KR102632441B1 - Synbiotics type intestinal microflora improvement composition comprising polysaccharide-based nanoparticles - Google Patents

Abstract

The present invention relates to a synbiotic composition for improving intestinal flora containing lactic acid bacteria strains as probiotics and polysaccharide nanoparticles as prebiotics, and feed additives, health functional food additives, and pharmaceutical compositions containing the same.

Description

Synbiotic composition for improving intestinal flora comprising polysaccharide nanoparticles {Synbiotics type intestinal microflora improvement composition comprising polysaccharide-based nanoparticles}

The present invention relates to a synbiotic composition for improving intestinal flora containing polysaccharide nanoparticles, and more specifically, to a synbiotic composition as a probiotic, such as Pediococcus acidilactici or Lactobacillus plantarum strain. It relates to a synbiotic composition for improving intestinal flora, including polysaccharide nanoparticles as prebiotics.

Gut microbiota refers to the totality of microorganisms living in the intestines that are formed early in life and actively interact with the host and each other throughout life. Based on genes that are more than 100 times more abundant than humans, the intestinal flora has various effects on the host's physiology, including intestinal mucosal immunity, absorption of nutrients, and bile acid metabolism. In particular, it has recently been known that an imbalance in the intestinal flora is a cause of various diseases such as colon disease, dementia, cancer, or obesity, so maintaining, restoring, and improving the balance of the intestinal flora is important for maintaining health and preventing/treating diseases.

The intestinal flora is constantly changing due to various factors such as diet, pathogen infection, antibiotic exposure, and aging. In general, the intestinal flora that has completed its formation within a few years of life maintains a stable state (symbiosis) with little change throughout life and does not cause significant changes in the host's physiology, but can suddenly change due to exposure to antibiotics or infection with pathogens. If it changes and becomes dysbiosis, it becomes vulnerable to various diseases. In particular, lipopolysaccharide (LPS), a gram-negative bacterial cell wall component, is an endotoxin that causes inflammation. When the intestinal flora is imbalanced, it is distributed in high concentrations around the intestines or in the bloodstream, causing inflammatory bowel disease and various metabolic diseases. It acts as a cause.

Meanwhile, general indicators of the state of the intestinal flora include the diversity of the flora and the high relative abundance of beneficial bacteria. High blood endotoxin level (serum LPS level), which is the cause of endotoxemia and various diseases derived from it, is a result of an imbalance in the intestinal flora and is also an indicator of the risk of developing disease.

Representative methods that many agree on to maintain and improve the intestinal flora include a systematic method to secure the diversity of microorganisms, and a component method to suppress the proportion of harmful bacteria and increase the proportion of beneficial bacteria among specific bacteria in the flora. There is. A representative strategy for this is the introduction of probiotics, prebiotics, or synbiotics, a combination of these, into the host.

Regarding synbiotics, Republic of Korea Patent No. 10-1381794 discloses a synbiotic food composition containing tagaros and probiotic lactic acid bacteria. However, no specific method for improving intestinal flora using synbiotics has yet been proposed.

The present inventors manufactured polysaccharide nanoparticles (phthalyl dextran nanoparticle, PDN; phthalyl pullulan nanoparticle, PPN) using polysaccharide polymers such as dextran and pullulan, and then simply mixed them with probiotics to produce synbiotics. A composition in the form of tics was developed and fed to hosts (rats) with unstable intestinal flora, and changes in the host's intestinal flora and physiological changes were confirmed. The present invention is based on this.

KR 10-1381794 B

In order to solve the above problems, the present invention aims to provide a composition for improving the intestinal flora, which can secure the diversity of intestinal microorganisms by suppressing the proportion of harmful bacteria in the intestinal flora and increasing the proportion of beneficial bacteria.

In order to achieve the above object, the present invention provides a synbiotic composition for improving intestinal flora containing lactic acid bacteria strains as probiotics and polysaccharide nanoparticles as prebiotics.

Additionally, the present invention provides a feed additive containing the composition for improving intestinal flora.

Additionally, the present invention provides a health functional food additive containing the composition for improving intestinal flora.

In addition, the present invention provides a pharmaceutical composition for improving intestinal flora, including the composition for improving intestinal flora.

The synbiotic composition for improving the intestinal flora according to the present invention reduces the proportion of harmful bacteria in the intestinal flora that is in a state of imbalance (dysbiosis) due to rapid changes in the intestinal flora due to exposure to antibiotics or infection with pathogens, and increases the proportion of beneficial bacteria in the intestine. The intestinal flora can be maintained and improved by ensuring diversity of flora and high relative abundance of beneficial bacteria.

The synbiotic composition for improving intestinal flora according to the present invention improves the production of antibacterial proteins by probiotics through a self-defense mechanism and exhibits higher antibacterial activity against Gram-positive and negative pathogens than the probiotic itself, thereby improving the colonization of intestinal flora. Modification can be used to suppress or treat pathogenic intestinal infections and prevent a decrease in the diversity of the microbiota.

The synbiotic composition for improving intestinal flora according to the present invention can reduce the level of endotoxin in the blood, thereby strengthening the intestinal barrier and preventing or alleviating inflammation.

The synbiotic composition for improving intestinal flora according to the present invention may exhibit physiological changes such as increased body weight, increased feed intake, and increased colon length.

