from RNA such as mRNA, rRNA, micro RNA, or an artificial random sequence generated depending on the actual target nucleic acid. , It may be an artificial target nucleic acid as described above.

The actual target nucleic acid may be nucleic acid of prokaryotic cells such as pathogenic bacteria, nucleic acid of eukaryotic cells derived or isolated from humans, etc., nucleic acid of pathogenic virus, or viroid nucleic acid. Here, pathogenic bacteria include enteric bacteria resistant to antibiotics such as vancomycin or carbapenem, Acinetobacter baumannii , which can cause pneumonia or sepsis, and Bordetella pertussis , which can cause whooping cough. Pathogenic viruses include viruses that cause gastrointestinal diseases (Rotavirus A, Astrovirus, Adenovirus F40, Adenovirus F41, Norovirus GⅠ, Norovirus GⅡ, etc.), human papilloma virus, and respiratory tract viruses. Disease-causing agents (Influenza A/H1N1, Influenza A/H3N2, Influenza A/H1N1/2009pdm, Influenza B, Parainfluenza 1, Parainfluenza 3, Respiratory syncytial virus A, Respiratory syncytial virus B, Human metapneumovirus, Adenovirus) are included.

In the present invention, a primer is an oligonucleotide capable of inducing the initiation of synthesis of a target nucleic acid, and is composed of a forward primer and a reverse primer for each target nucleic acid. Primers are designed to specifically bind to the target nucleic acid (actual target nucleic acid in the sample or artificial target nucleic acid produced depending on it) and have a melting temperature sufficient to maintain binding to the target nucleic acid during the extension reaction of the PCR reaction. The extension reaction usually takes place in an extension step, but this does not have to be the case. The first hybridization probe may bind to and detect either the actual target nucleic acid or the artificial target nucleic acid in the sample. When the first hybridization probe detects the artificial target nucleic acid, the artificial target nucleic acid is the first nucleic acid. If the length is shorter than the hybridization probe of 1, it may act as a primer in the annealing step in which it binds complementary to the first hybridization probe and extend while separating the signal material and quencher material of the first hybridization probe. If the extension reaction for a target nucleic acid occurs in the annealing step, the forward and reverse primers for the target nucleic acid are designed so that their melting temperature is at least the temperature of the annealing step, and the extension reaction for a certain target nucleic acid occurs in the extension step. If this occurs, the forward and reverse primers for the target nucleic acid are designed so that their melting temperature is at least the temperature of the extension step. This design can usually be accomplished by adjusting the length of the primer while making it complementary to the target nucleic acid. These primer designs are described in PCR Methods Appl. 1993 Dec;3(3):S30-7], literature [Biomolecular Detection and Quantification 14 (2017) 19-28], etc., or commercially available software (e.g. Visual OMP, Invitrogen OligoPerfect Designer) can be used.

Primers can have various lengths, but usually have a length of 10 to 50 nucleotides. Similar to probes, some sequences of primers are PNA (Peptide Nucleic Acid), LNA (Locked Acid), as long as they do not affect the synthesis initiation inducing function of the primer. It may be a nucleic acid analogue such as Nucleic Acid, HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), or MNA (Mannitol Nucleic Acids), and may include modified nucleotides as well as natural nucleotides. You may.

In the present invention, the mixture for the PCR reaction in step (a) includes, in addition to the primer set and the three probes described above, four types of NTPs, DNA polymerase, and pH as other factors. Tris-HCl as a stabilizer, MgCl2, MgSO4 or (NH4)2SO4 as a cofactor to promote enzyme activity, BSA (Bovine Serum Albumin), gelatin, glycerol or PEG 6000 as a factor for stabilizing the enzyme, and the primer's target nucleic acid. KCl, a factor that promotes binding, Tween 20 or Triton Urea, DMSO (dimethylsulfoxide), DMF (dimethylformamid), betaine, and SDS (Sodium Dodecyl Sulfate), which are factors to prevent aggregation of DNA polymerase, are used to promote annealing. It may additionally include Triton X-100, etc.

In the present invention, the DNA polymerase uses a thermostable polymerase. These thermostable polymerases include Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, and Thermus caldophilus. , Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococ cus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus and Aquifex aeolieus , etc. or manufactured by genetic recombination technology. It can be used separately or manufactured separately and purchased commercially.

A modified DNA polymerase may be used. Modified polymerases include those in which some sequence has been artificially modified or naturally modified (mutated). These modified polymerases include G46E E678G CS5 DNA polymerase, G46E L329A E678G CS5 DNA polymerase, G46E L329A D640G S671F CS5 DNA polymerase, G46E L329A D640G S671F E678G CS5 DNA polymerase, G46E E678G CS6 DNA polymerase. enzyme, Z05 DNA polymerase, ΔZ05 polymerase, ΔZ05-Gold polymerase, ΔZ05R polymerase, E615G Taq DNA polymerase, E678G TMA-25 polymerase, E678G TMA-30 polymerase, etc. It can be exemplified.

The DNA polymerase is preferably a DNA polymerase with the 5'->3' exonuclease activity removed. These commercially available polymerases include AptaTaq exo DNA Polymerase (Roche, Switzerland), Top DNA Polymerase (Bioneer, Korea), Vent® (exo-) DNA Polymerase (NEB, USA), and Phusion® High-Fidelity DNA Polymerase (NEB, USA). USA), and KlenTaq-1 DNA polymerase (an analogue of the Klenow fragment in Taq polymerase) can be used.

In the present invention, the PCR reaction amplifies the template nucleic acid by repeatedly performing the three steps of denaturation, annealing, and extension for 2 or more cycles, usually 15 to 50 cycles. Before performing these 3-step cycles, an initial denaturation step is performed. ) may be included. This initial denaturation step is performed to activate DNA polymerase and denature the template DNA. This initial denaturation step may be performed within the range of 30 seconds to 20 minutes, taking into account the GC content of the template DNA.

Additionally, an extension step (final elongation step) may be included after the above three-step reaction. This extension step is for DNA polymerase to complete the final extension reaction and is usually performed for about 1 to 20 minutes at the same temperature as the extension step in step 3 above.

For more details regarding PCR reactions, see U.S. Patent Nos. 4,683,195, 4,683,202, PCR Protocols: A Guide to Methods and Applications, Innis et al, eds, 1990, and BioTechniques 69: 317?325 (October 2020)], Front Microbiol. 2017 Feb 2;8:108], J Invest Dermatol. 2013 Mar; 133(3): e6], etc.

Also, in the present invention, the signal may be used without particular limitation, such as a fluorescence signal, a luminescent signal, or a colorimetric signal, but it is preferable to use a fluorescence signal.

In the present invention, when using a fluorescent signal, any fluorescent material for generating the signal may be appropriately selected and used among those known in the art, taking into account the detection wavelength of each detection channel of the PCR device. Known fluorescent substances include, for example, Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520) ), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™(533), TO-PRO™-1(533), TOTO1(533), JOE(548), BODIPY530/550(550), Dil(565), BODIPY TMR(568), BODIPY558/568(568) ), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ ( 576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy35™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615) ), TexRed (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO™- 3(660), TOTO3(660), DiD DilC(5)(665), Cy5™(670), Thiadicarbocyanine(671), Cy55(694), HEX(556), TET(536), Biosearch Blue(447) , CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520) , Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). The numbers in parentheses are the maximum emission wavelengths in nanometers.

A quenching material is a material that absorbs and generates heat to quench the fluorescence emitted by a fluorescent material when it is adjacent to a fluorescent material. Many such quenching materials are known in the art. Among those known, the fluorescent material used is Considering the emission wavelength, one with an appropriate absorption wavelength can be selected and used. Known quenching materials include Dabcyl (453), QSY 35 (475), BHQ-0 (495), Eclipse (530), BHQ-1 (534), QSY 7 (560), QSY 9 (562), and BHQ-2. (579), ElleQuencher (630), Iowa Black (651), QSY 21 (661), BHQ-3 (672), etc. The numbers in parentheses are the maximum absorption wavelength in nanometers.

