KR102610435B1 - Method for preparing wilson's disease model based on liver organoid and use thereof - Google Patents

Abstract

The present invention relates to a method for producing a Wilson disease model based on liver organoids and a Wilson disease model produced by the above method. The present invention relates to a method for producing a Wilson disease model based on liver organoids, and to a method for producing a Wilson disease model based on the above method. The present invention relates to cell viability due to accumulation of copper in the liver organoid model that causes a mutation in Wilson disease of the present invention. It was confirmed that this decreases, cell viability, which had decreased when treated with Wilson's disease treatment drugs, increases, and ceruloplasmin in plasma decreases, making it useful as a liver model for exploring the pathogenesis of Wilson's disease and for screening drugs for treating Wilson's disease. It can be used effectively.

Description

Method for preparing Wilson's disease model based on liver organoid and use thereof}

The present invention relates to a method for producing a Wilson disease model based on liver organoids and its use.

The liver is a central organ of metabolic and physiological homeostasis with diverse functions such as metabolism, protein synthesis, bile production, and red blood cell elimination. Hepatocytes, parenchymal cells of the liver, are primarily responsible for maintaining liver homeostasis and are therefore the target of many diseases. Despite recent technological advances in disease modeling of liver failure, there is a need for models of congenital and progressive metabolic diseases that can lead to end-stage liver failure. Moreover, because the liver has a unique function in drug detoxification, a model that mimics human hepatocytes is required as a tool for drug metabolism and toxicity evaluation in drug development. Although current in vitro and in vivo liver models have contributed greatly to elucidating the pathogenesis of liver diseases and evaluating drug safety, they still have limitations that do not fully reflect human liver physiology. Animal models have limitations in predicting drug toxicity due to differences between species. In addition, primary human hepatocytes (PHH) are the standard for in vitro liver models, but their use is limited due to limited accessibility to human liver tissue and unstable function, and liver cancer cells are not normal cells and therefore metabolize drugs. It is not suitable for evaluating drug toxicity because the enzyme is not fully expressed or has a reduced function. Therefore, it is necessary to create a liver model that can simulate human liver metabolism and has the ability to metabolize drugs.

Organoids are organ-specific cell aggregates created by three-dimensionally cultivating, aggregating, or recombining stem cells. They are capable of self-renewal and are also called 'mini-organs' or 'pseudo-organs.' Organoids are similar to actual organs and can carry out studies in vitro that are difficult to implement in animal models, such as regulating molecular signals, so they are very useful in basic research, as well as in human developmental processes, establishment of disease models, screening for drug effectiveness evaluation, etc. It is a technology that can be very useful in a variety of fields, including the development of drug toxicity evaluation platforms and cell therapy development.

Human liver organoids were first developed from adult human liver tissue using R-Spondin 1-containing culture medium. Primary cultured human hepatocytes (PHH) were also applied to 3D organoid culture, and the generation of liver buds and liver organoids from human pluripotent stem cells (hPSC) was reported. Liver organoids (hHO) derived from human pluripotent stem cells have been proposed as an in vitro model for disease modeling, such as genetic and metabolic disorders, cell therapy, and drug toxicity testing.

Currently, research is being conducted to establish various organoids, and liver organoids are also being developed. Conventional techniques related to liver organoid production methods include generating liver organoids through an expansion step derived from definitive endoderm and hepatic endoderm, and demonstrating that the generated liver organoids have the ability to proliferate, Literature confirmed that it has the ability to model and regenerate citrullinemia type 1 and alcoholic liver damage (Akbari et al. (2019). Robust, Long-Term Culture of Endoderm-Derived Hepatic Organoids for Disease Modeling. Stem Cell Reports 13, 627-641. , Wang et al. (2019). Human ESC-derived expandable hepatic organoids enable therapeutic liver repopulation and pathophysiological modeling of alcoholic liver injury. Cell Res 29, 1009-1026.) and 3D spherical hPSC derived mature Holocarboxylase synthetase (HLC) Generation of expandable human pluripotent stem cell-derived hepatocyte-like liver organoids (Mun et al. (2019)) proposed liver organoids as a model for producing liver organoids in an advanced expansion stage and evaluating drug-induced liver steatosis. J Hepatol 71, 970-985.), there is a US registered patent US8642339B2, which discloses a method of generating organoids by collecting human liver cells and isolating stem cells therefrom.

Wilson's disease, or liver lens nucleus degeneration, is one of the congenital metabolic disorders and is caused by a mutation in ATP7B, which plays a role in binding copper transported into liver cells to ceruloplasmin and transporting it out of the cells or excreting it into the biliary tract. As a result, copper cannot be metabolized normally and accumulates in peripheral tissues, resulting in symptoms such as progressive degeneration of the basal ganglia of the brain, the formation of brown rings around the cornea, and liver cells gradually being replaced by fibrous tissue. Therefore, to diagnose Wilson's disease, the celluloplasmin content in the serum is mainly measured, and in patients with Wilson's disease, ceruloplasmin is reduced in the serum because ceruloplasmin cannot be transported along with copper outside the cells. This disease usually first appears in people's teens and twenties and is also associated with involuntary tremors, inability to cooperate, and personality changes. Treatment involves limiting copper intake, a high-protein diet, and administering chelating compounds such as penicillamine to excrete copper in tissues through urine. As cirrhosis worsens, liver transplantation is eventually required.

Existing models of Wilson's disease include a mouse model with an ATP7B mutation or Korean Patent No. 10-2159877, which discloses a liver cell-like cell model differentiated from human embryonic stem cells. However, the mouse model is similar to that of the human liver due to differences between species. cannot be perfectly reproduced, and there is a limit to the supply of liver cell-like cell models.

Accordingly, the present inventors found that in a liver organoid model that caused a mutation in Wilson's disease, cell viability decreased due to the accumulation of copper, cell viability, which had decreased when treated with a Wilson's disease treatment drug, increased, and ceruloplasmin in the plasma decreased. By confirming this, the present invention was completed.

The purpose of the present invention is to provide a method for producing a Wilson's disease model based on liver organoids and a Wilson's disease model produced by the method.

In order to achieve the above object, the present invention

1) A step of causing a mutation in ATP7B (ATPase Copper Transporting Beta) of human pluripotent stem cells (hPSC);

2) Differentiating the ATP7B mutant human pluripotent stem cells (hPSC) of step 1) into definitive endoderm (DE) cells;

3) Differentiating the complete endoderm cells of step 2) into liver endoderm cells (hepatic endoderm, HE);

4) Differentiating the liver endoderm cells of step 3) into liver endoderm organoids (hHEO);

5) Differentiating the liver endoderm organoid of step 4) into liver organoid (hepatic organoid, hHO); Provides a method for manufacturing a Wilson disease model, including.

Additionally, the present invention provides a liver organoid-based Wilson's disease model prepared by the above production method.

Additionally, contacting the Wilson disease model with a test substance; and

Comprising the step of comparing the expression level or activity level of ceruloplasmin (CP), or cell viability in the Wilson disease model treated with the test substance with the control model, for the prevention or treatment of Wilson's disease Provides a method for screening.

The present invention relates to a method for producing a Wilson disease model based on liver organoids and a Wilson disease model produced by the above method. The present invention relates to a method for producing a Wilson disease model based on liver organoids, and to a method for producing a Wilson disease model based on the above method. The present invention relates to cell viability due to accumulation of copper in the liver organoid model that causes a mutation in Wilson disease of the present invention. It was confirmed that this decreases, cell viability, which had decreased when treated with Wilson's disease treatment drugs, increases, and ceruloplasmin in plasma decreases, making it useful as a liver model for exploring the pathogenesis of Wilson's disease and for screening drugs for treating Wilson's disease. It can be used effectively.