Figure 1 is (A) a reaction scheme for PDN synthesis, (B) the form of PDN observed by SEM, (C) the mole percent of phthalic acid in PDN calculated by ¹ H NMR, and (D) the size of PDN by DLS. Measurement results and zeta potential by ELS (magnification: 10,000X; scale bar = 2 μm).
Figure 2 shows the results of confocal microscopy and FACS analysis of the incorporation of PDN (A) and dextran (B) by PA in a carrier-, temperature-, and time-dependent manner.
Figure 3 shows the antibacterial activity of PA, dextran-treated PA (PA/D), and PDN-treated PA (PA/PDN) against pathogens (AD) (data are the mean ± SEM of three independent experiments). Indicated as. Statistical significance between each group was analyzed by one-way ANOVA and Tukey's test (*p < 0.05, **p < 0.01, ***p < 0.001).
Figure 4 shows the biological effects of PDN on PA, (A) pediocin production by Bradford assay, (B) pediocin activity (AU/ml) by growth inhibition diameter of Listeria monocytogenes , (C) 16S Relative mRNA expression of pedA-D compared to rRNA expression, (D) Expression levels of groEL , groES , dnaK , and dnaJ relative to 16S rRNA quantified by qRT-PCR (data as mean ± SEM of three independent experiments) Indicated. Statistical significance between PA and other groups was analyzed by one-way ANOVA and Tukey's test (*p < 0.05, **p < 0.01, ***p < 0.001).
Figure 5 shows the physiological changes in mice after feeding synbiotics according to an embodiment of the present invention, comparing (A) change in body weight, (B) change in feed intake, and (C) change in colon length by group. will be. (C: control group; T1 group: PA; T2 group: PA with dextran; T3 group: PA with PDN)
Figure 6 shows changes in the intestinal microflora of mice after feeding synbiotics according to an embodiment of the present invention, (A) control mice or mice treated with PA, PA with dextran, or PA with PDN. From the unweighted principal coordinate analysis (PCoA) plot of the mouse intestinal microbiota, (B) the number of observed OTUs in the mouse intestinal microbiota, (C) the measurement results of the viable count of E.coli O157:H7 in mouse fecal samples, (D) ) Ratio of E.coli O157:H7 (intimin) in mouse fractionated samples, (E) Change in proportion of Proteobacteria phylum in intestinal microflora, (F) Content of lactic acid bacteria (LAB) in feces, (G) Bifidobacteria in feces It shows the content of Bifidobacterium spp. (C: control group; T1 group: PA; T2 group: PA with dextran; T3 group: PA with PDN)
Figure 7 shows the chemical synthesis reaction of PPN (phthalyl pullulan nanoparticles).
Figure 8 shows (A) the mole percent of phthalic acid in PPN calculated by ^1H NMR, (B) the zeta potential by ELS, (C) the measurement result of PPN size by DLS, and (D) observation by SEM. This is the shape of a PPN (magnification: 10,000X; scale bar = 100 nm).
Figure 9 shows the results of analyzing the incorporation of PPN by LP (FITC-PPN is shown in green, LP is stained in blue with DAPI), and the incorporation of PPN was quantified by FACS after 2 hours of treatment and statistically By analysis, (A) Z-section image showing the introduction of PPN into LP, (B) LP precultured with 10% (w/v) glucose, fructose, galactose, or PPN3 at 0.5% (w/v) v) treated with FITC-PPN3 for 2 hours at 37°C and observed by CLSM and FACS (confocal and FACS data are representative of three independent experiments, mean values are shown in bar charts ± Expressed as SEM. Statistical significance was analyzed between each group by one-way ANOVA and Turkey's test ( ^*** p <0.001). Scale bar = 10㎛.)
Figure 10 shows the FITC fluorescence intensity and location of FITC-PPN3 after staining the LP cell membrane using a membrane-binding dye (FM4-64). (A) The intensity of FITC fluorescence is maximum at the center of LP, and (B) It was confirmed that FITC fluorescence was visible within the bacteria.
Figure 11 shows (A) LP treated with 0.5% (w/v) FITC-pullulan, FITC-PPN1, FITC-PPN2, and FITC-PPN3 at 37°C for 2 hours and observed by CLSM and FACS, ( B) LP was treated with 0.5% (w/v) FITC-PPN3 for 2 hours at 4°C, 20°C, and 37°C and observed by CLSM and FACS (confocal and FACS data are representative of three independent experiments) The average value is shown in the bar chart as the mean ± SEM of independent FACS experiments. Statistical significance was analyzed between each group by one-way ANOVA and Turkey's test ( ^*** p < 0.001).Scale bar=2㎛).
Figure 12 relates to the antibacterial ability of LP/PPN against E.coli and LM. LP treated with PPN or pullulan was co-cultured with Gram-negative E.coli or Gram-positive LM, and E. The growth inhibition rate for coli (A) and LM (C) was calculated in CFU. Similarly, growth inhibition diameters of E. coli (B) and LM (D) were measured on LB and BHI agar plates (data are shown as mean ± SEM of three independent experiments. Statistical significance was determined by one-way variance. Statistical significance was analyzed between LP treated with P and LP treated with PPN by one-way ANOVA and Turkey's test ( ^** p <0.01 and ^*** p <0.001).
Figure 13 is an analysis of the mechanism for improving antibacterial activity, (A) measuring the growth of LP in the LP group treated with PPN or pullulan, (B) measuring the pH of the culture medium, and proteinase K The antibacterial efficacy of LP/PPN against E. coli (C) and LM (D) was measured after treatment, (E) the relative mRNA expression level of planS compared to the 16S rRNA expression level was measured, (F) The separated plantaricin was measured by SDS-PAGE. Data confirming mRNA expression levels are expressed as the mean ± SEM of three independent experiments. Statistical significance between groups was analyzed by one-way ANOVA and Turkey's test ( ^* p <0.05, ^** p <0.01, and ^*** p <0.001).
Figure 14 shows the results of gene analysis related to stress response in LP treated with PPN, where the expression levels of dnaK (A) and dnaJ (B) for 16S rRNA were quantified by qRT-PCR (data are from three independent experiments) Expressed as mean ± SEM. Statistical significance was analyzed between LP and other groups by one-way ANOVA and Turkey's test ( ^* p <0.05, ^** p <0.01, and ^*** p <0.001). .)
Figure 15 compares (A) change in body weight, (B) change in food intake, and (C) change in colon length of mice by group after feeding synbiotics according to an embodiment of the present invention. (C: Control; T1 group: LP untreated; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: LP with pullulan and PPN LP)
Figure 16 compares the results of measuring the cecum weight of mice by group after feeding synbiotics according to an embodiment of the present invention. (C: Control; T1 group: LP untreated; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: LP with pullulan and PPN LP)
Figure 17 shows the blood endotoxin (EU/ml) levels for each group orally administered E. coli . (C: Control; T1 group: LP untreated; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: LP with pullulan and PPN LP)
Figure 18 shows principal coordinate analysis (PCoA) results based on unweighted UniFrac distances. (C: Control; T1 group: LP untreated; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: LP with pullulan and PPN LP)
Figure 19 shows principal coordinate analysis (PCoA) results based on weighted UniFrac distances. (C: Control; T1 group: LP untreated; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: LP with pullulan and PPN LP)
Figure 20 shows changes in the intestinal microflora of mice after feeding synbiotics according to an embodiment of the present invention, (A) the number of observed OTUs in the mouse intestinal microflora, (B) E. in mouse fecal samples. coli O157:H7 viable count measurement results, (C) changes in the proportion of Proteobacteria phylum in the intestinal microflora, (D) counting results using a selection medium (MRS agar) for lactic acid bacteria (LAB) in feces, (E) It shows the content of Lactobacillus ( Lactobacillus spp.) in feces and (F) the content of Bifidobacterium ( Bifidobacterium spp.) in feces. (C: Control; T1 group: LP untreated; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: LP with pullulan and PPN LP)
Figures 21 and 22 schematically show a synbiotic feeding schedule according to an embodiment of the present invention.

Hereinafter, preferred embodiments according to the present invention will be described in detail with reference to the attached drawings. However, identical or similar components will be assigned the same reference numbers regardless of the reference numerals, and duplicate descriptions thereof will be omitted.

Additionally, when describing the present invention, if it is determined that a detailed description of related known technologies may obscure the gist of the present invention, the detailed description will be omitted. In addition, it should be noted that the attached drawings are only intended to facilitate easy understanding of the spirit of the present invention, and should not be construed as limiting the spirit of the present invention by the attached drawings.

As used herein, the term 'antibacterial' refers to bactericidal activity or inhibition of microbial growth in microbial populations, particularly Escherichia coli and/or methicillin-resistant Staphylococcus aureus. As used herein, the term “antibacterial” means a significant reduction in the number of microorganisms compared to the control group when measured after 24 hours.

In this specification, 'probiotics' refers to live microbial preparations that have a beneficial effect on the host by improving the intestinal flora.

In this specification, 'prebiotics' refers to substances that are not digested but decomposed by specific intestinal microorganisms to induce the growth and activity of probiotics.

In this specification, 'Dysbiosis' refers to a state in which the intestinal flora is unstable and the effect of pathogen infection is maximized.

In this specification, 'microbiome' refers to microorganisms existing in a specific environment and their entire genetic information, and refers to a collection of genomes that represent the entire genetic information of a single organism. Therefore, 'Human Microbiome' refers to the microorganisms living inside and outside the human body and their entire genetic information.

One embodiment of the present invention provides a synbiotic composition for improving intestinal flora containing lactic acid bacteria strains as probiotics and polysaccharide nanoparticles as prebiotics.

The lactic acid bacteria are Pediococcus pentosaceus , or Pediococcus acidilactici , Lactobacillus lactis subsp., or Lactococcus lactis, and It may be one or more types of lactic acid bacteria selected from the group consisting of Lactobacillis plantarum .

The lactic acid bacteria can produce antibacterial proteins. Antibacterial proteins are proteins biosynthesized by useful microorganisms such as lactic acid bacteria, yeast, photosynthetic bacteria, and Bacillus, or glycoproteins that combine proteins and carbohydrates, and are substances with antibacterial effects produced by microorganisms to defend themselves.

The types of antibacterial proteins are different depending on the microbial strain that produces the antibacterial proteins. Antibacterial proteins produced from lactic acid bacteria include pediocin produced from Pediococcus pentosaceus or Pediococcus acidilactici , Lactobacillus lactis subsp. ) or nisin produced from Lactococcus lactis, sakacin produced from Lactobacillus sake, and salivaricin produced from Lactobacillus salivarius. ), heveticin or lactocin produced from Lactobacillus helveticus, acidophilucin or lactacin produced from Lactobacillus acidophilus (lactacin), plantaricin or plantacin produced from Lactobacillus plantarum, mersacidin produced from Bacillus spp, Enterococcus faecalis ( It may be cytolysin produced from Enterococcus faecalis, Entericin produced from Enterococcus faecium, and gassericin produced from Lactobacillus gasseri.

In one embodiment of the present invention, the antibacterial protein is preferably one or more antibacterial proteins selected from the group consisting of pediocin, nisin, plantaricin, and plantacin. .

In one embodiment of the present invention, the lactic acid bacteria strain may be Pediococcus acidilactici, which produces pediocin.

In one embodiment of the present invention, the Pediococcus acidilactici may be Pediococcus acidilactici KCTC 21,088.

In another embodiment of the present invention, the lactic acid bacteria strain may be Lactobacillus plantarum , which produces plantaricin.

The Lactobacillus plantarum may be LP 177 isolated from pig intestines. LP 177 exhibits strong antibacterial activity against E. coli K99.

Prebiotics, generally defined as indigestible food ingredients, induce the growth or activity of beneficial microorganisms in the gastrointestinal tract and provide beneficial health effects to the host. In the present invention, polysaccharides are used as prebiotics.

Non-limiting examples of the polysaccharides include cellulose, inulin, pullulan, starch, dextran, pectin, etc.

Dextrans are increasingly used as a prebiotic source due to their complex branched glucans consisting of α(1→6) glycosidic linkages between straight-chain glucose molecules and α(1→3) linkages between branches. This linkage cannot be digested by pancreatic enzymes in the upper gastrointestinal (GI) tract, but can be fermented by the intestinal microflora.

The pullulan is a water-soluble polysaccharide produced by Aureobasidium pullulans , a type of fungus, in which maltotriose units are linked by an α-1,6 bond. This pullulan can be used as a prebiotic for Lactobacillus plantarum and fermented into butyrate and propionate by Lactobacillus plantarum . Butyrate can modulate intestinal barrier function, and propionate can treat DSS-induced intestinal dysfunction.

