KR102611242B1 - Antiviral composition comprising alkane as effective component - Google Patents

Abstract

The present invention relates to an antiviral composition containing an alkane compound represented by Formula 1 or an acceptable salt thereof as an active ingredient, and the compound represented by Formula 1 of the present invention is a respiratory syncytial virus in cells. , RSV), it can be usefully used as an antiviral pharmaceutical, health functional food, or quasi-drug composition.

Description

Antiviral composition comprising alkane as effective component {Antiviral composition comprising alkane as effective component}

The present invention relates to an antiviral composition containing an alkane as an active ingredient.

Alkanes are chain hydrocarbons without a ring, and are a general term for compounds that can be represented by the general formula C _n H _2n+2 and consist only of single bonds of carbon and hydrogen. Depending on the number of carbons contained, methane (carbon number = 1), ethane (carbon number = 2), propane (carbon number = 3), butane (carbon number = 4), and pentane (carbon number = 4). ; There are several types, such as hexane (carbon number = 6), heptane (carbon number = 7), and octane (carbon number = 8). As the molecular weight of an alkane increases, the number of electrons surrounding the molecule increases proportionally, and the surface area of the molecule also increases, increasing the van der Waals force. Therefore, as the molecular weight of an alkane increases, its boiling point increases. Alkanes with 1 to 4 carbon atoms exist in a gaseous state at room temperature (25°C), alkanes with 5 to 17 carbon atoms exist in a liquid state, and alkanes with 18 or more carbon atoms exist in a solid state.

Meanwhile, respiratory syncytial virus (RSV) is a virus belonging to the Pneumovirus genus of the Paramyxoviridae family. It is named so because the F protein on the surface of the virus induces membrane fusion with nearby cells. It was attached. RSV is the main cause of lower respiratory tract infections and is known to occur frequently in infancy and early childhood. In addition, entry into cells begins when the G protein of RSV binds to an extracellular matrix composed of disaccharides called GAGs, and the F protein interacts with the RhoA protein and mediates attachment of the virus. Viral gene expression and replication occur in the cytoplasm, and when the virus enters the cytoplasm, the nucleocapsid and genome are released.

As a RSV prevention method, Palivizumab (MedImmune), a monoclonal antibody targeting the F protein, is used as a vaccine for immature infants or infants with heart and lung diseases, but its use is very limited due to its high price. . To date, treatment of RSV has been limited to adjuvant treatment, and adrenaline, bronchodilators, steroids, antibiotics, and ribavirin, which are used as antiviral drugs, have been reported to be ineffective in treating RSV.

Meanwhile, Korean Patent No. 1563219 discloses 'a composition with anti-respiratory syncytial virus activity containing carnosic acid as an active ingredient', and Korean Patent Publication No. 2017-0090424 discloses 'composition against respiratory syncytial virus (RSV). Although piperidine-substituted pyrazolo[1,5-A] pyrimidine derivatives with replication inhibitory activity are disclosed, the 'antiviral composition containing an alkane as an active ingredient' of the present invention is not described. There is no bar.

The present invention was derived from the above needs, and the present inventors infected HEp2 cells with RSV fused to GFP and infected with eicosane (C ₂₀ H ₄₂ ), docosane (C ₂₂ H ₄₆ ) and tetra As a result of analyzing the antiviral activity after treatment with tetracosane (C ₂₄ H ₅₀ ), it was found that eicosane, docosane, and tetracosane reduce RSV titer in HEp2 cells and inhibit the expression of RSV-G protein. By confirmation, the present invention was completed.

In order to solve the above problems, the present invention provides an antiviral pharmaceutical composition containing the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides an antiviral health functional food composition containing the compound represented by Formula 1, a stereoisomer thereof, or a foodologically acceptable salt thereof as an active ingredient.

Additionally, the present invention provides an antiviral quasi-drug composition containing the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

Since the alkane compound represented by Formula 1 of the present invention has excellent antiviral activity against respiratory syncytial virus, it is expected to be used in a variety of applications such as antiviral pharmaceuticals, health functional foods, or quasi-drug compositions.