Figure 1 shows a schematic diagram of a method for producing liver organoids according to the differentiation period from human induced pluripotent stem cells.
Figure 2 is a diagram showing a droplet-shaped liver endoderm organoid (D-HEO).
Figure 3 is a diagram showing liver endoderm organoids (S-HEO) in suspension.
Figure 4 is a diagram showing hepatic endoderm (HE) and drop-shaped liver endoderm organoids (D-HEO) differentiated from hepatic endoderm cells.
Figure 5 shows binding to EpCAM and R-spondin 1, markers of hepatic progenitor cells/stem cells in liver endoderm cells (HE) and droplet-shaped liver endoderm organoids (D-HEO). The number of cells expressing LGR5, a target protein of Wnt, was shown by flow cytometry, and the expression of target genes AXIN2 and EPHB2 was measured by RT-qPCR, indicating that the Wnt signaling process is required in liver endoderm organoids compared to liver endoderm cells. This shows that it is not done.
Figure 6 shows the number of organoids prepared in the liver endoderm organoid production medium excluding R-Spondin 1, Noggin, and EGF (RNE) when differentiating liver endoderm organoids in a droplet shape. Production of liver endoderm organoids containing RNE This diagram shows similarity to organoids prepared in medium.
Figure 7 shows the number of organoids prepared in liver endoderm organoid production medium excluding R-Spondin 1, Noggin, and EGF (RNE) when liver endoderm organoids were differentiated in suspension. Production of liver endoderm organoids containing RNE This diagram shows that the number of organoids increases significantly compared to organoids prepared in medium.
Figure 8 is a diagram showing that the formation rate of liver endoderm organoids (S-HEO) prepared in suspension is 3.5 times higher when cultured in a medium without RNE compared to when cultured in a medium with RNE.
Figure 9 shows bright-field microscopic images and structures of liver endoderm organoids cultured under four conditions: D(+)-HEO, D(-)-HEO, S(+)-HEO, and S(-)-HEO. This was confirmed by Hematoxylin&Eosin (H&E) staining.
Figure 10 shows liver progenitor cell markers SOX9 and CK19 in liver endoderm organoids cultured under four conditions: D(+)-HEO, D(-)-HEO, S(+)-HEO, and S(-)-HEO. and EpCAM are confirmed to be expressed.
Figure 11 shows genes differentially expressed in liver endoderm organoids cultured under four conditions: D(+)-HEO, D(-)-HEO, S(+)-HEO, and S(-)-HEO. It is also a degree.
Figure 12 is a schematic diagram showing the process of differentiating liver organoids from liver endoderm organoids.
Figure 13 is a diagram showing that the expression of major liver genes increases when liver organoids are differentiated in culture medium conditions without EGF during differentiation into liver organoids.
Figure 14 shows bright-field microscopy images and the structure of liver organoids cultured under four conditions: D(+)-HO, D(-)-HO, S(+)-HO, and S(-)-HO. This was confirmed by Hematoxlin & Eosin (H&E) staining.
Figure 15 shows liver markers ALB, AAT, and CYP3A4 in liver organoids cultured under four conditions: D(+)-HO, D(-)-HO, S(+)-HO, and S(-)-HO. This is the way that has been confirmed to be manifesting itself.
Figure 16 shows liver markers ALB, AAT, TDO2, and The expression levels of HNF4A, G6P, and CYP3A4 were confirmed, and it was confirmed that the expression of liver markers was high in D(-)-HO and S(-)-HO.
Figure 17 shows the number of cells expressing ALB (albumin) in liver organoids cultured under four conditions: D(+)-HO, D(-)-HO, S(+)-HO, and S(-)-HO. This diagram shows the results of counting.
Figure 18 shows that ALB (albumin), AAT (Alpha 1-antitrypsin), and ApoA1 (Apolipoprotein A1) are higher in D(-)-HO and S(-)-HO than in D(+)-HO and S(+)-HO. This is a diagram confirming that protein expression increases.
Figure 19 is a diagram confirming that liver organoids cultured under D(-)-HO and S(-)-HO conditions exhibit microvilli structure (MV) and tight junction structure (TJ).
Figure 20 Transcriptional expression analysis of drug transporter-related genes between D(-)-HO, S(-)-HO, primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D hepatocyte-like cells (2D HLC). As a result, it was confirmed that compared to 2D HLC, both D(-)-HO and S(-)-HO had high expression of apical drug transporter genes such as MRP2, BSEP, MDR1, and BCRP.
Figure 21 shows confirmation of the expression of MRP2 (stained with CDFDA), an apical drug transporter-related gene, in the apical monolayer membrane of D(-)-HO and S(-)-HO, and probenecid, an MRP2 inhibitor. As a result of the treatment, it was confirmed that each drug transporter-specific fluorescence accumulated in the lumen of the liver organoid.
Figure 22 shows confirmation of the expression of MDR1 (stained with rhodamine 123), an apical drug transporter-related gene, in the apical monolayer membrane of D(-)-HO and S(-)-HO, and ketoconazole, an MDR1 inhibitor. As a result of the treatment, it was confirmed that each drug transporter-specific fluorescence accumulated in the lumen of the liver organoid.
Figure 23 shows confirmation of the expression of BSEP (stained with CLF), an apical drug transporter-related gene, in the apical monolayer membrane of D(-)-HO and S(-)-HO, and treatment with ketoconazole, a BSEP inhibitor. As a result, it was confirmed that each drug transporter-specific fluorescence accumulated in the lumen of the liver organoid.
Figure 24 is a diagram confirming the presence of 19 different cell clusters in liver organoids.
Figure 25 shows that the liver organoid is composed of three cell groups, the first group contains biliary-like cells, and the second group contains gallbladder-like cells. It has been confirmed that the third group includes hepatocyte-like cells.
Figure 26 is a diagram confirming the expression of representative markers of each group (ALB, ASGR1, and SERPINA1 for the hepatocyte lineage, KRT19, EPCAM, and ITGB4 for the biliary lineage, and REG4, TFF3, and FCGBP for the gallbladder lineage).
Figure 27 is a diagram confirming that specific markers of each group are exclusively expressed in each cluster.
Figure 28 confirms that the four CYP450 genes in D(-)-HO and S(-)-HO show higher expression levels than D(+)-HO and S(+)-HO, and that D(-)- This diagram shows that liver organoids cultured under HO and S(-)-HO conditions have improved drug metabolism ability.
Figure 29 is a diagram showing the activities of major CYP450s in D(-)-HO, S(-)-HO, primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D hepatocyte-like cells (2D HLC).
Figure 30 is a schematic diagram of the process of differentiating liver endoderm organoids into liver organoids using liver organoid differentiation medium containing 20 μM iron citrate (FC).
Figure 31 is a diagram showing no cytotoxicity when differentiated into liver organoids using liver organoid differentiation medium containing 20 μM iron citrate (FC).
Figure 32 is a diagram showing that cells are alive when differentiated into liver organoids using liver organoid differentiation medium containing 20 μM iron citrate (FC).
Figure 33 is a measurement of the activity of the CYP450 enzyme for 24 hours. When differentiated into suspended liver organoids using liver organoid differentiation medium containing iron citrate, the activity of CYP450, a drug metabolizing enzyme, increased. It is also a degree.
Figure 34 shows the measurement of the activity of CYP450 enzyme for 7 days, showing that the activity of CYP450, a drug metabolizing enzyme, is maintained when differentiated into suspended liver organoids using liver organoid differentiation medium containing iron citrate. This is the diagram shown.
Figure 35 is a diagram showing that in most drugs, D-HO FC has cytotoxicity at lower concentrations than other cell models.
Figure 36 shows the ability of liver organoids differentiated using liver organoid differentiation medium containing iron citrate to metabolize drugs including amitriptyline (CYP2D6 and CYP2C19), chlorpromazine (CYP2D6), and diclofenac (CYP2C9 and UGT2B7). This is a diagram showing that it has a .
Figure 37 is a diagram showing the metabolic pathway of acetaminophen in the liver.
Figure 38 shows APAP-glucuronidase, a non-CYP450-mediated metabolite of acetaminophen in the liver, in liver organoids, primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D hepatocyte-like cells. This is a diagram showing the concentrations of nide (APAP-Glu) and APAP-sulfate (APAP-Sul).
39 shows APAP-glutathione (APAP-GSH), a CYP450-mediated metabolite of acetaminophen in the liver, in liver organoids, primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D hepatocyte like cells. ) and the concentration of APAP-cysteine (APAP-Cys).
Figure 40 is a diagram showing the metabolic pathway of fimasartan in the liver.
Figure 41 shows FMS S-oxide, BR, a CYP3A4-mediated metabolite of fimasartan in the liver in liver organoids, primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D hepatocyte like cells. This is a diagram showing the concentrations of -A-557 and BR-A-535.
42 shows 1-OH butyl FMS, a CYP2C9-mediated metabolite of fimasartan in the liver, in liver organoids, primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D hepatocyte like cells. This is a diagram showing the concentrations of 2- or 3-OH butyl FMS and 4-OH butyl FMS.
Figure 43 is a diagram showing the metabolic pathway where cyclophosphamide (CP) is metabolized in the liver and causes cardiac toxicity.
Figure 44 is a diagram showing the beating rate of hiPCS-CM with or without liver organoids after treatment with cyclophosphamide at concentrations of 250 and 500 μM for 24 hours and 72 hours.
Figure 45 shows the normalized field potential duration of hiPCS-CM with and without liver organoids after treatment with cyclophosphamide at concentrations of 250 and 500 μM for 24 hours and 72 hours.
Figure 46 is a diagram showing the metabolic pathway by which terbinafine ( TERfenadine, TER) exerts cardiac toxicity.
Figure 47 is a diagram showing the beating rate of hiPCS-CM with or without liver organoids after treatment with terbinafine at concentrations of 1 and 10 μM for 24 hours and 72 hours.
Figure 48 is a diagram showing the normalized field potential duration of hiPCS-CM with and without liver organoids after treatment with terbinafine at concentrations of 1 and 10 μM for 24 hours and 72 hours.
49 shows liver endoderm organoids (hHEO) and liver organoids (hHO) differentiated from human embryonic stem cells (control, con) and liver endoderm organoids differentiated from human embryonic stem cells with the R778L mutation in the ATP7B gene (hHEO) ) and micrographs of liver organoids (hHO) (WD, Wilson disease model) and the expression of liver markers Alpha1-antitrypsin (AAT) and Hepatocyte nuclear factor 4 alpha (HNF4A) in liver organoids from control and Wilson disease models. This is the diagram shown.
Figure 50 shows liver markers (ALB, This diagram shows the mRNA expression levels (AAT, ASGR1, CYP2C9, CYP2C19, CYP3A4).
51 shows genes involved in copper transport in control human embryonic stem cells (con ESC), control liver organoids (con HO), Wilson disease mutant human embryonic stem cells (WD ESC), and Wilson disease mutant liver organoids (WD HO). This diagram shows the mRNA expression levels of CTR1 and ATP7B, a gene related to copper excretion.
Figure 52 is a diagram showing the concentration of copper accumulated in cells when copper was treated at different concentrations to control liver organoids or Wilson disease mutant liver organoids.
Figure 53 is a diagram showing cell viability when copper was treated at different concentrations to control liver organoids or Wilson disease mutant liver organoids.
Figure 54 is a diagram showing cell viability when control liver organoids or Wilson disease mutant liver organoids were treated with a Wilson disease treatment drug.
Figure 55 is a diagram showing the expression level of ceruloplasmin mRNA in control liver organoids, Wilson's disease mutant liver organoids, and primary cultured human hepatocytes (PHH).
Figure 56 is a diagram showing the activity level of ceruloplasmin protein in control liver organoids, Wilson's disease mutant liver organoids, and primary cultured human hepatocytes (PHH).

Hereinafter, the present invention will be described in detail.

The present invention includes the steps of 1) causing a mutation in ATP7B (ATPase Copper Transporting Beta) of human pluripotent stem cells (hPSC);

2) Differentiating the ATP7B mutant human pluripotent stem cells (hPSC) of step 1) into definitive endoderm (DE) cells;

3) Differentiating the complete endoderm cells of step 2) into liver endoderm cells (hepatic endoderm, HE);

4) Differentiating the liver endoderm cells of step 3) into liver endoderm organoids (hHEO);

5) Differentiating the liver endoderm organoid of step 4) into liver organoid (hepatic organoid, hHO); Provides a method for manufacturing a Wilson disease model, including.

The human pluripotent stem cells may be human embryonic stem cells (hESC) or human induced pluripotent stem cells (iPSC), and may be of human origin, but are not limited thereto.

In addition to Wilson's disease, which is a disease caused by the mutation of ATP7B, SERPINA1 gene mutation in human pluripotent stem cells in step 1) causes alpha-1 antitrypsin deficiency (AATD) model and SLC25A13 gene. It is possible to create a citrin deficiency model by causing mutations.

Alpha-1 AntiTrypsin Deficiency (AATD) is a disease that occurs when the Alpha-1 AntiTrypsin (A1AT) protein is misfolded due to a mutation in the SERPINA1 gene. Alpha-1 antitrypsin (A1AT) protects the lungs and organs from proteolytic enzymes secreted by the immune response when infection or inflammation occurs. Abnormal folding of A1AT prevents it from leaving the liver where it is produced, preventing it from protecting organs such as the lungs.

The citrin deficiency causes adult-type citrullinemia type II (CTLN2) or NICCD (neonatal intrahepatic cholestasis caused by citrin deficiency) in the neonatal period accompanied by cholestatic hepatitis. Cytrin (aspartate-glutamate carrier protein) exists in the liver mitochondrial membrane and acts to move aspartate into the cytoplasm. Aspartate is required to convert citrulline to argininosuccinic acid, so if there is a problem in this process, citrulline accumulates.

The mutation in step 1) is R778L, in which arginine (Arg, R), the 778th amino acid of the ATP7B protein, is replaced with leucine (L).

The R778L mutation can be induced using CRISPR/Cas9 gene editing technology.

Specifically, a guide RNA (single guide RNA, sgRNA) targeting exon 8 of ATP7B was cloned into the pSpCas9(BB) 2APuro(PX459) V2.0 vector, and the guide RNA was inserted into the vector containing the mutated sequence. Single-stranded DNA oligonucleotides can be produced by transfecting human embryonic stem cells using lipofectamine.

Among various single guide RNA (sgRNA) candidates targeting the adjacent genomic region of the R778L mutation locus, two sgRNAs (sgRNA-1: AGTGTTCCAGCCACCGGCCC (SEQ ID NO: 1), sgRNA-2: CATTGCCCTGGGCCGGTGGC (SEQ ID NO: 2)) were selected; It was integrated into the px459 plasmid, which co-expresses the Cas9 protein and the puromycin resistance gene. To introduce a single base substitution for R778L, single-stranded oligodeoxynucleotides (ssODNs, SEQ ID NO: 3) containing the mutant sequence (c.2333G>T) and the homologous sequence on each side of the target region were designed.

In step 3), the liver contains more than 95% of the total cells, and if it is confirmed through flow cytometry that the liver contains more than 95% of the liver endoderm cells, proceed to step 4).

The differentiation may be to differentiate stem cells in a culture vessel coated with Matrigel to simulate the microenvironment of cells, but is not limited to this, and a culture vessel coated with fibronectin or laminin may be used. .

The liver endoderm organoids can be prepared in droplet form or suspension.

The droplet-shaped liver endoderm organoids can be produced by mixing liver endoderm cells and Matrigel GFR (growth factor reduced) stock solution, dispensing into a dome structure in a well flight, and solidifying.

The suspended liver endoderm organoids can be produced by adding liver endoderm cells to a well plate dispensed with medium containing Matrigel GFR (growth factor reduced).

The differentiation of stage 4) consists of a generation stage and an expansion stage.

The developmental stage takes place in liver endoderm organoid production medium (GE medium, GM).

The liver endoderm organoid production medium contains fibroblast growth factor 10 (FGF10), hepatocyte growth factor (HGF), nicotinamide, [Leu ¹⁵ ]-Gastrin I human, N- It contains acetyl-L-cysteine, A83-01, Forskolin, and CHIR 99021, and may optionally contain Matrigel GFR (growth factor reduced) if it is desired to produce liver endoderm organoids in suspension.

The FGF10 may be included in the medium at 30 to 70 ng/ml, preferably 40 to 60 ng/ml, or more preferably 45 to 55 ng/ml.

The HGF may be included in the medium at 5 to 45 ng/ml, preferably 15 to 35 ng/ml, or more preferably 20 to 30 ng/ml.

The nicotinamide may be included in the medium at 1 to 20mM, preferably 5 to 15mM, or more preferably 7 to 13mM.

The [Leu ¹⁵ ]-Gastrin I human may be included in the medium at 1 to 20 nM, preferably 5 to 15 nM, or more preferably 7 to 13 nM.

The N-acetyl-L-cysteine may be included in the medium at 0.25 to 2.25mM, preferably 0.5 to 2mM, or more preferably 1 to 1.5mM.

The A83-01 may be included in the medium at 1 to 9 μM, preferably 3 to 7 μM, or more preferably 4 to 6 μM.

The Forskolin may be included in the medium at 5 to 15 μM, preferably 7 to 13 μM, or more preferably 8 to 12 μM.

The CHIR 99021 may be included in the medium at 1 to 5 μM, preferably 2 to 4 μM, or more preferably 2.5 to 3.5 μM.

The Matrigal GFR may be included in the medium at 0.2 to 0.8 mg/ml, preferably 0.3 to 0.7 mg/ml, or more preferably 0.4 to 0.6 mg/ml.

The development step may be performed for 10 to 18 days, preferably 12 to 16 days, and more preferably 13 to 15 days.

The expansion step takes place in a medium with the same composition as the liver endoderm organoid production medium used in the development step.

The expansion step may be performed for 3 to 7 days, preferably 4 to 6 days.

Compared to the medium composition in the existing liver organoid culture method (Hugh et al., Long-Term Culture of Genome-Stable Bipotent Stem Cells from Adult Human Liver, Cell (2015)), liver endoderm cells were grown into liver endoderm organoids. The medium used in the generation stage of differentiation does not contain R spondin-1, Noggin, and EGF, and the expansion stage does not contain R spondin-1 and EGF.

The step of differentiating the liver endoderm cells into liver endoderm organoids may be performed for 13 to 25 days, preferably for 15 to 23 days, and more preferably for 17 to 21 days. It can be.

The liver organoids in step 5) may be prepared in droplet form or suspension.