According to one embodiment of the present invention, the polysaccharide is preferably a polysaccharide having a hydrophobic residue.

Polysaccharides are obtained from nature and have a structure without hydrophobic residues, but the polysaccharides used in the method according to an example of the present invention are artificially added to a hydrophobic group through an ester bond to the primary alcohol group of the polysaccharide. This is a structure that introduced . The hydrophobic residues include acetate, propionate, butyrate, phthalate, cholesterol, mercaptosuccinic acid, and methyl glutaric acid. It may be, etc.

Polysaccharides into which these hydrophobic residues are introduced can self-assemble into nanoparticles due to the hydrophobic effect in hydrophilic solvents. In this way, polysaccharides having hydrophobic residues can enhance the biosynthesis of antibacterial proteins by increasing the activity and stimulation of microorganisms.

According to one embodiment of the present invention, the hydrophobic residue is at least one selected from the group consisting of acetate, propionate, butylate, phthalate, cholesterol, mercaptosuccinic acid, and methyl glutaric acid, and the polysaccharide is cellulose, It is preferable that it is at least one selected from the group consisting of inulin, pullulan, starch, dextran, and pectin.

Examples of polysaccharides having such hydrophobic residues include acetyl inulin, phthalyl inulin, phthalyl dextran, phthalyl starch, and phthalyl pullulan. ), cholesteryl pullulan, propyl inulin, etc.

For example, the polysaccharide nanoparticle may be phthalyl dextran nanoparticle (PDN).

In the present invention, as shown in Figure 1 (A), phthalyl dextran nanoparticles (PDN) were prepared in which a hydrophobic phthalyl group was introduced into dextran by ester bonding a hydroxyl group in dextran and a carboxylic acid in phthalic acid.

As another example, the polysaccharide nanoparticle may be phthalyl pullulan nanoparticle (PPN).

In the present invention, as shown in Figure 7, phthalyl pullulan nanoparticles (PPN) were prepared in which a hydrophobic phthalyl group was introduced into pullulan through an ester bond between a hydroxyl group in pullulan and a carboxylic acid in phthalic acid.

The synbiotic composition may be a formulation containing the lactic acid bacteria strain and the polysaccharide nanoparticles.

According to one embodiment of the present invention, the synbiotic composition may be a formulation containing Pediococcus acidilactici and phthalyl dextran nanoparticles (PDN).

According to another embodiment of the present invention, the synbiotic composition may be a formulation containing Lactobacillus plantarum and phthalyl pullulan nanoparticles (PPN).

The polysaccharide nanoparticles can be introduced into lactic acid bacteria cells to increase the activity and stimulation of microorganisms and enhance the biosynthesis of antibacterial proteins.

In an experimental example of the present invention, the process of introducing polysaccharide nanoparticles into lactic acid bacteria cells was confirmed to be a time-, temperature-, and carrier-dependent process.

Additionally, the present invention provides a feed additive containing the synbiotic composition for improving intestinal flora.

The feed additive can be manufactured in powder or granular form, and, if necessary, organic acids such as citric acid, humalic acid, adipic acid, lactic acid, and malic acid, or phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate, and polyphosphate, It may additionally contain one or more of natural antioxidants such as polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, and phytic acid.

The feed additives include grains such as ground or broken wheat, oats, barley, corn and rice; Vegetable protein feeds, such as those based on rape, soybean, and sunflower; Animal protein feeds such as blood meal, meat meal, bone meal and fish meal; It may further include dry ingredients such as sugar and dairy products, such as various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, etc.

The feed additive may be administered to animals alone or in combination with other feed additives in an edible carrier. Additionally, the feed additives can be easily administered to animals as a top dressing, by mixing them directly into the feed, or in an oral formulation separate from the feed. When the feed additive composition is administered separately from feed, it can be prepared into an immediate-release or sustained-release formulation by combining it with a pharmaceutically acceptable edible carrier, as is well known in the art. These edible carriers can be solid or liquid, such as corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil and propylene glycol. If a solid carrier is used, the feed additive may be a tablet, capsule, powder, troche or sugar-containing tablet or a top dressing in microdisperse form. If a liquid carrier is used, the feed additive may be in the form of gelatin soft capsules, or a syrup, suspension, emulsion, or solution.

The feed additive may contain, for example, preservatives, stabilizers, wetting or emulsifying agents, solution accelerators, etc. The feed additive can be used by adding it to animal feed by injecting, spraying, or mixing it.

The feed additive can be applied to a number of animal diets, including mammals and poultry. The mammals include pigs, cows, sheep, goats, laboratory rodents, and laboratory rodents, as well as pets (e.g., dogs, cats), and the poultry can include chickens, turkeys, ducks, geese, pheasants, etc. It can also be used for quails, etc.

Additionally, the present invention provides a health functional food additive containing the synbiotic composition for improving intestinal flora.

The health functional food additive may be added as is to the composition for improving intestinal flora, or may be used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). Generally, when producing food or beverages, the synbiotic of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw materials. However, in the case of long-term intake for the purpose of health and hygiene or health control, the mixing amount may be below the above range, and since there is no problem in terms of safety, the mixing amount may be used in an amount above the above range.

There are no particular restrictions on the types of health functional foods. Examples of foods to which the synbiotics can be added include dairy products, various soups, beverages, teas, drinks, and vitamin complexes, and include all health foods in the conventional sense.

Additionally, the present invention provides a pharmaceutical composition for improving intestinal flora, including the synbiotic composition for improving intestinal flora.

The pharmaceutical composition can be administered orally or parenterally, and when administering parenterally, it is preferable to select external dermal application or intrarectal injection.

The pharmaceutical composition may further include commonly used excipients, disintegrants, sweeteners, lubricants, flavoring agents, etc. In addition, the pharmaceutical composition may further include pharmaceutically acceptable additives. In this case, the pharmaceutically acceptable additives include microcrystalline cellulose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, gum arabic, Powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sorbitol, talc, etc. can be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the pharmaceutical composition.

Solid preparations for oral administration include powders, granules, tablets, capsules, soft capsules, pills, etc. Liquid preparations for oral use include suspensions, oral solutions, emulsions, syrups, and aerosols. In addition to the commonly used simple diluents such as water and liquid paraffin, they contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. You can. Preparations for parenteral administration include external preparations such as powders, granules, tablets, capsules, sterilized aqueous solutions, solutions, non-aqueous solvents, suspensions, emulsions, syrups, suppositories, aerosols, etc. and sterilized injection preparations according to conventional methods. It can be formulated and used in the form of a cream, gel, patch, spray, ointment, warning agent, lotion, liniment agent, pasta agent, or cataplasma agent. It can be prepared and used as a pharmaceutical composition for external use on the skin. , but is not limited to this. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

The preferred dosage of the pharmaceutical composition varies depending on the absorption, inactivation rate and excretion rate of the active ingredient in the body, the age, gender and condition of the patient, and the severity of the disease to be treated, but can be appropriately selected by a person skilled in the art. However, for desirable effects, in the case of oral administration, the composition of the present invention is generally administered to adults at 0.0001 to 100 mg/kg per day, preferably 0.001 to 100 mg/kg per kg of body weight per day. good night. Administration may be administered once a day, or may be administered several times. The above dosage does not limit the scope of the present invention in any way.

Hereinafter, the present invention will be described in more detail through examples and comparative examples. These examples are merely presented as examples to explain the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples. .

<Example 1> Synthesis of PDN

All materials and chemicals used in the present invention were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise noted. Lysogeny broth (LB), LB agar, MRS broth, MacConkey agar medium, and Brain Heart Infusion (BHI) broth for bacterial culture were purchased from BD Difco (Sparks, MD, USA).

As shown in Figure 1 (A), phthalyl dextran nanoparticles (PDN) were prepared in which a hydrophobic phthalyl group was introduced into dextran by ester bonding a hydroxyl group in dextran and a carboxylic acid in phthalic acid.

Specifically, dextran (1 g, MW=4000 gmol ^-1 ) was added to 5 ml of dimethyl formamide, and then 0.2 ml of 5% sodium acetate (w/v) was added as a catalyst for the reaction. Subsequently, phthalic anhydride was added to the dextran solution at a 2:1 M ratio. The reaction was performed with nitrogen at 40°C for 24 hours to synthesize PDN, and the PDN was lyophilized and stored at -20°C until use.

<Experimental Example 1> Characteristics of PDN

The surface of the PDN prepared in Example 1 was measured using a scanning electron microscope (FE-SEM) (Carl Zeiss, SUPRA 55VP-SEM). As shown in Figure 1 (B), the shape of the PDN was spherical at the nanometer scale.

Additionally, particle size was measured using a dynamic light scattering (DLS) spectrophotometer (Otsuka Electronics, DLS-7000). As shown in Figure 1 (D), the average size of PDN was 238.7 nm with a polydispersity index of 0.220.