Figure 1 shows the results of analyzing GFP expression after infecting HEp2 cells with RSV-GFP and treating them with alkane.
Figure 2 shows the results of analyzing GFP expression (A, B) and RSV titer (C) after infecting HEp2 cells with RSV-GFP and treating them with eicosane, docosane, and tetrachosane, respectively.
Figure 3 shows EC ₅₀ (left panel) and CC ₅₀ values (right panel) after HEp2 cells were infected with RSV-GFP and treated with eicosane (A), docosane (B), and tetrachosane (C) at different concentrations. This is the result of measuring GFP expression and cell number for analysis.
Figure 4 shows the results of analyzing the mRNA expression level of RSV-G protein after infecting HEp2 cells with RSV-GFP and treating them with eicosane (EIC), docosane (DOC), and tetrachosane (TET), respectively.
Figure 5 shows the results of analyzing the expression level of RSV-G protein after infecting HEp2 cells with RSV-GFP and treating them with eicosane (A), docosane (B), and tetrachosane (C), respectively.
Figure 6 shows analysis of GFP expression (A) and RSV titer (B) after infecting HEp2 cells with RSV-GFP and treating them with eicosane, docosane, tetrachosane, and their mixture (1:1:1), respectively. It is a result.

In order to achieve the object of the present invention, the present invention provides an antiviral pharmaceutical composition containing a compound represented by the following formula (1), a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

In Formula 1, n is an integer from 18 to 22.

In the antiviral pharmaceutical composition according to the present invention, the compound represented by Formula 1 is preferably eicosane with n of 18, docosane with n of 20, or tetracosane with n of 22 ( tetracosane), but is not limited thereto.

As used herein, the term “antivirus” refers to the ability to reduce, prevent, inhibit, or eliminate the growth or survival of viruses.

In the present invention, “pharmaceutically acceptable salt” refers to any salt of the present compound that maintains the biological properties of the present compound and is not toxic or unsuitable for pharmaceutical use. Such salts may be derived from and include a variety of organic and inorganic counterions known in the art. These salts include organic or inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, sulfamic acid, acetic acid, trifluoroacetic acid, trichloroacetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, glutaric acid, Pyruvic acid, lactic acid, malonic acid, succinic acid, sorbic acid, ascorbic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, chric acid, cinnamic acid, mandelic acid, phthalic acid, Lauric acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzene sulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphoric acid, camphor acid. Forsulfonic acid, 4-methylbicyclo [2.2.2]-oct-2-en-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, lauryl sulfate, gluconic acid. , acid addition salts formed with benzoic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, cyclohexylsulfamic acid, quinic acid or muconic acid, etc.; or the acidic proton present in the parent compound is a metal ion (e.g., an alkali metal ion, an alkaline earth metal ion, or an aluminum ion), an alkali metal, or an alkaline earth metal hydroxide (e.g., sodium, potassium, calcium, magnesium, aluminum, lithium, zinc). and barium hydroxide), ammonia, or substituted with an organic base such as aliphatic, cycloaliphatic or aromatic organic amines such as ammonia, methylamine, dimethylamine, diethylamine, picoline, ethanolamine, diethanolamine, triethanol. Amine, ethylenediamine, lysine, arginine, ornithine, choline, N, N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, N-methylglucamine piperazine , tris(hydroxymethyl)-aminomethane, or a salt formed when coordinated with tetramethylammonium hydroxide.

Additionally, examples of salts include sodium, potassium, calcium, magnesium, ammonium, or tetraalkylammonium salts, and when the compound contains a basic functional group, salts with non-toxic organic acids or inorganic acids, such as hydrohalides (e.g., hydrohalides). chloride or hydrobromide), sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, ru Bates, lactate, malonate, succinate, sorbate, ascorbate, maleate, maleate, fumarate, tartarate, citrate, benzoate, 3-(4-hydroxybenzoyl fumarate, tartarate) citrate, benzoate, 3-(4-hydroxybenzoyl)benzoate, picrate, cinnamate, mandelate, phthalate, laurate, methanesulfonate (mesylate), ethanesulfonate, 1,2-ethane -Disulfonate, 2-hydroxyethanesulfonate, benzenesulfonate (besylate), 4-chlorobenzenesulfonate, 2-naphthalenesulfonate, 4-toluenesulfonate, camphorate, camphorsulfonate, 4- Methylbicyclo[2.2.2]-oct-2-en-1-carboxylate, glucoheptonate, 3-phenylpropionate, trimethyl acetate, tert-butylacetate, lauryl sulfate, gluconate, benzoate. It may include ate, glutamate, hydroxynaphthoate, salicylate, stearate, cyclohexylsulfamate, quinate, or muconate salt.