The differentiation in step 5) consists of subculturing the liver endoderm organoids and differentiating the liver endoderm organoids into liver organoids.

The droplet-shaped liver organoids are prepared by subculturing the droplet-shaped liver endoderm organoids and differentiating them into liver organoids.

Liver organoids in suspension are prepared by subculturing liver endoderm organoids in suspension and differentiating them into liver organoids.

The step of subculturing the liver endoderm organoids is performed in liver endoderm organoid maintenance medium (EM).

The liver endoderm organoid maintenance medium contains bone morphogenetic protein 7 (BMP7), fibroblast growth factor 10 (FGF10), hepatocyte growth factor (HGF), and nicotinamide. , [Leu ¹⁵ ]-Gastrin I human, N-acetyl-L-cysteine, A83-01, Forskolin, CHIR 99021, and optionally Matrigel GFR (growth factor reduced) when producing liver organoids in suspension. may include.

The BMP7 may be included in the medium at 5 to 45 ng/ml, preferably 15 to 35 ng/ml, or more preferably 20 to 30 ng/ml.

The FGF10 may be included in the medium at 30 to 70 ng/ml, preferably 40 to 60 ng/ml, or more preferably 45 to 55 ng/ml.

The HGF may be included in the medium at 5 to 45 ng/ml, preferably 15 to 35 ng/ml, or more preferably 20 to 30 ng/ml.

The nicotinamide may be included in the medium at 1 to 20mM, preferably 5 to 15mM, or more preferably 7 to 13mM.

The [Leu ¹⁵ ]-Gastrin I human may be included in the medium at 1 to 20 nM, preferably 5 to 15 nM, or more preferably 7 to 13 nM.

The N-acetyl-L-cysteine may be included in the medium at 0.25 to 2.25mM, preferably 0.5 to 2mM, or more preferably 1 to 1.5mM.

The A83-01 may be included in the medium at 1 to 9 μM, preferably 3 to 7 μM, or more preferably 4 to 6 μM.

The Forskolin may be included in the medium at 5 to 15 μM, preferably 7 to 13 μM, or more preferably 8 to 12 μM.

The CHIR 99021 may be included in the medium at 1 to 5 μM, preferably 2 to 4 μM, or more preferably 2.5 to 3.5 μM.

The Matrigal GFR may be included in the medium at 0.2 to 0.8 mg/ml, preferably 0.3 to 0.7 mg/ml, or more preferably 0.4 to 0.6 mg/ml.

The step of subculturing the liver endoderm organoids may be performed for 2 to 8 days, preferably for 3 to 7 days, and more preferably for 4 to 6 days.

The step of differentiating the liver endoderm organoids into liver organoids is performed in liver organoid differentiation medium (DM).

The liver organoid differentiation medium contains bone morphogenetic protein 7 (BMP7), fibroblast growth factor 19 (FGF19), hepatocyte growth factor (HGF), and [Leu ¹⁵ ]-Gastrin. It contains I human, N-acetyl-L-cysteine, A83-01, DAPT, and dexamethasone, and can optionally contain Matrigel GFR (growth factor reduced) if you want to manufacture liver organoids in suspension. , ferric citrate (FC) may be additionally included to further enhance drug metabolism ability.

The BMP7 may be included in the medium at 5 to 45 ng/ml, preferably 15 to 35 ng/ml, or more preferably 20 to 30 ng/ml.

The FGF19 may be included in the medium at 50 to 150 ng/ml, preferably 70 to 130 ng/ml, or more preferably 90 to 110 ng/ml.

The HGF may be included in the medium at 5 to 45 ng/ml, preferably 15 to 35 ng/ml, or more preferably 20 to 30 ng/ml.

The [Leu ¹⁵ ]-Gastrin I human may be included in the medium at 1 to 20 nM, preferably 5 to 15 nM, or more preferably 7 to 13 nM.

The N-acetyl-L-cysteine may be included in the medium at 0.25 to 2.25mM, preferably 0.5 to 2mM, or more preferably 1 to 1.5mM.

The A83-01 may be included in the medium at 0.1 to 0.9 μM, preferably 0.2 to 0.8 μM, or more preferably 0.4 to 0.6 μM.

The DAPT may be included in the medium in an amount of 0.2 to 1.8 μl, preferably 0.5 to 1.5 μl, or more preferably 0.8 to 1.2 μl.

The dexamethasone may be included in the medium at 1 to 5 μM, preferably 2 to 4 μM, or more preferably 2.5 to 3.5 μM.

The Matrigal GFR may be included in the medium at 0.2 to 0.8 mg/ml, preferably 0.3 to 0.7 mg/ml, or more preferably 0.4 to 0.6 mg/ml.

The iron citrate may be included at a concentration of 10 to 30 μM, preferably 15 to 25 μM.

The step of differentiating the liver endoderm organoids into liver organoids may be performed for 10 to 20 days, preferably for 12 to 18 days, and more preferably for 13 to 17 days. .

In addition, compared to the conventional culture method in the step of subculturing the liver endoderm organoids during the step of differentiating liver endoderm organoids into liver organoids, R spondin-1 and EGF are not included, and the liver endoderm organoids are converted into liver organoids. EGF is not included in the stage of differentiation into noids.

In conclusion, culturing in culture medium without R-spondin 1, Noggin and EGF influences organoid maturation at the stage of differentiation into liver endoderm organoids. Removal of R-spondin 1 and EGF promotes the maturation of liver organoids by increasing the expression levels of genes involved in liver and drug metabolism.

The differentiation in step 5) may be performed for 10 to 30 days, preferably for 13 to 27 days, and more preferably for 15 to 25 days.

Additionally, the present invention provides a liver organoid-based Wilson's disease model prepared by the method for producing the Wilson's disease model.

The Wilson disease model is characterized by decreased expression of ceruloplasmin (CP).

The Wilson disease model is characterized by intracellular copper accumulation.

In addition, the present invention includes the steps of contacting a test substance with a Wilson's disease model; and

Comprising the step of comparing the expression level or activity level of ceruloplasmin (CP), or cell viability in the Wilson disease model treated with the test substance with the control model, for the prevention or treatment of Wilson's disease Provides a method for screening.

In the above method, the test substance may be any one selected from the group consisting of peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, or animal tissue extracts, but is not limited thereto.

The test substance may be a single compound, a mixture of compounds (e.g., natural extract or cell or tissue culture), an antibody or peptide, or may be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Libraries of synthetic compounds are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA), and SigmaAldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA) and It is commercially available from MycoSearch (USA).

If the ceruloplasmin expression level or activity level, or cell viability is increased compared to the control group, it is judged to be a preventive or therapeutic agent for Wilson's disease.

The step of measuring the expression level of the ceruloplasmin gene can be performed through various methods known in the art, for example, western blotting, dot blotting, enzyme immunohistochemistry. Enzyme-linked immunosorbent assay, radioimmunoassay (RIA), radioimmunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation, complement fixation assay, flow cytometry. (FACS) or protein chip methods may be used.

The step of measuring the activity level of the ceruloplasmin protein can be performed through various methods known in the art, including Western blotting, immunoprecipitation assay, and dual luciferase assay. It may be measured by any one method selected from the group consisting of luciferase reporter assay), enzyme-linked immunosorbent assay (ELISA), and immunohistochemistry, but is not limited to this.

A test substance that increases the expression level of ceruloplasmin and/or increases the activity level of ceruloplasmin protein in a Wilson's disease model, obtained through a screening method, can be an effective substance for the treatment of Wilson's disease. Such a candidate substance for the treatment of Wilson's disease will later act as a leading compound in the development process of a treatment for Wilson's disease, and its structure will be modified so that the leading compound can exhibit a more effective treatment effect for Wilson's disease. By optimizing it, a new treatment for Wilson's disease can be developed.

In a specific embodiment of the present invention, it was confirmed that the Wnt signaling process is not required in the step of differentiating liver endoderm organoids from liver endoderm cells (FIG. 5), and the step of differentiating liver endoderm organoids from liver endoderm cells was confirmed. When cultured in a medium excluding R-Spondin 1, Noggin, and EGF (RNE), the number of organoids was equal to or greater than when cultured in a medium containing RNE (FIGS. 6 and 7); The organoid formation rate increased (Figure 8), and liver progenitor cell markers SOX9, CK19, and EpCAM were confirmed to be well expressed (Figure 10). In addition, when liver organoids were differentiated from liver endodermal organoids in EGF-free culture medium conditions, the expression of major liver genes increased (Figure 13), and liver markers ALB, AAT, and CYP3A4 were expressed (Figure 15). , the expression levels of liver markers were high in D(-)-HO and S(-)-HO (Figure 16), and in D(-)-HO and S(-)-HO, D(+)-HO and S( It was confirmed that the expression of liver markers ALB (albumin), AAT (Alpha 1-antitrypsin), and ApoA1 (Apolipoprotein A1) protein was increased compared to +)-HO (FIG. 18). In addition, the expression of apical drug transporters is high in liver organoids (FIG. 20), and biliary-like cells, gallbladder-like cells, and hepatocyte-like cells are present in liver organoids. like cell) (Figures 25 to 27), and the expression level of the drug metabolizing enzyme CYP450 gene ranges from D(-)-HO and S(-)-HO to D(+)-HO and S(+). It was confirmed that it was higher than -HO (Figures 28 and 29). In addition, when liver organoids were differentiated by adding iron citrate to the liver organoid differentiation medium having the composition of Table 8 or Table 9 (Figure 30), CYP450 activity significantly increased (Figure 33), and the enzyme activity was maintained for a long period of time. (Figure 34). In addition, liver organoids differentiated by adding iron citrate showed cytotoxicity for eight types of drugs (Figure 35), showed CYP450-mediated drug metabolism (Figure 36), and had the ability to metabolize acetaminophen and pimasartan. It was confirmed that there was (Figures 37 to 42) and cardiac toxicity caused by cyclophosphamide and terbinafine (Figures 43 to 48). In addition, a Wilson disease liver organoid model was prepared from human embryonic stem cells with a Wilson disease-causing mutation (R778L), and liver markers AAT and HNF4A were confirmed to be expressed in the produced Wilson disease liver organoid model (Figure 49 ), it was confirmed that various liver markers were expressed at the mRNA and protein levels (Figure 50). In addition, it was confirmed that CRT1, a gene related to copper transport, and ATP7B, a gene related to copper excretion, were highly expressed in the control group and Wilson's disease liver organoid model (FIG. 51). In addition, in the Wilson disease liver organoid model, as the copper treatment concentration increased, the intracellular copper accumulation concentration increased and cell viability decreased compared to the control group, confirming that the phenotype of Wilson disease in which copper is not excreted was reproduced. It was confirmed (Figure 52) that cell viability increased when treated with a treatment drug for Wilson's disease (Figure 54). In addition, it was confirmed that the level of ceruloplasmin mRNA expression and protein activity level was decreased in the Wilson disease liver organoid model (Figures 55 and 56).

Therefore, the Wilson's disease model produced by the method of the present invention can be usefully used as a liver model for exploring the pathogenesis of Wilson's disease and screening drugs for treating Wilson's disease.

Hereinafter, the present invention will be described in detail through the following examples and experimental examples.

However, the following examples and experimental examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following examples and experimental examples.

< Example 1> Human induced pluripotent stem cells pluripotent stem cells, iPSCs) derived from liver endoderm organoid (human hepatic endoderm organoids , hHEOs) preparation

<1-1> Coating of plates and humans pluripotency Culture of stem cells (- Day 10 )

First, Vitronectin XF (Cat#.07180, Stem cell technologies) was added to the cell culture plate to coat the wells of the plate. Human induced pluripotent stem cells (iPSCs) derived from human dermal fibroblasts (provided by Dr. Yongman Han, KAIST) through ectopic expression of OCT4, SOX2, KLF4, and c-MYC were grown on coated plates in mTeSR™-E8™ medium (Cat# .05940, Stem cell technologies) was prepared by subculturing every 3 or 4 days using 0.5mM EDTA in Dulbecco's phosphate-buffered saline (DPBS) under 37°C and 5% CO ₂ conditions. At this time, the medium was changed every day during the subculture period.

0.5 ml of diluted Matrigel (hESC qualified Matrigel, Corning, Cat No. 354277) was added per well to a 12-well plate, and the plate was coated with Matrigel for 30 minutes at 37°C. Afterwards, the cultured human induced pluripotent stem cells were taken out, the medium was removed, 1 ml of DPBS without ^{Ca 2+} and Mg ²⁺ containing 0.5 mM EDTA was added, and the cells were incubated at 37° ^C for 4 to 5 minutes. The cultured cells were taken out of the incubator, the plate was tilted to remove EDTA, and the cells were recovered using 1 ml of 12 ml of mTeSR™-E8™ medium containing 2 μM Y27632. The recovered cells were placed in a conical tube containing 11 ml of mTeSR™-E8™ medium containing 2 μM Y27632, mixed by gently pipetting, and then the recovered cells were added to Matrigel-coated plates at a rate of 1 ml per well. The human induced pluripotent stem cells were seeded on Matrigel-coated plates by dispensing and culturing for one day in a 37°C, 5% CO ₂ environment.