Additionally, the amount of phthalyl group in PDN was measured using a 600 MHz ¹ H nuclear magnetic resonance (NMR) spectrometer (Bruker, AVANCE 600). As shown in Figure 1 (C), the protons of dextran and phthalic acid in PDN were confirmed to be 3.8 and 7.4-7.7 ppm, respectively. In addition, the phthalyl group of PDN was 27.6 mol% based on the total of the protons of the dextran group and the phthalyl group.

Additionally, the surface charge (zeta potential) was measured using an electrophoretic light scattering photometer (Otsuka Electronics, ELS-8000). As shown in Figure 1 (D), the surface charge was confirmed to be -27.32 Mv. This is due to the carboxylic acid in the phthalyl group of PDN.

<Experimental Example 2> Confirmation of introduction characteristics of PDN in PA

With respect to the PDN prepared in Example 1, it was confirmed whether Pediococcus acidilactici KCTC 21,088 (PA) was introduced.

(1) Check whether or not it is introduced by incubation time

First, PDN and dextran labeled with FITC (fluorescence isothiocyanate) were prepared, respectively. PDN and dextran dissolved in 5 mg of FITC and 1 ml of DMSO were mixed, respectively, and stirred in the dark at room temperature for 4 hours. Afterwards, the reaction product was dropped into 10 ml of ethanol to remove unreacted FITC, and FITC-labeled PDN (FITC-PDN) and dextran (FITC-dextran) were each recovered by centrifugation at 19,000 xg for 10 minutes. Afterwards, 200 ml of DAPI (4,6-diamidino-2-phenylindol, 2 ug/ml) solution was added and reacted for 10 minutes.

The PA cultured in 1 ml of MRS liquid medium was treated with ^0.5 % (w/v) FITC-PDN or FITC-dextran at 2.0 Samples washed three times with 1 ml of PBS were measured using flow cytometry (BD Biosciences, BD FACSCanto2) and confocal laser microscopy, and the results are shown in Figure 2. FITC-PDN or FITC-dextran is shown in green, and PA was stained blue with DAPI (4',6-diamidino-2-phenylindole).

As shown in Figure 2 (A), FITC-PDN was confirmed to be introduced into the PA within 3 minutes and the degree of introduction increased with time.

(2) Check whether to introduce each incubation temperature

The experiment was conducted in the same manner as (1) of Experimental Example 2, except that FIIC-PDN or FITC-dextran was incubated in PA for 2 hours at 4°C, 25°C, and 37°C.

The incorporation of PDN in Figure 2 was confirmed to be higher after incubation at 37°C for 2 hours than after incubation at 25°C or 4°C. From this, it can be seen that the introduction of PDN into PA is an energy-dependent mechanism that increases with increasing culture temperature.

(3) Check whether each carrier has been introduced

To identify the transporter that introduces PDN into cells, glucose, galactose, and fructose were used as PDN transport blockers.

First, the PA ^2.0 /v) FITC-dextran or FITC-PDN was incubated at 37°C for 2 hours. Samples washed three times with 1 ml of PBS were measured using flow cytometry (BD Biosciences, BD FACSCanto2) and confocal laser microscopy, and the results are shown in Figure 2.

As shown in Figure 2 (A), it was confirmed that glucose pre-incubation interfered with the introduction of PDN by about 74.6%, while galactose and fructose pre-incubation prevented the introduction of PDN by about 55.1% to 46.8%, respectively. From this, it was found that when PDN is introduced into PA, a transporter that transports glucose into cells is more involved.

<Experimental Example 3> Antibacterial activity of PA/PDN

To evaluate whether the antibacterial properties of PA changed with the introduction of PDN, Gram-negative bacteria such as Salmonella Gallinarum, Escherichia coli K88, and Escherichia coli O157:H7 were used. Co-culture test to confirm the antibacterial activity of PA, dextran-treated PA (PA/D), and PDN-introduced PA (PA/PDN) against Gram-positive pathogens such as pathogens and Listeria monocytogenes. and agar diffusion tests were performed.

All bacterial strains used were cultured in the corresponding media: Pediococcus acidilactici (PA) in MRS broth, Gram-negative Salmonella Gallinarum and Escherichia in LB broth. coli K88, and Escherichia coli O157:H7, and Gram-positive Listeria monocytogenes in BHI broth .

Gram-positive and Gram-negative bacteria were cultured at 37°C in a shaking incubator (255 rpm) and used in subsequent experiments or stored at -70°C in 15% (v/v) glycerol. Pathogenic strains were provided by the Agricultural Microorganism Bank (KACC).

For co-culture tests, 1.0x10 ⁶ CFU/ml of the above Gram-negative pathogens were incubated in MRS broth at 1.0x10 ⁶ CFU/ml of PA [0.5% (w) for 8 hours at 37°C in a shaking incubator (255 rpm) (aerobic conditions). /v) treated with or without PDN or dextran]. The co-culture samples were then plated on MacConkey agar medium.

For the agar diffusion test, 120 μl of the above Gram-negative pathogens (2.0x10 ⁸ CFU/ml) were plated on LB agar plates. Next, the paper disks were placed on agar smeared with pathogens, and 120 μl (2.0×10 ⁸ CFU/ml) of PA [cultured with 0.5% (w/v) PDN or dextran] was spread onto the paper disks. It was loaded onto. The inhibition zone was measured after incubation at 37°C for 20 hours. In the case of Gram-positive pathogens, 1.0×10 ⁵ CFU/ml of PA and Listeria monocytogenes were directed to BHI broth and then plated on Oxford agar for co-culture. BHI agar was used in the agar diffusion test.

As shown in Figure 3 (A) to (D), in the co-culture test, PA/PDN had significantly higher antibacterial activity against both Gram-negative and positive pathogens than untreated PA or PA treated with dextran alone (PA/D). It was confirmed that it represents .

Additionally, in the agar diffusion test, the growth inhibition rate was calculated as the diameter of the inhibition zone.

As shown in Figures 3 (A) to (D), PA/PDN was confirmed to exhibit a wider inhibition area than PA/D or PA alone.

From this, it can be seen that the introduction of PDN by PA induces antibacterial activity and affects the production of antibacterial proteins.

<Experimental Example 4> Pediosin expression and quantitative analysis by PA/PDN

(1) Pediosin expression by PA/PDN

PA was added to the PDN-treated MRS liquid medium and cultured for 24 hours in a constant temperature shaker (255 rpm) at 37°C. The culture was centrifuged at 3,000 Once the protein precipitated, it was centrifuged at 3,000 xg for 30 minutes at 4°C. The pellet from which the supernatant was removed was dissolved in PBS buffer and purified using a centrifugal filter (Sigma-Aldrich) to recover the sample. Samples were dialyzed overnight (o/n) in PBS. The protein obtained by dialysis was freeze-dried and stored at 4°C. The obtained protein was confirmed to be pediocin by SDS-PAGE using commercially available pediocin.

(2) Pediocin quantitative analysis

The production of pediocin by PA was quantitatively analyzed using the Bradford method, pediocin activity test, and quantitative real-time PCR (qRT-PCR).

1) Bradford analysis

The amount of protein obtained by treating PA with nothing (PA), protein obtained by treating PA with dextran (PA/D), and protein obtained by treating PA with PDN (PA/PDN) was measured using the Bradford assay. quantified, and the results are shown in Figure 4. Pediocin was purified using the ASM purification method and then quantified using the bovine serum albumin standard curve. As shown in Figure 4 (A), the production of pediocin by PA/PDN was confirmed to be 2.2 times and 1.7 times higher than that of PA and PA/D, respectively.

2) Pediocin activity analysis

To measure the specific activity of pediocin, the inhibition diameter of Listeria monocytogenes was measured after incubation with culture supernatant (pH 5.5) and expressed as arbitrary units (AU) per ml. As shown in Figure 4 (B), PA/PDN was confirmed to have 7.0 times and 5.8 times higher pediocin activity than PA and PA/D, respectively.

3) Quantitative real-time PCR

To verify pediocin production by PA at the gene level, qRT-PCR was performed to measure the expression of genes involved in pediocin biosynthesis. Specifically, the expression levels of stress-related genes, including heat shock-related genes such as groEL , groES , dnaK , and dnaJ , were measured after introduction of PDN into PA.

RNA extraction was performed using the TRIzol® Max™ Bacterial RNA Isolation Kit purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Total RNA extraction was performed according to the manufacturer's instructions.

After isolation of RNA, cDNA was synthesized from 1 μg of RNA using ReverTra Ace ^® qPCR RT Master Mix and gDNA remover purchased from TOYOBO CO., LTD (Dojima, Osaka, Japan).