In the antiviral pharmaceutical composition according to the present invention, the virus may preferably be Paramyxoviridae, and more preferably may be respiratory syncytial virus, but is not limited thereto. .

Since the antiviral pharmaceutical composition according to the present invention contains a compound having antiviral activity against respiratory syncytial virus as an active ingredient, it can be used for preventing or treating viral infections.

The antiviral pharmaceutical composition of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents, such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, and preservatives. It may include etc. Representative examples of pharmaceutically acceptable carriers, excipients or diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, gum acacia, alginate, calcium phosphate, calcium carbonate, calcium. Silicates, Cellulose, Methyl Cellulose, Microcrystalline Cellulose, Polyvinyl Pyrrolidone, Water, Methylhydroxybenzoate, Propylhydroxybenzoate, Talc, Magnesium Stearate, Mineral Oil, Propylene Glycol, Polyethylene Glycol, Vegetable Oil, Injectable Examples include ester, Witepsol, Macrogol, Tween 61, Kakaoji, and Lauridge. The antiviral pharmaceutical composition of the present invention may be in a form selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, emulsions, syrups, aerosols, topical preparations, suppositories, and injections. The method of formulating the pharmaceutical composition may be carried out according to conventional methods known in the art, and is not particularly limited.

In addition, it is clear to those skilled in the art that the dosage, administration route, components, etc. of the antiviral pharmaceutical composition of the present invention can be appropriately selected from conventional techniques known in the art.

The antiviral pharmaceutical composition of the present invention may contain other pharmaceutically active ingredients in addition to the compound represented by Formula 1 as an active ingredient, or may be mixed with a pharmaceutical composition containing other antiviral active ingredients.

The present invention also provides an antiviral health functional food composition containing the compound represented by Formula 1, a stereoisomer thereof, or a foodologically acceptable salt thereof as an active ingredient.

In the antiviral health functional food composition of the present invention, the compounds and viruses are as described above.

Since the antiviral health functional food composition according to the present invention contains a compound having antiviral activity against respiratory syncytial virus as an active ingredient, it can be used to prevent or improve respiratory syncytial virus infection.

The antiviral health functional food composition of the present invention may further include a foodologically acceptable food supplement. Foodologically acceptable food supplements that can be used in the present invention include natural carbohydrates such as sugars such as glucose, fructose, maltose, sucrose, dextrin, and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol, and thaumatin. , natural flavors such as stevia extract, synthetic flavors such as saccharin and aspartamic acid, colorants, pectic acid or its salts, alginic acid or its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, Includes, but is not limited to, alcohol, carbonating agent, etc. The antiviral health functional food of the present invention may be in a form selected from the group consisting of powder, granule, tablet, capsule, candy, chewing gum, jelly, and beverage. The content of the compound represented by Chemical Formula 1 in the antiviral health functional food can be appropriately selected considering the form, flavor, and taste of the food, for example, 0.01 to 30% by weight based on the total weight of the health functional food. It may be a range. It is clear to those skilled in the art that the form, composition, manufacturing method, etc. of the antiviral health functional food of the present invention can be appropriately selected from common techniques known in the technical field.

The present invention also provides an antiviral quasi-drug composition containing the compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.

In the antiviral quasi-drug composition of the present invention, the compounds and viruses are as described above.

In the present invention, “quasi-drug composition” refers to fibers, rubber products, or similar products used for the purpose of treating, alleviating, treating, or preventing diseases in humans or animals; they have a weak effect on the human body or do not act directly on the human body; and devices Or, it is an article that is not a machine or similar, or an agent used for sterilization, insecticide, and similar purposes to prevent infection, and is used for the purpose of diagnosing, treating, alleviating, treating, or preventing diseases in humans or animals. It refers to articles excluding those that are not instruments, machines, or devices among articles used for the purpose of having a pharmacological effect on the structure and function of humans or animals, excluding those that are not instruments, machines, or devices. Specifically, it refers to articles for external use on the skin or It may be, but is not limited to, personal hygiene products. The quasi-drug composition of the present invention can be included in various weight% if it can exhibit antiviral effect, preferably 0.00001 to 10% by weight, but is not limited thereto.