<1-2> Human pluripotency Differentiation of stem cells into definitive endoderm (DE) cells (- Day 9 Inner paper - Day 4 )

The following process was performed to differentiate the human induced pluripotent stem cells cultured in Example 1-1 into complete endoderm cells.

Specifically, 12 ml of endoderm differentiation medium 1 (DE medium 1) having the composition shown in Table 1 below was brought to 37°C, and then the medium was removed. Endoderm differentiation medium 1 prepared for the human induced pluripotent stem cells cultured in Example 1-1. 1 ml per well was added and cultured at 37°C in a 5% CO ₂ environment for 24 hours. Afterwards, it was replaced with endoderm differentiation medium 2 (DE medium 2) having the composition shown in Table 2 below and cultured in an environment of 37°C and 5% CO ₂ for 4 days. The medium was changed every 24 hours every day during the culture period.

endoderm Differentiation medium Composition of 1 (DE medium 1) (12 ml) RPMI-1640 containing 0.1% BSA and 1% B27 supplement 50ng/ml Activin A (ActA) 0.5mM sodium butyrate 3μM CHIR99021

endoderm Differentiation medium Composition of 2 (DE medium 2) RPMI-1640 containing 0.1% BSA and 1% B27 supplement 50ng/ml Activin A (ActA) 0.1M sodium butyrate

<1-3> Differentiation of definitive endoderm cells (DE) into hepatic endoderm cells (HE) (- Day 4 inside Day 0 )

The following process was performed to differentiate the complete endoderm cells differentiated in Example 1-2 into liver endoderm cells.

Specifically, 12 ml of hepatic endoderm differentiation medium (HE medium) with the composition shown in Table 3 below was brought to 37°C, and then the medium was removed and the hepatic endoderm differentiation medium prepared in the complete endoderm cells differentiated in Example 1-2 was added to each well. After adding 1 ml each, the mixture was cultured at 37°C and 5% CO ₂ environment for 4 days. The medium was changed every 24 hours every day during the culture period. After completion of differentiation, EpCAM positive cells were identified in some cells by flow cytometry as disclosed in Experimental Example 1 below. It was analyzed using the same conditions and methods as in the method, and if EpCAM positive cells were more than 95%, it proceeded to the next step, the production of liver endoderm organoids.

liver endoderm Differentiation medium (HE medium) Composition (12ml) RPMI-1640 containing 0.1% BSA and 1% B27 supplement 50ng/ml BMP4 10μM SB431542

<1-4> Liver endoderm from liver endoderm cells of organoids production( Day 0 inside Day 14 )

After differentiation was completed, the medium was removed from ^the liver endoderm cells prepared in Example 1-3, washed once with DPBS without Ca ²⁺ and Mg ²⁺ , and 500 μl of Accutase per well was added ^and incubated at 37°C for 10 minutes. Cultured. Cells separated into single cells were placed in a 15 ml conical tube containing 10 ml organoid basal medium (Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/ml penicillin-streptomycin, and 0.1% BSA). Transferred to , centrifugation was performed at 1200 rpm for 3 minutes, and the supernatant was removed. For 1 ml cold D-HEO or S-HEO The cell pellet was resuspended in liver endoderm production medium (Table 4 or Table 5 below) and transferred to a 1.5 ml tube for cell counting, and liver endoderm organoids were produced in droplet shape or suspension as shown below.

<1-4-1> Droplet-shaped liver endoderm Organoid (D-HEO) Production (generation stage)

15,000 liver endoderm cells were prepared in 100 μl of cold liver endoderm organoid production medium with the composition shown in Table 4 below in a 1.5 ml tube and placed on ice. 200㎕ Matrigel GFR (growth factor reduced) stock solution was added to the prepared cells and mixed by pipetting to prevent bubbles from forming. A mixture of 100 ㎕ of Matrigel and liver endoderm cells in a 24-well or 4-well plate was made to a cell density of 5000 cells/droplet, dispensed in the center, formed into a dome structure, and hardened at 37°C for 10 minutes. Afterwards, 700 to 1000 ㎕ of liver endoderm organoid production medium at 37°C was added per well and cultured for 14 days in an environment of 37°C and 5% CO ₂ . The medium was changed every 3 days of culture.

D- HEO liver endoderm organoid Composition of production medium (GE medium) Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/mL penicillin-streptomycin, 0.1% BSA, 1% B27 supplement minus vitamin A, 1% N2 supplement. 50ng/ml FGF 10 (fibroblast growth factor 10) 25ng/ml HGF(hepatocyte growth factor) 10mM Nicotinamide 10 nM [Leu ¹⁵ ]-Gastrin I human 1.25mM N-acetyl-L-cysteine 5 μM A83-01 10 μM Forskolin 3 μM CHIR99021

<1-4-2> suspension (Suspension) liver endoderm Organoid (S-HEO) Production (generation stage)

Liver endoderm organoid production medium with the composition shown in Table 5 below was dispensed in advance at 0.5 mL per well in a 24-well ultra low attachment plate, and the medium was always kept on ice to prevent Matrigel from hardening. After adding 10,000 liver endoderm cells per well, the cells were cultured for 14 days at 37°C in an environment of 5% CO ₂ . At this time, the pieces were spread evenly and cultured to prevent the organoids from clumping and growing. The medium was changed every 3 days of culture. To replace the medium, use a 1000P pipette to collect all the medium containing the organoids being cultured in suspension into a 1.5 ml tube, centrifuge for 3 minutes at a maximum speed of 1200 rpm, remove the supernatant, and replace the new medium as shown in Table 5 below. It was resuspended in 0.5 ml of liver endoderm maintenance medium containing the following composition, then spread on the plate again and cultured in an environment of 37°C and 5% CO ₂ for 3 days.

S- HEO Yonggan endoderm organoid Composition of production medium (GE medium) Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/mL penicillin-streptomycin, 0.1% BSA, 1% B27 supplement minus vitamin A, 1% N2 supplement. 50ng/ml FGF 10 (fibroblast growth factor 10) 25ng/ml HGF(hepatocyte growth factor) 10mM Nicotinamide 10 nM [Leu ¹⁵ ]-Gastrin I human 1.25mM N-acetyl-L-cysteine 5 μM A83-01 10 μM Forskolin 3 μM CHIR99021 *0.5 mg/㎖ Matrigel GFR (growth factor reduced)

*: suspension Liver endoderm produced in culture organoid (S- HEO ) added during production

<1-5> Liver endoderm of organoids expansion stage ( Day 14 inside Day 19 )

The liver endoderm organoids prepared in Examples 1-4-1 and 1-4-2 were further cultured for 5 days in a medium having the composition of Table 4 or Table 5, respectively, to finally produce a droplet-shaped liver. Endoderm organoids (D-HEO) (Figure 2) and liver endoderm organoids in suspension (S-HEO) (Figure 3) were prepared.

<1-6> Liver endoderm of organoids Freeze and Thaw

<1-6-1> Liver endoderm of organoids freezing

In the case of droplet-shaped liver endoderm organoids (D-HEO), remove D-HEO from the incubator and pipet it with a 1000P pipette to destroy the dome-shaped Matrigel containing the organoids, then pour 1.5 ml It was recovered in a tube.

In the case of liver endoderm organoids (S-HEO) in suspension, S-HEO was taken out of the incubator and pipetted with a 1000P pipette, and all organoids including the medium in the well were recovered in a 1.5 ml tube.

To separate the liver endoderm organoids and Matrigel, they were left on ice for 30 minutes and centrifuged at a maximum speed of 5000 rpm to remove the supernatant. 200 μl of cold D-HEO or S-HEO long liver endoderm organoid maintenance medium was added and the organoids were fragmented by pipetting with a 200P pipette. Afterwards, centrifugation was performed at a maximum ^{speed of} 5000 rpm to remove the supernatant. After adding 1 ml of cold DPBS without Ca ²⁺ and Mg ²⁺ , centrifugation was performed at a maximum speed of 5000 rpm to remove the supernatant. After resuspending 1 to 1.5 ml of CryoStor CS10 (Stem cell Technologies), a cryopreservation solution, 0.5 ml each was dispensed into cryotubes, placed in a freezing container, stored in a deep freezer for one day, and transferred to a LN ₂ tank (nitrogen tank) the next day for storage. .

<1-6-2> Liver endoderm of organoids thaw

Take one cryotube from the LN ₂ tank and melt it in a water bath at 37°C. When it is half melted, take it out of the water bath and add 10 ml of previously prepared organoid basal medium (10 mM HEPES, 1% GlutaMAX, 100 U/ml penicillin-streptocyst). Advanced DMEM/F12 containing mycin, 0.1% BSA) This was transferred to a 15 ml conical tube and centrifuged at 1000 rpm for 3 minutes to remove the supernatant.

In the case of droplet-shaped liver endoderm organoids (D-HEO), the organoid pellet was resuspended in 100㎕ of cold liver endoderm organoid maintenance medium (medium in Table 6 below), and then added to 200㎕ of Matrigel GFR. The stock solution was added and mixed. Afterwards, 100㎕ of the mixture of liver endoderm organoids and Matrigel was dispensed into a new 24-well plate in the center of the well to form a dome shape and hardened at 37°C for 10 minutes. 700 to 1000 μl of liver endoderm organoid maintenance medium (medium in Table 6 below) containing 20 μM Y27632 at 37°C was added per well and cultured at 37°C and 5% CO ₂ for 3 to 4 days.

In the case of liver endoderm organoids (S-HEO) in suspension, the organoid pellet was resuspended in 1 to 1.5 ml of cold liver endoderm organoid maintenance medium (medium in Table 7 below), and then added to a new 24-HEO. 0.5 ml per well was dispensed into an ultra-low attachment plate, and cultured at 37°C and 5% CO ₂ for 3 to 4 days. At this time, the pieces were spread evenly and cultured to prevent the organoids from clumping and growing. The medium was changed every 3 days of culture.

< Comparative example 1> Preparation of in vitro liver cell model

Primary human hepatocytes (PHH), HepG2 (liver cancer cell line), and 2D liver-like cells (HLC) were cultured as follows.

Primary human hepatocytes (PHH) were cultured using BD Gentest™ Cryo Human Hepatocytes (BD Biosciences, Donor No. HFC 476) in BD™ hepatocyte culture medium according to the manufacturer's instructions, and experiments were performed 24 hours later.

The human hepatocellular carcinoma cell line HepG2 was maintained in MEM (HyClone) supplemented with 10% fetal bovine serum (Lonza) and 100 U/ml penicillin-streptomycin (Gibco).

For 2D liver-like cells (HLC), human embryonic stem cells (HE) were used at 0.5 mg/ml BSA, 1X B27, 10ng/ml FGF4, 10 ng/ml HGF, 10ng/ml Experiments were performed by further culturing for 7 days with RPMI-1640 supplemented with OSM and 0.1 μM dexamethasone.

< Example 2> Liver organoid (human hepatic organoids , hHO )Manufacture of

The liver endoderm organoids prepared in Examples 1-5 above were subcultured and differentiated in differentiation medium to prepare liver organoids (human hepatic organoids, hHOs) in the following manner.

<2-1> Liver endoderm of organoids Passage culture( Day 19 inside Day 24 )

<2-1-1> Droplet-shaped liver endoderm Organoid (D-HEO) Passage culture

The drop-shaped liver endoderm organoid (D-HEO) prepared in Example 1-5 was recovered in a 1.5 ml tube after destroying the dome-shaped Matrigel containing the organoid using a 1000P pipette, and then stored in a 1.5 ml tube. To separate Rigel and liver endoderm organoids, the tube was left on ice for 30 minutes. Place the tube in a centrifuge at a maximum speed of 5000 rpm to remove the supernatant, add 200 ㎕ of cold hepatic endodermal organoid expansion mediun (EM) with the composition shown in Table 6 below, and pipette several times with a 200P pipette. Pipetting was performed to fragment the organoids. Afterwards, the tube was placed in a centrifuge at a maximum speed of 5000 rpm to remove the supernatant, 140 μl of cold liver endoderm organoid maintenance medium was added, and 280 μl of Matrigel GFR stock solution was added and mixed. In a new 24-well plate, dispense 100㎕ of Matrigel and organoid mixture in the center to form a dome, harden at 37℃ for 10 minutes, then add 700 to 1000㎕ of liver endoderm organoid maintenance medium at 37℃ per well and incubate at 37℃. , and cultured for 5 days in an incubator with 5% CO ₂ .

D- HEO liver endoderm organoid Maintenance badge ( EM ) Composition of Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/mL penicillin-streptomycin, 0.1% BSA, 1% B27 supplement minus vitamin A, 1% N2 supplement. 25ng/ml BMP7 50ng/ml FGF 10 (fibroblast growth factor 10) 25ng/ml HGF (hepatocyte growth factor) 10mM Nicotinamide 10 nM [Leu ¹⁵ ]-Gastrin I human 1.25mM N-acetyl-L-cysteine 5 μM A83-01 10 μM Forskolin 3 μM CHIR99021

<2-1-2> suspension (Suspension) liver endoderm Organoid (S-HEO) Passage culture

Suspension liver endoderm organoids (S-HEO) prepared in Examples 1-5 were cultured for 5 days in liver endoderm organoid production medium with the composition shown in Table 7 below and supplemented with 25 ng/ml of BMP7. . At this time, the medium was changed once after 3 days of culture.