RT-PCR was performed with SYBR qPCR Mix using the one-step real-time PCR protocol. The primer sequences used at this time are as listed in Table 1 below.

gene Primer sequence (5’-3’) Size (bp) groEL F:GGTAACGGTCGCGTTTTAGA
R:TTCAACGACTGCAACTAAGTCC 156 groES F:GGAAGACCTTGACGCAGAAGR:CGTTTTGAAGTGCTGAACGA 239 dnaK F:TTAACACGGGCACAATTTGAR:GCTTCGTCAGGGTTAATGGA 212 dnaJ F:GCCCAACTTGTGTGTGGTACTR:CCAGTGCAGCTTGTACGAAA 240 16S F:GATGCGTAGCCG ACCTGAGAR:TCCATCAGACTTGCGTCCATT 113

For relative quantification, the relative expression level of each gene was calculated using the ΔΔCt method based on the expression level of 0.01 ng of 16S RNA Cdna in 1 ng of primer.

Target gene expression was normalized to the relative expression of the 16s rRNA gene, which was used as an internal control in each sample. Data are presented as fold change relative to probiotic control.

As shown in Figure 4 (C), the relative expression levels of all four pediocin biosynthetic genes are higher in PA/PDN than in PA or PA/D, and in particular, the expression of the ped A gene is significantly higher in PA/PDN than in untreated PA. It was confirmed that it was high (3.3 times).

From this, it can be seen that the introduction of PDN by PA improved the antibacterial activity of PA through induction of pediocin production.

In addition, as shown in Figure 4 (D), the expression levels of groEL , groES , and dnaK in PA/PDN were confirmed to be higher than those in PA or PA/D. In particular, the expression of groEL in PA/PDN was significantly higher (3.2-fold) than in PA. From this, it can be seen that the introduction of PDN by PA induced a stress response in PA.

<Experimental Example 5> Animal dietary experiment

Animal feeding experiments were performed using 5-week-old BALB/C male mice in accordance with international ethical guidelines. Animal experiments were conducted with approval from the Animal Experiment Ethics Committee of Seoul National University (SNU-170,531-1-1).

Mice were housed at controlled temperature (22±2°C) with a 12 hour light/dark cycle. Animals were fed standard mouse chow ad libitum and distilled water was provided at all times. After 7 days of acclimation, mice were randomly assigned into four groups (10 BALB/C mice per group). The control group continued to be fed as before. The T1 group was administered a single dose of 10 ⁸ CFU Pediococcus acidilactici (PA) in saline solution by oral gavage. The T2 and T3 groups were each administered a single dose of dextran (0.5% w/v)-treated PA or PDN (0.5% w/v)-treated PA. The test group was continuously administered the test diet for 7 days, but after 6 days of the test diet, E.coli O157:H7 ( ¹⁰⁹ CFU) was administered 0.2 ml of 1% NaHCO ₃ ( E. coli) by oral gavage for 3 days. coli O157: administered with H7 (treated for 30 minutes before administration).

group Justice animal C E.coli O157:H7 10 BALB/C T1 PA ^** + E.coli O157:H7 10 BALB/C T2 PA/D ^*** + E.coli O157:H7 10 BALB/C T3 PA/PDN ^**** + E.coli O157:H7 10 BALB/C

^* E.coli O157:H7: 0.1ml/BALB/C (mouse) (2 x 10 ⁹ CFU)

^** PA: 0.2ml/mouse ( Pediococcus acidilactici 2 x 10 ⁸ CFU)

^*** D: 0.5% w/v dextran

^**** PDN: 0.5% w/v PDN

BALB/C: mouse breed

The body weight and food intake of mice were monitored daily throughout the entire experimental period. Changes in PA and E. coli were counted by measuring viable CFU using fecal samples (10 mg/ml) collected daily starting from day 1 of pathogen administration. Specifically, the collected feces were spread on MRS liquid medium and MacConkey agar medium, cultured at 37°C for 20 hours, and CFU was counted. At the end of the experiment, the mice were euthanized using CO ₂ and intestinal and fecal samples were collected. Each collected fecal sample was used for measuring viable bacterial counts and extracting DNA.

<Experimental Example 6> Physiological changes

As a result of the mouse diet experiment in Experimental Example 5, as shown in (A) of FIG. 5, the T3 group that consumed a diet supplemented with PA/PDN increased body weight after 13 days compared to the body weight at 7 days. In particular, body weight decreased in the control group on day 13 compared to day 7, while body weight increased in the T2 and T3 groups. In addition, as shown in Figure 5 (B), the average feed intake per animal of the T3 group that consumed the PA/PDN-supplemented diet was confirmed to be higher than that of the other groups.

After the test, changes in colon length were measured. Increase in colon length was positively correlated with weight gain (correlation ratio: 0.408). As shown in Figure 5 (C), the T3 group that consumed a diet supplemented with PA/PDN was confirmed to have the longest colon length compared to the other groups.

<Experimental Example 7> Effect of synbiotics on intestinal microflora

Each fecal sample obtained in Experimental Example 5 was analyzed to confirm changes in the intestinal microflora.

(1) Species diversity index

The observed OTU (OTU) was confirmed as a diversity index of each fecal sample.

Microbiota was analyzed using Quantitative Insights Into Microbial Ecology (QIIME) v1.9.1 software. OTU picking was performed using the usearch61 method (parameter settings: s 0.1). Representative sequences were aligned using PyNAST. Representative sequences were taxonomically assigned using the uclust consensus taxonomy assignor. The OTU table was normalized to 16,660 reads per sample by single rarefaction and further analyzed.

Alpha diversity index (OTU observed) was calculated from 16,660 sequence reads per sample through rarefaction of 10 replicates. Principal coordinate analysis (PCoA) was performed based on weighted UniFrac distances, and treatment effects on microbiota were assessed using the ANOSIM statistical test. The abundance of microbial taxa was expressed as a percentage of a total of 16 S rRNA gene sequences.

As shown in Figure 6 (A), PCoA based on unweighted UniFrac distance confirmed that the fecal microbiota of mice was changed after treatment. In particular, the control and T3 groups were distinct from each other.

Additionally, as shown in Figure 6(B), the number of observed OTUs was 1692.0 (±171.8), 1798.0 (±155.3), 1866.0 (±229.5), and 1946.0 (±163.4) for the control, T1, T2, and T3 groups, respectively. ) was. In particular, the T3 group that consumed a diet supplemented with PA/PDN showed significantly higher microbial diversity than the control group.

(2) Number of E. coli in feces

In addition to measuring the number of viable bacteria, the amount of specific microorganisms in the fecal sample was quantified by performing quantitative PCR (qPCR) using primers specific for specific microorganisms.

To track intestinal colonization, fecal samples were plated on MacConkey agar medium and MRS agar medium every day from the start of E. coli treatment, and then viable cell count was measured. The results are shown in (C) of Figure 6. indicated.

As shown in Figure 6 (C), on the first day of oral administration of E. coli O157:H7, there was no colonization by E. coli O157:H7 in the feces of all four mouse groups, and on average, in the feces of all treatment groups one day later. Approximately 4 log ₁₀ (CFU/mg of stool) E. coli was observed. In the case of the control group, during the 5 days of oral administration of E. coli O157:H7, the average amount of E. coli in feces did not change significantly and was maintained at about 3.98 to 3.69 log ₁₀ . There was no significant difference in the number of E. coli O157:H7 cells in the T1 and T2 groups, but in the T3 group, the viable cell count of E. coli O157:H7 decreased from 3.85 to 2.98 log ₁₀ on day 2.

At the end of the experiment (day 5), the viable cell count of E.coli O157:H7 was 3.69 log ₁₀ for the control group, 3.00 log ₁₀ for T1, 2.80 log ₁₀ for T2, and 1.57 log ₁₀ for T3, in the T3 group. This was confirmed to be significantly different from the control group.

Next, the number of viable bacteria was measured by Qpcr using intimin, a specific marker for E. coli O157:H7, and the content of lactic acid bacteria in feces was verified using MRS agar medium.

As shown in Figure 6 (D), intimin levels were found to be significantly lower in the three groups administered orally with probiotics compared to the control group (4.2 times) (T1: 1.78 times, T2: 2.05 times, and T3: 0.95 times. pear), that is, it can be seen that feeding probiotics eliminates intestinal pathogens. Although not very significant, the amount of Pediococcus acidilactici in the PA-fed groups (T1, T2, and T3 groups) was slightly higher than that in the control group (6.18 times) (T1: 8.29 times, T2: 6.20 times, and T3: 7.24 times).