Regarding the appropriate pair of fluorescent material and quenching material, it is necessary to consider quenching efficiency for accurate detection without unnecessary noise signals, such as Cy5/BHQ-2, Cy5/BHQ-1, TexRed/BHQ- 2, TexRed/QSY 7, TexRed/BHQ-1, TexRed/Dabcyl, Cy3/BHQ2, Cy3/QSY 7, Cy3/BHQ-1, Cy3/Dabcyl, TET/BHQ-2, TET/QSY 7, TET/TAMRA , TET/BHQ-1, FAM/BHQ-2, FAM/QSY 7, FAM/TAMRA, FAM/BHQ-1, FAM/Dabcyl, etc. are known to have high quenching efficiency ( Nucliec Acids Res. 30, e122, 2002) , it may be desirable to select and use among these pairs.

There is much literature known in the art regarding signaling and quenching substances and the selection of suitable pairs, and reference may be made to such known literature. Such documents include Methods Mol Biol. 335, 17-29, 2006], Biotechniques 31, 1106-1121, 2001, J. Am Chem. Soc. 124, 6950-6956, 2002], Chem. Eur. J. 9, 3466-3471, 2003], Nucliec Acids Res. 30, e122, 2002], J. Phys. Chem. 100, 5541-5553, 1996], etc.

In the present invention, a single signal refers to a signal detected through one detection channel. Therefore, even if two signal generating substances are used, if the signal generated by the two substances is detected in one detection channel, it is a single signal. For example, if only one fluorescent substance, Cy2™ (506), is used as the signal substance, the fluorescent signal generated is of course a single signal, but if two fluorescent substances, Alexa™ (520) and Rhodamine 110 (520), are used as the signal substance. Even in this case, if their detection wavelengths are the same and are detected in one fluorescence detection channel, the signals from these two fluorescent substances also become a single signal.

In the present invention, signal detection occurs during the annealing and extension steps of the PCR reaction. In the annealing step, a first hybridization probe that generates a signal by specifically binding to the first target nucleic acid (the actual target nucleic acid in the sample or an artificial target nucleic acid generated depending on the actual target nucleic acid) and separating the signal material and the quencher The first target nucleic acid is detected by detecting the signal, and in the extension step, the second hybridization process generates a signal by specifically binding to the second target nucleic acid (this is an artificial target nucleic acid) and separating the signal material and the quencher. The second target nucleic acid is detected by detecting the signal of the probe. In the extension step, the signal of the second hybridization probe is generated by dissociation of the quenched probe. Signal detection is usually achieved at the end of each step by radiating light from a light source (lamp, laser, LED) provided in the PCR device to the sample and detecting the light emitted from the sample in a detection channel.

Signal detection can be performed in some or all cycles of the amplification reaction, but is preferably performed in all cycles. When performed in all cycles, the detection results for the first target nucleic acid and/or the second target nucleic acid are derived as a PCR result graph consisting of signal intensity and number of PCR cycles. The PCR result graph can be derived as one graph showing two amplification curves for two target nucleic acids, or as separate graphs showing amplification curves for two target nucleic acids. If the target nucleic acid to be detected is present and a sufficient number of cycles of amplification reaction are performed, the PCR result graph will appear in the form of Initiation phase, Exponential phase, and Plateau phase, through which 2 Detection information (qualitative and/or quantitative information) of target nucleic acids can be easily derived.

In the present invention, the first and second hybridization probes bind complementary to the target nucleic acid and a signal is generated by separating the signal material and the quenching material. However, in this case, if the target nucleic acid is an artificial target nucleic acid, the artificial target nucleic acid is the artificial target nucleic acid. If the length is shorter than that of the hybridization probe, it may act as a primer for each first and second hybridization probe and extend to separate the signal material and quencher material of the hybridization probe. At this time, in the extension reaction, the first hybridization probe binds to the target nucleic acid in the annealing step at a relatively low temperature and generates a signal, but dissociates and the signal disappears in the extension step at a relatively medium temperature, and the second hybridization probe undergoes the annealing step at a relatively low temperature. In that it binds to the target nucleic acid, but the signal is quenched by the quenching probe, the quenched probe dissociates in the extension step at relatively medium temperature, and the quenched signal appears, so it is preferable to do it in the annealing step. In general, it is known that Taq DNA polymerase exhibits the most optimal activity at 72-75°C, which is the typical temperature for the extension step. However, at 50-65°C, which is the typical temperature for the annealing step, the extension reaction can occur at a sufficient rate. It is known to be active. If the artificial target nucleic acid acts as a primer and an extension reaction occurs in the annealing step, it is desirable to maintain the annealing step for an appropriate time (usually 30 seconds to 2 minutes) to ensure that the extension reaction is sufficiently achieved.

In the present invention, the first target nucleic acid detected by the first hybridization probe in the annealing step at a relatively low temperature may be an actual target nucleic acid in the sample or an artificial target nucleic acid produced depending on the target nucleic acid, but the second hybridization probe The second target nucleic acid detected in the extension step at a relatively medium temperature must be an artificial target nucleic acid. If the nucleic acid to be detected by binding to the second hybridization probe is the actual target nucleic acid in the sample, the hybridization probe may be degraded by the exonuclease activity of DNA polymerase like the Taqman probe, as described above.

Considering the above, the nucleic acid detected by the first hybridization probe and the second hybridization probe in the present invention, its detection step, and the step of extension reaction of the actual target nucleic acid can be summarized as follows:

(1) When the first target nucleic acid detected is the actual target nucleic acid in the sample rather than an artificial target nucleic acid

The first actual target nucleic acid undergoes an extension reaction in the extension step, and is detected by a first hybridization probe that binds complementary to the first target nucleic acid in the annealing step of the next cycle.

The second target nucleic acid detected at this time is an artificial target nucleic acid produced dependently on the actual second target nucleic acid in the sample, and this artificial target nucleic acid is extended to the actual second target nucleic acid in the sample during the extension step and is connected to the actual second target nucleic acid. It is generated depending on the annealing step of the next cycle and binds to the second hybridization probe, but the signal is quenched and not detected as the quenching probe binds to the second hybridization probe, and then quenches as the temperature rises in the next step, the extension step. Detected by dissociation of the probe.

(2) When the first target nucleic acid to be detected is an artificial target nucleic acid produced depending on the actual target nucleic acid in the sample

The first actual target nucleic acid undergoes an extension reaction in the extension step, and during this extension reaction, an artificial target nucleic acid is generated depending on the first actual target nucleic acid, which binds complementary to the first target nucleic acid in the annealing step of the next cycle. Detected by the first hybridization probe.

Detection of the second target nucleic acid is the same as in case (1) above.

In this case, if the first and second artificial target nucleic acids are shorter than their respective hybridization probes, they can act as primers using each hybridization probe as a template, and when they act as primers, the extension reaction of the primers takes place in the annealing step. .

In another aspect, the present invention relates to a method for detecting a target nucleic acid using the hybridization probe and the quenching probe as described above.

The method of the present invention specifically includes (a) mixing the target nucleic acid, the hybridization probe, and the quenching probe to induce binding of the target nucleic acid, the hybridization probe, and the quenching probe, (b) dissociating the quenching probe by increasing the temperature. Inducing a signal to be generated from the hybridization probe, and (c) detecting the signal.

Here, the hybridization probe is a probe having a specific complementary sequence to the target nucleic acid. This hybridization probe has a structure in which the signal substance and the quencher are adjacent to each other and no signal is generated when the target nucleic acid does not bind to the probe. and has a single-stranded sequence extending terminally from the sequence to which the signal substance is bound,

The quenching probe is a probe having a quenching material capable of quenching the signal material of the hybridization probe by binding complementary to the extended single-stranded sequence of the hybridization probe. When complementary to a single-stranded sequence extending toward the end of a (second hybridization probe), the quencher of this probe is adjacent to the signal material of the hybridization probe and quenches the signal material of the hybridization probe. It has a structure that can

The hybridization probe and the quenching probe are designed so that the melting temperature at which the hybridization probe dissociates from its complementary target nucleic acid is higher than the melting temperature at which the quenching probe dissociates from its complementary hybridization probe.

Therefore, when a hybridization probe binds to its target nucleic acid, the signal material and the quenching material are separated, but no signal is generated by the quenching probe, and when the temperature rises and the quenching probe dissociates, the quenching effect by the quenching probe disappears and hybridization occurs. A signal is generated from the Mars probe.