The suspended liver endoderm organoids (S-HEO) prepared in Example 1-5 were collected in a 1.5 ml tube using a 1000P pipette, and the tube was used to separate Matrigel and liver endoderm organoids. was left on ice for 30 minutes. Place the tube in a centrifuge at the highest speed of 5000 rpm to remove the supernatant, add 200 ㎕ of cold hepatic endodermal organoid expansion mediun (EM) with the composition in Table 7 below, and pipet at 200P several times. Pipetting was performed to fragment the organoids. Into a new 24-well ultra-low attachment plate, 0.5 ml of the liver endoderm maintenance medium shown in Table 7 was dispensed in advance, and 66 ㎕ of fragmented suspended liver endoderm organoids (S-HEO) were dispensed per well at 37°C. , cultured for 5 days in an environment of 5% CO ₂ . At this time, the pieces were spread evenly and cultured to prevent the organoids from clumping and growing. The medium was changed every 3 days of culture. To replace the medium, use a 1000P pipette to collect all medium containing organoids in suspension into a 1.5 ml tube, place in a centrifuge at a maximum speed of 5000 rpm to remove the supernatant, and add 0.5 ml of liver endoderm maintenance medium. After resuspension, it was spread on the plate again.

S- HEO liver endoderm organoid Maintenance badge ( EM ) Composition of Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/mL penicillin-streptomycin, 0.1% BSA, 1% B27 supplement minus vitamin A, 1% N2 supplement. 25ng/ml BMP7 50ng/ml FGF 10 (fibroblast growth factor 10) 25ng/ml HGF(hepatocyte growth factor) 10mM Nicotinamide 10 nM [Leu ¹⁵ ]-Gastrin I human 1.25mM N-acetyl-L-cysteine 5 μM A83-01 10 μM Forskolin 3 μM CHIR99021 *0.5 mg/㎖ Matrigel GFR (growth factor reduced)

*: suspension Liver endoderm produced in culture organoid (S- HEO ) added during production

<2-2> Liver endoderm From organoids liver to organoids differentiation( Day 24 inside Day 39 )

<2-2-1> Droplet-shaped liver Organoid (D-HO) manufacturing

The drop-shaped liver endoderm organoids subcultured in Example 2-1-1 were cultured for 15 days using liver organoid differentiation medium with the composition shown in Table 8 below, with the medium being replaced every 3 days.

liver organoid Composition of differentiation medium (DM) Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/mL penicillin-streptomycin, 0.1% BSA, 1% B27 supplement minus vitamin t. 25 ng/ml BMP7 100 ng/ml FGF19 25 ng/ml HGF 10 nM [Leu ¹⁵ ]-G astrin I human 1.25mM N-acetyl-L-cysteine 0.5 μM A83-01 1㎕ DAPT 3 μM Dexamethasone

<2-2-2> suspension Liver in (Suspension) state Organoid (S-HO) manufacturing

The subcultured suspended liver endoderm organoids of Example 2-1-2 were cultured for 15 days, replacing the medium every 3 days using liver organoid differentiation medium with the composition shown in Table 9 below.

To replace the medium, use a 1000P pipette to collect all medium containing liver organoids cultured in suspension into a 1.5 ml tube, place it in a centrifuge at a maximum speed of 5000 rpm to remove the supernatant, and add 0.5 ml of liver organoid differentiation medium. After resuspending it, it was spread on the plate again.

liver organoid Composition of differentiation medium (DM) Advanced DMEM/F12 containing 10 mM HEPES, 1% GlutaMAX, 100 U/mL penicillin-streptomycin, 0.1% BSA, 1% B27 supplement minus vitamin t. 25 ng/ml BMP7 100 ng/ml FGF19 25 ng/ml HGF 10 nM [Leu ¹⁵ ]-G astrin I human 1.25mM N-acetyl-L-cysteine 0.5 μM A83-01 1㎕ DAPT 3 μM Dexamethasone *0.5 mg/㎖ Matrigel GFR (growth factor reduced)

*: suspension Liver endoderm produced in culture organoid (S- HEO ) added during production

< Experiment example 1> Determination of medium composition

To determine the composition of the liver endoderm organoid production medium, the following experiment was performed.

Specifically, the liver endoderm organoids were differentiated using the same method and conditions as in Example 1-4-1, except that the cells were cultured in a medium further containing R-Spondin 1, EGF, and Noggin in the medium composition shown in Table 4, Liver endoderm organoids were generated with liver endoderm organoid maintenance medium (EM) with the composition in Table 6. The number of cells expressing EpCAM in liver endoderm cells and liver endoderm organoids was analyzed by flow cytometry, and the expression levels of Wnt target protein LGR5 and target genes AXIN2 and EPHB2 were measured by RT-qPCR. .

Flow cytometry was performed by dissociating cells or organoids with TypLETM Express Enzyme (Thermo), fixing them with 4% formaldehyde, and permeabilizing them with 0.1% Triton X-100 in DPBS (HyCloneTM). Samples were incubated with fluorescently labeled primary antibodies for 10 min on ice and washed twice with 0.5% BSA (Sigma) in DPBS. Flow cytometry was performed using CytoFLEX (Beckman Coulter) and data were processed using Kaluza analysis software (Beckman Coulter).

For quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), total RNA was isolated from each sample using NucleoZOL Reagent (Macherey-Nagel, Duren, Germany) and reverse transcribed using GoScript™ Reverse Transcription Mix (Promega). qPCR was performed using GoTaq® qPCR Master Mix (Promega) on a StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA), and triplicate PCR amplification was performed for each sample. PCR results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and expressed as fold change relative to control cells. ΔCt (SΔCt) values were calculated as the difference between the Ct values obtained for GAPDH and the target gene. The ΔCt value of the control cell was used as the control ΔCt (SΔCt) value. Relative gene expression levels were determined using the formula 2-(SΔCt-CΔCt).

As a result, as shown in Figure 4, it was confirmed that liver endodermal organoids were formed after 14 days and maintained for more than 35 days. Additionally, as shown in Figure 5, EpCAM, a marker of hepatic progenitor cells/stem cells, was expressed at high levels in liver endoderm cells and drop-shaped liver endoderm organoids. On the other hand, LGR5, a target protein of Wnt that binds to R-spondin 1, was not detected on the cell surface, and Wnt target genes AXIN2 and EPHB2 were significantly reduced in drop-shaped liver endoderm organoids compared to liver endoderm cells.

The above results suggest that the Wnt signaling process is not required for liver endodermal organoid development. In addition, R-Spondin 1, EGF, and Noggin are known to be key factors in intestinal organoid production and expansion, and Noggin, a BMP antagonist, is known to inhibit liver specification, so the medium composition excluding R-Spondin 1, EGF, and Noggin was used. Liver endoderm organoids were differentiated.

< Experiment example 2>R- Spondin One, EGF and when liver endodermal organoids were differentiated with medium composition excluding Noggin. liver endoderm of organoids characteristic

<2-1> Liver endoderm cells are R- Spondin One, EGF and liver endoderm with medium composition excluding Noggin. With organoids In case of differentiation of organoids number and organoid Formation rate measurement

In the case of differentiation into liver endoderm organoids by culturing in a medium further containing R-Spondin 1, EGF, and Noggin in the medium composition of Table 4, and liver endoderm organoids using the same method and conditions as in Example 1-4-1. When differentiated, the number of organoids and the rate of organoid formation were measured.

As a result, as shown in Figure 6, when liver endoderm organoids were differentiated in a droplet shape, the number of organoids prepared in the liver endoderm organoid production medium excluding R-Spondin 1, Noggin, and EGF (RNE) was It was similar to the organoids prepared in the containing liver endoderm organoid production medium, and as shown in Figure 7, when liver endoderm organoids were differentiated in suspension, liver endoderm except for R-Spondin 1, Noggin, and EGF (RNE) The number of organoids prepared in organoid production medium was significantly increased compared to organoids prepared in liver endoderm organoid production medium containing RNE. In addition, as shown in Figure 8, the formation rate of liver endoderm organoids (S-HEO) prepared in suspension was more than 3.5 times higher when cultured in medium without RNE compared to when cultured in medium with RNE. .

<2-2> Differentiated liver endoderm Organoids In the expansion phase R- Spondin 1 and EGF Media composition excluding liver endoderm Organoids If cultured

Liver endoderm organoids were cultured in droplet form in liver endoderm organoid production medium containing R-Spondin 1 and EGF(RE) (D(+)-HEO), containing R-Spondin 1 and EGF(RE). When liver endoderm organoids were cultured in the form of droplets in liver endoderm organoid production medium without (D(-)-HEO), liver endoderm organoids were cultured in liver endoderm organoid production medium containing R-Spondin 1 and EGF (RE). When organoids were cultured in suspension (S(+)-HEO), when liver endoderm organoids were cultured in suspension in liver endoderm organoid production medium without R-Spondin 1 and EGF (RNE) ( In S(-)-HEO), the proliferative capacity of liver endoderm organoids and the expression level of liver progenitor cell markers were measured and transcriptome analysis was performed.

<2-3> Liver endoderm differentiated under various conditions of organoids Proliferative ability and liver progenitor cells marker's Check the level of expression

Structure of liver endoderm organoids cultured under four conditions: D(+)-HEO, D(-)-HEO, S(+)-HEO, and S(-)-HEO, whether they contain proliferating cells, and the number of liver endoderm cells. Expression of the markers SOX9 and EpCAM was measured as follows.

Specifically, liver endoderm organoids differentiated under four conditions were taken as bright-field microscopy images, and paraffin-embedded sections of liver endoderm organoids differentiated under each condition were stained with Hematoxylin & Eosin (H&E). .

For BradU staining, liver endoderm organoids (hHEO) were treated with 10 μM bromo-deoxyuridine (BrdU) labeling solution (Molecular Probes, Eugene, OR, USA) and incubated for 48 h at 37°C in 5% CO ₂ . did. hHEO was isolated, fixed, permeabilized, denatured with 1.2 M HCl, and stained with BrdU monoclonal antibody, Alexa Flour 488 (Invitrogen), followed by DAPI staining. Images were observed using an Olympus FV3000 confocal microscope.

For immunostaining, organoids were separated using cell recovery solution (Corning) to remove them from Matrigel for immunofluorescence of paraffin-embedded sections, fixed in 4% formaldehyde overnight at 4°C, and then embedded in paraffin blocks. . Sections were cut, hydrated, and boiled in sodium citrate buffer pH 6.0 for antigen retrieval. Samples were permeabilized, blocked with 5% normal serum (Jackson ImmunoResearch), incubated overnight at 4°C with each primary antibody, and labeled with fluorescein-conjugated secondary antibodies for 1 hour. Nuclei were stained with 4'-6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) and then mounted with ProLongTM Glass Antifade Mountant (Thermo). Images were taken with Zeiss LSM 800 and Olympus FV3000 confocal microscopes.

As a result, as shown in Figure 9, D(+)-HEO and S(+)-HEO had a multi-layer cystic structure, and D(-)-HEO and S(- )-HEO, a single-layer cystic structure was observed. In addition, as shown in Figure 10, a proliferating cell population was observed in the liver endoderm organoids in all conditions in the BradU staining photos, and liver progenitor cell markers SOX9, CK19, and EpCAM were also confirmed to be expressed.

<2-4> Liver endoderm differentiated under various conditions of organoids transcriptome analyze

Transcriptome analysis of liver endoderm organoids cultured under four conditions: D(+)-HEO, D(-)-HEO, S(+)-HEO, and S(-)-HEO was performed as follows.

Specifically, mRNA libraries were generated using the TruSeq Stranded mRNA LT Sample Prep Kit and then sequenced using the Illumina NovaSeq 6000 platform. Reads were aligned using HISAT2 (v2.1.0) (Kim et al., 2019) and assembled using StringTie (v1.3.4). Read counts were normalized to the trimmed mean of M-values (TMM) using the edgeR (v3.26.8) R package. Differentially expressed genes (highly variable genes) and principal components were calculated using the var and prcomp functions, respectively, in the stats (v3.6.1) R package. Gene ontology and KEGG pathway analysis were performed using DAVID (Huang da et al., 2009a, b). Gene set enrichment analysis (GSEA) was performed using GSEA software (v4.0.3) with feature gene sets from MSigDB (v7.0) ( Mootha et al., 2003 ).

As a result, as shown in Figure 11, the difference in culture conditions (droplet form or suspension state) was a condition that showed a greater difference in differentially expressed genes than the treatment with R-spondin 1 and EGF. When culturing liver endoderm organoids in the form of droplets, the expression of genes involved in organoid proliferation is high, and when culturing liver endoderm organoids in suspension, the expression of genes involved in organoid differentiation is high. I was able to confirm its appearance.

Taken together, the above results show that liver endoderm cells differentiated from human induced pluripotent stem cells can produce liver endoderm organoids by culturing them in medium without RNE, and liver endoderm organoids can be produced in the expansion stage without R-Spondin 1 and EGF. suggests that it can be maintained as liver endoderm cells.