(3) Abundance of pathogenic microorganisms

DNA was extracted from 50 mg of each fecal sample using the AccuPrep® Stool DNA extraction kit (manufactured by Bioneer, Daejeon, Korea) according to the manufacturer's protocol, and stored at -20°C until further analysis. For species-specific quantitative PCR, the primers used were as listed in Table 3 below, and qPCR was performed by the method described above.

gene Primer sequence (5'-3') Size (bp) ped A F: TGGCAAACATTCCTGCTCTGT
R:CACCAGTAGCCCATGCCATAG 83 ped B F: ATTGCCAGCCAAGCGTTAGTR: GCCCCACCCTTTTTGAGAAT 102 ped C F: CCATATCGGTGAG TGCTGACAR: AGGAATAACGCCCCTGATGTT 104 ped D F:GGCCCATCTTTCGACAGCTTR:GCACAGCTTCGGCATTTAAAT 101 16S F: GATGCGTAGCCG ACCTGAGAR: TCCATCAGACTTGCGTCCATT 113 dnaK F: TTAACAGGGCACAATTTGAR: GCTTCGTCAGGGTTAATGGA 212 dnaJ F: GCCCAACTTGTGTGTGGTACTR:CCAGTGCAGCTTGTACGAAA 240 groEL F: GGTAACGGTCCGTTTTAGAR: TTCAACGACTGCAACTAAGTCC 156 groES F: GGAAGACCTTGACGCAGAAGR: CGTTTTGAAGTGCTGAACGA 239 clpB F: CGGCAGCCAAGTTATCTAGCR: GCAGTGCCTTTAAGCGTTTC 219 Pediococcus acidilactici F: GTTCCGTCTTGCATTTGACC
R: GGACTTGATAACGTACCCGC 449 Intimin F: CTCATGCGGAAATAGCCGTTA R: CATTGATCAGGATTTTTCTGGTGATA 102 Bifidobacterium spp. F: GGTGTTCTTCCCGATATCTACAR: CTCCTGGAAACGGGTGG 549-563

For Illumina MiSeq, the V4 region of the bacterial 16S rRNA gene was amplified from total extracted DNA using Takara Ex Taq polymerase (Takara Bio, Shiga, Japan) and the 515F-806 R primer pair. The amplification program consisted of 1 cycle at 94°C for 3 min, 40 cycles at 94°C for 45 s, 55°C for 1 min, and 72°C for 1.5 min, and finally 1 cycle at 72°C for 10 min.

A DNA library was constructed using the Illumina TruSeq DNA sample preparation kit, and paired-end sequencing of amplicons (2x300 bp) was completed on an Illumina MiSeq (Macrogen, Seoul, Korea). The confirmed 16S rRNA gene sequence was deposited in the NCBI Sequence Read Archive (SRA) database (accession number: SRR7867415).

The relative abundance of intestinal microorganisms was determined from the results of amplifying the 16S rRNA gene sequence and mass sequencing through Illumina Miseq sequencing.

Among them, the relative abundance of Proteobacteria , a representative phylum containing many pathogenic microorganisms, in the fecal flora was confirmed to be lowest in the T3 group, as shown in (E) of Figure 6. From these results, it can be seen that the supply of PA/PDN suppressed pathogens by improving the antibacterial activity of PA compared to the supply of dextran itself or PA alone.

(4) Content of beneficial bacteria

In order to measure the content of lactic acid bacteria, which are representative beneficial bacteria in feces, the amount of lactic acid bacteria (LAB) in feces was measured based on CFU, and the primers listed in Table 3 above, which are molecularly and genetically specific to Bifidobacterium spp. It was quantified using,

As shown in Figure 6 (G), the content of Bifidobacterium spp. was confirmed to be higher in T2 and T3 than in the control group.

In addition, as shown in Figure 6 (F), the CFU of lactic acid bacteria (LAB) was confirmed to be higher in all T1, T2, and T3 groups than the control group. From these results, it can be seen that the supply of PA/PDN improved the antibacterial activity of PA more than the supply of dextran itself or PA alone.

Overall, it can be seen that PA/PDN not only inhibits the harmful bacteria Proteobacteria but also regulates the gut microbiota by increasing microbial diversity, abundance, and the level of some beneficial bacteria.

<Example 2> Synthesis of PPN

Pullulan used in the present invention was purchased from Shandong Freda Biotechnology Co., Ltd. (Shandong, China), and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA). ) was purchased from. Lysogeny broth (LB), LB agar, MRS broth, MacConkey agar medium, and brain heart infusion (BHI) broth for bacterial culture were purchased from BD Difco (Sparks, MD, USA).

As shown in Figure 7, phthalyl pullulan nanoparticles (PPN) were prepared in which a hydrophobic phthalyl group was introduced into pullulan through an ester bond between the hydroxyl group in pullulan and the carboxylic acid in phthalic acid.

Specifically, 1 g of pullulan was dissolved in 10 ml of dimethylformamide (DMF), 0.1 mol% dimethyl aminopyridine per pullulan sugar residue was added to the solution as a catalyst, and then phthalic anhydride was added to the solution at different molar ratios. PPNs with different degrees of phthalyl group substitution were produced: 6:1 (phthalic anhydride:flurane) (named PPN1), 9:1 (phthalic anhydride:flurane) (named PPN2), and 12:1 (anhydride). Phthalic acid:flurane) (named PPN3)

The reaction was carried out under nitrogen at 54°C for 48 hours. The produced PPN was first dialyzed in DMF to remove unreacted phthalic anhydride, and then placed in distilled water at 4°C for 24 hours to form self-assembled nanoparticles of phthalyl pullulan. After ultracentrifugation of the prepared PPN, unreacted pullulan was removed. Finally, PPN was lyophilized and stored at -20°C until use.

<Experimental Example 8> Characteristics of PPN

The surface of the PPN prepared in Example 2 was measured using a scanning electron microscope (FE-SEM) (Carl Zeiss, SUPRA 55VP-SEM). As shown in Figure 8 (D), PPN3 was confirmed to be a nanometer-sized sphere.

Additionally, particle size was measured using a dynamic light scattering (DLS) spectrophotometer (Otsuka Electronics, DLS-7000). As shown in Figure 8 (C), as a result of DLS measurement, the sizes of the nanoparticles for PPN1, PPN2, and PPN3 were 140.0, 108.9, and 82.1 nm, respectively. From this, it can be seen that the particle size decreases as the number of bound phthalic acid groups in pullulan increases.

In addition, the degree of substitution of the phthalyl portion of PPN was confirmed using ¹ H-NMR spectroscopy, and the phthalic acid proton (C1 position of α-1,6 and α-1,4 glycosidic bonds, 4.68 and 5.00 ppm, respectively) was confirmed. The ratio of protons (7.4-77 ppm) was determined and calculated. According to the degree of substitution of phthalic acid, PPN was named as follows: PPN1 (DS: 30.90 mol%), PPN2 (DS: 50.45 mol%), and PPN3 (DS: 68.50 mol%). (Figure 8 (A))

Additionally, the surface charge (zeta potential) was measured using an electrophoresis light scattering photometer (Otsuka Electronics, ELS-8000). As shown in Figure 8 (B), the surface charges of PPN1, PPN2, and PPN3 were -38.09, -38.45, and -33.84 mV, respectively. Due to the unreacted carboxyl group among the phthalic acid groups, PPN showed a negative zeta potential.

<Experimental Example 9> Confirmation of LP introduction characteristics of PPN

For the PPN prepared in Example 2, it was confirmed whether LP 177 was introduced.

(1) Check whether PPN has introduced LP

First, FITC (fluorescence isothiocyanate)-labeled PPN (FITC-PPN) and pullulan (FITC-pullulan) were prepared, respectively.

First, 5 mg of FITC was mixed with pullulan dissolved in 100 ml PPN or 2 ml dimethyl sulfoxide (DMSO). After stirring in an opaque tube at room temperature for 4 hours, the mixture was dialyzed with distilled water at 4°C for 24 hours. Finally, FITC-labeled PPN (FITC-PPN) and pullulan were lyophilized and stored at -20°C until use.

The LP 177 (2.0x10 ⁶ CFU/ml) cultured in 1 ml of MRS liquid medium was treated with 0.5% (w/v) FITC-PPN or FITC-pullulan and cultured at 37°C for 2 hours. Samples washed three times with 1 ml of PBS were measured using flow cytometry (BD Biosciences, BD FACSCanto2) and confocal laser microscopy, and the results are shown in Figure 9. Samples were washed with PBS and analyzed by flow cytometry and confocal laser scanning microscopy (CLSM) (SP8X STED Leica, Wetzlar, Germany).

As shown in Figure 9, CLSM results confirmed that FITC-PPN and FITC-pullulan were introduced into LP after culturing at 37°C for 2 hours.

To further confirm whether PPN is located on the cell surface or introduced into LP, LP was treated with FITC-PPN3 and the localization of FITC-PPN3 was confirmed in Z-section mode of CLSM.

As shown in Figure 9, the fluorescence intensity of FITC and DAPI was highest in the center of LP, and from this, it was confirmed that PPN was introduced into LP.

In addition, as another method to determine the location of introduction of polysaccharide nanoparticles into microorganisms, the cell membrane was stained using a membrane-bound dye (FM4-64) as a negative control, and then the FITC fluorescence intensity and location of FITC-PPN3 were measured. was confirmed. As a result, as shown in Figure 10, the intensity of FITC fluorescence was maximum at the center of LP, and it was confirmed that FITC fluorescence appeared within the bacteria.

(2) Check whether to introduce each incubation temperature

To determine whether the incorporation of PPN3 into LP is temperature dependent, three separate cultures of LP were treated with 0.5% (w/v) FITC-PPN3 and then incubated at 4, 20, and 37°C for 2 h. Additionally, samples were washed with PBS and analyzed by flow cytometry (FACS) and CLSM.