In addition to the above hybridization probe and quenching probe, it is possible to detect two or more target nucleic acids by using one or more hybridization probes and quenching probes with different melting temperatures for each hybridization probe of the quenching probes used. You can. For these additional hybridization probes and quenching probes, the hybridization probe and the quenching probe are naturally used so that the melting temperature at which the hybridization probe dissociates from the target nucleic acid complementary thereto is higher than the melting temperature at which the quenching probe dissociates from the hybridization probe complementary thereto. An extinction probe is designed. The use of one or more of these additional hybridization probes and quenching probes may be useful for melting curve analysis for two multiple target nucleic acids after completion of PCR.

In the method of the present invention, the target nucleic acid may be an actual target nucleic acid in a sample or an artificial target nucleic acid produced depending on it.

In the method of the present invention, as for the hybridization probe and the quenching probe, the description of the second hybridization probe and the quenching probe in relation to the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention shall be applied as is. You can.

Meanwhile, the method of the present invention can also be applied to a PCR method for real-time detection of target nucleic acid. This method is the same as the case of using only the second hybridization probe and the quenching probe without using the first hybridization probe in the PCR method for real-time detection of two target nucleic acids with a single signal as described above. When applied to a PCR method for real-time detection of a target nucleic acid, there is only one target nucleic acid to be detected, and the target nucleic acid is preferably an artificial target nucleic acid produced depending on the actual target nucleic acid in the sample for the reasons already described above.

Specifically, the PCR method of the present invention includes steps (a) to (c) below.

(a) Mixing (i) to (iii) below with the sample to be detected.

(i) a set of forward and reverse primers to amplify the target nucleic acid;

(ii) A hybridization probe having a specific complementary sequence to an artificial target nucleic acid that is generated depending on the target nucleic acid. In this hybridization probe, when the target nucleic acid does not bind to the probe, the signal substance and the quencher are adjacent to each other. It has a structure in which no signal is generated, and has a single-stranded sequence extending terminally from the sequence to which the signal substance is bound, and the melting temperature at which it (hybridization probe) dissociates from the artificial target nucleic acid complementary to it is Among the relatively high-temperature denaturation step, relatively low-temperature annealing step, and relatively medium-temperature extension step of the PCR reaction, between the temperature of the extension step and the temperature of the denaturation step, in the annealing step and the extension step, the hybridization probe is used as an artificial target complementary thereto. A probe capable of remaining bound to a nucleic acid; and

(iii) a quenching probe having a quenching material capable of quenching a signal substance of the hybridization probe by binding complementary to the extended single-stranded sequence of the hybridization probe, wherein the quenching probe is capable of quenching the signal material of the hybridization probe and the hybridization probe. When complementary to a single-stranded sequence extending toward the end of a (hybridization probe), the quencher of this probe is adjacent to the signal material of the hybridization probe and has a structure capable of quenching the signal material of the hybridization probe. Also, the melting temperature at which this quenching probe dissociates from its complementary sequence is between the temperatures of the annealing step and the extension step among the relatively high-temperature denaturation step, relatively low-temperature annealing step, and relatively medium-temperature extension step of the PCR reaction. A probe that can quench the signal of the hybridization probe by binding to the hybridization probe in the annealing step, but can cause the quenching probe to dissociate from its complementary sequence in the extension step to generate a signal from the hybridization probe;

(b) placing the mixture of step (a) in a single reaction vessel and performing two or more cycles of PCR reaction comprising denaturation at relatively high temperature, hybridization at relatively low temperature, and extension step at relatively medium temperature; and

(c) simultaneously performing the PCR reaction, detecting the target nucleic acid by measuring the signal generated from the hybridization probe in the extension step.

Regarding the method of the present invention, what was described in the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention can be applied as is.

In another aspect, the present invention relates to (a) a hybridization probe and (b) a quenching probe set below.

(a) A complementary sequence specific to the target nucleic acid is a self-hybridizing probe, and this hybridization probe has a structure in which the signal substance and the quencher are adjacent to each other and no signal is generated when the target nucleic acid does not bind to the probe. , a probe having a single-stranded sequence extending terminally from the sequence to which the signal substance is bound; and

(b) a quenching probe having a quenching material capable of quenching the signal substance of the hybridization probe by binding complementary to the extended single-stranded sequence of the hybridization probe, wherein the quenching probe is attached to the end of the hybridization probe A probe that has a structure capable of quenching the signal material of the hybridization probe when it binds complementary to a single-stranded sequence extending in the direction, and the quenching material of this probe is adjacent to the signal material of the hybridization probe;

Here, the hybridization probe and the quenching probe are designed so that the melting temperature at which the hybridization probe dissociates from its complementary target nucleic acid is higher than the melting temperature at which the quenching probe dissociates from its complementary hybridization probe.

The description of the second hybridization probe and the quenching probe in relation to the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention can also be applied to the probe set of the present invention.

In another aspect, the present invention relates to a kit for real-time detection of two or more target nucleic acids with a single signal during PCR.

The kit of the present invention includes the primer set (i) and probes (ii) to (iv) below.

(i) one set of forward and reverse primers to amplify each of the two target nucleic acids;

(ii) (ii-a) a first artificial target nucleic acid that has a specific complementary sequence to the first target nucleic acid among the two target nucleic acids, or (ii-b) is produced depending on the first target nucleic acid. A first hybridization probe having a specific complementary sequence, this hybridization probe has a structure in which the signal substance and the quencher are adjacent to each other and no signal is generated when the target nucleic acid does not bind to the probe, The melting temperature at which it (the first hybridization probe) dissociates from its complementary target nucleic acid or artificial target nucleic acid is the annealing step among the relatively high-temperature denaturation step, relatively low-temperature annealing step, and relatively medium-temperature extension step of the PCR reaction. Between the temperature and the temperature of the extension step, in the annealing step, the signal material and the quenching material are separated by binding to the sequence complementary to it (the first hybridization probe), thereby generating a signal, but in the extension step, the signal material and the quenching material are separated. hybridization probe), a probe having a structure in which a signal substance and a quencher are adjacent and the signal is quenched by dissociating from its complementary sequence;

(iii) a second hybridization probe having a specific complementary sequence to a second artificial target nucleic acid produced depending on the second target nucleic acid among two or more target nucleic acids, wherein the hybridization probe corresponds to the target nucleic acid When not bound to a probe, the signal material and the quencher are adjacent to each other and have a structure in which no signal is generated, and have a single-stranded sequence extending terminally from the sequence to which the signal material is bound, and it (second The melting temperature at which the hybridization probe dissociates from the second artificial target nucleic acid complementary thereto is the temperature of the extension step and the denaturation step among the relatively high-temperature denaturation step, the relatively low-temperature annealing step, and the relatively medium-temperature extension step of the PCR reaction. A probe capable of maintaining a binding state between the second hybridization probe and a second artificial target nucleic acid complementary thereto during the annealing step and the extension step between temperatures; and

(iv) a quenching probe having a quenching material capable of quenching the signal material of the second hybridization probe by binding complementary to the extended single-stranded sequence of the second hybridization probe, wherein the quenching probe When complementary to the second hybridization probe and a single-stranded sequence extending toward its end (second hybridization probe), the quencher of this probe is combined with the signal material of the second hybridization probe. It has a structure capable of quenching the signal material of the second hybridization probe adjacent to it, and the melting temperature at which this quenching probe dissociates from its complementary sequence is the relatively high temperature denaturation step of the PCR reaction and the relatively low temperature annealing step. During the extension step and the relative medium temperature, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe in the annealing step between the temperature of the annealing step and the temperature of the extension step, but in the extension step, the signal of the second hybridization probe can be quenched. A probe capable of causing the quenching probe to dissociate from its complementary sequence, thereby generating a signal in a second hybridization probe.

In addition to containing the primer set and the three probes, the kit of the present invention may further include four types of NTPs and DNA polymerase, and as other factors, Tris-HCl, a pH stabilizer, to promote enzyme activity. MgCl2, MgSO4 or (NH4)2SO4 as auxiliary factors for enzyme stabilization, BSA (Bovine Serum Albumin), gelatin, glycerol or PEG 6000 as factors for enzyme stabilization, KCl as a factor promoting binding of primers to target nucleic acids, and non-specific amplification. Tween 20 or Triton It may additionally contain (urea), DMSO (dimethylsulfoxide), DMF (dimethylformamid), betaine, SDS (Sodium Dodecyl Sulfate) or Triton there is.