< Experiment example 3> Liver under various conditions of organoids Liver after differentiation marker Confirmation of gene expression

<3-1> EGF Liver endoderm in culture media with and without inclusions Organoi Confirmation of changes in expression of major liver genes when cells are differentiated into liver organoids

Liver endoderm organoids cultured under four conditions, D(+)-HEO, D(-)-HEO, S(+)-HEO, and S(-)-HEO, were grown with EGF in the medium of Table 8 or Table 9 above. After differentiation into liver organoids using the same method and conditions as in Example 2-2 in two different culture medium composition conditions with and without inclusion (FIG. 12), the expression of major liver genes was measured.

Specifically, changes in the expression of major liver genes, nuclear receptors, and CYP450 genes, including ALB, AAT, HNF4A, TDO2, G6P, CYP2C9, CYP2C19, CYP3A4, and FXR, using the same method and conditions as RT-qPCR disclosed in Experimental Example 1 above. was confirmed.

As a result, as shown in Figure 13, when liver organoids were differentiated in culture medium conditions without EGF during differentiation into liver organoids, the expression of major liver genes increased. Therefore, liver organoid differentiation medium without EGF was used to differentiate liver endoderm organoids into liver organoids under each culture condition.

<3-2> Liver differentiated under various conditions of organoids Structure confirmation and liver marker Check gene expression level

Liver organoids differentiated under four conditions were subjected to bright-field imaging, H&E staining, and immunostaining using the same methods and conditions as those described in Experimental Example 2-3 to confirm the structure of the liver organoids, and the experimental examples RT-qPCR was performed at the transcription level to determine the gene expression level of liver markers using the same method and conditions as described in 1, and flow cytometry was performed to confirm the number of cells expressing ALB (albumin).

As a result, as shown in Figure 14, the liver endoderm organoids self-organized into a shrunken spherical shape after differentiation, and all four conditions showed a lumen inside the organoids. S(+)-HO and S(-)-HO formed liver organoids more uniformly than D(+)-HO and D(-)-HO. D(-)-HO and S(-)-HO have superior expression of liver marker levels compared to D(+)- and S(+)-HO at the protein level (Figure 15) and transcription level (Figure 16). confirmed that

In addition, as shown in Figure 17, flow cytometry was performed to count the number of cells expressing ALB (albumin), and it was confirmed that R-Spondin 1 and Noggin had a negative effect on ALB expression, and in Figure 18 As shown, albumin (ALB), alpha 1-antitrypsin (AAT), and apolipoprotein A1 (ApoA1) were higher in D(-)-HO and S(-)-HO than in D(+)-HO and S(+)-HO. ) It was confirmed that protein expression increased.

Therefore, these results suggest that the absence of R-Spondin 1 and EGF during the expansion phase affected liver maturation during differentiation into liver endoderm organoids and that removal of EGF from the culture medium during differentiation into liver organoids affected the liver and drugs. The expression levels of metabolism-related genes increased, suggesting an increased maturation process of liver organoids.

< Experiment example 4> Liver In organoids Drug Metabolizing Enzymes and Drugs transporter Expression confirmation

<4-1> Liver of organoids Structure confirmation and drug transporter Confirmation of expression of related genes

In the liver, the ATP-binding cassette transporter (ABC transporter) plays an important role in the efflux of endogenous and exogenous substances by phase II conjugation with CYP450 enzymes. Therefore, the structure of liver organoids differentiated from liver endoderm organoids was observed using a transmission electron microscope, and liver organoids differentiated in the form of water droplets (D-HOs) prepared in Example 2 above, liver organoids differentiated in suspension, and liver organoids differentiated in suspension were observed using a transmission electron microscope. Apical and basolateral regions (S-HO), primary human hepatocyte (PHH), HepG2 (liver cancer cell line), and 2D liver-like cell (2D HLC) prepared in Comparative Example 1 ( Expression of genes related to apical and basolateral drug transporters was confirmed using the same method and conditions as those described in Experimental Example 1.

Specifically, the transmission electron microscopy observation process is as follows. Liver organoids were fixed for 12 h in 2% glutaraldehyde-paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4, and washed in 0.1 M phosphate buffer. After fixation with 1% OsO ₄ dissolved in 0.1 M PB for 2 hours, it was dehydrated with gradient ethanol (50 to 100%) and permeated with propylene oxide. Specimens were embedded in the Poly/Bed 812 kit (Polysciences). Embedded in pure fresh resin and polymerized for 24 h in an electron microscope oven (TD-700, DOSAKA, Japan) at 65°C. Sections approximately 200 to 250 nm thick were initially cut and stained with toluidine blue (Sigma-Aldrich) for light microscopy. 70 nm thin sections were double stained with 6% uranyl acetate (EMS, 22400, 20 min) and lead citrate (Fischer, 10 min) for counterstaining. Sections cut by a LEICA EM UC-7 (Leica Microsystems, Austria) were transferred onto copper and nickel grids using a diamond knife (Diatome), and all thin sections were subjected to transmission electron microscopy (JEM-1011, JEOL) at an accelerating voltage of 80 kV. , Japan).

As a result, as shown in Figure 19, the microvilli structure and tight junction structure of the luminal side membrane were observed in the liver organoid. In addition, as shown in Figure 20, as a result of transcriptional expression analysis of drug transporter-related genes between D(-)-HO, S(-)-HO, PHH, HepG2, and 2D HLC, compared to 2D HLC, D(-) )-HO and S(-)-HO both had high expression of apical drug transporter genes such as MRP2, BSEP, MDR1, and BCRP. Meanwhile, D(-)-HO and S(-)-HO showed significantly higher expression of the basolateral drug transporter genes MRP3 and NTCP, respectively.

The above results suggest that the apical side membrane with microvilli is intensively developed in liver organoids located in the luminal side membrane.

<4-2> apex drug transporter genes have gone In organoids Check whether it is expressed or not

Whether the apical drug transporter-related genes MRP2, BSEP, and MDR1 were expressed in liver organoids, and the expression changes when inhibitors of each gene were administered were confirmed using fluorescent staining.

Specifically, liver organoids were recovered from Matrigel and washed three times with DPBS. For CDFDA ((5(6)-carboxy-2',7'-dichlorofluorescein diacetate) staining, liver organoids were treated or not with 2mM probenecid for 3 hours at 37°C in 5% CO _2. For 15 min, staining was performed with 10 μM CDFDA (Sigma-Aldrich). For Choyl-Lysyl-Fluorescein (CLF) and rhodamine 123 staining, 4 μM CLF (Corning) was used with or without 10 μM ketokonazole) for 24 h. Liver organoids treated with 10 μM rhodamine 123 (Invitrogen) for 15 minutes each were incubated for 1 hour, and all samples were washed three times with DPBS, stained with Hoechst 33342, and observed under an Olympus FV3000 confocal microscope.

As a result, as shown in Figure 21, the expression of MRP2 (stained with CDFDA) was confirmed in the apical monolayer membrane of D(-)-HO and S(-)-HO, and as shown in Figure 22, MDR1 (rhodamine The expression of (stained with 123) was confirmed, and as shown in Figure 23, it was confirmed that BSEP (stained with CLF) was specifically detected in the apical monolayer membrane of liver organoids (green fluorescence). The emission of each absorbed fluorescence was observed at steady state and inhibitors of each transporter (inhibitors of MRP2 were probenecid, MDR1 and When blocked by ketoconazole, an inhibitor of BSEP, each drug transporter-specific fluorescence accumulated in the liver organoid lumen. As shown in Figure 23, rhodamine 123 was not released out of the cell due to cytoplasmic accumulation due to MDR1 inhibition.

The above results suggest that the prepared liver organoids have a drug release function due to the high expression of apical efflux drug transporters due to the development of the apical membrane present in the lumen rather than the basolateral side.

< Experiment example 5> Liver of organoids Cell composition and liver cell specific marker Expression confirmation

To investigate the cellular composition of liver organoids, single-cell transcriptome analysis of S(-)-HO was performed by single-cell RNA sequencing.

Specifically, the libraries for scRNA-seq used Chromium Single Cell 3’Reagent Kit v3, Chromium Chip B Single Cell Kit, and Chromium i7 Multiplex Kit (10X Genomics). Liver organoids were isolated using the Embryoid body dissociation kit (Miltenyi Biotec), then filtered through a 35 μm strainer and loaded onto the Chromium microfluidic platform to capture 7,000 individual cells. Libraries were sequenced paired-end on the Illumina HiSeq X Ten platform. Sequencing the Single Cell 3' library generated a FASTQ file containing sample indices of paired-end Read 1 (including 16bp 10x™ barcode and 12bp UMI) and Read 2, i7 indexed reads. These files were processed with Cell Ranger™ (v3.1.0) using default arguments. Reads were aligned to the human reference genome (GRCh38). Cells with less than 2,000 genes and a UMI of 10% or more were further filtered using the Seurat (v3.0.4) R package and finally a 20,125 × 1,859 gene-specific matrix was generated. got it Expression matrices were imported and analyzed using the scanpy (v1.4.5.1) Python package. Cells were visualized as two-dimensional ForceAtlas2 plots using the tl.draw_graph function and then recalculated with PAGA-initialization. Clustering was performed using the tl.leiden function with "n_neighbors = 4", "n_pcs = 20" and "resolution = 1". Marker genes for clusters and cell groups were discovered using the Wilcoxon rank-sum test option and the tl.rank_genes_groups function. Gene set expression scores, including hepatocyte-like, biliary-like, gallbladder-like, and cell cycle, were calculated using the tl.score_genes function. Gene ontology and KEGG pathway analysis were performed using DAVID.

As a result, as shown in Figure 24, it was confirmed that 19 different cell clusters existed in the liver organoid.

Additionally, as shown in Figure 25, cells were classified into three groups based on gene expression patterns and GO-term analysis, with the first group consisting of clusters 2 and 15 and biliary-like cells. The second group consists of cluster 18 and contains gallbladder-like cells, and the third group contains the remaining clusters and contains hepatocyte-like cells. It was confirmed that it exists.

In addition, as shown in Figure 26, representative markers of each group (ALB, ASGR1, and SERPINA1 for the hepatocyte lineage, KRT19, EPCAM, and ITGB4 for the biliary lineage, and REG4, TFF3, and FCGBP for the gallbladder lineage) were confirmed to be expressed. And, as shown in Figure 27, specific markers of each group were exclusively expressed in each cluster. It was confirmed that the liver organoids contained 88.44% of hepatocyte-like cells, which is a similar proportion to ALB-expressing cells, and that biliary-like cells accounted for 10.38% and gallbladder-like cells for 1.18%.

The above results suggest that liver organoids are composed of liver-like cells, gallbladder-like cells, and biliary-like cells, including progenitor-like cells expressing cell-specific markers, and can closely mimic the liver.

< Experiment example 6> Liver of organoids Measurement of drug metabolism ability

Since metabolic elimination of drugs is one of the main functions of liver tissue, a highly functional drug metabolic capacity that is reproducible in drug efficacy and toxicity tests in liver organoid models is required. Therefore, to determine whether liver organoids exhibit appropriate drug metabolism ability, the expression levels of major CYP450s, including CYP1A2, CYP2C9, CYP2C19, CYP2D6, and CYP3A4, were measured by RT-qPCR using the same method and conditions as described in Experimental Example 1 above. was performed and compared with other in vitro models (liver cancer cell line (HepG2), primary cultured human hepatocytes (PHH), and hepatocyte-like cells (2D HLC)). The activity of major CYP450s was measured through LC-MS/MS analysis.

Specifically, to measure basal CYP450 activity, substrate reactions were performed using liver organoids in _droplet form (D(-)HO), liver organoids cultured in suspension (S( -)HO), primary cultured human hepatocytes (PHH), hepatoma cell line (HepG2), and 2D liver cell-like cells (2D HLC). A CYP450 isoform-specific substrate cocktail set (Set A, 50 μM phenacetin for CYP1A2, 5 μM coumarin for CYP2A6, 5 μM amodiaquine for CYP2C8, 100 μM S-mephenytoin for CYP2C19, 5 μM midazolamthorphan for CYP2D6, and 20 μM dextromethorphan for CYP3A4; set B, 50 μM bupropion for CYP2B6, 90 μM diclofenac for CYP2C9, and 90 μM chlorzoxazone for CYP2E1). Each CYP450 isoform-specific substrate cocktail set was cultured in a 24-well culture plate with a final volume of 0.6 ml per well. 80 ㎕ of medium was collected at 2, 4, 6, and 24 hours, and 80 ㎕ of ice-cold acetonitrile (ACN) containing 100 nM carbamazepine (CBZ) and 300 nM 4-methylumbelliferone (4-MUF) was added for reaction. quenched. Samples were centrifuged at 16,000 g for 10 min at 4°C and the supernatant was subjected to liquid chromatography-tandem mass spectrometry (LC-MS/MS). Data were normalized to protein concentration.