When using the composition of the present invention as a quasi-drug additive, the compound represented by Formula 1 can be added as is or used together with other quasi-drugs or quasi-drug components, and can be used appropriately according to conventional methods.

The quasi-drug composition of the present invention is not limited thereto, but preferably may be a disinfectant cleaner, shower foam, gargle, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment, patch, or filter filler.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited thereto.

Materials and Methods

1. Cell culture and virus propagation

HEp2 cells (Human Epithelial type 2, ATCC CCL-23) were cultured in DMEM (Doulbecco's modified eagle medium) containing 10% FBS and 1% antibiotics at 37°C and 5% CO ₂ conditions. RSV-GFP, a respiratory syncytial virus (RSV) fused to GFP (green fluorescent protein), was used by proliferating in HEp2 cells.

2. Compound treatment

Eicosane, docosane, tetracosane, dotriacontane, tritetracontane, and heptacosane were purchased from Sigma (USA). After treating RSV-GFP-infected HEp2 cells at different concentrations, an experiment on antiviral activity was performed.

3. Statistical analysis

All experiments were performed in three independent repetitions, the experimental results were expressed as mean ± standard deviation, and statistical analysis was performed using GraphPad Prism software version 6 (GraphPad Software, USA). In all results, * means p<0.05, ** means p<0.01, and *** means p<0.001.

Example 1. Screening for antiviral activity of alkane compounds

HEp2 cells were infected with RSV-GFP at a multiplicity of infection (MOI) of 0.1, and then cultured at 37°C in DMEM medium containing 1% FBS. After 2 hours, the medium was washed with PBS and replaced with DMEM containing 10% FBS, and then treated with 100mM each of eicosane, docosane, tetracosane, dotriacontaine, tritetracontaine, and heptacosein. . After 48 hours, GFP expression was analyzed through fluorescence measurement using the Glomax multi-detection system (Promega, USA).

As a result, it was confirmed that the GFP expression of the experimental group treated with eicosane, docosane, and tetrachosane was significantly reduced compared to the group treated with RSV-GFP alone. On the other hand, it was confirmed that the experimental group treated with dotriacontaine, tritetracontaine, and heptacosein, respectively, had no significant difference from the group treated with RSV-GFP alone (Figure 1). Therefore, among the alkane compounds, eicosane, docosane, and tetracosane were selected and then antiviral experiments were conducted.

Example 2. RSV titer analysis

HEp2 cells were infected with RSV-GFP at an MOI of 0.1, and 2 hours later, they were treated with 100 mM eicosane, docosane, and tetrachosane, respectively. After 48 hours, cells were photographed using a fluorescence microscope, and GFP expression was analyzed through fluorescence measurement using the Glomax multi-detection system (Promega, USA). Nguyen et al. (2010, PLoS Pathog. 6, e1001049) RSV-GFP titer was measured through plaque assay according to the method described in .

As a result, it was confirmed that the GFP expression and RSV titer of the experimental group treated with eicosane, docosane, and tetracosane, respectively, were significantly reduced compared to the group treated with RSV-GFP alone (Figure 2).

Example 3. EC against RSV ₅₀ and C.C. ₅₀ value measurement

HEp2 cells were infected with RSV-GFP at an MOI of 0.1, and 2 hours later, they were treated with eicosane, docosane, and tetrachosane, respectively. After 48 hours, EC ₅₀ (effective concentration) and CC ₅₀ (cytotoxic concentration) values were measured. The EC ₅₀ value was calculated as the concentration of the compound at which GFP expression was 50%, and the CC ₅₀ value was calculated as the concentration of the compound at which the number of cells was 50% using Cell counting kit-8 (Dojindo Molecular Technologies, USA). Additionally, the CC ₅₀ /EC ₅₀ value was calculated and expressed as SI (selectivity index).

As a result, the EC ₅₀ values for RSV of eicosane, docosane and tetrachosane in HEp2 cells were 86.41 ± 2.36, 71.25 ± 4.23 and 74.95 ± 1.25 mM, respectively, and the CC ₅₀ values were 314.24 ± 8.25, 389.25 ± 7.14 and 389.25 ± 7.14, respectively. It was 250.04 ± 1.27 mM, and the SI values were confirmed to be 3.65, 5.44, and 3.33, respectively (Figure 3).