Additionally, the kit of the present invention may additionally include instructions for using the kit. This manual may teach a PCR method for real-time detection of two target nucleic acids with a single signal of the present invention as described above.

As described above, according to the present invention, a PCR method can be provided for detecting two or more target nucleic acids with a single signal.

The method of the present invention can detect signals for two target nucleic acids in the annealing step and extension step, respectively, without interfering with each other, even if a single signal is used during the PCR process. These detection signals according to the method of the present invention are obtained using the same single signal, so there is no need for data processing such as addition or subtraction, and therefore, whether two target nucleic acids are detected in the PCR result graph consisting of signal intensity and number of PCR cycles. It provides the effect of being able to immediately and easily check (qualitative information) and detection degree (quantitative information).

Figure 1 shows the structures of three probes, first and second hybridization probes, and one quenching probe according to the present invention.
Figure 2 is a conceptual diagram of the PCR method for real-time detection of two target nucleic acids with a single signal of the present invention.
Figure 3 is a conceptual diagram of C-TAG (Cleavable Tag) technology for generating artificial target nucleic acids.
Figure 4 is an experimental result showing that in the case of the second hybridization probe (DaO), a signal is generated in the annealing step and the extension step, but when a quenching probe (QO) is used together, a signal is generated only in the extension step.
Figure 5 shows the results of confirmation of the melting temperature of the second hybridization probe (DaO) with its target nucleic acid and the melting temperature of the quenching probe (QO) with the second hybridization probe (DaO).
Figure 6 is a result showing that real-time detection of target nucleic acids H3 and 09pdm during PCR is possible with a single signal according to the method of the present invention.
Figure 7 is a result showing through real-time detection of SARS-CoV-2 and Flu A/H3N2 that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperature in a multiple fluorescence channel configuration according to the method of the present invention.
Figure 8 is a result showing through real-time detection of FluA/H1N1pdm and Flu B that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperatures in a multiple fluorescence channel configuration according to the method of the present invention.
Figure 9 shows real-time detection of adenovirus (ADV) and a control group (NC) that does not contain target nucleic acids, showing that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperatures in a multiple fluorescence channel configuration according to the method of the present invention. This is the result shown through .

Hereinafter, the present invention will be described with reference to examples. However, the present invention is not limited to these embodiments.

<Example> Real-time detection of two target nucleic acids with a single signal through PCR

Justice

In this example, the cTAG primer is a primer applied to the C-TAG technology and refers to a primer that makes it possible to generate an artificial target nucleic acid depending on the target nucleic acid. Also, in this example, the DaO ((Dual-annealing oligonucleotide) probe refers to the second hybridization probe according to the present invention, which has a sequence that enables complementary binding to the target nucleic acid and also complementary binding to the quenching probe. Also, in this example, the QO (quenching oligonucleotide) probe is a quenching probe according to the present invention, and this probe has a structure that can quench the signal of DaO by binding complementary to the DaO.

<Example 1> Confirmation of fluorescence signal suppression by QO probe

This experiment was conducted to confirm that the DaO probe binds to the target nucleic acid at a temperature lower than the QO probe melting temperature, and that the signal of the DaO probe is quenched by QO by binding to the QO probe. In this example, Fenton DNA of adenovirus, the cause of respiratory disease, was used as the actual target nucleic acid, and artificial target nucleic acid generated from the actual target nucleic acid by C-TAG technology was detected using a DaO probe.

The DaO probe (DaO #1) is labeled with a quencher molecule (BHQ-2) at the 5' end and a fluorescent signal molecule (Cy5) at the inner part, and the QO probe (QO #1) is labeled with a quencher molecule (Cy5) at the 3' end. It is marked as BHQ-2). And the forward primer (primer 1) contains an artificial random sequence between the 5' end and the restriction enzyme recognition site to generate an artificial target nucleic acid sequence to implement C-TAG technology. The artificial target nucleic acid is a complementary sequence and is generated only when the actual target nucleic acid is present in the sample.

The primer and probe sequences used are as follows.

Primer 1: 5'- GCATCTCCGTGAGCCAGA CCAGG CACCGTCAGTGAAAACGTTCC-3'

Primer 2: 5'-ATGCCCAGGGCCTTTGTAAAC-3'

DaO #1:

5'-[BHQ2]CGCCGCGAGTCCCTTCCGCCGTGAGCCAGACGGCGGCG[T(Cy5)]GACCTGCGTCGACCGCCGG[ C3 spacer ]-3'

QO #1: 5'-CCGGGCGGTCGACGCAGGTC[BHQ2]-3'

The bold and slanted sequence of primer 1 indicates the recognition sequence of the restriction enzyme PspGI, and the underline is the complementary sequence of the artificial target nucleic acid produced thereby . In DaO and QO, parentheses indicate the position of the base sequence where the quenching molecule, fluorescent signal molecule, or C3 spacer is located . C3 spacer refers to an aliphatic linker made of three carbons. The C-TAG sequence generated from the amplicon is as follows.

C-TAG sequence 1: 5'-TCTGGCTCACGGAGATGC-3'

The generated C-TAG sequence is hybridized to a probe or DAO and extended, and the extended sequence is as follows.

C-TAG extension sequence 1: TCTGGCTCACGGAGATGCGACGTCGCGGCG

The melting temperature of DaO #1 with the target nucleic acid (C-TAG extension sequence 1) is designed to be 78°C, and the melting temperature of QO #1 with DaO #1 is designed to be 70°C.

0.3 μM each of forward and reverse primers, 0.1 μM DaO #1 without QO #1 or with 0.3 μM QO #1, 5U of Psp GI (NEB, USA), PCR buffer (1x), MgCl ₂ A total of 20 μl of reaction solution mixed with 2.5 mM, dNTP 200 μM, Solg™ h-Taq DNA polymerase (Solgent, Korea) 1.6 U, and adenovirus template DNA 100 pg/ul was subjected to CFX96 Real-time PCR ( Real-time PCR reaction was performed using Bio-Rad, USA). The tube containing the reaction solution was incubated at 55°C for 5 minutes, then denatured at 95°C for 15 minutes, denaturation at 95°C for 30 seconds, hybridization at 60°C for 30 seconds, and 75°C. In the extension step, a cycle of 30 seconds was repeated 40 times. Fluorescence signals were detected during the annealing step at 60°C and the extension step at 75°C in each cycle.

The results are shown in Figure 4. As can be seen in Figure 4, the fluorescence signal detected in two sections, the annealing step at 60°C and the extension step at 75°C in the condition without QO, was the extension step at 75°C in the condition including QO. It can be confirmed that it is detected in only one section.

Among the sequences of primer 1, the C-TAG sequence complementary to 5'- GCATCTCCGTGAGCCAGA -3', an artificial random sequence at the 5' end generated by Psp GI, which acts only when the target nucleic acid is present, is the DaO probe sequence. It binds complementary to the position of the same sequence as the above random sequence, acts as a primer for the DaO probe, and is extended in the annealing step at 60°C to separate the quenching molecule and the fluorescent signal molecule of the DaO probe from each other. The extended C-TAG sequence is designed to have a dissociation temperature of 78°C, so that the binding is maintained even during the extension step at 75°C, thereby keeping the quencher molecule and the fluorescent signal molecule apart.

Meanwhile, the QO probe binds to the QO complementary sequence at the 3' end of the DaO probe sequence in the annealing step at 60°C, suppressing the signal generation of the internal fluorescent signal molecule of the DaO probe by the quenching molecule at the 3' end of the QO. The QO probe was designed to have a dissociation temperature of 70°C, so it dissociates from DaO in the extension step at 75°C and loses the effect of suppressing the fluorescence signal by the quenching molecule of QO.