As shown in Figure 11 (B), the incorporation of PPN3 into LP was highest at 37°C, which shows that the incorporation of PPN3 is energy dependent.

(3) Check whether each carrier has been introduced

To identify the transporter that introduces PPN into cells, glucose, galactose, fructose, and PPN3 were used as PPN transport blockers.

First, the LP (2.0x10 ⁶ CFU/ml) cultured in 1 ml of MRS liquid medium was pre-incubated with 10% (w/v) glucose, galactose, fructose, or PPN3 for 10 minutes at 37°C, and then incubated with 0.5% ( w/v) FITC-PPN3. Samples washed three times with 1 ml of PBS were measured using flow cytometry (BD Biosciences, BD FACSCanto2) and confocal laser microscopy, and the results are shown in Figure 9.

As shown in Figure 9 (B), galactose pre-incubation was confirmed to hinder the introduction of PPN by about 40%. From this, it can be seen that when PPN is introduced into LP, a transporter that transports galactose into the cell is more involved.

<Experimental Example 10> Antibacterial activity of LP/PPN

To evaluate whether the antibacterial properties of LP were altered by the introduction of PPN, E. coli K99 and Listeria monocytogenes (LM) were treated with LP, pullulan, against representative Gram-negative and Gram-positive pathogens. Co-culture tests and agar diffusion tests were performed to confirm the antibacterial activity of LP (LP/pullulan) and PPN-introduced LP (LP/PPN). LP177 was cultured in MRS broth, E. coli K99 was cultured in LB broth, and LM was cultured in BHI broth.

All bacterial cultures were grown at 37°C for 24 hours in a shaking incubator (250 rpm) and then stored at -70°C in 15% glycerol until further experiments or use.

To compare the antibacterial activity of LP against E. coli by co-culture test, ^2.0x106 CFU/ml of E. coli was cultured in MRS broth at 0.5°C for 8 h at 37°C in a shaking incubator (250 rpm) (aerobic conditions). % (w/v) co-cultured with 2.0x10 ⁵ CFU/ml LP treated or not with PPN or pullulan. Antibacterial activity was determined by the survival rate of E. coli . Co-culture samples were plated on MacConkey agar medium, incubated at 37°C for 24 hours, and the number of E. coli colonies was counted.

Additionally, the antibacterial activity of LP against LM was measured by co-culture test. LP and LM were cocultured in BHI broth under similar conditions described above.

As shown in Figures 12 (A) and (C), the antibacterial activity of the LP/PPN group was higher than that of the untreated LP or LP/P against E. coli and LM. Additionally, it was observed that the antibacterial activity of LP became stronger as the size of the nanoparticles became smaller.

To determine whether PPN alone has antibacterial activity, E. coli and LM were treated with PPN. PPN alone did not show antibacterial activity (data not shown), which suggests that polysaccharide nanoparticles do not have antibacterial activity on their own, but are introduced into LP, a probiotic, thereby increasing the antibacterial activity of the probiotic. You can.

The antibacterial activity of LP/PPN was confirmed by an agar diffusion test.

After placing the paper disk on the E. coli spread plate, 120 μl of LP medium cultured for 8 hours with or without treatment with 0.5% (w/v) PPN and pullulan was dropped onto the paper disk. After drying at room temperature, the plates were incubated at 37°C overnight. The area of inhibition of E. coli growth was used as a direct measure of antibacterial activity. The inhibitory effect of LP treated with or without 0.5% (w/v) PPN or pullulan on LM growth on BHI agar plates was tested in the same manner. Finally, the co-cultured samples were plated on Oxford KEPCO, and the number of LM colonies was counted.

As shown in Figures 12 (B) and (D), it was confirmed that the inhibition area was relatively largest when treated with PPN3, which had the smallest nanoparticle size of 82.1 nm.

From this, it can be seen that introduction of PPN by LP affects the production of antibacterial proteins and induces antibacterial activity.

To confirm whether LP exerts antibacterial activity through the protein plantaricin, the culture medium was treated with 1 mg/ml proteinase K, incubated at 37°C for 2 hours, and then tested against E. coli and LM. The agar diffusion test of LP was performed identically to the protocol described above, and then each culture supernatant was heated at 100°C for 30 min. As shown in Figures 13 (C) and (D), the antibacterial activity of the proteinase K treated group was confirmed to be significantly reduced compared to the untreated group. From this, it can be seen that plantaricin was decomposed by proteinase K.

<Experimental Example 11> Plantarisin expression and quantitative analysis by LP/PPN

(1) Effect of PPN on LP growth and lactic acid production

To test the growth of LP after treatment with PPN or pullulan, cell colonies were counted at different time points. As shown in Figure 13 (A), it was confirmed that there was no difference in LP growth depending on the presence or absence of PPN or pullulan treatment.

The pH of the culture medium of LP after treatment with PPN or pullulan was also measured to evaluate lactic acid production. As shown in Figure 13 (B), it was confirmed that the pH curve of LP treated with or without PPN or pullulan showed no significant change between groups. Therefore, it can be seen that the introduction of PPN to LP does not have a negative impact on LP growth.

(2) Plantaricin expression by LP/PPN

LP was added to the PPN-treated MRS liquid medium and cultured for 24 hours in a constant temperature shaker (255 rpm) at 37°C. The supernatant from the co-cultured medium was stirred with ammonium sulfate (80% saturation) for 2 hours at room temperature. Recovered by centrifugation, precipitated proteins were dissolved in citrate phosphate buffer (50 mM) and desalted by dialysis (1 kDa cutoff membrane, Spectrum Labs, USA). Proteins were freeze-dried and stored at 4°C for further analysis. The obtained protein was confirmed by SDS-PAGE along with commercially available plantaricin, and the molecular weight was found to be plantaricin of 2.5 to 6.5 kDa.

As shown in Figure 13 (F), it was confirmed that plantaricin production was increased in the LP/PPN group compared to the LP and LP/P groups under the same isolation conditions.

<Experimental Example 12> Quantitative real-time PCR

To evaluate the production of plantaricin by PPN-treated LP at the mRNA level, the expression level of plantaricin mRNA in PPN-treated LP was compared with that of untreated LP using qRT-PCR.

RNA extraction was performed using the TRIzol® Max™ Bacterial RNA Isolation Kit purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Total RNA extraction was performed according to the manufacturer's instructions.

After RNA was isolated, cDNA was synthesized from 1 μg of RNA using ReverTra Ace ^® qPCR RT Master Mix and gDNA remover purchased from TOYOBO CO., LTD (Dojima, Osaka, Japan).

RT-PCR was performed with SYBR qPCR Mix using the one-step real-time PCR protocol. Primer sequences are as listed in Table 4 below.

gene Primer sequence (5’-3’) Size (bp) planS F:GCCTTACCAGCGTAATGCCCR:CTGGTGATGCAATCGTTAGTTT 450 dnaK F:ATTAACGGACATTCCAGCGGR:TTGGCCTTTTTGTTCTGCCG 600 dnaJ F:GGAACGAATGGTGGCCCTTA R:CTAGACGCACCCACCACAAA 474

For relative quantification, 0.01 ng of 16S RNA cDNA was used for 1 ng of primer.

Relative gene expression was calculated using the -2ΔΔCt method.

The plantaricin gene planS was selected, and 16S rRNA was used for normalization. As shown in Figure 13 (E), after treatment with PPN or pullulan for 8 hours, the expression level of planS was higher in PPN-treated LP than in untreated or pullulan-treated LP, and the expression of planS was an antibacterial effect of PPN-treated LP. It was confirmed that activity was improved.

In previous studies, inulin nanoparticles introduced into PA were found to induce stress responses in PA (Cui et al., 2018; Kim et al., 2018). To determine whether similar behavior occurs in LP, we measured the expression levels of stress-related genes, including the heat shock proteins dnaK and dnaJ . As shown in Figures 14 (A) and (B), after treatment with PPN or pullulan for 8 hours, the expression levels of dnaK and dnaJ were confirmed to be significantly higher in PPN-treated LP than in untreated LP. From this, it can be seen that the introduction of PPN into LP induced a stress response.

<Experimental Example 13> Animal dietary experiment

Animal feeding experiments were performed using 5-week-old BALB/C male mice in accordance with international ethical guidelines. Animal experiments were conducted with approval from the Animal Experiment Ethics Committee of Seoul National University (SNU-170,531-1-1).