Example 4. Measurement of RSV-G protein expression level

HEp2 cells were infected with RSV-GFP at an MOI of 0.1, and 2 hours later, they were treated with 100 mM eicosane, docosane, and tetrachosane, respectively. Total RNA was extracted from cells after 6, 12, 24, and 36 hours, cDNA was synthesized, and quantitative RT-PCR (qRT-PCR) was performed using the primers in Table 1 below.

Primers used for qRT-PCR analysis amplification gene Primer sequence (5'-3') sequence number RSV-G F: CCAAACAAACCCAATAATGATTT SEQ ID NO: 1 R: GCCCAGCAGGGTTGGATTGT SEQ ID NO: 2 GAPDH F: TGACCACAGTCCATGCCATC SEQ ID NO: 3 R: GACGGACACATTGGGGGTAG SEQ ID NO: 4

As a result, it was confirmed that 24 and 36 hours after treatment with eicosane, docosane, and tetracosane, respectively, the mRNA expression level of RSV-G protein was significantly reduced compared to the group treated with RSV-GFP alone (Figure 4).

Additionally, HEp2 cells were cultured and infected with RSV-GFP at an MOI of 0.1, and 2 hours later, they were treated with 100 mM eicosane, docosane, and tetrachosane, respectively. Proteins were extracted from cells after 0, 24, 36, and 48 hours, Western blot was performed using anti-RSV-G antibody, and band intensity was analyzed using ImageQuant LT 7.0 (GE-Life Science, USA) software. did.

As a result, it was confirmed that the expression level of RSV-G protein in the experimental group treated with eicosane, docosane, and tetrachosane was significantly reduced compared to the group treated with RSV-GFP alone (FIG. 5).

Through the above results, it was found that eicosane, docosane, and tetrachosane inhibit the proliferation of RSV in HEp2 cells.

Example 5. Synergy effect analysis

To analyze the synergistic effect of eicosane, docosane, and tetrachosane on the antiviral activity, HEp2 cells were infected with RSV-GFP at an MOI of 0.1, and 2 hours later, eicosane, docosane, and tetrachosane each or a mixture thereof were infected. 48 hours after treatment (1:1:1), GFP expression and RSV-GFP titer were measured.

As a result, it was confirmed that there was no significant difference in GFP expression and RSV-GFP titer when treated with eicosane, docosane, and tetracosane individually and when treated with a 1:1:1 mixture of the above compounds (Figure 6 ).

Based on the above results, it was found that not all alkanes have antiviral activity, and that among alkanes, eicosane, docosane, and tetracosane have significantly better antiviral activity.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Antiviral composition comprising alkane as effective component <130> PN21075 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ccaaacaaac ccaataatga ttt 23 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gcccagcagg ttggattgt 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tgaccacagt ccatgccatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gacggacaca ttgggggtag 20

Claims (7)

An antiviral pharmaceutical composition containing a compound represented by the following formula (1), a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient,
An antiviral pharmaceutical composition, characterized in that the virus is a respiratory syncytial virus.
[Formula 1]

In Formula 1, n is an integer from 18 to 22. delete delete The antiviral pharmaceutical according to claim 1, wherein the pharmaceutical composition has a dosage form selected from the group consisting of tablets, pills, powders, granules, capsules, suspension emulsions, syrups, aerosols, topical preparations, suppositories, and injections. Composition. An antiviral health functional food composition containing a compound represented by the following formula (1), a stereoisomer thereof, or a foodologically acceptable salt thereof as an active ingredient,
An antiviral health functional food composition, characterized in that the virus is a respiratory syncytial virus.
[Formula 1]

In Formula 1, n is an integer from 18 to 22. The antiviral health functional food composition according to claim 5, wherein the health functional food has a formulation selected from the group consisting of powder, granule, tablet, capsule, candy, chewing gum, jelly, and beverage. An antiviral quasi-drug composition containing a compound represented by the following formula (1), a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient,
A quasi-drug composition for antiviral use, wherein the virus is a respiratory syncytial virus.
[Formula 1]

In Formula 1, n is an integer from 18 to 22.