Therefore, the results in Figure 4 show that when the QO probe is not present, the DaO probe is bound to its complementary sequence in both the annealing step at 60°C and the extension step at 75°C, so its quenching molecule and the fluorescent signal molecule are separated from each other. A fluorescence signal is detected, but when a QO probe is present, it binds complementary to the DaO probe during the annealing step at 60°C, so the quenching molecule of the QO probe and the fluorescence signal molecule of the DaO probe are adjacent to each other, so no signal is generated. 75 It can be seen that in the extension stage of ℃, the QO probe melts and separates from the DaO probe, thereby generating the signal of the DaO probe.

Meanwhile, in the condition without addition of adenovirus template DNA, which is the actual target nucleic acid ( NC ), no fluorescence signal was detected in both conditions (see Figure 9).

<Example 2> Confirmation of melting temperature of DaO probe and QO probe

The change in fluorescence signal according to the melting temperature of the DaO probe (DaO #1) and QO probe (QO #1) of Example 1 was confirmed through melting peak analysis. The cycle was performed 40 times under the same conditions as in Example 1, and at the last 40 times, the amplification product was extended for 10 minutes, and then the temperature of the obtained amplification product was increased from 55°C to 90°C at a rate of 0.5°C per 5 seconds. Changes in fluorescence signals according to temperature changes were observed.

The results are shown in Figure 5. As confirmed by the dissolution peak analysis results in Figure 5 , in the QO-free condition, only a peak in the positive direction corresponding to the separation of DaO from its complementary sequence is observed (i.e., a decrease in the fluorescence signal). However, under the QO inclusion conditions, in addition to the positive peak corresponding to the separation of DaO from its complementary sequence, a negative peak reflecting the separation of QO from its complementary sequence was simultaneously observed. . From the melting peak observed in this way, it can be confirmed that the melting temperature of DaO with its complementary sequence is 78°C, and the melting temperature of QO with its complementary sequence is 70°C.

In conditions where the target nucleic acid was not included, no peaks were identified due to an increase or decrease in the fluorescence signal in both conditions including and without QO.

<Example 3> Analysis of two target nucleic acids in a single fluorescence channel

This experiment was conducted to prove that it is possible to detect two different target nucleic acids in one reaction tube using a single fluorescence channel.

This example was conducted on RNA of influenza A virus subtype H3N2 and subtype 09pdm, which are the cause of respiratory diseases, and PCR using C-TAG technology was performed in the detection process described below.

Taq DNA polymerase was used to extend the forward and reverse primers, and a C-TAG probe or a DNA fragment (C-TAG) complementary to DaO was generated from the amplification product using restriction enzymes. The generated DNA fragment hybridizes to the complementary binding site within the C-TAG probe/DaO sequence and is extended by polymerase to change the structure of the C-TAG probe/DaO. At this time, below the melting temperature of QO, DaO is quenched by QO, and a fluorescence signal is detected after the melting temperature.

Primer information and target sequence information generated during the amplification process are as follows.

Primer 3: 5'- ACACATCGACCCGTACGATG CCAGG CCGACAGTCCTCACCGAATCC -3'

Primer 4: 5'-GCTGTAAGCTTTGCTGCGTT -3'

Primer 5: 5'- GTGCCTCAGGAACGCTCG CCAGG AGCAAGAAGTTCAAGCCGGA -3'

Primer 6: 5'- CCCGGCTCTACTAGTGTCCA -3'

C-TAG Probe 1: 5'- ATAATTAAGAA[T(FAM)] ACACATCGACCCGTACGATG [BHQ1] -3'

DaO #2:

5'-[BHQ1]CGCCGCGGGTGCTCAGGAACGCTCGCGCGGCG[T(FAM)]TAGACGACGGCCGACCCTGC[C3 spacer]-3'

QO #2: 5'-GCAGGGTCGGCCGTCGTCTA[BHQ1]-3'

The thick and slanted sequences of primers 3 and 5 indicate the recognition sequence of the restriction enzyme PspGI, and the underline is the complementary sequence of the artificial target nucleic acid produced thereby. In probes, DaO and QO, parentheses indicate the position of the base sequence where the fluorescent reporter, fluorescent quencher or C3 spacer is located. C3 spacer refers to an aliphatic linker consisting of three carbons. The C-TAG sequence generated from the amplicon is as follows.

C-TAG sequence 2 5'-CATCGTACGGGTCGATGTGT-3'

C-TAG sequence 3: 5'-CGAGCGTTCCTGAGGCAC-3'

The generated C-TAG sequence is hybridized to a probe or DAO and extended to generate an artificial target nucleic acid, and the extended sequence is as follows.

C-TAG extension sequence 2: 5'-CATCGTACGGGTCGATGTGTATTCTTAATTAT-3'

C-TAG extension sequence 3: 5'-CGAGCGTTCCTGAGGCACCCGCGGCG-3'

The melting temperature of C-TAG probe 1 is designed at 66°C, the melting temperature of DaO #2 with the target nucleic acid (which is an artificial target nucleic acid produced by C-TAG) is designed at 77°C, and QO #2 The melting temperature with DaO #2 is designed to be 68°C.

Primers 3 and 4 react with the H3N2 gene sequence, primers 5 and 6 react with the 09pdm gene sequence, and C-TAG sequence 2 generated during the H3N2 gene amplification process of primers 3 and 4 reacts with probe 1 and primers 5 and 6. C-TAG sequence 3 generated during the 09pdm gene amplification process reacts with DaO #2. QO #2 reacts with the QO binding site of DaO #2.

5U of Psp GI (NEB, USA), PCR buffer (PCR buffer, 1x), MgCl ₂ 2.5 mM, dNTP 200 μM, DTT 0.1mM, RNase Inhibitor 1U, SuperiorScript III (Enzynomics, Korea) at 100 pg/ul without template or with H3 or 09pdm template RNA alone or 100 pg each of H3 and 09pdm A total of 20 ㎕ of reaction solution mixed with the template RNA at a ratio of /ul was subjected to real-time PCR reaction using CFX96 Real-time PCR (Bio-Rad, USA). The tube containing the reaction solution was subjected to a reverse transcription reaction at 55°C for 30 minutes, then denatured at 95°C for 15 minutes, followed by a denaturation step of 30 seconds at 95°C, an annealing step of 30 seconds at 60°C, and extension of 30 seconds at 75°C. The cycle consisting of steps was repeated 45 times. Fluorescence signals were detected at 60°C and 75°C for each cycle.

The results are shown in Figure 6. As can be seen in Figure 6, under the condition of H3 template alone, the amplification curve was confirmed only at 60°C, and no fluorescence signal was confirmed at 75°C. In the condition of 09pdm template alone, the amplification curve is not confirmed at 60℃, and the amplification curve is confirmed only at 75℃. In the mixed conditions of H3 and 09pdm, the amplification curve of H3 is confirmed at 60℃ and the amplification curve of 09pdm is confirmed at 75℃. The PCR result graph confirmed at each temperature under the mixed conditions of H3 and 09pdm was confirmed to be the same as the PCR result graph detected under the H3 or 09pdm alone condition in which the same concentration of template was input, and in the detection of two target nucleic acids, the graph of PCR results confirmed at each temperature was confirmed to be the same. It can be confirmed that the detection results are obtained by a single fluorescence detection channel without interference with each other.

<Example 4> Analysis of multiple target nucleic acids in multiple fluorescence channels

This experiment was conducted to prove that individual analysis of multiple target nucleic acids is possible through fluorescence channels and detection temperature in one reaction tube using multiple fluorescence channels.

This example was conducted on nucleic acids of SARS-CoV-2, Influenza A virus/H3N2, Influenza A virus/09pdm, Influenza B virus, and Adenovirus, which are the causes of respiratory diseases, and C-TAG technology was applied in the detection process described below. PCR was carried out.

Taq DNA polymerase was used to extend the forward and reverse primers, and a C-TAG probe or DNA fragment (C-TAG) complementary to DaO was generated from the amplification product using restriction enzymes. The resulting DNA fragment hybridizes to the complementary binding site within the C-TAG probe/DaO sequence and is extended by polymerase to change the structure of the C-Tag probe/DaO. At this time, below the melting temperature of QO, DaO is quenched by QO, and a fluorescence signal is detected after the melting temperature.

Primer information and target sequence information generated during the amplification process are as follows.