As a result, as shown in Figure 28, except for the CYP1A2 gene, the four CYP450 genes of D(-)-HO and S(-)-HO had higher expression than D(+)-HO and S(+)-HO. level was indicated. In addition, as shown in Figure 29, the activity of major CYP450 was confirmed to vary in metabolite production depending on the addition of R Spondin-1 and EGF only in droplet-type culture, but there was no difference in suspension culture, D(-) CYP2C9 and CYP2C19 activities in -HO and S(-)-HO were similar to primary cultured human hepatocytes (PHH). Liver organoids had higher levels of CYP450 expression and activity than HepG2 and 2D HLC, whereas metabolite production mediated by CYP1A2, CYP2D6 and CYP3A4 was lower compared to PHH.

The above results indicate that the expression and activity of CYP450, a drug metabolizing enzyme, increase when liver organoids are differentiated in a medium that does not contain R-Spondin 1 and EGF in the expansion stage.

< Experiment example 7> Ferric Citrate, F.C. ) Liver in a medium supplemented with Organoi Determination of the effect on CYP450 activity when differentiating

Heme (iron(III) protoporphyrin-IX) is an important cofactor for oxygen activation when binding to CYP450. Ferric citrate (FC) increases hepatic iron accumulation in macrophages and hepatocytes (Chang et al., 2018; Lim et al., 2019). Therefore, we examined whether iron(III) supplementation could improve CYP450 activity during the differentiation stage of liver organoids (FIG. 30).

Specifically, liver endoderm organoids were differentiated into liver organoids for 15 days in the same manner and conditions as Example 2 above using liver organoid differentiation medium containing 20 or 50 μM iron citrate (FC). For live and dead cell analysis, liver organoids treated with or without FC were stained with the live/dead Viability/Cytotoxicity kit (Thermo). Images were observed using an Olympus FV3000 confocal microscope. The survival rate of liver organoids was measured using the CCK-8 (Dojindo) assay. These values were normalized to those obtained from the CellTiter-Glo® 3D Cell Viability Assay (Promega). The survival rate (%) of control liver organoids was normalized to 100%.

For detection and quantification of metabolites of CYP450, samples were analyzed using a Prominence UFLC system with a parallel LC-20ADXR pump, autosampler, and column oven (Shimadzu). The sample injection volume was 10 μl, using an Atlantis dC18 column (2.1 mm × 50 mm id, 3 μm, Waters, Milford, MA) with a SecurityGuard C18 guard column (2.0 mm × 4.0 mm id; Phenomenex, Torrence, CA) maintained at 30°C. Separation was performed in The HPLC flow rate was set at 0.4 mL/min. The HPLC mobile phase consisted of A [deionized water containing 0.1% (v/v) formic acid] and B [acetonitrile containing 0.1% (v/v) formic acid]. LC-MS/MS data were collected on an Applied Biosystems SCIEX 3200 QTRAP hybrid triple quadrupole-linear ion trap mass spectrometer equipped with a TurboIonSpray interface operating in positive or negative (for CYP2E1) ESI mode. Additionally, 4-hydroxy diclofenac was set to m/z 312 → 230 in positive mode. Data collection and analysis were performed with AnalystTM software (ver. 1.6.2; Applied Biosystems, Foster city, CA).

As a result, as shown in Figure 31, iron citrate (FC) did not show cytotoxicity when treated at a dose of 20 μM in the medium composition of Tables 8 and 9 above. In addition, as shown in Figure 32, when 50 μM iron citrate was included in the medium, only the red fluorescence of EthD-1 appeared in dead cells, but when 20 μM iron citrate was included in the medium, Calcein appeared in living cells. Green fluorescence of AM appeared, and the treatment dose of iron citrate was determined to be 20 μM.

Additionally, as shown in Figure 33, CYP450 activity was significantly increased by treatment with iron citrate, except for CYP1A2, in liver organoids (S-HO FC) cultured in suspension. To observe the maintenance of CYP450 enzyme activity over a long period of time, the activities of CYP1A2, CYP2C9, CYP2C19, CYP2D6, and CYP3A4 of D-HO and S-HO FC were measured for 7 days. As shown in Figure 34, CYP1A2, CYP2C9, and CYP2D6 The activity was maintained for 7 days, but CYP2C19 and CYP3A4 tended to decrease from day 4.

The above results suggest that iron is required to increase CYP450 activity in liver organoids.

< Experiment example 8> Liver of organoids drug toxicity test

<8-1> Liver of organoids Drug toxicity assessment

To confirm the usefulness of liver organoids as a cell model for drug toxicity evaluation, drug toxicity evaluation was performed on liver organoids, a liver cancer cell line (HepG2), and 2D hepatocyte-like cells.

Specifically, D-HO, S-HO, HepG2, and 2D HLC prepared by culturing in culture medium with iron citrate were cultured in 96 well plates. Compounds (ticlopidine, flutamide, etc.) at 1-, 5-, 10-, 20-, and 40-fold Cmax concentrations were prepared in each basal medium, and the final DMSO concentration was 0.1%. Liver organoids or cells were treated with compounds 24 Treatment time, and viability was measured using the CellTiter-Glo® 3D Cell Viability Assay (Promega).The values obtained were normalized to the control.The normalized values visualize the dose-response relationship as a non-linear regression curve and represent the IC50 value. (GraphPad Prism, GraphPad Software, San Diego, CA). Additionally, the sensitivity of different cell types to each compound tested was displayed as a heatmap of IC50 values (GraphPad Prism).

As a result, as shown in Figure 35, for most drugs, D-HO FC was observed to have cytotoxicity at lower concentrations than other cell models.

<8-2> Liver of organoids CYP450 medium Evaluation of drug metabolism ability

To confirm the usefulness of liver organoids as a cell model for evaluating drug metabolism capacity, CYP450-mediated drug metabolism capacity was compared in liver organoids (D-HO FC and S-HO FC) and primary cultured human liver cells (PHH). .

Specifically, to measure the amount of prodrugs in the media of liver organoids and PHHs, amitriptyline for CYP2D6 and CYP2C19, chlorpromazine for CYP2D6, and diclofenac for CYP2C9 and UGT2B7. Compounds containing were used. Compounds were treated at a concentration of 1 μM for 24 hours at 37°C in 5% CO ₂ . They were cultured in a final volume of 0.7 ml per well in each 24 well culture plate. 60 μl of medium was withdrawn at 1.5, 3, 6, 12, and 24 h, respectively, and the reaction was quenched by adding 60 μl of ice-cold ACN containing 100 nM CBZ and 300 nM 4-MUF. Samples were centrifuged at 16,000 g for 10 min at 4°C and the supernatant was subjected to liquid chromatography-tandem mass spectrometry (LC-MS/MS). Values for compound alone (organic or cell-free) were used as controls. Data were normalized to protein concentration.

As a result, as shown in Figure 36, the CYP450-mediated drug metabolism ability was increased in D-HO FC and S-HO FC, including amitriptyline (CYP2D6 and CYP2C19), chlorpromazine (CYP2D6), and diclofenac (CYP2C9 and UGT2B7). The disappearance of the drug was determined using and indicated a drug metabolic function in liver organoids similar to PHH in liver organoids.

<8-3> Liver of organoids Acetaminophen (Acetaminophen) Metabolic Ability Assessment

Acetaminophen (APAP), a safe and effective analgesic and antipyretic, is known to undergo extensive hepatic metabolism through two pathways: detoxification (conjugation such as glucuronidation and sulfation) and bioactivation (CYP450-mediated oxidation) (Hodgman and Garrard , 2012). Acetaminophen metabolism was tested under non-cytotoxic concentrations in D-HO, S-HO, PHH, HepG2 and 2D HLC. Conjugate reactions by UGT (UDP-glucuronosyltransferase) and SULT (sulfotransferase) are the main metabolic pathways for APAP metabolism (Figure 37).

Specifically, to measure the metabolites of APAP, reactions were performed on PHH, D-HO, S-HO, HepG2, and 2D HLC treated with 10mM APAP for 24 h at 37°C in 5% CO ₂ . APAP was processed to a final volume of 0.7 ml per well in each 24-well culture plate. 70 μl of medium was withdrawn at 3, 6, 12, and 24 h, respectively, and the reaction was quenched by adding 70 μl of ice-cold ACN containing 100 nM BR-A-563 as an internal standard. Samples were centrifuged at 16,000 g for 10 min at 4°C and the supernatant was subjected to liquid chromatography-tandem mass spectrometry (LC-MS/MS). Data were normalized to protein concentration.

As a result, as shown in Figure 38, APAP-glucuronide (APAP-Glu) was produced in greater amounts in D-HO, S-HO, and PHH than in HepG2 and 2D HLC. Additionally, as shown in Figure 39, for APAP-GSH, the amount of metabolites tended to decrease after 12 hours in D-HO, S-HO and PHH, while no metabolites were detected in HepG2 and 2D HLC. These results suggest that liver organoids are capable of metabolizing acetaminophen.

<8-4> Liver of organoids Fimasartan ( fimasartan ) Metabolic capacity assessment

Pimasartan (FMS), an angiotensin II receptor blocker, is used to treat hypertension and is known to be metabolized by CYP2C9, CYP3A4, and CYP3A5. FMS metabolism was tested using D-HO, S-HO, PHH, HepG2 and 2D HLC at non-cytotoxic concentrations. It is further metabolized by CYP3A4/5 to BR-A-557 and by CYP3A4 to BR-A-535, and CYP2C9, CYP3A4, and CYP3A5 are involved in the formation of FMS S-oxide (Figure 40).

Specifically, to measure the metabolites of fimasartan (FMS), reactions were performed on PHH, D-HO, S-HO, HepG2, and 2D HLC treated with 50 μM FMS for 24 h at 37°C in 5% CO ₂ did. FMS was processed to a final volume of 0.7 ml per well in each 24-well culture plate. 70 μl of medium was withdrawn at 3, 6, 12, and 24 h, respectively, and the reaction was quenched by adding 70 μl of ice-cold ACN containing 100 nM BR-A-563 as an internal standard. Samples were centrifuged at 16,000 g for 10 min at 4°C and the supernatant was subjected to liquid chromatography-tandem mass spectrometry (LC-MS/MS). Data were normalized to protein concentration.

As a result, as shown in Figure 41, production of sequential metabolites of FMS was observed in PHH, hHO, and 2D HLC, but production of BR-A-535, the third step metabolism of FMS by CYP3A4, was not observed in HepG2. . Additionally, as shown in Figure 42, CYP2C9 played an exclusive role in n-butyl hydroxylation of FMS. It was confirmed that D-HO and S-HO produced more metabolites including 1-OH, 2- or 3-OH and 4-OH butyl FMS than HepG2 and 2D HLC.

The above results suggest that liver organoids can serve as an in vitro model to study and test CYP450-mediated drug metabolism.

< Experiment example 9> Liver of organoids Cardiac toxicity assessment

Whether liver organoids can be used to evaluate cardiotoxicity induced by drug metabolites was determined by treating liver organoids with cyclophosphamide and terbinafine.

<9-1> Cyclophosphamide ( cyclophosphamide , CP) Cardiotoxicity evaluation

Cyclophosphamide (CP) is an alkylating agent used in anticancer chemotherapy drugs and is known to cause cardiotoxicity. CP is activated by hepatic CYP450, a drug-metabolizing enzyme that includes CYP2B6, CYP2C9/C19, and CYP3A4/A5, to form 4-hydroxy-CP and coexists with the tautomer AldoCP. In the heart, AldoCP is broken down into acrolein and phsophormide mustard (PM) (Figure 43). Acrolein is a toxic metabolite that causes toxicity to the myocardium, cardiomyocytes, and endothelial cells. Therefore, we tested the electrophysiological effects of CP in co-cultured hiPSC-derived cardiomyocytes (hiPSC-CMs) under conditions with or without FC-treated S(-)-HO.

Specifically, the electrical activity of Cardiosight®-S (NEXEL Co., South Korea), a hiPSC-CM, was measured using an MEA system (Axion BioSystems, Maestro, US) set at 37°C, 5% CO ₂ , 20% O ₂ , and perfused with 75% N ₂ . hiPSC-CMs were first seeded in 12-well MEA plates at a density of 4 × ¹⁰ cells per well and maintained for 7 days in cardiomyocyte culture medium provided by NEXEL Co. to stabilize with half-to-medium changes performed every 2 days. It has been done. After one week, the culture medium was replaced with liver organoid differentiation medium (DM). Then, a Transwell insert (Corning) was placed in each well, FC-treated S(-)-HO was seeded into the insert, and cultured for 3 days. On the day of compound application, culture medium was completely removed from the wells and inserts and fresh medium was added to ensure the correct volume per well (2 mL/well total). Cells were allowed to equilibrate for 4 h, and online parameters were monitored to ensure a stable baseline for >40 min. Cells were exposed to cyclophosphamide drug at a single dose per well. After application of drug or control (0.1% DMSO), field potentials were measured every 5 minutes for 30 seconds for 72 hours. Field potential signals were recorded and analyzed with Axion BioSystems' Integrated Studio (AxIS) software to measure beating frequency and field potential duration. Typically, Fredericia's velocity correction algorithm (FPDcF) is used to correct for velocity-dependent effects. Here, FPDcF = FPD / Beat Period0.33. Data were normalized to pretreated control values.