Mice were housed at controlled temperature (22±2°C) with a 12 hour light/dark cycle. Animals were fed standard mouse chow ad libitum and distilled water was provided at all times. After 7 days of acclimation, mice were randomly assigned into five groups. Test groups T1 to T5 were treated with antibiotics for 3 days before 5 days of the test diet to induce dysbiosis and were infected with the pathogen E. coli K99 while making them vulnerable to pathogen infection. A mixture of ampicillin, gentamicin, neomycin, and vancomycin (ampicillin:gentamicin:neomycin:vancomycin=2:2:2:1 (20mg/mouse)) was used as an antibiotic. The control group continued to be fed as before. The T2 group was administered a single dose of 10 ⁸ CFU Lactobacillus plantarum (LP) in saline solution by oral gavage. The T3 and T4 groups were each administered a single dose of flurane (0.5% w/v) and LP mixed formulation or PPN (0.5% wv) and LP mixed formulation. Additionally, the T5 group was administered a single dose of LP treated with pullulan (0.5% w/v) and PPN (0.5% w/v). The test group was continuously administered the test diet for 7 days, but after 6 days of the test diet, E.coli K99: 0.2ml/mouse ( ^1x109 CFU) was administered 0.2ml of 1% NaHCO ₃ by oral gavage for 3 days. (treated for 30 minutes before administering E. coli K99).

group Justice animal C unprocessed 6BALB/C T1 Antibiotics -E.coli K99 ^* 6BALB/C T2 Antibiotics -E.coli K99―LP ^** 6BALB/C T3 Antibiotics -E.coli K99 LP/P ^*** 6BALB/C T4 Antibiotics -E.coli K99 LP/PPN ^**** 5 BALB/C T5 Antibiotics -E.coli K99 LP/P/PPN 5 BALB/C

^* E.coli K99: 0.2ml/mouse (1x10 ⁹ CFU)

^** LP: 0.2ml/mouse ( Lactobacillus plantarum 1x10 ⁸ CFU)

^*** P: 0.5% w/v pullulan

^**** PPN: 0.5% w/v PPN

Antibiotics: mixture of ampicillin, gentamicin, neomycin and vancomycin.

(Ampicillin:Gentamicin:Neomycin:Vancomycin=2:2:2:1 (20mg/mouse))

The body weight and food intake of mice were monitored daily throughout the entire experimental period. Starting from day 1 of pathogen administration, LP and E. coli were counted as viable CFU from daily fecal samples (10 mg/ml). Feces were plated on both MRS agar and MacConkey agar medium and cultured at 37°C for 20 hours. At the end of the experiment, the mice were euthanized with _CO2 .

Intestinal samples and feces were collected from the intestines and used for measuring the number of viable bacteria and analyzing the microbiota.

<Experimental Example 14> Physiological changes

As a result of the mouse diet experiment, as shown in Figure 15 (A), the T5 group supplemented with the LP/pullulan/PPN combination increased the body weight the most, while the body weight of the T2 group treated with only probiotics increased on day 14 compared to day 12. So it was reduced.

In addition, as shown in Figure 15 (B), T4 and T5 supplemented with synbiotics The group was found to have the highest average dietary intake per animal.

Changes in colon length were measured after the test. Increase in colon length was positively correlated with weight gain (correlation ratio: 0.408). As shown in Figure 15 (C), the T4 group supplemented with the LP/PPN combination had the longest colon length compared to the other groups, and the T2, T3, T4, and T5 groups supplemented with probiotics or synbiotics had the longest colon length compared to the other groups. They were found to have a longer colon length compared to the T1 group, which was not supplemented with biotics.

Cecal weight was also measured. As shown in Figure 16, the T1 group administered only E. coli K99 and not supplemented with probiotics or synbiotics had the largest cecal weight, while the T2 to T5 groups supplemented with probiotics or synbiotics had the largest cecal weight in group C. It was lowered to a level closer to .

Intestinal barrier function plays an important role in maintaining normal intestinal function by preventing enteric bacteria, toxins, and harmful substances such as gram-negative bacteria LPS from entering other tissues or the systemic circulation.

As shown in Figure 17, probiotics or synbiotics were not supplemented. The T1 group had the highest blood endotoxin level (serum LPS level), and the blood endotoxin levels in the groups supplemented with probiotics or synbiotics, especially the T4 and T5 groups administered LP/PPN and LP/P/PPN, respectively. It was confirmed that the level was low.

<Experimental Example 15> Synbiotic effect on intestinal microflora

Each fecal sample obtained in Experimental Example 13 was analyzed to confirm changes in the intestinal microflora.

(1) Check species diversity

The OTU observed as a species diversity index of each fecal sample was confirmed in the same manner as described in Experimental Example 7 above.

In particular, to investigate the effect of PPN and probiotics on the diversity of gut microbiota, PPN treatment (C, T1, T2, T3 vs. T4, T5) or probiotic treatment (C, T1 vs. T2, T3, T4, T5). After reorganizing the groups, we checked whether there were differences in species diversity indicators. Interestingly, the OTUs observed were higher when treated with PPN or with probiotics. Additionally, as shown in Figure 20 (A), the observed OTUs were confirmed to increase in the following order: T1, C, T2, T3, T4, and T5.

Principal coordinate analysis (PCoA) based on unweighted and weighted UniFrac distances confirmed that the gut microbiota was grouped according to pathogen infection and probiotic or synbiotic treatment, and the Adonis test (unweighted: R ² = 0.2798, P < It was confirmed that this was a significant effect (0.001; weighting: R ² = 0.8418, P < 0.001) (Figures 18 and 19).

(2) Confirmation of the number of E. coli in feces

The amount of specific microorganisms was quantified from fecal samples using viable cell count measurement and quantitative PCR (qPCR).

To track the colonization of the treated E. coli and lactic acid bacteria in the intestines, the viable cell counts of E. coli and lactic acid bacteria (LAB) were evaluated by plating stool samples on MacConkey agar medium and MRS agar medium, respectively. As shown in Figure 20 (B), the viable count of E. coli cells was approximately 7 log10 ( CFU/mg of stool) was higher, and the T4 and T5 groups were confirmed to have the lowest number of E. coli bacteria compared to T2 and T3. From this, it can be seen that PPN fed to the T4 and T5 groups induces the antibacterial ability of E. coli .

The viable cell count of LAB was assessed on MRS agar plates. As shown in Figure 20 (D), the viable count of LAB in group C was approximately 3-4 log10 (CFU/mg of feces), while in the probiotic or synbiotic treated groups (T2, T3, T4 and T5) The viable count of LAB was found to be approximately 5-6 log10 (CFU/mg of feces). The T1 group had only 2 to 3 log10 (CFU/mg of stool), which shows that the intestinal microflora was clearly destroyed by antibiotic treatment and recovered by treatment with probiotics and synbiotics.

(3) Abundance of pathogenic microorganisms

To identify the microbial taxa that primarily responded to changes in gut microbiota caused by pathogen attack and probiotic and synbiotic treatment, one-way ANOVA was performed to identify several phyla and genera. In particular, as shown in Figure 20 (C), at the phylum level, Proteobacteria was found to be more abundant in the T1 group than in the C group and significantly decreased in the T2, T3, T4 and T5 groups. From these results, it can be seen that the level of Proteobacteria increased by pathogen infection can be returned to a normal state by treatment with probiotics and synbiotics.

(4) Content of beneficial bacteria

Lactic acid bacteria (LAB), a representative beneficial bacteria in feces, were confirmed by CFU counting and measured using a Bifidobacterium spp.-specific marker.

As shown in Figure 20 (F), Bifidobacterium ( Bifidobacterium spp.) was found to be significantly more abundant in T4 and T5 supplied with LP/PPN.

In addition, as shown in Figure 20 (E), the content of lactic acid bacteria (LAB) was more abundant in T4 and T5 than in other groups.

Overall, LP/PPN not only suppresses the effects of pathogen infection, including by suppressing Proteobacteria , but also modulates the gut microbiota by increasing microbial diversity, abundance, and levels of some beneficial bacteria. there is.

Claims (13)

In the synbiotic composition for improving intestinal flora comprising lactic acid bacteria strains as probiotics and polysaccharide nanoparticles as prebiotics,
The lactic acid bacterium is Pediococcus acidilactici , and the lactic acid bacterium produces the antibacterial protein pediocin,
The polysaccharide has a hydrophobic residue and is self-assembled into nanoparticles by a hydrophobic effect in a hydrophilic solvent,
The polysaccharide nanoparticles are phthalyl dextran nanoparticles in which a hydrophobic phthalyl group is introduced into dextran by ester bonding a hydroxyl group in dextran and a carboxylic acid in phthalic acid,
The synbiotic composition is a formulation that combines the lactic acid bacteria strain and the polysaccharide nanoparticles,
It is produced by pre-cultivating the lactic acid bacteria of Pediococcus acidilactici cultured in a liquid medium with glucose at 37°C, and then culturing phthalyl dextran nanoparticles at 37°C for 3 minutes to 2 hours,
The synbiotic composition for improving intestinal flora is a synbiotic composition for improving intestinal flora, characterized in that it exhibits physiological changes such as an increase in colon length. delete delete delete delete delete delete delete delete A feed additive comprising the synbiotic composition for improving intestinal flora of claim 1. A health functional food additive containing the synbiotic composition for improving intestinal flora of claim 1. delete A pharmaceutical composition for improving intestinal flora, comprising the synbiotic composition for improving intestinal flora of claim 1.

Images