Primer 7: 5'- ACACATCGACCCGCGATG CCAGG ACCCGCAATCCTGCTAACAA-3'

Primer 8: 5'-ACGAGAAGAGGCTTGACTGC-3'

Primer 9: 5'- GTGCCTCAGGAACGCTCG CCAGG AATAGAGCTCGCACCGTAGC

Primer 10: 5'-AACATGTTGTGCAACCACC-3'

Primer 11: 5'- CGCACGCGAAGGCGTCT CCAGG CGCAGCAAAGCTTACAGCAA-3'

Primer 12: 5'-AAACTCCAGGGTGCCTGATG-3'

Primer 13: 5'- GACGACGCTGGCCACC CCAGG CAACCGCAAATGCAGACACA-3'

Primer 14: 5'-ACCCAAATGCAATGGGGCTA-3'

Primer 15: 5'- GCGACCCTGCGACGAG CCAGG ACGCCAGAATGCAACTGAGA-3'

Primer 16: 5'-TTCTGGATCAACCGCCCTTC-3'

Primer 17: 5'- CTGGCGTGCACGGGTC CCAGG AGACATCAAGGCCAAGACGG-3'

Primer 18: 5'-TGTCTGCAATCCCTGGGTTC-3'

Primer 19: 5'- CTGGCAGCGCAGGCAG CCAGG CTGCTCTCACAGATCACGGG-3'

Primer 20: 5'-CCCAGGGCCTGTAAACGTA-3'

C-TAG probe 2: 5'-ATAATTAAGAA[T(FAM)]ACACATCGACCCGTACGATG[BHQ1]-3'

C-TAG probe 3: 5'-ATTATTATAA[T(HEX)] CGCACGCGAAGGCGTCT [BHQ1]-3'

C-TAG probe 4: 5'-CTATTATTA[T(Cy5)] GCGACCCTGCGACGAG [BHQ2]-3'

DaO #3:

5'-[BHQ1]CGCCGCGTG GTGCCTCAGGAACGCTCG CGCGGCG[T(FAM)]TAGACGACGGCCGACCCTGC[C3 spacer]-3'

DaO #4:

5'-[BHQ1]CGCGGGCAG GACGACGCTGGCCACC GCCCGCG[T(HEX)]TAGACGACGGCCGACCCTGC[C3 spacer]-3'

DaO #5:

5'-[BHQ2]GGCCGCGAC CTGGCGTGCACGGGTC CGCGGCC[T(CalRed610)]GTGTGTGACGACTCGGCTGCG[C3 spacer]-3'

DaO #6:

5'-[BHQ2]CCCGGCCTC CTGGCAGCGCAGGCAG GGCCGGC[T(Cy5)]TCGAGGGCTGGAACACGGTG[C3 spacer]-3'

QO #3: 5'-GCAGGGTCGGCCGTCGTCTA[BHQ1]-3'

QO #4: 5'-GGTCGGTCGGGTCACCCCA[BHQ1]-3'

QO #5: 5'-CGCAGCCGAGTCGTCACACAC[BHQ2]-3'

QO #6: 5'-CACCGTGTTCCAGCCCTCGA[BHQ2]-3'

The thick and slanted sequence of the primer indicates the recognition sequence of the restriction enzyme PspGI, and the underline is the complementary sequence of the artificial target nucleic acid produced thereby. In DaO and QO, parentheses indicate the position of the base sequence where the quenching molecule, fluorescent signal molecule, or C3 spacer is located, and the C3 spacer refers to an aliphatic linker consisting of three carbons. The C-TAG sequence generated from the amplicon is as follows.

C-TAG sequence 4: 5’- CATCGTACGGGTCGATGTGT -3’

C-TAG sequence 5: 5’- CGAGCGTTCCTGAGGCAC -3’

C-TAG sequence 6: 5’- AGACGCTTCGCGTGCG -3’

C-TAG sequence 7: 5’- GGTGGCCAGCGTCGTC -3’

C-TAG sequence 8: 5'- CTCGTCGCAGGGTCGC -3'

C-TAG sequence 9: 5’- GACCCGTGCACGCCAG -3’

C-TAG sequence 10: 5'- CTGCCTGCGCTGCCAG -3'

The generated C-TAG sequence is hybridized to a probe or DAO and extended, and the extended sequence is as follows.

C-TAG extension sequence 4: 5’-CATCGTACGGGTCGATGTGTATTCTTAATTAT-3’

C-TAG extension sequence 5: 5’-CGAGCGTTCCTGAGGCACCCGCGGCG-3’

C-TAG extension sequence 6: 5’-AGACGCTTCGCGTGCGATTATAATAAT-3’

C-TAG extension sequence 7: 5’-GGTGGCCAGCGTCGTCCTGCCCGCG-3’

C-TAG extension sequence 8: 5’-CTCGTCGCAGGGTCGCATAATAATAG-3’

C-TAG extension sequence 9: 5’-GACCCGTGCACGCCAGGTCGCGGCC-3’

C-TAG extension sequence 10: 5’-CTGCCTGCGCTGCCAGGAGGCCGGG-3’

Primers 7 and 8, 9 and 10 are the N and RDRP genes of SARS-CoV-2, respectively, primers 11 and 12, 13 and 14 are the HA genes of the H3N2 and H1N1pdm types of the Influenza A virus, and primers 15 and 16, respectively. Primers 17 and 18 react with the NP gene of Influenza A virus, primers 17 and 18 react with the NP gene of Influenza B virus, and primers 19 and 20 react with the penton gene of Adenovirus. C-TAG sequences 4, 5, 6, 7, 8, 9, 10 generated during SARS-CoV-2 N, RDRP, H3N2, H1N1pdm, Flu A, Flu B, ADV gene amplification using primers 7 to 20 reacts with C-TAG probe 2, DaO #3, C-TAG probe 3, DaO #4, C-TAG probe 4, DaO #5, and DaO #6, respectively, to produce cTAG extension sequences 4, 5, 6, 7, and 8. , 9, and 10 are formed. QO #3, 4, 5, and 6 react with the QO binding site of DaO #3, 4, 5, and 6, respectively.

The melting temperature of C-TAG probes 2 to 5 is designed to be 66 to 67°C, and the melting temperature of DaO #3 to 6 with each target nucleic acid (which is an artificial target nucleic acid produced by C-TAG) is 77 to 67°C. It is designed at 78℃, and the melting temperature with DaO, which includes each binding site of QO #3~6, is designed at 68~70℃.

5U of Psp GI (NEB, USA), including primers 7 to 20 at 0.15 μM each, C-TAG probes 2 to 4 and DaO #3 to 6 at 0.1 μM each, QO #3 to 6 at 0.3 μM each, PCR buffer (1x), MgCl ₂ 2.5 mM, dNTP 200 μM, DTT 0.1mM, RNase Inhibitor 1U, SuperiorScript III (Enzynomics, Korea) without template or SARS-CoV-2, Influenza A virus/H3N2, Influenza A total of 20 ㎕ of reaction solution containing A virus/H1N1pdm, Influenza B virus, and Adenovirus nucleic acids at a concentration of 10^6 copies/ul was subjected to real-time PCR reaction using CFX96 Real-time PCR (Bio-Rad, USA). . The tube containing the reaction solution was subjected to a reverse transcription reaction at 55°C for 30 minutes, then denatured at 95°C for 15 minutes, followed by a denaturation step at 95°C for 30 seconds, an annealing step at 60°C for 30 seconds, and an extension at 75°C for 30 seconds. The cycle consisting of steps was repeated 45 times. Fluorescence signals were detected at 60°C and 75°C for each cycle.

The results are shown in Figure 7. As can be seen in Figure 7, under SARS-CoV-2 template reaction conditions, only the amplification curve by C-TAG probe 2 and DaO #3 was confirmed only in the FAM channel at 60°C and 75°C. and fluorescence signals from other channels are not confirmed. Under H3N2 template reaction conditions, only the amplification curves by C-TAG probe 3 and DaO #4 are confirmed in the HEX channel at 60°C and CalRed 610 at 75°C, and no fluorescence signals in other channels are confirmed.