As a result, as shown in Figure 44, after treatment with CP at concentrations of 250 and 500 μM for 24 hours and 72 hours, the beating rate of hiPCS-CMs with liver organoids was significantly reduced compared to hiPSC-CMs alone, resulting in CP's It caused cardiac toxicity.

Additionally, as shown in Figure 45, the field potential duration corrected by beat frequency using Fridericia's formula (FPDcF) was 24 and 72 hours for hiPSC-CMs with liver organoids treated with 250 μM of CP. It later increased and showed cardiotoxicity.

<9-2> of terbinafine Cardiac toxicity assessment

Terfenadine ( TER) can cause life-threatening ventricular arrhythmias. Terbinafine is metabolized by CYP3A4 in the liver, and the main active metabolite is fexofenadine (FEX), which is known to have lower toxic effects compared to terbinafine (Figure 46).

The cardiac toxicity of terbinafine was measured in liver organoids using the same method and conditions as in Experimental Example 9-1, except that terbinafine was treated instead of cyclophosphomide.

As a result, as shown in Figure 47, it was confirmed that the addition of terbinafine induced cessation of spontaneous beating within 30 minutes in hiPSC-CMs not cultured with liver organoids. Additionally, as shown in Figure 48, hiPSC-CM cultured with liver organoids induced an increase in beating frequency by treatment with 1 and 10 μM TER, and it was confirmed that FPDcF did not change. The results indicate that the cardiotoxicity of terbinafine in relation to beating rate and field potential in hiPSC-CMs was alleviated by metabolism (non-toxic fexofenadine) via liver organoids.

Taken together, the above results suggest that the liver organoids of the present invention can serve as an in vitro model for studying and testing target organ toxicity induced by hepatic CYP450-mediated drug metabolism.

< Experiment example 10> Fabrication of the Wilson disease model

<10-1> Wilson's disease liver organoid Manufacturing of models

Wilson's disease (WD) is a genetic liver disease in which patients have deficient hepatic excretion and utilization of copper, resulting in abnormal hepatic and neurological phenotypes (Ala et al., 2007; Prohaska, 1986; Wu et al., 2015).

To produce a Wilson disease model, instead of using human induced pluripotent stem cells (iPSCs), a Wilson disease-causing mutation (arginine (Arg, R), the 778th amino acid of the ATP7B protein, is changed to leucine (L)) is used in the protein encoding the ATP7B gene. Liver endoderm organoids were prepared using the method and conditions of Example 1, except that human embryonic stem cells (hESC) with a substituted R778L) and a human embryonic stem cell line (BG01 cell line) were used as a control, followed by the above procedure. It was differentiated into liver organoids using the method and conditions of Example 2.

<10-2> Liver in Wilson's disease model marker and confirmed expression of copper transport-related genes.

The expression levels of liver markers and copper transport-related genes in the Wilson's disease model and control liver organoids prepared in Experimental Example 10-1 were confirmed using the same method and conditions as RT-qPCR disclosed in Experimental Example 1.

As a result, as shown in Figure 49, it was confirmed that the liver markers AAT and HNF4A were expressed, and as shown in Figure 50, the control and Wilson's disease liver organoids expressed liver markers (ALB, AAT) at the mRNA level and protein level. , ASGR1, CYP2C9, CYP2C19, CYP3A4). As shown in Figure 51, before observing the Wilson disease phenotype in liver organoids, CTR1, a gene involved in copper transport, and ATP7B, a gene involved in copper excretion, were highly expressed in control liver organoids and Wilson disease-induced liver organoids. confirmed. ATP7B is highly expressed in Wilson's disease-induced liver organoids, but does not perform its role properly due to mutations.

<10-3> In the Wilson disease model Copper chloride (CuCl ₂ )of process

The following experiment was performed to determine whether the Wilson disease liver organoid model was defective in copper excretion.

Specifically, to measure cell viability with copper and drug treatments for Wilson's disease, chemicals were treated for 48 hours at the concentrations specified in each experiment. For 100 μl of culture medium, 10 μl of Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan) was added to the organoids and cultured for 2 to 4 hours. Absorbance was measured at 450 nm using an iMark™ microplate reader (Bio-Rad) and normalized to protein content determined by Bradford assay. Cell viability was calculated using Equation 1 below.

<Equation 1>

Survival rate (%)=(A _sample -A _blank )/(A _{control group} -A _blank )×100

As a result, as shown in Figure 52, treatment with high concentration CuCl ₂ resulted in a higher accumulation level of intracellular copper in Wilson's disease model liver organoids than in the control group, which suggests that Wilson's disease liver organoids are defective in excreting copper. It indicates that there is. Additionally, as shown in Figure 53, the cell viability of Wilson's disease liver organoids was decreased in a dose-dependent manner by CuCl ₂ treatment compared to control liver organoids.

<10-4> Wilson's disease liver organoid on the model Wilson's disease Disposal of therapeutic drugs

Considering the differences in intracellular copper and cell viability between control and Wilson's disease organoids, the copper concentration was fixed at 50 μM and four Wilson's disease clinical drugs (D-penicillamine, Bathocuproinedisulfonic acid, Trientine, and DL-alpha-Tocopherol acetate) were administered. Changes were observed after processing (Cells. 2020 Apr; 9(4): 872.).

Specifically, to measure cell viability with copper and drug treatments for Wilson's disease, chemicals were treated for 48 hours at the concentrations specified in each experiment. For 100 μl of culture medium, 10 μl of Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan) was added to the organoids and cultured for 2 to 4 hours. Absorbance was measured at 450 nm using an iMark™ microplate reader (Bio-Rad) and normalized to protein content determined by Bradford assay. Cell viability was calculated using Equation 1 below.

<Equation 1>

Survival rate (%)=(A _sample -A _blank )/(A _{control group} -A _blank )×100

As a result, as shown in Figure 54, cell viability was measured in the control group and Wilson's disease liver organoid model due to treatment with copper and therapeutic drugs. As a result, D-Penicillamine, the most commonly prescribed drug for Wilson's disease patients, was treated at 10 μM. cell viability increased, and a similar increase in cell viability was observed at higher doses in the Wilson disease liver organoid model. Other drugs such as bathocuproinedisulfonic acid, Trientine hydrochloride, and DL-α-Tocopherol acetate (Vitamin E) also showed an effect of increasing cell viability in Wilson's disease liver organoids in a dose-dependent manner.

The cell viability of the Wilson's disease liver organoid model of the present invention is reduced by treatment with copper, and the cell viability is increased by treatment of known Wilson's disease treatment drugs, which means that the Wilson's disease liver organoid model of the present invention is a treatment drug for Wilson's disease. We suggest that it is a cell model suitable for screening and exploration of pathogenesis.

<10-5> Wilson's disease liver organoid in model Ceruloplasmin Expression level measurement

In clinical diagnosis, a decrease in plasma ceruloplasmin (CP) (a protein encoded by the ceruloplasmin gene) is a characteristic of Wilson disease. The existing Wilson disease model using hepatic-like cells (HLC) differentiated from human pluripotent stem cells does not express ceruloplasmin, so it cannot model ceruloplasmin-related phenotypes. There is (request for related references to be included). Therefore, ceruloplasmin mRNA and protein expression levels were measured in the Wilson disease liver organoid model of the present invention as follows.

Specifically, the level of ceruloplasmin mRNA expression was measured using the same method and conditions as RT-qPCR in Experimental Example 1 above. Additionally, secreted ceruloplasmin (CP) was measured using a human ceruloplasmin ELISA kit (Novus Biologicals). Liver organoids were cultured in liver organoid differentiation medium (DM) for 3 days, and then liver organoids and culture medium were harvested separately. The culture was centrifuged at 3000 × g for 10 minutes at 4°C to remove foreign substances and obtain the supernatant. The supernatant was added to the microplate strip and incubated for 2 hours. Reactions with biotinylated human ceruloplasmin antibody, ceruloplasmin conjugate, and chromogenic substrate were performed sequentially for 1 hour, 30 minutes, and 25 minutes, respectively. Wells were washed five times with wash buffer between each step, stop solution was added and absorbance was measured at a wavelength of 450 nm using an iMark™ microplate reader (Bio-Rad). All measurements were normalized by protein content determined by Bradford assay.

As a result, as shown in Figure 55, it was confirmed that ceruloplasmin mRNA expression was significantly decreased in the Wilson disease liver organoid model. Additionally, as shown in Figure 56, it was confirmed that the secretion of ceruloplasmin in plasma was significantly reduced in the Wilson disease liver organoid model.

The above results show that Wilson's disease can be successfully modeled using liver organoids in relation to drug response and clinical biomarkers, and the liver organoid of the present invention can be used as a model for not only Wilson's disease but also various other liver diseases. It suggests that there is a possibility that this could happen.

<110> Korea Research Institute of Chemical Technology <120> Method for preparing Wilson's disease model based on liver organoid and use thereof <130> 2020P-10-032 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223>sgRNA-1 <400> 1 agtgttccag ccaccggccc 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223>sgRNA-2 <400> 2 cattgccctg ggccggtggc 20 <210> 3 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> ssODNs <400> 3 ggagccctgt gacattcttc gacacgcccc ccatgctctt tgtgttcatt gccctgggcc 60 tgtggctgga acacttggca aaggtaacag cagcttcagg ttcagaaaag agctgctcct 120 tcagtaaaca aatctcactt cctctgaaca c 151

Claims (20)

1) A step of causing a mutation in ATP7B (ATPase Copper Transporting Beta) of human pluripotent stem cells (hPSC);
2) Differentiating the ATP7B mutant human pluripotent stem cells (hPSC) of step 1) into definitive endoderm (DE) cells;
3) Differentiating the complete endoderm cells of step 2) into liver endoderm cells (hepatic endoderm, HE);
4) culturing the liver endoderm cells of step 3) in liver endoderm organoid production medium to develop liver endoderm organoids;
5) expanding the liver endoderm organoids of step 4);
6) subculturing the liver endoderm organoids expanded in step 5);
7) Differentiating the liver endoderm organoids obtained in step 6) into liver organoids (hepatic organoids, hHO) in liver organoid differentiation medium. A method of producing liver organoids for a Wilson disease model, comprising:
The liver endoderm organoid production medium in step 4) includes fibroblast growth factor 10 (FGF10), hepatocyte growth factor (HGF), nicotinamide, [Leu15]-Gastrin I human. , N-acetyl-L-cysteine, A83-01, Forskolin, CHIR 99021,
The liver organoid differentiation medium in step 7) contains bone morphogenetic protein 7 (BMP7), fibroblast growth factor 19 (fibroblast growth factor, FGF19), hepatocyte growth factor (HGF), and [Leu15 ]-Gastrin I human, N-acetyl-L-cysteine, A83-01, DAPT, dexamethasone,
Method for producing liver organoids for Wilson disease model.
The method of claim 1, wherein the human pluripotent stem cells are human embryonic stem cells (hESC) or human induced pluripotent stem cells (iPSC). .
The method of claim 1, wherein the mutation in step 1) is R778L in which arginine (Arg, R), the 778th amino acid of the ATP7B protein, is replaced with leucine (L). .
The method of claim 1, wherein the liver endoderm organoid production medium in step 4) further contains Matrigel GFR (growth factor reduced).
The method of claim 1, wherein the liver endoderm cells in step 4) are cultured in a medium that does not contain R spondin-1, Noggin, and EGF.
The method of claim 1, wherein step 4) is performed for 10 to 18 days.
The method of claim 1, wherein the liver endoderm organoids in step 5) are cultured in a medium that does not contain R spondin-1 and EGF.
The method of claim 1, wherein step 5) is performed for 3 to 7 days.
delete The method of producing liver organoids in a Wilson disease model according to claim 1, wherein the liver organoid differentiation medium in step 7) further contains Matrigel GFR (growth factor reduced), iron citrate, or both.
The method of claim 1, wherein the liver endoderm organoids in step 6) are subcultured in a medium that does not contain R spondin-1 and EGF.
The method of claim 1, wherein the liver endoderm organoids in step 7) are differentiated into liver organoids by culturing them in a medium that does not contain EGF.
The method of claim 1, wherein the step of subculturing the liver endoderm organoids in step 6) is performed for 3 to 7 days.
The method of claim 1, wherein the step of differentiating the liver endoderm organoids into liver organoids in step 7) is performed for 10 to 20 days.
delete A liver organoid-based Wilson disease model prepared by the method for producing the Wilson disease model according to any one of claims 1 to 8 and 10 to 14.
The liver organoid-based Wilson's disease model according to claim 16, wherein the Wilson's disease model is characterized by reduced expression of ceruloplasmin (CP).
17. The liver organoid-based Wilson's disease model according to claim 16, wherein the Wilson's disease model is characterized by intracellular copper accumulation.
Contacting the test substance with the Wilson disease model of claim 16; and
Comprising the step of comparing the expression level or activity level of ceruloplasmin (CP), or cell viability in the Wilson disease model treated with the test substance with the control model, for the prevention or treatment of Wilson's disease How to screen.
The method of claim 19, wherein when the ceruloplasmin expression level or activity level, or cell viability is increased compared to the control group, it is determined to be a preventive or therapeutic agent for Wilson's disease. .