Under the H1N1pdm template reaction conditions, only the amplification curve by C-TAG probe 4 and DaO #4 is confirmed in HEX and CalRed 610 at 75℃, and the fluorescence signals of other fluorescence channels in the 60℃ section and 75℃ are not confirmed. Under the Flu B template reaction conditions, only the amplification curve by C-TAG probe 5 in Cy5 at 60°C is confirmed, and fluorescence signals in other channels at 60°C and in the 75°C section are not confirmed (FIG. 8).

Under ADV template reaction conditions, only the amplification curve from Cy5 to DaO #5 at 75°C is confirmed, and the fluorescence signals of other fluorescence channels in the 60°C section and 75°C are not confirmed. Under conditions of reaction without template, no amplification curves were observed in all fluorescence channels at 60 and 75°C (Figure 9).

In each condition, only the fluorescence signal from the C-TAG probe or DaO probe for the template is detected and no other signals are detected, so it can be confirmed that each target can be individually detected through the fluorescence channel and detection temperature range in the multiple fluorescence channel. You can.

Claims (28)

PCR method for real-time detection of two or more target nucleic acids in a single detection channel comprising the following steps (a) to (c):
(a) Preparing a mixture for PCR reaction containing (i) to (iv) below in the sample to be detected
(i) Forward and reverse primer pairs for amplifying the first target nucleic acid, wherein one of the primer pairs includes a random nucleic acid sequence non-complementary to the first target nucleic acid, a restriction enzyme recognition sequence, and the first target nucleic acid. Contains complementary nucleic acid sequences sequentially,
Forward and reverse primer pairs for amplifying the second target nucleic acid, wherein one of the primer pairs includes a random nucleic acid sequence non-complementary to the second target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid complementary to the second target nucleic acid. contains sequences sequentially;
(ii) a first hybridization probe having a specific complementary sequence to a first artificial target nucleic acid produced depending on the first target nucleic acid among two or more target nucleic acids, wherein the hybridization probe is connected to the artificial target If the nucleic acid does not bind to the probe, the signal material and the quencher have a structure in which no signal is generated because the signal material is adjacent to each other, and the melting temperature at which the first hybridization probe dissociates from the artificial target nucleic acid complementary to it is the temperature of the PCR reaction. During the denaturation step at a relatively high temperature, the annealing step at a relatively low temperature, and the extension step at a relatively medium temperature, it (the first hybridization probe) binds to its complementary sequence in the annealing step between the temperature of the annealing step and the temperature of the extension step. By doing this, the signal material and the quenching material are separated and a signal is generated, but in the extension step, it (the first hybridization probe) is dissociated from its complementary sequence, so the signal material and the quenching material are adjacent to each other and the signal is quenched. Probe with;
(iii) a second hybridization probe having a specific complementary sequence to a second artificial target nucleic acid produced depending on the second target nucleic acid among two or more target nucleic acids, wherein the hybridization probe is a second artificial target nucleic acid. When the target nucleic acid does not bind to the corresponding probe, the signal material and the quencher have a structure in which no signal is generated because the signal material is adjacent to each other, and it has a single-stranded sequence extending terminally from the sequence to which the signal material is bound, and The melting temperature at which the (second hybridization probe) dissociates from the second artificial target nucleic acid complementary thereto is the temperature of the extension step among the relatively high temperature denaturation step, relatively low temperature annealing step, and relatively medium temperature extension step of the PCR reaction. A probe capable of maintaining the second hybridization probe bound to a second artificial target nucleic acid complementary thereto during the annealing step and the extension step between the temperatures of the denaturation step and the temperature of the denaturation step; and
(iv) a quenching probe having a quenching material capable of quenching the signal material of the second hybridization probe by binding complementary to the extended single-stranded sequence of the second hybridization probe, wherein the quenching probe When complementary to the second hybridization probe and a single-stranded sequence extending toward its end (second hybridization probe), the quencher of this probe is combined with the signal material of the second hybridization probe. It has a structure capable of quenching the signal material of the second hybridization probe adjacent to it, and the melting temperature at which this quenching probe dissociates from its complementary sequence is the relatively high temperature denaturation step of the PCR reaction and the relatively low temperature annealing step. During the extension step and the relative medium temperature, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe in the annealing step between the temperature of the annealing step and the temperature of the extension step, but in the extension step, the signal of the second hybridization probe can be quenched. a probe capable of causing the quenching probe to dissociate from its complementary sequence, thereby generating a signal in a second hybridization probe;
(b) placing the mixture of step (a) into a single reaction vessel and performing two or more cycles of PCR reaction of denaturation at relatively high temperature, hybridization at relatively low temperature, and extension step at relatively medium temperature; and
(c) Simultaneously with performing the PCR reaction, the first target nucleic acid is detected by measuring the signal generated from the first hybridization probe in the annealing step, and the second hybridization probe is detected in the extension step. Detecting the second target nucleic acid by measuring the signal generated from the chemical probe.
According to paragraph 1,
The first hybridization probe or the second hybridization probe has a stem-loop structure, and a complementary sequence that specifically binds to the artificial target nucleic acid is present in the loop region.
According to paragraph 1,
The method wherein the denaturation step is performed at 92 to 98°C, the annealing step is performed at 50 to 65°C, and the extension step is performed at 70 to 85°C.
According to paragraph 1,
A method wherein the first artificial target nucleic acid or the second artificial target nucleic acid is produced in quantitative dependence on the first target nucleic acid or the second target nucleic acid, respectively.
The method of claim 1, wherein the production of the artificial target nucleic acid is an amplification product extended from a primer having a structure sequentially comprising a random nucleic acid sequence non-complementary to the target sequence, a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the target sequence. A method characterized in that the complementary sequence of the random nucleic acid sequence contained in is released as a complementary tag fragment of the random sequence during cleavage of the amplification product with a restriction enzyme.
According to paragraph 1,
The first hybridization probe of (ii-b) and the second hybridization probe of (iii) are each of the first artificial target nucleic acid and the second hybridization probe produced depending on the first target nucleic acid and the second target nucleic acid. Has a specific complementary sequence to the artificial target nucleic acid of 2,
The first artificial target nucleic acid and the second artificial target nucleic acid act as primers for the first hybridization probe and the second hybridization probe, respectively, and are extended in the annealing step to form the first hybridization probe and the second hybridization probe. 2 A method characterized by separating each signal substance and quencher substance of the hybridization probe.
According to paragraph 1,
The method includes a first nucleic acid sequence sequentially comprising a random nucleic acid sequence non-complementary to the first or second target nucleic acid of (i), a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the first or second target nucleic acid. Or instead of a primer for amplifying a second target nucleic acid
A pair of forward and reverse primers complementary to the target nucleic acid is used to amplify the target nucleic acid. In this case, the production of artificial target nucleic acid is PTO (Probing and Tagging Oligonucleotide) with an artificial random tag sequence along with a probe sequence complementary to the target nucleic acid. ) is used to generate a PTO fragment, which is a 5' tag of an artificial random sequence, and this PTO fragment becomes an artificial target nucleic acid.
According to paragraph 1,
A method characterized in that the sample to be detected is any sample that requires detection because it contains or is suspected of containing the target nucleic acid to be detected.
According to paragraph 1,
A method wherein the detection target sample is a biological sample obtained from a human body or an animal or a processed sample thereof.
According to paragraph 1,
A method wherein the first target nucleic acid or the second target nucleic acid is cDNA generated by reverse transcription from single-stranded DNA, double-stranded DNA, or RNA.
According to paragraph 1,
A method characterized in that the first target nucleic acid or the second target nucleic acid is a prokaryotic nucleic acid such as a pathogenic bacteria, a eukaryotic nucleic acid derived from or isolated from humans, a pathogenic virus nucleic acid, or a viroid nucleic acid.
According to paragraph 1,
The mixture for the PCR reaction in step (a) includes, in addition to the primer set and the three probes, four types of NTPs and a DNA polymerase.
According to clause 12,
The mixture for the PCR reaction in step (a) is
Tris-HCl as a pH stabilizer, MgCl ₂ or MgSO ₄ or (NH ₄ ) ₂ SO ₄ as a cofactor to promote enzyme activity, BSA (Bovine Serum Albumin), gelatin, glycerol or PEG 6000 as a factor for stabilizing the enzyme, KCl, a factor that promotes the binding of primers to target nucleic acids, Tween 20 or Triton ), urea, DMSO (dimethylsulfoxide) or DMF (dimethylformamid), which are factors to promote annealing of the primer with the target nucleic acid, betaine, and SDS, which is a factor to prevent aggregation of DNA polymerase. A method comprising at least one of (Sodium Dodecyl Sulfate) or Triton X-100.
According to clause 12,
A method characterized in that the DNA polymerase is a polymerase in which 5'->3' exonuclease activity has been removed.
The method of claim 1, wherein the artificial target nucleic acid is a sequence extended after a nucleic acid primarily produced depending on the target nucleic acid is hybridized to a probe.
According to paragraph 1,
The signal material is a fluorescent material,
The fluorescent substances include FAM (6-Carboxyfluorescein), HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), and JOE (6-Carboxy-4',5'- Dichloro-2',7'-Dimethoxyfluorescein), 6-Carboxyl- ) A method characterized in that it is any one of the fluorescent substances.
According to paragraph 1,
The quencher is BHQ1[2-[N-(2-hydroxyethyl)-4-[[2-methoxy-5-methyl-4-[(4-methyl-2-nitrophenyl)diazenyl]phenyl]diazenyl]anilino]ethanol ], BHQ2 (4-[[4-[2-[2,5-Dimethoxy-4-[2-(4-nitrophenyl)diazenyl]phenyl]-diazenyl]phenyl]methylamino]-butanoic acid) and Dabcyl; A method characterized in that it is a quencher of any one of N-[4-(4'-dimethylamino)phenylazo]benzoic acid).
According to paragraph 1,
In step (c) above,
A method for measuring signals generated from the first hybridization probe or measuring signals generated from the second hybridization probe, wherein the results are derived as a PCR result graph consisting of signal intensity and number of PCR cycles.
delete delete delete delete delete The kit of the present invention is a kit for real-time detection of two target nucleic acids with a single signal during PCR, including the primer set (i) and the probes (ii) to (iv) below.
(i) Forward and reverse primer pairs for amplifying the first target nucleic acid, wherein one of the primer pairs includes a random nucleic acid sequence non-complementary to the first target nucleic acid, a restriction enzyme recognition sequence, and the first target nucleic acid. Contains complementary nucleic acid sequences sequentially,
Forward and reverse primer pairs for amplifying the second target nucleic acid, wherein one of the primer pairs includes a random nucleic acid sequence non-complementary to the second target nucleic acid, a restriction enzyme recognition sequence, and a nucleic acid complementary to the second target nucleic acid. contains sequences sequentially;
(ii) a first hybridization probe having a specific complementary sequence to a first artificial target nucleic acid produced depending on the first target nucleic acid among the two target nucleic acids, wherein the artificial target nucleic acid is dependent on the target nucleic acid This also includes cases where the primarily generated nucleic acid is a sequence extended after hybridization to the probe, and in this hybridization probe, if the first artificial target nucleic acid does not bind to the probe, the signal material and the quencher are adjacent to each other. It has a structure that does not generate a signal, and the melting temperature at which it (the first hybridization probe) dissociates from the artificial target nucleic acid complementary to it is the denaturation step at a relatively high temperature, the annealing step at a relatively low temperature, and the annealing step at a relatively medium temperature of the PCR reaction. During the extension step, between the temperature of the annealing step and the temperature of the extension step, in the annealing step, the signal material and the quenching material are separated by binding to the sequence complementary to it (the first hybridization probe), thereby generating a signal, but during the extension step, the signal material and the quenching material are separated. In the step, a probe having a structure in which the signal substance and the quencher are adjacent and the signal is quenched by dissociating from its complementary sequence (the first hybridization probe);
(iii) a second hybridization probe having a specific complementary sequence to a second artificial target nucleic acid produced depending on a second target nucleic acid among two or more target nucleic acids, wherein the artificial target nucleic acid is dependent on the target nucleic acid This also includes cases where the initially produced nucleic acid is a sequence extended after hybridization to the probe, and in this hybridization probe, if the artificial target nucleic acid does not bind to the probe, the signal material and the quencher are adjacent to each other and no signal is generated. It has a structure that does not bind the signal material, and has a single-stranded sequence extending terminally from the sequence to which the signal substance is bound, and it (second hybridization probe) is fused to dissociate from a second artificial target nucleic acid that is complementary to it. The temperature is between the temperature of the extension step and the temperature of the denaturation step among the denaturation step at a relatively high temperature, the annealing step at a relatively low temperature, and the extension step at a relatively medium temperature of the PCR reaction, so that the second hybridization probe is used in the annealing step and the extension step. A probe capable of maintaining a binding state with a second complementary artificial target nucleic acid; and
(iv) a quenching probe having a quenching material capable of quenching the signal material of the second hybridization probe by binding complementary to the extended single-stranded sequence of the second hybridization probe, wherein the quenching probe When complementary to the second hybridization probe and a single-stranded sequence extending toward its end (second hybridization probe), the quencher of this probe is combined with the signal material of the second hybridization probe. It has a structure capable of quenching the signal material of the second hybridization probe adjacent to it, and the melting temperature at which this quenching probe dissociates from its complementary sequence is the relatively high temperature denaturation step of the PCR reaction and the relatively low temperature annealing step. During the extension step and the relative medium temperature, the signal of the second hybridization probe can be quenched by binding to the second hybridization probe in the annealing step between the temperature of the annealing step and the temperature of the extension step, but in the extension step, the signal of the second hybridization probe can be quenched. A probe capable of causing the quenching probe to dissociate from its complementary sequence, thereby generating a signal in a second hybridization probe.
According to clause 24,
The kit is characterized in that, in addition to including the primer set and the three probes, it further includes four types of NTPs and DNA polymerase.
According to clause 25,
The kit contains Tris-HCl as a pH stabilizer, MgCl ₂ or MgSO ₄ or (NH ₄ ) ₂ SO ₄ as a cofactor to promote enzyme activity, BSA (Bovine Serum Albumin), gelatin, glycerol, or PEG 6000, KCl, a factor that promotes the binding of primers to target nucleic acids, Tween 20 or Triton Preventing aggregation of spermidine, urea, DMSO (dimethylsulfoxide) or DMF (dimethylformamid), betaine, and DNA polymerase, which are factors to promote annealing of primers with the target nucleic acid. A kit characterized by additionally containing one or more of SDS (Sodium Dodecyl Sulfate) or Triton
According to clause 24,
The kit sequentially contains a random nucleic acid sequence non-complementary to the first or second target nucleic acid of (i), a restriction enzyme recognition sequence, and a nucleic acid sequence complementary to the first or second target nucleic acid. Instead of primers for amplifying the second target nucleic acid, it includes a pair of forward and reverse primers complementary to the target nucleic acid for amplifying the first or second target nucleic acid,
In this case, the kit additionally includes Probing and Tagging Oligonucleotide (PTO); Here, the PTO includes (i) a 3'-targeting site containing a hybridized nucleotide sequence complementary to the target nucleic acid sequence; and (ii) a 5'-tagging region comprising a nucleotide sequence non-complementary to the target nucleic acid sequence; The 3'-targeting portion of the PTO hybridizes to the target nucleic acid sequence, and the 5'-tagging portion of the PTO does not hybridize to the target nucleic acid sequence;
A kit wherein the fragment released from the PTO becomes an artificial target nucleic acid.
According to clause 24,
The signal material is a fluorescent material,
The fluorescent substances include FAM (6-Carboxyfluorescein), HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), and JOE (6-Carboxy-4',5'- Dichloro-2',7'-Dimethoxyfluorescein), 6-Carboxyl- ) is any one of the fluorescent substances,
The quencher is BHQ1[2-[N-(2-hydroxyethyl)-4-[[2-methoxy-5-methyl-4-[(4-methyl-2-nitrophenyl)diazenyl]phenyl]diazenyl]anilino]ethanol ], BHQ2 (4-[[4-[2-[2,5-Dimethoxy-4-[2-(4-nitrophenyl)diazenyl]phenyl]-diazenyl]phenyl]methylamino]-butanoic acid) and Dabcyl; A kit characterized in that it is one of N-[4-(4'-dimethylamino)phenylazo]benzoic acid).